Genome Editing and Stem Cell Engineering for Disease Modeling Adriana S

Home , Directed differentiation

Genome editing and stem cell engineering for disease modeling Adriana S. Beltran Assistant Professor, Department of Pharmacology Director, Human Pluripotent Stem Cell Core Phone: (919) 537-3996 (office), (919) 537-3995 (lab) Email: [email protected] Website: http://www.med.unc.edu/humanstemcellcore The University of North Carolina at Chapel Hill

April 13, 2017 The human Pluripotent Stem Cell core (HPSCC) is committed to accelerating collaborative studies in stem cell biology

The HPSCC mission is to serve as the central platform of technical support for investigators seeking to work with human embryonic and pluripotent stem cells Pluripotent stem cells

Embryonic Stem cells

Self-renew Diﬀeren5a5on

PROS Limitless poten5al in regenera5ve medicine and disease

CONS Rejec5on aBer transplanta5on Usage of human embryos to create them Inducing a pluripotent state (iPS)

Self-renewal network-ON Self-renewal network-OFF Differentiation genes-OFF Differentiation genes-ON

ES Cell Differentiation

Somatic cells iPS Cell Reprogramming

Oct4 Klf4 Sox2 c-Myc

464

has ASD technology editing Gene . [22,33] ) 3 Box ( possible become associated are that measures Quantiﬁable iPSCs.

have performed iPSCs within genes single manipulating improved, by manifested phenotypes vitro in examine to

or lowing (TALEN) nucleases effector activator-like transcription be can analysis functional differentiation, neuronal

editing by (ZFN) nuclease ﬁnger zinc as such technologies Fol- patients. ASD from cells somatic reprogramming

modeling murine gene As . [32] iPSCs using disorders X-linked available readily are iPSCs Meanwhile, . [9] models

inactivation gical for concern a raising culture, in time over transgenic by examined be can genes the of functions

X can of erosion undergoes iPSCs female in chromosome physiolo- the and genes candidate culprit the identify

. [28–31] When inactive the that showed study recent a However, methods genomics ASD, with diagnosed is person a

) 2 Box and below (see feature this of advantage taking iPSCs. and models, animal genomics, using ASD studying

by patients syndrome Rett female from chromosome X for scheme a depicts 1 Figure . [26] cells heterologous of use

active the on allele mutant or type wild the either with the prevent that barriers immunological and ESCs human

produced be can iPSCs Thus, . [27] ﬁbroblasts of status obtain to embryos destroying with associated issues ethical

chromosome X active/repressed the retaining by iPSCs the bypass iPSCs Furthermore, therapies. replacement

female isogenic of sets unique produces reprogramming cell for sources autologous and screening, drug for forms

females, in prominent and X-linked is disease a when that plat- models, cellular disease-speciﬁc of development the

fact the of advantage take to is lines isogenic generating enable patients from iPSCs Thus, . [20–25] cells parental

for method One control. ideal the are lines iPSC isogenic by manifested those represent presumably iPSCs from

Nevertheless, effect. genetic compounding the reduce differentiated cells of phenotypes the cells, somatic ental

can parents, or siblings as such persons, related genetically par- the of composition genetic the retain iPSCs Because

closely from derived iPSCs of use the physiology, cellular self-renewal. for capacity the and potential, differentiation

individual morphology, on inﬂuence large a have variations genetic pluripotent markers, surface of expression

healthy Klf-4 Because . [21] controls as used been have persons as such characteristics share ESCs and iPSCs . [18,19]

from iPSCs often, Most phenotypes. vitro in the of pretation and , c-Myc , Sox2 , Oct4 factors transcription four the of sion

inter- the determines control standard of selection proper expres- ectopic the by cells differentiated reprogramming

the ASD, for model cellular a as iPSCs using When by created been have iPSCs . [14–17] tissues and organs

ASD. human damaged treating as well as diseases

human 464

ameliorating for chemicals of efﬁcacy the test to platform modeling for resources cellular considered are ESCs

has ASD technology editing Gene . [22,33] ) 3 Box ( possible become associated are that measures Quantiﬁable

iPSCs.

screening a as used be can migration, neuronal and ity, capacities, self-renewing and pluripotent their to Owing ).

have performed iPSCs within genes single manipulating improved, by manifested phenotypes vitro in examine

activ- synaptic connectivity, neuronal as such ASDs, with Box ( layers germ three all to rise give can they

pluripotent

or lowing (TALEN) nucleases effector activator-like transcription be can analysis functional differentiation, neuronal

editing by (ZFN) nuclease ﬁnger zinc as such technologies Fol- patients. ASD from cells somatic reprogramming

modeling murine gene As . [32] iPSCs using disorders X-linked available readily are iPSCs Meanwhile, . [9] models

inactivation gical for concern a raising culture, in time over transgenic by examined be can genes the of functions

therapy. cell-based or modeling disease vitro in for controls

X can of erosion undergoes iPSCs female in chromosome physiolo- the and genes candidate culprit the identify

isogenic provide to mutation given the correcting facilitate technologies editing gene developed Recently treatments. potential as drugs screen to and pathogenesis

. [28–31] When inactive the that showed study recent a However, methods genomics ASD, with diagnosed is person a

disease novel elucidate to used be can cells neuronal The ). 1 Table ( protocols well-established using iPSCs from directed be can ASD, for neurons relevant

iPSC as patient-specific pre-clinical most

) 2 Box and below (see feature this of advantage taking iPSCs. and models, animal genomics, using ASD

studying

are which neurons, Cortical generated. be can iPSCs ASD patient-derived samples, blood or biopsy skin From genes. ASD novel seek actively to used are tools

genomics

by patients syndrome Rett female from chromosome X for scheme a depicts 1 Figure . [26] cells heterologous of

use

Advanced defects. genetic well-defined by caused are syndrome, Timothy or syndrome, X Fragile syndrome, Rett including ASDs, syndromic Monogenic

disorder.

active the on allele mutant or type wild the either with the prevent that barriers immunological and ESCs

human neurodevelopmental genetic a is ASD research. (ASD) disorder spectrum autism in technology (iPSC) cell stem pluripotent induced adopting of Overview . 1

Figure

produced be can iPSCs Thus, . [27] ﬁbroblasts of status obtain to embryos destroying with associated issues

disease models ethical

TRENDS in Molecular Medicine Medicine Molecular in TRENDS

chromosome X active/repressed the retaining by iPSCs the bypass iPSCs Furthermore, therapies. Review Trends in Molecular Medicine August 2012, Vol. 18, No. 8 replacement

female isogenic of sets unique produces reprogramming cell for sources autologous and screening, drug for forms

females, in prominent and X-linked is disease a when that plat- models, cellular disease-speciﬁc of development

the

model

fact the of advantage take to is lines isogenic generating enable patients from iPSCs Thus, . [20–25] cells

parental

Animal

for method One control. ideal the are lines iPSC isogenic by manifested those represent presumably iPSCs from

Nevertheless, effect. genetic compounding the reduce differentiated cells of phenotypes the cells, somatic ental Timothy syndrome, etc. syndrome, Timothy

can parents, or siblings as such persons, related genetically par- the of composition genetic the retain iPSCs

Because

gene causing ASD causing gene

Fragile X syndrome X Fragile

Review Trends in Molecular Medicine August 2012, Vol. 18, No. 8

closely from derived iPSCs of use the physiology, cellular self-renewal. for capacity the and potential, differentiation on of novel of on ﬁca Iden syndrome, Re

individual morphology, on inﬂuence large a have variations genetic pluripotent markers, surface of

expression Monogenic disorders: Monogenic

Gene engineering Gene

healthy Klf-4 Because . [21] controls as used been have persons as such characteristics share ESCs and iPSCs . [18,19]

from iPSCs often, Most phenotypes. vitro in the of pretation and , c-Myc , Sox2 , Oct4 factors transcription four the of sion

inter- the determines control standard of selection proper expres- ectopic the by cells differentiated

reprogramming

and genomics Molecular genomics and therapy Disease the ASD, for model cellular a as iPSCs using When by created been have iPSCs . [14–17] tissues and Somac cells organs

Disease cs gene in Advances

Cell ASD. human damaged treating as well as diseases modeling mechanism of human

modeling ameliorating for chemicals of efﬁcacy the test to platform modeling for resources cellular considered are

Speciﬁc cell type Neuronal ESCs

the disease

ent ent pa ASD

Reprograming iPSC Disease screening a as used be can migration, neuronal and ity, capacities, self-renewing and pluripotent their to Owing ). Somac cells 1

diﬀeren9a9on

diﬀerenaonmodeling

activ- synaptic connectivity, neuronal as such ASDs, with Box ( layers germ three all to rise give can they Reprogramming pluripotent

discovery Neuronal

Drug diﬀerenaon

Reprogramming Drug

Reprogramming Reprogramming

on on a eren ﬀ

di Drugdiscovery

Neuronal therapy. cell-based or modeling disease vitro in for discovery controls

modeling isogenic provide to mutation given the correcting facilitate technologies editing gene developed Recently treatments. potential as drugs screen to and iPSCs pathogenesis

iPSC

disease novel elucidate to used be can cells neuronal The ). 1 Table ( protocols well-established using iPSCs from directed be can ASD, for neurons relevant most c cells cells c ASD paent Soma

iPSC Speciﬁc cell type ASD paent Disease

are which neurons, Cortical generated. be can iPSCs ASD patient-derived samples, blood or biopsy skin From genes. ASD novel seek actively to used are tools

diﬀeren9a9on genomics Advanced defects. genetic well-defined by caused are syndrome, Timothy or syndrome, X Fragile syndrome, Rett including ASDs, syndromic Monogenic

Advances in genecs Cell Cell Cardiac, neural, disorder. neurodevelopmental genetic a is ASD research. (ASD) disorder spectrum autism in technology (iPSC) cell stem pluripotent induced adopting of Overview . 1 Drug Figure Advances in genecs therapy

and genomics therapydiscovery liver toxicity and genomics Medicine Molecular in TRENDS tests

Gene engineering

Pa5ents Monogenic disorders: model Gene9c engineering Re syndrome, Idenﬁcaon of novel Animal

Fragile X syndrome gene causing ASD Gene engineering

Monogenic disorders: etc. syndrome, Timothy

Timothy syndrome, etc. 8 No. 18, Vol. 2012, August Medicine Molecular in Trends gene causing ASD causing gene Fragile X syndrome X Fragile

Re syndrome, Idenﬁcaon of novel Review

on of novel of on ﬁca Iden

syndrome,

Animal Re

Monogenic disorders: Monogenic Fragile X syndrome gene causing ASD engineering Gene model

Timothy syndrome, etc.

and genomics genomics and

therapy TRENDS in Molecular Medicine Regenera9ve cs gene in Advances

Cell Animal

Figure 1. Overview of adopting induced pluripotent stem cell (iPSC) technology in autism spectrum disorder (ASD) research. ASD is a genetic neurodevelopmentalMedicine

ent ent model pa ASD

iPSC

disorder. Monogenic syndromic ASDs, including Rett syndrome, Fragile X syndrome, or Timothy syndrome, areSpeciﬁc cell type caused by well-defined genetic defects. Advanced

genomics tools are used to actively seek novel ASD genes. From skin biopsy or blood samples, patient-derived ASD iPSCs can be generated. Cortical neurons, which are

discovery diﬀeren9a9on

most relevant neurons for ASD, can be directed from iPSCs using well-established protocols (Table 1). The neuronal cells can be used to elucidate novel disease

Drug

pathogenesis and to screen drugs as potential treatments. Recently developed gene editing technologies facilitate correcting the given mutation to provide isogenic

Reprogramming controls for in vitro disease modeling or cell-based therapy. TRENDS in Molecular Medicine on on a eren ﬀ di

Neuronal

modeling

Figure 1. Overview of adopting induced pluripotent stem cell (iPSC) technology in autism spectrum disorder (ASD) research. ASD is a genetic neurodevelopmental c cells cells c Soma

Disease

disorder. Monogenic syndromic ASDs, including Rett syndrome, Fragile X syndrome, or Timothy syndrome, are caused by well-defined genetic defects. Advanced

pluripotent they can give rise to all three germ layers (Box with ASDs, such as neuronal connectivity, synaptic activ-

genomics tools are used to actively seek novel ASD genes. From skin biopsy or blood samples, patient-derived ASD iPSCs can be generated. Cortical neurons, which are

1). Owing to their pluripotent and self-renewing capacities, ity, and neuronal migration, can be used as a screening

most relevant neurons for ASD, can be directed from iPSCs using well-established protocols (Table 1). The neuronal cells can be used to elucidate novel disease

ESCs are considered cellular resources for modeling platform to test the efﬁcacy of chemicals for ameliorating

pathogenesis and to screen drugs as potential treatments. Recently developed gene editing technologies facilitate correcting the given mutation to provide isogenic

human diseases as well as treating damaged human ASD.

controls for in vitro disease modeling or cell-based therapy.

organs and tissues [14–17]. iPSCs have been created by When using iPSCs as a cellular model for ASD, the

reprogramming differentiated cells by the ectopic expres- proper selection of standard control determines the inter- 8 No. 18, Vol. 2012, August Medicine Molecular in Trends

Review

sion of the four transcription factors Oct4, Sox2, c-Myc, and pretation of the in vitro phenotypes. Most often, iPSCs from

Klf-4 [18,19]. iPSCs and ESCs share characteristics such as healthy persons have been used as controls [21]. Because

morphology, expression of surface markers, pluripotent individual genetic variations have a large inﬂuence on

pluripotent theydifferentiationcan give rise potential,to all threeand thegermcapacitylayersfor self-renewal.(Box withcellularASDs,physiology,such astheneuronaluse of iPSCsconnectivity,derived fromsynapticclosely activ-

1). Owing to theirBecausepluripotentiPSCs retainand self-renewingthe genetic compositioncapacities,of the par-ity,geneticallyand neuronalrelated persons,migration,such ascansiblingsbe usedor parents,as acanscreening

ental somatic cells, the phenotypes of cells differentiated reduce the compounding genetic effect. Nevertheless,

ESCs are considered cellular resources for modeling platform to test the efﬁcacy of chemicals for ameliorating

from iPSCs presumably represent those manifested by isogenic iPSC lines are the ideal control. One method for

human diseasesparentalas wellcells [20–25]as treating. Thus, iPSCsdamagedfrom patientshumanenableASD.generating isogenic lines is to take advantage of the fact

the development of disease-speciﬁc cellular models, plat- that when a disease is X-linked and prominent in females,

organs and tissues [14–17]. iPSCs have been created by When using iPSCs as a cellular model for ASD, the

forms for drug screening, and autologous sources for cell reprogramming produces unique sets of isogenic female

reprogrammingreplacementdifferentiated therapies.cellsFurthermore,by the ectopiciPSCsexpres-bypass theproperiPSCsselectionby retainingof standardthe active/repressedcontrol determinesX chromosomethe inter-

ethical issues associated with destroying embryos to obtain status of ﬁbroblasts [27]. Thus, iPSCs can be produced

sion of the four transcription factors Oct4, Sox2, c-Myc, and pretation of the in vitro phenotypes. Most often, iPSCs from

human ESCs and immunological barriers that prevent the with either the wild type or mutant allele on the active

Klf-4 [18,19]. iPSCsuse ofandheterologousESCs sharecells [26]characteristics. Figure 1 depictssucha schemeas forhealthyX chromosomepersons fromhavefemalebeen Rettusedsyndromeas controlspatients[21]by. Because

morphology, expressionstudying ASDofusingsurfacegenomics,markers,animal models,pluripotentand iPSCs.individualtaking advantagegeneticofvariationsthis feature have(see belowa largeand Boxinﬂuence2) on

When a person is diagnosed with ASD, genomics methods [28–31]. However, a recent study showed that the inactive

differentiation potential, and the capacity for self-renewal. cellular physiology, the use of iPSCs derived from closely

can identify the culprit candidate genes and the physiolo- X chromosome in female iPSCs undergoes erosion of

Because iPSCs gicalretainfunctionsthe geneticof the genescompositioncan be examinedof theby transgenicpar- geneticallyinactivationrelatedover timepersons,in culture,suchraisingas siblingsa concernor parents,for can

murine models [9]. Meanwhile, iPSCs are readily available modeling X-linked disorders using iPSCs [32]. As gene

ental somatic cells, the phenotypes of cells differentiated reduce the compounding genetic effect. Nevertheless,

by reprogramming somatic cells from ASD patients. Fol- editing technologies such as zinc ﬁnger nuclease (ZFN)

from iPSCs presumablylowing neuronalrepresentdifferentiation,thosefunctionalmanifestedanalysisbycan beisogenicor transcriptioniPSC linesactivator-likeare the effectorideal control.nucleases One(TALEN)method for

performed to examine in vitro phenotypes manifested by have improved, manipulating single genes within iPSCs

parental cells [20–25]. Thus, iPSCs from patients enable generating isogenic lines is to take advantage of the fact

ASD iPSCs. Quantiﬁable measures that are associated has become possible (Box 3) [22,33]. Gene editing technology

the development of disease-speciﬁc cellular models, plat- that when a disease is X-linked and prominent in females,

464

forms for drug screening, and autologous sources for cell reprogramming produces unique sets of isogenic female

replacement therapies. Furthermore, iPSCs bypass the iPSCs by retaining the active/repressed X chromosome

ethical issues associated with destroying embryos to obtain status of ﬁbroblasts [27]. Thus, iPSCs can be produced

human ESCs and immunological barriers that prevent the with either the wild type or mutant allele on the active

use of heterologous cells [26]. Figure 1 depicts a scheme for X chromosome from female Rett syndrome patients by

studying ASD using genomics, animal models, and iPSCs. taking advantage of this feature (see below and Box 2)

When a person is diagnosed with ASD, genomics methods [28–31]. However, a recent study showed that the inactive

can identify the culprit candidate genes and the physiolo- X chromosome in female iPSCs undergoes erosion of

gical functions of the genes can be examined by transgenic inactivation over time in culture, raising a concern for

murine models [9]. Meanwhile, iPSCs are readily available modeling X-linked disorders using iPSCs [32]. As gene

by reprogramming somatic cells from ASD patients. Fol- editing technologies such as zinc ﬁnger nuclease (ZFN)

lowing neuronal differentiation, functional analysis can be or transcription activator-like effector nucleases (TALEN)

performed to examine in vitro phenotypes manifested by have improved, manipulating single genes within iPSCs

ASD iPSCs. Quantiﬁable measures that are associated has become possible (Box 3) [22,33]. Gene editing technology

464 Genome editing in rats 47

cussed in relation to genetic analysis and manipulation in KI mutations. Therefore, artificially designed ZFNs in animals, especially in rats. can be used to generate KO or KI alleles at the targeted sequences via NHEJ or HR repair, respectively. A summary of how to generate targeted KO rats Zinc-finger nucleases using ZFNs is given in Figure. 1. Briefly, two ZFNs are Zinc finger nucleases are chimeric proteins that consist designed across the spacer domain to recognize the of a specific DNA-binding domain that is made of tan- targeted DNA sequences. Messenger RNAs are then dem zinc finger-binding motifs fused to a non-specific transcribed in vitro from the two ZFN plasmids and cleavage domain of the restriction endonuclease FokI injected into the male pronuclei of rat zygotes. Pronu- (Bibikova et al. 2001; Porteus & Carroll 2005; Wu et al. clear stage embryos are collected from female rats 2007) (Fig. 1). As one zinc finger unit binds with 3-bp that were superovulated by equine chorionic gonado- of DNA, 9–18 bp sequences can be specifically recog- tropin and human chorionic gonadotropin injection. nized by combining 3–6 different zinc finger units. By The ZFN-injected embryos that differentiate into two designing two zinc finger motifs on either side of 5– cells are then transferred to the oviduct of pseudo- 6 bp spacer sequences at a target region, the FokI pregnant females. This method is based on a similar nuclease combined with the zinc finger can introduce technique used to produce conventional transgenic a double-strand break (DSB) within the 5–6 bp spacer animals (Palmiter et al. 1982, 1983; Mullins et al. sequences. Although the DSB is usually repaired via 1990), except that mRNA is used. The procedure for non-homologous end joining (NHEJ), an arbitrary dele- the micromanipulation of embryos is the same for all tion or deletion of base pairs often occurs during the nucleases, including the below-mentioned TALEN and repair process. Consequently, repair by NHEJ is muta- clustered regularly interspaced short palindromic genic and mostly results in a loss-of-function mutation. repeats (CRISPR) enzymes. Moreover, if DNA fragments homologous to the tar- The ZFN technology was first reported in the 1990s geted sequences are co-injected with the nucleases, (Kim et al. 1996; Chandrasegaran & Smith 1999). homologous recombination (HR) can occur, enabling From the 2000s, ZFNs have been developed for insertionTools of a transgene orfor replacement genome of the homolo- various mammalian editing cells (Bibikova et al. 2001, 2003; gous sequences at the targeted region, which results Porteus & Baltimore 2003; Urnov et al. 2005;

Zinc Finger nucleases (ZFN)

FokI nuclease FOX1

GCCAACCGCACTATGCCTCTATAACTACCGGAGCAGTCGAGGTTGAGCTT CGGTTGGCGTGATACGGAGATATTGATGGCCTCGTCAGCTCCAACTCGAA

FOX1 FokI nuclease

Easy to design Advantage: Long experience in using Simplicity Clinical trial High speciﬁcity High eﬃciency

Labor intense to construct Disadvantage: Diﬃcult to designed and PAM requirement “T” requirement Construct Oﬀ-target concerns Target site restric9ons Sensi9ve to 5’methylcytosine

Fig. 1. Gene targeting technologies with zinc ﬁnger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas in rats. Schematic representation of the genetic engineering methods used for generating targeted knockout rats.

Mashimo T. 2014, 56, 46-52 ª 2013 The Author Development, Growth & Differentiation ª 2013 Japanese Society of Developmental Biologists Medical applications of iPS cells REVIEW INSIGHT Figure 2 | Medical applications of iPS cells. Reprogramming technology and iPS cells have the potential to be used to model and treat human disease. In this example, the patient has Treatment Transplantation of genetically a neurodegenerative disorder. Patient-specific with drugs matched healthy cells iPS cells — in this case derived by ectopic co-expression of transcription factors in cells isolated from a skin biopsy — can be used in one of two pathways. In cases in which the disease- Patient causing mutation is known (for example, familial Parkinson’s disease), gene targeting could be Disease-specifc drugs used to repair the DNA sequence (right). The cMYC OCT4 Healthy cells gene-corrected patient-specific iPS cells would then undergo directed differentiation into the Screeningening fforor KLF4 SOX2 affected neuronal subtype (for example, midbrain therapeuticapeutic In vitro compoundspounds diferentiation dopaminergic neurons) and be transplanted into the patient’s brain (to engraft the nigrostriatal axis). Alternatively, directed differentiation of the patient-specific iPS cells into the affected Skin biopsy, blood, kera5nocytes Skin biopsy neuronal subtype (left) will allow the patient’s disease to be modelled in vitro, and potential drugs Afected cell type Repaired iPS cells can be screened, aiding in the discovery of novel therapeutic compounds.

Use gene targeting to repair In vitro disease-causing mutation diferentiation

Patient-specifc iPS cells

Given the number of drugs that have notoriously been withdrawn from this study, we showed that a high expression level of multiple telomerase the market because of their tendency to induce arrhythmias, it is highly components was characteristic of the pluripotent state more generally, Adapted from: Robinton & Daley, Nature 2012 likely that the current inadequate approaches for assessing cardiotoxic- illustrating how iPS cells can reveal fundamental aspects of cell biology. ity will be complemented by iPS-cell-based assessments of drug effects. An independent study of the reprogramming of cells from patients with A study from our laboratory explored dyskeratosis congenita, a dis- dyskeratosis congenita confirmed the general transcriptional upregula- order of telomere maintenance, and provided an unanticipated insight tion of multiple telomerase components and the maintenance of telomere into the basic biology of telomerase that has therapeutic implications73. lengths in clones74; however, in this study, no clones with elongated telom- In its most severe form, dyskeratosis congenita is caused by a mutation eres were identified. The different outcomes of these studies highlight the in the dyskerin gene (DKC1), which is X linked, leading to shortened tel- limitations of iPS-cell-based disease models that are imposed by clonal omeres and premature senescence in cells and ultimately manifesting as variation as a result of the inherent technical infidelity of reprogram- the degeneration of multiple tissues. Because the reprogramming of cells ming75. This point also introduces an additional important consideration. to an induced pluripotent state is accompanied by the induction of the Before a given iPS-cell disease model can be claimed to be truly represent- gene encoding telomerase reverse transcriptase (TERT), we investigated ative of the disease, how many patients must be involved, and how many whether the telomerase defect would limit the derivation and mainte- iPS cell lines must be derived from each patient? Although the answers to nance of iPS cells from individuals with dyskeratosis congenita. Although these questions are unclear, it is crucial to keep these issues in mind when the efficiency of iPS-cell derivation was poor, we were able to successfully generating disease models and making claims based on these models. reprogram patient fibroblasts. Surprisingly, whereas the mean telomere Although iPS cells are an invaluable tool for modelling diseases in vitro, length immediately after reprogramming was shorter than that of the the goal of developing patient-specific stem cells has also been motivated parental fibroblast population, continued passage of some iPS cell lines by the prospect of generating a ready supply of immune-compatible cells led to telomere elongation over time. This process was accompanied by and tissues for autologous transplantation. At present, the clinical trans- upregulation of the expression of TERC, which encodes the RNA subunit lation of iPS-cell-based cell therapies seems more futuristic than the in of telomerase. vitro use of iPS cells for research and drug development, but two ground- Further analysis established that TERT and TERC, as well as DKC1, breaking studies have provided the proof of principle in mouse models were expressed at higher levels in dyskeratosis-congenita-derived iPS cells that the dream might one day be realized. Hanna, Jaenisch and colleagues than in the parental fibroblasts73. We determined that the genes encoding used homologous recombination to repair the genetic defect in iPS cells these components of the telomerase pathway — including a cis element derived from a humanized mouse model of sickle-cell anaemia76. Directed in the 3ʹ region of the TERC locus that is essential for a transcriptionally differentiation of the repaired iPS cells into haematopoietic progenitors active chromatin structure — were direct binding targets of the pluri- followed by transplantation of these cells into the affected mice led to potency-associated transcription factors. Further analysis indicated that the rescue of the disease phenotype. The gene-corrected iPS-cell-derived transcriptional silencing owing to a 3ʹ deletion in the TERC locus leads to haematopoietic progenitors showed stable engraftment and correction of the autosomal dominant form of dyskeratosis congenita by diminishing the disease phenotype. TERC transcription. Although telomere length is restored in dyskeratosis- In another landmark study from Jaenisch’s research group, Wernig congenita-derived iPS cells, differentiation into somatic cells is accompa- and colleagues derived dopaminergic neurons from iPS cells that, when nied by a return to pathogenesis with low TERC expression and a decay in implanted into the brain, became functionally integrated and improved telomere length. This finding showed that TERC RNA levels are dynami- the condition of a rat model of Parkinson’s disease77. The successful cally regulated and that the pluripotent state of the cells is reversible, sug- implantation and functional recovery in this model is evidence of the gesting that drugs that elevate or stabilize TERC expression might rescue therapeutic value of pluripotent stem cells for cell-replacement therapy defective telomerase activity and provide a therapeutic benefit. Although in the brain — one of the most promising areas for the future of iPS- we set out to understand the pathogenesis of dyskeratosis congenita with cell applications.

19 JANUARY 2012 | VOL 481 | NATURE | 301 © 2012 Macmillan Publishers Limited. All rights reserved Human pluripotent stem cell services Cell derivation and characterization: • IPSC generation and characterization • hES/hiPS directed differentiation into specialized cell types • hES/hiPS maintenance, expansion and banking

Genome engineering: • Genome editing of mammalian cells (hESC, iPSC, CSC) • Engineering effector molecules for gene regulation

Training in stem cell culture techniques Source materials

Fibroblast Neural cells Hair follicle Urine cells Keratinocytes Keratinocytes T cells Fibroblast Blood Adipose stem cells Urine Mesenchymal stem cells Cord blood stem cells Availability Availability Neural stem cells Germline stem cells Easy to reprogram

Blood: easy to obtain and easy to reprogram Fibroblast: easy to obtain, frozen stock and expandable Urine: easiest to obtain, easy to reprogram, potential contamination Comparison of IPSC derivation technology

Lentivirus RNA Sendai virus

Efficiency Episomal vector

Adenovirus Protein Safety Method Integra5on Eﬃciency Cost Retrovirus Yes 0.001 – 0.01% ++ Len9virus Yes 0.001 – 0.01% ++ Adenoviral Possible 0.0001 – 0.001% ++++ Sendai virus No 0.01 – 1% ++++ Episomal Possible 0.0001 – 0.01% + mRNA No >1% ++++ Protein No 0.00001% ++++ PROTOCOL

Sendai virus Figure 1 | Overview of the TiPSC generation Blood sampling Reseeding Picking up infection Isolation of PBMCs onto feeder cells TiPS colonies protocol. PBMCs are activated for 5 d with IL-2 (24 h) and anti-CD3 antibody, and then transduced with Passage SeV expressing human OCT3/4, SOX2, KLF4 and with cell count c-MYC. TiPSC colonies emerge at 20–25 d after blood sampling.

IL-2 + anti-CD3 antibody + ESC condition (bFGF +) Day 0 Day 5 Day 6 Days 20–25 the successful reprogramming of mono- T cells before Activated Infected Culturing 15–17 TiPS cells nuclear blood cells . In these methods, activation T cells T cells on feeder cells mononuclear blood cells from donors or frozen samples were infected using retro- 15 16,17 Activation with virus or lentivirus to express four IL-2 and factors, human OCT3/4, SOX2, KLF4 and anti-CD3 antibody

c-MYC. In these studies, human T cell Oct3/4 Sox2 reprogramming into iPSCs was achieved, but the efficiency of reprogramming was Klf4 c-Myc extremely low (approximately 0.0008– Reprogramming factors 0.01%). Although these methods used less peripheral blood and did not require the pharmacological Experimental design pretreatment of patients, the problems of transgene genomic Blood sampling. Our protocol is focused on the simple procedure insertion and low reprogramming efficiency remained, pre- of peripheral venous blood sampling to obtain the donor cells, cluding their wide use in the clinical application of iPSCs. using a standard process. Patient somatic cells can then be easily Generating iPSCs with TS-mutated SeV easily erases residual and aseptically obtained from the blood sample. In our protocol, genomic viral RNA from the target cells10, and the method 1 ml of whole blood is sufficient to generate TiPSCs (Fig. 2a). is significantly more efficient (~0.1%) compared with those protocols in which iPSCs were generated from T cells with Derivation of activated T cells. Peripheral blood mononuclear retrovirus or lentivirus. cells (PBMCs) can be separated by a Ficoll gradient method from Human keratinocytes derived from plucked human hair have also heparinized whole blood samples (Fig. 2b). Although PBMCs been used as another less invasive method of obtaining iPSCs from contain lymphocytes and monocytes, activation with plate-bound patient cells4,18. However, in some cases, these reported methods anti-CD3 monoclonal antibody and IL-2 selectively proliferates require several hairs to obtain successful cell outgrowth of keratino- T cells, and clearly increases the proportion of T cells in the cytes. Dental tissue has also been explored as a potential source of cultured PBMCs11. CD3 protein exists in the complex of TCR iPSCs19. However, although teeth are routinely removed in many proteins on the surface of T cells, and can therefore be used clinics and no further procedures are required with respect to the as a T cell–specific marker. Anti-CD3 antibody modulates the donor, it is generally difficult to routinely obtain patients’ dental TCR-CD3 complex to induce T cell proliferation and activation20, © All rights reserved. 2012 Inc. Nature America, tissues—with specific genetic or nongenetic diseases—for the pur- whereas IL-2 also activates general T cell signaling pathways pose of iPSC studies. In comparison with these outlined methods, and eventually promotes cytokine transcription, cell survival, our protocol involves harvesting only a small sample of peripheral cell-cycle entry and growth21. At day 5 of culture with anti-CD3 Timelineblood; in addition, T cell proliferation for does not neediPSC stochastic cell monoclonal derivation antibody and IL-2, CD3 + cells increased up to ~95% outgrowth. These are clear advantages for clinical application in of cultured PBMCs (Fig. 2c–e). With this culture method, users comparison with the methods reported in the past. can avoid using a fluorescence-activated cell sorter in which

Blood%draw% Sendai%virus% Pick%iPS% Isola4on%of%PBMCs%% %infec4on%(24%h)% Colonies% colonies% Before After Reseeding%onto% a b c d PBMCs day 0 PBMCs day 5 centrifuging centrifuging PBMCs day 0 PBMCs day 5 feeder%cells% emerge% 250 CD3-positive CD3-positive 200 200 cells 71.2% cells 95.9% Erythroblast+expansion++PBMCs%Expansion% 150 Initial 1 weeks 1-2 weeks Primary 2 days 150

Count 100 Day%9% Day%11%CryopreservationCount 100 Day%20D23% Day%0% 50 Day%29D35% iPSC%medium%+%50 Contact Cells500 µm 500 µm EM%medium% Cytokines% 0 iPSC%medium% 0 hES%medium% 102 103 104 105 102 103 104 105 the Core FITC-A FITC-A Figure Patient2 | IsolationCCM#pa&ents# and sample activation of PBMCs. (a) Whole blood is collected into a 2.5-ml syringe by venipuncture.Methods: (b) Before e 100 centrifugation, two distinct layers are distinguishable in the 15-ml tube.Reprogramming The upper, dark red layer is the diluted blood and the 80 IRB lower layer is the Ficoll solution. After centrifugation, three distinct layers are apparent. The upper yellow layer containsSendai platelet- virus60 rich plasma, whereas the bottom clear layer is the Ficoll solution, and the thin white layer in between contains PBMCs (arrow). 40 (c) Morphology of PBMCs shortly after being seeded in the culture plate3-4 and activatedweeks using anti-CD3 antibody with IL-2 for 5 d. cells (%) CD3-positive 20 Tissue source: Proliferated T cells show many clusters in the culture plate at day 5 of activation. (d,e) Flow cytometric analysis Self-replicatingof isolated PBMCs RNA vector + 0 and PBMCs activated for 5 d with anti-CD3 antibody and IL-2 gated on the CD45 cell population. CD3 surface expressions of these 035 Blood, skin, hair populations were examined. The graph represents an average of three independent examinations. Error bars showProtein means ± s.d. Day

iPSCs NATURE PROTOCOLS | VOL.7 NO.4 | 2012 | 719

8-12 weeks 5-15 weeks

2-7 weeks Gene expression Karyotyping Methylation Stem cell markers MicroRNA profiling Direct Teratoma formation Genome engineering differentiation EB differentiation into specialized cell types © 2012 Nature America, Inc. All rights reserved. less peripheral blood and did not require the pharmacological pharmacological the require not did and blood used peripheral less methods these Although 0.01%). 0.0008– (approximately low extremely was reprogramming of efficiency the but achieved, was iPSCs into reprogramming these In c-MYC. SOX2, and OCT3/4, KLF4 human factors, virus frozen samples were infected using retro or donors from cells blood mononuclear nuclear cells blood the successful reprogrammingmono of blood sampling. c-MYC SeV expressing human and anti-CD3 antibody, and then transduced with protocol. PBMCs are activated for 5 d with IL-2 Figure 1 populations were examined. The graph represents an average of three independent examinations. Error bars show means ± s.d. and PBMCs activated for 5 d with anti-CD3 antibody and IL-2 gated on the CD45 Proliferated T cells show many clusters in the culture plate at day 5 of activation. ( ( rich plasma, whereas the bottom clear layer is the Ficoll solution, and the thin white layer in between contains PBMCs (arrow). lower layer is the Ficoll solution. After centrifugation, three distinct layers are apparent. The upper yellow layer contains platelet- centrifugation, two distinct layers are distinguishable in the 15-ml tube. The upper, dark red layer is the diluted blood and the Figure 2 past. the in reported methods the with comparison in application clinical for advantages clear are These outgrowth. blood; in addition, T cell proliferation does not need stochastic cell our protocol involves harvesting only a small sample of peripheral pose of iPSC studies. In comparison with these outlined methods, tissues—with specific genetic or nongenetic diseases—for the pur patients’dental obtain routinely to difficult generally donor, is it procedures to areno further respect the and clinics required with iPSCs cytes. Dental tissue has also been explored as a potential source of require several hairs to obtain successful cell outgrowth of keratino cells patient been used as another less invasive method of obtaining iPSCs from with cells T from generated lentivirus. or retrovirus were iPSCs those with which in compared (~0.1%) protocols efficient more significantly is cells target the from residual RNA erases viral genomic easily SeV TS-mutated with iPSCs. iPSCs of Generating application clinical the in use wide their cluding pre remained, efficiency genomic reprogramming low and transgene insertion of problems the patients, of pretreatment a c ) Morphology of PBMCs shortly after being seeded in the culture plate and activated using anti-CD3 antibody with IL-2 for 5 d. Human keratinocytes derived from plucked human hair have also . TiPSC colonies emerge at 20–25 d after 1 1 5 9 or lentivirus . However, although teeth are routinely removed in many in removed routinely are However,. teeth although

| | Overview of the TiPSC generation Isolation and activation of PBMCs. ( PBMCs. of activation and Isolation CCM#pa&ents# Reprogramming Reprogramming blood to Pa9ents 4,1 8 . However, in some cases, these reported methods methods reported these cases, some However,. in using a integration-free method

studies, human T cell cell T human studies, OCT3/4, SOX2 15–1 16,1 7 b . In these . In 7 centrifuging to express four four express to Before , KLF4

methods, Passage&0 and centrifuging iPSC colonies in Feeders a After ) Whole blood is collected into a 2.5-ml syringe by venipuncture. ( - - Isola4on%of%PBMCs%%

& 1 0 Blood%draw% ES+like&colonies , and the method method the and , Day%0% c Erythroblast+expansion++ PBMCs day PBMCs%Expansion% EM%medium% 0 500 - - - Isolation ofPBMCs

Blood sampling T cellsbefore µ &

+ activation m

cell population. CD3 surface expressions of these T cells, and clearly increases the proportion of T cells in the the in cells T of proportion the increases clearly and cells, T proliferates selectively IL-2 and antibody monoclonal anti-CD3 contain lymphocytes and monocytes, activation with plate-bound ( samples blood whole heparinized by can from be cells method (PBMCs) a separated gradient Ficoll Derivation of activated T cells. 1 ml whole blood is of sufficient to generate TiPSCs ( protocol, our In sample. blood the from obtained aseptically and easily be then can cells somatic Patient process. standard a using cells, donor the obtain to sampling blood venous peripheral of Blood sampling. Experimental design can avoid using a fluorescence a using avoid can of cultured PBMCs ( and IL-2,antibody monoclonal CD3 growth and entry cell-cycle pathways signaling survival, cell transcription, cell cytokine promotes T eventually and general activates also IL-2 whereas activation and proliferation cell T induce to the complex TCR-CD3 modulates used antibody be Anti-CD3 marker. therefore can cell–specific and T a as cells, T of surface the on proteins PBMCs cultured Day d Passage&3 , IL-2 +anti-CD3antibody e RNA vector %infec4on%(24%h)% 0 ) Flow cytometric analysis of isolated PBMCs anti-CD3 antibody Sendai%virus% Activation with PBMCs day with cellcount IL-2 and Day%9% Passage & Reprogramming factors iPSC Day 5 5 Sendai virus 500 Activated Oct3/4 Cytokines% Our protocol is focused on the simple procedure infection + Klf4 1 T cells (24 h) %medium%+% 1 Day%11% . CD3 protein exists in the complex of TCR TCR of complex the in exists protein CD3 . µ m Day 6 c-Myc Fig. 2c Sox2 Reseeding%onto% d

Count feeder%cells% NATUREPROTOCOLS 100 150 200 250 50 0 b 2 Infecte – T cells 1 ) Before 10 e . At day 5 of culture with anti-CD3 anti-CD3 with culture . of 5 At day iPSC ). With this culture method, users users method, culture ). this With PBMCs day 2 d - Peripheral blood mononuclear mononuclear blood Peripheral 10 FITC-A activated cell sorter in which which in sorter cell activated CD3-positive %medium% cells 71.2 3 ESC condition(bFGF+) iPSCs feeder-free

+ 10 Fig. 2 Fig. onto feedercells

cells increased up cells increased to ~95% 4 on feedercell Reseeding 0 10 Culturing %

5 | b VOL.7 NO.4VOL.7 iPS ). Although PBMCs PBMCs Although ). Passage 12 Count 100 150 200 50 e 0 Colonies% Day%20D23%

CD3-positive s PROTOCOL emerge% cells (%) 10 100 20 40 60 80 PBMCs day 2 0 Fig. 2 TiPS colonies | 10 Days 20–25 FITC-A TiPS cell 2012 Picking up CD3-positive 035 3 cells 95.9 cells 10 Day a hES ). 4 | s 5

10 719 %medium% % 2 5 0 ,

colonies% Pick% Day%29D35%

iPS % Quality assurance: characterization

Immunofluorescence of of iPSCs pluripotency markers 14JL2 +/&+ 46,XX iPSC1&CCM3Karyotype

Alkaline phosphatase OCT4

NANOG SOX2

Teratoma forma9on SSEA-4 TRA-1-61 qRT-PCR of pluripotency markers hESCs% iPSCs% PBMCs% 1.6" 1.4" 1.2" NANOG% 1" SOX2%% 0.8" POU% 0.6"

Fold"change"" 0.4" 09July2014

relaIve"to"H7"WT" 0.2" 0" +/%' +/%' +/%' +/%' +/%'

38ED" H7"WT" 24SM" 40EG1"26CA3" 14JL2" 30SR7" H7%hES'iPSC%C1'iPSC%C2' iPSC%C3'25DN5"iPSC%C4' 26CA:PBMCs"14JL:PBMCs" iPSC2%CCM3iPSC3%CCM3iPSC1%CCM3 PBMCs1%CCM3PBMCs3%CCM3 Adriana Beltran, Bryan Richardson Differentiation of hES and IPS into three germ layers Ectoderm Mesoderm Endoderm NESTIN SMA FOXA2

PAX6 CDX2 SOX17

Review Trends in Molecular Medicine August 2012, Vol. 18, No. 8

Specific cell type differentiation Somac cells Disease Pa5ents modeling Reprograming Neuronal differenSpecific cell type aon Reprogramming differen9a9on Drug Molecular discovery mechanism of the disease iPSCs ASD paent iPSC

Advances in genecs Cell and genomics therapy

Mesoderm Gene engineering Monogenic disorders: Ectoderm Endotherm Re syndrome, Idenﬁcaon of novel Fragile X syndrome gene causing ASD Mesenchymal Timothy syndrome, etc. stem cells Hematopoie9c Pancrea9c Epithelial stem cells Animal progenitors stem cells Cardiac model Neural Progenitors Intes9nal Hepatocyte Progenitors stem cells progenitors

TRENDS in Molecular Medicine

Figure 1. Overview of adopting induced pluripotent stem cell (iPSC)Skin technology in autism spectrum disorderHemangioblast(ASD) research. ASD is a genetic neurodevelopmental

disorder. Monogenic syndromic ASDs, including Rett syndrome, Fragile X syndrome, or Timothy syndrome, are caused by well-defined genetic defects. AdvancedBeta cells

Pigment cells Immature

genomics tools are used to actively seek novel ASD genes. From skin biopsy or blood samples,Cardiomyocytes patient-derived ASD iPSCsEndothelial can be generated. Cortical neurons, which are

Astrocytes lung cells

most relevant neurons for ASD, canForebrain be directed from iPSCs using well-established protocols (Table 1). The neuronal cellscells can be used to elucidate novel disease

Hepatocytes

pathogenesis and to screen drugs asMidbrain potential treatments.Oligodendrocytes Recently developed gene editing technologies facilitate correcting the given mutation to provide isogenic

controls for in vitro disease modeling orSplinalcell-based therapy.

pluripotent they can give rise to all three germ layers (Box with ASDs, such as neuronal connectivity, synaptic activ-

1). Owing to their pluripotent and self-renewing capacities, ity, and neuronal migration, can be used as a screening

ESCs are considered cellular resources for modeling platform to test the efﬁcacy of chemicals for ameliorating

human diseases as well as treating damaged human ASD.

organs and tissues [14–17]. iPSCs have been created by When using iPSCs as a cellular model for ASD, the

reprogramming differentiated cells by the ectopic expres- proper selection of standard control determines the inter-

sion of the four transcription factors Oct4, Sox2, c-Myc, and pretation of the in vitro phenotypes. Most often, iPSCs from

Klf-4 [18,19]. iPSCs and ESCs share characteristics such as healthy persons have been used as controls [21]. Because

morphology, expression of surface markers, pluripotent individual genetic variations have a large inﬂuence on

differentiation potential, and the capacity for self-renewal. cellular physiology, the use of iPSCs derived from closely

Because iPSCs retain the genetic composition of the par- genetically related persons, such as siblings or parents, can