Concomitant Differentiation of a Population of Mouse Embryonic

between this versionandtheVersionrecord. Pleasecitethis articleasdoi:10.1002/dvdy.24466. through thecopyediting, typesetting, paginationandproofreadingprocess, whichmayleadtodifferences This istheauthormanuscript acceptedforpublicationandhasundergone full peerreviewbuthasnotbeen

Date Submitted Date Author: bythe Complete List of Authors: of Complete List Wileytype: - Manuscript embryonic cellsstem into neuron-like cells and Sch

Accepted Article Concomitant differentiation of a population of mous Manuscript Manuscript ID

myelination, cochlear implant myelination,cochlearimplant cells, deafn Schwann cells, stem inner neurons, ear BiomedicalEngineering University Kate; of Barald, Deve Cell Michigan, and Shuichi;Biomedic Michigan, of Takayama, University Deve Cell Mendez,Flor;Michigan, and University of Chemistry, University Fumi;Osaka 565-0871, Ebisu, JAPAN Osaka Developmental Neuroscience Biology and Molecular, C Richard;Michigan, Hume, University of Engineering University, Chung-Ang Mechanical J.R.; 4. Mechanical of Engineering, Park, School Co Engineering Engineering Exponent White,Joshua; Scientific and BiomedicalEngineering Poornapriya; Ramamurthy, UniversityCol Michigan of 16-Sep-2016 ResearchArticle SCDVDY-16-0021.R2 DevelopmentalDynamics Developmental Dynamics

llegeEngineering, of lopmentalBiology and ess, ess, microfluidics, lopmentalBiology ellular and Consulting, Biomedical Consulting, al Engineeringal lege of Engineering, of lege wann , , DivisionProtein of

e e Page 1of72 R01 DC00643604A2 (KFB)), NSF (IOS 0930096 (KFB)); 0930096 (IOS (KFB)), NSF DC00643604A2 R01 Grant Sponsors: Grant inhibitory fact migration macrophage microfluidics, Keywords: cells stem embryonic Hume Running Title: Title: Running BSRB 3053 Engineering Biomedical of Department Biology Developmental and Cell of Department F. Barald Kate Author *Corresponding Title: Authors: a in cells celllike Schwann and cells neuronlike 3. Present Address: Roche Diagnostics Clinical Oper Diagnostics Roche Address: Present 3. 2. Department of Cell and Developmental Biology, Un Biology, Developmental and Cell of Department 2. 5. Department of Molecular, Cellular and Developmen and Cellular Molecular, of Department 5. 7. Present address: Division of Protein Chemistry, Protein of Division address: Present 7. Collegeof Engineering, Biomedical of Department 1. 4. School of Mechanical Engineering, College of Eng of College Mechanical Engineering, of School 4. 6. Neuroscience Graduate Program, University of Mic of University Program, Graduate Neuroscience 6. Concomitant differentiation of a population of mou of apopulation of Concomitant differentiation 5,6 Alexander Drive 4401 Research Commons Bldg/Suite 30 Bldg/Suite Commons Research Drive 4401 Alexander Ann Arbor, MI 481092200 MI 481092200 Arbor, Ann USA USA Arbo Place, Ann Pitcher Zina 109 BSRB, 3728 School, Michigan, Ann Arbor, Michigan, 48109, USA 48109, Michigan, Arbor, Ann Michigan, University, Seoul 06974, Republic of Korea.of Republic 06974, Seoul University, Fax 7347631166 Fax7347631166 7346473376 Tel [email protected] Place Pitcher Zina 109 Osaka University Osaka 5650871, Japan. 5650871, University Osaka Osaka Building, University of Michigan, 48109, USA. USA. 48109, Michigan, University of Building, , Fumi Ebisu Fumi , Poornapriya RamamurthyPoornapriya Accepted cell stem stem cells, from neurons earlike inner Article

Concomitant Neuronal and Schwann cell microfluidic cell Schwann and Neuronal Concomitant

NIH (NIH/NIDCD 2RO1DC0418404, 3R01DC00418408W12 3R01DC00418408W12 NIH 2RO1DC0418404, (NIH/NIDCD 2,7 , Flor Mendez Flor , This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. 1,2,3 2 , Shuichi Takayama Shuichi , ,

Joshua B. Joshua White slowflow microfluidic device device slowflowmicrofluidic or, neurotrophic cytokines, hearing hearing cytokines, or,neurotrophic Institute for Protein Research Research Protein for Institute se embryonic stem cells into into cells stem seembryonic 1 Engineering, University of of University Engineering, ineering, ChungAng ChungAng ineering, ations (Study Manager) 79 TW TW 79 (StudyManager) ations 1 , higan Deafness Research Research Deafness iversity of Michigan Medical Medical Michigan iversityof

, Kate F Barald F , Kate tal Biology, Natural Sciences Sciences Natural tal Biology, Joong YullPark Joong derived Schwann cells, cells, derivedSchwann r, Michigan, 481092200, 481092200, Michigan, r, 0, Durham, NC 27709 27709 NC Durham, 0, differentiation of differentiation 1,2,6 4 , Richard I. Richard , and and

0718 DGE NSF (PR), Biotechnology) in (Microfluidics (PR) (TEAM) DE007057 NIHT32 (DRF) (KFB); Foundation

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. 128 (JBW, ID:2010101926). (JBW, 128 ; NIH 5T32EB00558205 5T32EB00558205 NIH ; Page 2of72 Page 3of72 Bullet Points: Points: Bullet

• • • • We then “coated” cochlear implants with alginate withalginate implants cochlear “coated” then We influence the tested We w phenotype the induceto neuronal used agents The microfluid “ultraslowflow” asimple haveused We

embryonic stem cells. stem embryonic coated implants or implant cochlear coated hydrogel wass subtypes “neuronal” the of any from outgrowth Accepted(e.g in animal used implants and implantation human outgrowth directed ne MIFinduced and ganglionneurons spiral neurons, Primarycells. mou celllike Schwann MIFproducing inducing a neural asthe wasused MIF if especially wereobser outgrowth in neurite directed reductions ant monoclonal witha functionblocking effects its bycelllikeinhibiting cells Schwann the to cells in myelinat observed earlysteps the influenced and di in resulted agents Usedifferent of vertebrates. Articlethatis cricytokine neurotrophic the (MIF), factor or macrop (CNTF) factor neurotrophic ciliary (NGF), agent. inducing cell a Schwann Neuregulin, differe three of one cells,using celllike Schwann int stem cells embryonic mouse of population single

invitro

of MIF on directional neurite outgrowth from neuron outgrowth from neurite MIF directional on of Developmental Dynamics John Wiley& Sons,Inc. to two types of cochlear implants: implants meant meant implants implants: cochlear of twoto types

MIF biochemically or by blocking byblocking or biochemically MIF tical for inner ear development in in development inner ear for tical fferences in neuronal properties neuronalproperties in fferences nt neuroninducing agents and and agents neuroninducing nt ibody. Statistically significant Statistically ibody. significant hydrogel layers containing the the containing layers hydrogel ic device to differentiate a differentiate deviceicto gent. gent. ion. ved under all conditions, but but conditions, underall ved o neuronlike cells and cells and o neuronlike hage migration inhibitory migration hage with undifferentiated withundifferentiated se statoacoustic ganglion statoacousticganglion se een toward a “bare” or or “bare” toward a een . gerbil) studies. No directed directed No gerbil) studies. . ere nerve growth factor factor growth nerve ere uronlike cells exhibited cells exhibited uronlike

like like for for

• Macrophage migration inhibitory factor (MIF)induc factor inhibitory migration Macrophage

Accepted ArticleCorti expl of out MIFknock organ a towards not but Org wildmouse type a outgrowthto neurite directed

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. ed neuronlikecells exhibited exhibited neuronlikecells ed ant. ant. an of Corti explant in culture in culture explant Corti of an Page 4of72 Page 5of72 Background: To send meaningful information to the b the to information meaningful send To Background: Results: Neuron and Schwann celllike cells were p were cells celllike Schwann and Neuron Results: 2008) 2007, implant. coated” al., et Roth 2002; al., et (Huang cells p cells” “Schwann mESCderived SGN. damaged or lost “neurons” (mESC)derived cell stem embryonic mouse cells supporting and Schwann both by dir made cytokine a (MIF), factor inhibitory migration ea macrophage Inner possible. as (SGN) Neurons Ganglion Spiral he and large as to coupled closely become must (CI) f approaches described. are loss hearing sensorineural cellbased stem novel Two Conclusions: Corti explant. Organ of out CI the to directionally grew “neurons” MIFinduced used were cells” “Schwann MIFexpressing outgrowth. g side cell Schwann the ear on MIF Blocking documented. and lawn cell” “Schwann device. the over microfluidic grew flow “neurons” ultraslow an in mESC of

Accepted Article

and to a wild type but not MIFknock MIFknock not but type wild a to and roduced from a common population population common a from roduced rain, an inner ear cochlear implant cochlear ear inner an rain, and could attract SGN to “ cell cell “ to SGN attract could and ectionally attractant neurotrophic neurotrophic attractant ectionally reatly reduced directional neurite directional reduced reatly (Bank et al., 2012). MIFinduced MIFinduced 2012). al., et (Bank to “coat” a CI: mouse SGN and SGN mouse CI: a “coat” to lh a ouain f remaining of population a althy s h ppltos interacted; populations the As roduce MIF as do all Schwann Schwann all do as MIF roduce y vns n ylnto were myelination in events ly ol ptnily usiue for substitute potentially could gnloeei dpns on depends gangliogenesis r r raig h polm of problem the treating or

cells. cells. to leads that crosstalk critical the in participate an neuronal both of properties mature the on taking Idea cells. stem engineered biologically with cells p and/or neurons peripheral and central diseased or bioengineer and neuroscientists to interest Fo intense focus. immediate more into medicine regenerative Wise et al., 2010) al.,et Wise functionalit their deafness, of onset post years 40 spi if even that appears R it 2008), al., et Breuskin and (BerminghamMcDonogh loss cell hair of models of models animal in than pronounced less is humans review). 2015, al., et (Pfingst implant/prosthesis Organ sensory remaining the either with interaction neu remaining the that so degenerate, progressively los neurons ganglion spiral disorders, genetic from into due incapacitated, or lost are Corti of Organ brain auditory in neurons central the to cells hair sensor peripheral from messages sensory for conduit

cl tmai f h ccla Hwvr i te futu the in However, cochlea. the of tympani scala coch implanting by achieved be can stimulation Such an when required is nerve auditory bone the of stimulation and implants ear middle aids, hearing using conductive Although 1985). (Parkins, discrimination deliver to required distribution frequency of range welldistr sufficiently and healthy be must neurons h inr a’ sia gnlo’ meiae bipola myelinated ganglion’s spiral ear’s inner The Development of new stem cellbased therapeutic appr therapeutic cellbased stem new of Development

Acceptedi cochlear a with productively interact to order In Article

, (Jiang et al., 2006). (Jiang 2006). al., et

myelination of the neurons by Schwann Schwann by neurons the of myelination ral ganglion neurons remain as long as long as remain neurons ganglion ral Although spiral ganglion neuron loss in loss neuron ganglion spiral Although stem nuclei. When the hair cells in the the in cells hair the When nuclei. stem jury, ageing or loss of function resulting function of loss or jury,ageing the necessary information for speech for information necessary the y can be impaired (Sato et al., 2006; al., et (Sato impaired be can y ibuted along the cochlea to cover the cover to cochlea the along ibuted sensorineural hearing loss is severe. is loss hearing sensorineural s is the potential replacement of lost of replacement potential the is s d Schwann cell types and could also could and types cell Schwann d of capable be would cells stem lly, of Corti hair cells or with a cochlear a with or cells hair Corti of mplant, the surviving spiral ganglion ganglion spiral surviving the mplant, hearing loss can be remediated by remediated be can loss hearing eripheral nervous system Schwann Schwann system nervous eripheral ter eihrl agt ad can and targets peripheral their e rons are less capable of functional of capable less are rons hair cell loss or Knock out mouse out Knock or loss cell hair y receptors of mechanosensory mechanosensory of receptors y er rshssipat i the in prostheses/implants lear re, direct auditory brain stem stem brain auditory direct re, eape a urn ae of area current a example, r hrd ern ad, direct a aids, hearing chored r neurons (SGN) provide the the provide (SGN) neurons r oaches is bringing the era of era the bringing is oaches bl 20; omr 2008; Bodmer, 2003; ubel, Page 6of72 Page 7of72 2009). 2009). contact neurite enhance to shown been have implants S neurotrophinreleasing “Classical” 4. 1999); al., di the reduce to concomitantly and implant the with neurona ganglion spiral Regrowing 3. 2012) al., et Reyes 2007: al., et Coleman 2006; al, et (Corrales substitut or augment to cells stem of types Ce various 2. 2015), al., et Pfingst see review a (for stem among can tested; which devices, implant being cochlear of engineering are perception hearing improve 2014). 2014). a therapeutic standard the become well may implants lncl r vn rlncl ras n ains wi patients 2009b; al., O'Learyet 2007a, b; al., et Pettingill in trials preclinical even or opti clinical treatment such However, 2009). al., et Jhaveri Ju 2007; al., et (Winter neurotrophins such release Jongkamonwiwat et al., 2012). 2012). al., et Jongkamonwiwat also models animal deafened into transplanted cells 20 review, Cunningham and Monzack 2013; al., et Wan functi cell hair replace and differentiate to shown cel Supporting Endogenous models. animal mammalian pumps or or pumps deafe to administered was neurotrophins of which cocktail in paradigms developed have researchers some of survival prolong and function hearing restore To fo a been have 2012) al., et Ramekers 2005; Hansen, neurotrophi ear inner earlieridentified on focused To improve the performance of cochlear implants, a a implants, cochlear of performance the improve To Some very promising studies of hearing restoration restoration hearing of studies promising very Some Strategies for prolonging survival or regenerating regenerating or survival prolonging for Strategies

Acceptedvia Article oher mlns otd ih aiu gels/hydroge various with coated implants cochlear

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. Pfingst et al., 2015). 2015). al., et Pfingst on (e.g. Mellado Lagarde et al., 2014; al., et Lagarde Mellado (e.g. on h ern ls (ilr t l, 2002; al., et (Miller loss hearing th han el ue t ‘ot cochlear ‘coat’ to used cells chwann s s nuig gns Rem and (Roehm agents inducing as ns et al., 2008; Chen, Jongkamonwiwat Chen, 2008; al., et e for lost or malfunctioning neurons neurons malfunctioning or lost for e l processes to improve connections connections improve to processes l stance between them (Altschuler et (Altschuler them between stance n et al., 2008; Winter et al., 2008; 2008; al., et Winter 2008; al., et n l elcmn teais involving therapies, replacement ll existing spiral ganglion neurons, neurons, ganglion spiral existing pproach (reviewed in Merkus et al, et Merkus in (reviewed pproach etrd ern fnto (Chen, function hearing restored n hv nt e porse to progressed yet not have ons omnct wl wt te brain the with well communicate s with the devices (O'Leary et al., et (O'Leary devices the with s ned animals using mini osmotic osmotic mini using animals ned cus of research for many years. years. many for research of cus prl agin ern, many neurons, ganglion spiral variety of different strategies to strategies different of variety ls of the inner ear have been have ear inner the of ls 14). Human inner ear stem stem ear inner Human 14). ae eety en oe in done been recently have snl nuorpi o a or neurotrophin single a hs ae 1 Advanced 1. are: these s ht a slowly can that ls

myelination in the microfluidic device (Fig. 4). device (Fig. 4). in the microfluidic myelination ca is et which (Uauy maturation functional (DHA), electrophysiological acid docosahexaenoic to exposure neuronli The 2012). al., et Bank 2008; 2007, al., conventiona o our in previously (NGF) done had we Factor as (CNTF) Growth Nerve with induced cells like propert cells’ neuronlike MIFinduced The RTqPCR. expre channel ion appropriate and neurotransmitters patch by microfluidic maturation functional slowflow electrophysiological the of side differentiation were done in conventional tissue culture culture devices/di tissue in conventional weredone et (Bank adulthood into neurons ganglion spiral on 1 of Faculty in cited 2012, al., et Bank 2012; al., that shown previously have a et (Holmes neurotrophin We important developmentally 2012). al., et Bank neu neuronlike motor induced CNTF and neurons C like and NGF NGF that studies ear. other in shown inner have we phenotypes; the of neurons ganglion spiral resembl significant some bear cells neuronlike the th is (CNTF) factor neurotrophic ciliary or (NGF) cells verysl differentiate a to 2009), al., used et (Park device We implant. cochlear a of tha properties cells factorproducing neurotrophic and neurons of Replacement loss: hearing sensorineural address flow rates. rates. flow alth which, fluid, agents of streams two inducing in simultaneously deliver to flow differential using n hs td, h MFidcd ernlk cls pr cells neuronlike MIFinduced the study, this In The research described in this report focuses on tw on focuses report this in described research The hn arpae irto ihbtr fco (MIF)—a factor inhibitory migration macrophage When

Accepted Article cell cells—neuronlike of types different two into

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. a common population of embryonic stem embryonic of population common a 000) and that receptors for MIF remain MIF for receptors that and 000) e neuroninducing agent, we show that wethat show agent, neuroninducing e shes. shes. ough side by side move at different different at move side by side ough ke cells’ maturation is enhanced by enhanced is maturation cells’ ke al., 2001; Khedr et al., 2004) and and 2004) al., et Khedr 2001; al., ssion by immunocytochemistry and and immunocytochemistry by ssion l., 2011; Shen et al., 2011; Shen etShen 2011; al., et Shen 2011; l., ne o ttaosi gnlo or ganglion statoacoustic to ance for neurons and Schwann cells cells Schwann and neurons for ies were compared to the neuron the to compared were ies clamping and for transporters, transporters, for and clamping devices were characterized for for characterized were devices l 21) Tee ale studies earlier These 2012). al, damaged or lost spiral ganglion ganglion spiral lost or damaged t could enhance the attractive attractive the enhance could t l tissue culture studies (Roth et (Roth studies culture tissue l produces dorsal root ganglion root dorsal produces o stem cellbased strategies to strategies cellbased stem o owdifferentialflow microfluidic microfluidic owdifferentialflow s and Schwann celllike cells, cells, celllike Schwann and s os Rt e a. 20, 2008; 2007, al., et (Roth rons r Ciliary Neurotrophic Factor Factor Neurotrophic Ciliary r MIF is the inner ear’s first first ear’s inner the is MIF T as idc neuronal induce also NTF oduced on the “neuronal” “neuronal” the on oduced nd not nerve growth factor factor growth nerve not nd al o ehnig both enhancing of pable Page 8of72 Page 9of72 et al., 2007, 2008). 2008). 2007, al., et as progress, myelination of markers stagespecific myel to lead that interactions their in steps EARLY order in cells Schwann and neurons primary both of t 2) label; cell live witha tagged is other the or conventional in (Paivalaine process interaction and differentiation cells Schwann from neurons primary 01 Jror t l, 02 fr eea raos 1) reasons: several for 2012) al., et Jarjour 2011; He 2008; al., et (Gingras cultur cells Schwann and tissue neurons conventional in myelination in result al, et Liu 2003a,b; al., (Li et investigation under cells stem from population cell hair sensory the of studies, studies, et 2015 al., et (Namqung regeneration Goodman nerve peripheral 1994; and (Mena al., Parkinsonism 2012); al., et et 2007;Boomkamp (Paino injury cord spinal sclerosi multiple including disorders, neurological ap therapeutic provide to together or independently cells Schwann vertebrate all asdo MIF produce they expecte the in properties celllike Schwann acquire myelinatin of properties the all have cells Schwann pr demonstrated We 2007). al., et (Roth ago celld decade stem embryonic first the made laboratory Our i 2008) 2007, al., et (Roth studies previous our in cells (Yang et al., 2008: Wei et al., 2010; Xionge 2010; al., et Wei 2008: al., et (Yang cells systems coculture such of number A 2012). al., et myeli of studies in markers and steps molecular key t a be dfiut o td te tgs f neuron of stages the study to difficult been has It Neuregulin (Gambarotta et al., 2013) was used to in to used was 2013) al., et (Gambarotta Neuregulin Tissue engineered coculture systems have been some been have systems coculture engineered Tissue uh tm eldrvd ernlk ad cwn cell Schwann and neuronlike cellderived stem Such

Accepteddeafness loss/ hearing sensorineural Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. he difficulty in obtaining immature cultures cultures immature obtaining in difficulty he 2014) although not in these studies. studies. in these not although 2014) (Pettingill et al., 2008). Replacement Replacement 2008). al., et (Pettingill t al., 2012; Yang et al., 2012) mostly to to mostly 2012) al., et Yang 2012; al., t n the other fluid stream of the device. the of stream fluid other the n n et al., 2008), unless one population population one unless 2008), al., et n (apn 21; hn e a. 2011) al., et Zhang 2011; (Taupin, s our earlier studies documented (Roth documented studies earlier our endogenous to the inner ear is also is ear inner the to endogenous have involved variously derived stem derived variously involved have g Schwann cells (Roth et al., 2007), 2007), al., et (Roth cells Schwann g (Huang et al., 2002). 2002). (Huangal., et nation (Hsu and Ni, 2009; Liazoghli Liazoghli 2009; Ni, and (Hsu nation d order during maturation and that and maturation during order d the inability to distinguish distinguish to inability the s f rmr prpea system peripheral primary of es ination and 3) sufficiently specific specific sufficiently 3) and ination proaches to alleviate a variety of of variety a alleviate to proaches to observe and document the key the document and observe to ) and, most importantly for these for importantly most and, ) nn t l, 08 Clio e al., et Callizot 2008; al., et inen rvd cwn cls lot a almost cells Schwann erived Shan el neatos that interactions cell Schwann eviously that these engineered engineered these that eviously duce Schwann celllike cells as as cells celllike Schwann duce aca e eee, 2008); Yebenes, de Garcia what successful in identifying in successful what cell cocultures during the the during cocultures cell l, 07 Zag t al., et Zhang 2007; al., lk cls ol b used be could cells like living

cultured primary neurons and stem cell derived neur cell derived stem and neurons primary cultured f established conditionswe previously using MIF to pathw downstream MIF we blocked experiments, of set previou done we have 7 days, as for M 4IPP 0.1 at biochemical MIF inhibitor, MIF biochemical the Schwann on production weMIF blocked “neurons” di cells had stem the embryonic After twoways. in the Schwann towards “neurons” the from processes of el” ih ielpe iia cnmtgah ad a and cinematography digital analyse andelectrophysiological timelapse immunohistological with cells” betwe interactions cellcell the study to us allows my in events early very the device—particularly the interac the of aspects many document to and factors computed to outgrowth neuronal and differentiation week 36 a over flow maintaining stably By 1). Fig. fr 2007) al., et Roth (Neuregulin; factors inducing al. et Bank CNTF; or NGF (MIF, factors neurotrophic in early events in myelination. myelination. in earlyevents in continuu the observe to sufficient been has systems of none However, component. “neuronal” the provide and eliminate wastes for up to 6 weeks. 6toweeks. wastes forup eliminate and d in cells culture to us allows that and detachment with flow slow sufficiently achieving to essential up for out carried be can which experiment, the of o in result that interactions cell neuronal/Schwann The role of MIF produced by the “Schwann cells” “Schwann in by the MIF produced role of The h vr solw eie ue i tee tde al studies these in used devices slowflow very The

Accepted Article gra overlapping generate to designed was device The

This article isprotected by copyright. All rights reserved. 4 iodo6phenylpyrimidine (4IPP; Specs, Delft, Nethe Delft, Specs, (4IPP; iodo6phenylpyrimidine Developmental Dynamics John Wiley& Sons,Inc. om two different inlets (see cartoon in cartoon (see inlets different two om period, we were able to correlate cell correlate to able were we period, nset of myelination during the course the during myelination of nset fferentiated into “Schwann cells” or or cells” “Schwann into fferentiated or studies of both mouse and chick chick and mouse both of studies or n h “ern” n te “Schwann the and “neurons” the en o ser ht os o cue cell cause not does that shear low ons (Bank et al., 2012). Blocking Blocking (Bank 2012). al.,et ons s of the cells in the device itself. itself. device in the cells the of s m of cellcell interactions that result that interactions cellcell of m sly (Shen et al., 2012). In another another In 2012). al.,et sly(Shen evices with nutrient replenishment replenishment nutrient with evices tions between the two cell types in in types cell two the between tions these engineered stem cell based based cell stem engineered these o wes A omtc up is pump osmotic An weeks. 6 to elination. The microfluidic device device microfluidic The elination. cell side of the device was tested wastested device the ofside cell , 2012) as well as Schwann cell Schwann as well as 2012) , cell side of the device with the withthe device the ofside cell ays with a monoclonal antibody monoclonal witha ays promoting directional outgrowth directional promoting concentrations of the different different the of concentrations s pris molecular, permits lso ins f n o the of one of dients lows us to study study to us lows rlands) Page 10of72 Page 11of72 demonstrated in conventional tissue culture experim tissue conventional in demonstrated (Fi devices microfluidic the lawnin cell” “Schwann in directio reduction significant in a resulted MIF with the implants werebyimmunocytochem visualized implants withthe bytimela wasobserved devices the toward neurites spiral and and SGVG) both that develop vertebrates gangl spiral the both of precursor embryonic the is and the simple ball type used in animal studies. studies. in animal used balltype simple the and typ the multielectrode implants: cochlear of types in sodium encapsulated cells, Schwann cellderived the MIF we used 2007), etin Roth al., 5B fig. (see byan production its through 2012) or al., et Bank either th outgrowth neurite directional in involved culture (Bank et al., 2012). 2012). al.,et (Bank culture n withprimary done this be that could demonstrated Organo out MIFknock the not but type wild towards towa neurites of outgrowth directional and explants ganglion neuron counts who are not good candidates candidates good not are who counts neuron ganglion Once we had convincing data confirming our earlier our confirming convincing data we had Once MIFinduced neuronlike cells were also cocultured werealso cells neuronlike MIFinduced Directional outgrowth of neurites from primary mous from neurites outgrowthof Directional

hs td cud vnuly eei to ye o pa of types two benefit eventually could study This Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. nal neurite outgrowth towards the the towards outgrowth neurite nal rough its direct effects (see fig. 1 in 1 fig. (see effects its direct rough mESCderived “Schwann cell” lawn cell” “Schwann mESCderived e commonly used in human patients patients in human used commonly e g. 2), just as we previously as just 2), g. producing mouse embryonic stem stem mouse embryonic producing ion and vestibular ganglion in the the in ganglion vestibular and ion rds the target was documented wasdocumented target the rds eurons in conventional tissue tissue conventional in eurons ents (Bank et al., 2012). 2012). al.,et (Bank ents algenate hydrogels, to coat two coat to hydrogels, algenate f Corti explants. We had already had explants. Corti We f pse cinematography. Contacts Contacts cinematography. pse ganglion explants extending extending explants ganglion istry using specific markers. markers. istryspecific using with mouse Organ of Corti Corti of Organ withmouse e statoacoustic ganglion (which ganglion statoacoustic e for cochlear implant therapy, for for therapy, implant cochlear for studies that MIF appears to be to MIF appears that studies tients—1) those with low spiral spiral low with those tients—1)

cochlear the implant. to neurites outgrowth directional improve markedly could cells with coated implants cochlear whom for patients 2) O native own their with contacts functional enhance derived cell stem of population replacement a whom

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. rgan of Corti sensory hair cells and cells hair sensory Corti of rgan of their remaining spiral ganglion ganglion spiral remaining their of could cells exogenous neuronlike MIFproducing Schwann celllike celllike Schwann MIFproducing Page 12of72 Page 13of72 nuig gn o cniin ee rprd n parall in prepared were condition or agent inducing Three 2012). al., et (Bank tested we concentration our in very effective be to proven had enhancement enhanceme DHA deliv was it 1d. and cases some and in devices microfluidic Figs.1b in cartoon the in red delivere was agent “neuron”inducing The Methods). Bank 2008; 2007, al., et (Roth optimized previously CNT NGF, device: the of half 1b) Fig. (red left the might result in evidence of myelination upon contac myelination of in evidence result might ne the from emerging neurites the and cells Schwann an as well as cell) Schwann or (neuronal maturation de microfluidic same the in cells celllike Schwann Schwann cells (Roth, Ramamurthy et al., 2007, 2008) 2007, al., et (Roth, Ramamurthy cells Schwann cartoon the previously had in we that Neuregulin seen of concentrations source outflow (blue device the we cells celllike Schwann flow, differential using depicte side cell” de “Schwann the and the red in of depicted cartoon A Procedures). Experimental (see co after device the of surfacearea entire the over Figure D (ESC; cells stem embryonic device. mouse undifferentiated the on seeded population cell stem neu or cel different factors two of differentiation the facilitate growth and nutrients with cells stem like cells and Schwann cell-like cells in a slow fl in a slow cells cell-like Schwann and cells like stem embryonic mouse of differentiation Concomitant One of 3 different inducing agents was used to prod to used was agents inducing different 3 of One e ifrnitd os ebync tm el it b into cells stem embryonic mouse differentiated We

Accepted Articlea establish to designed was system microfluidic The

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. RESULTS RESULTS l populations from a single undifferentiated undifferentiated single a from populations l ating the device with sterile porcine gel porcine sterile with device the ating re induced to form on the right half of half right the on form to induced re t with the Schwann celllike cells. cells. celllike Schwann withthe t ow microfluidic device microfluidic ow vice to study cell differentiation and differentiation cell study to vice F or MIF at concentrations we had had we concentrations at MIF or F ered through the same portal. DHA portal. same the through ered previous studies, even at the lowest lowest the at even studies, previous d in blue is seen in Fig. 1b. Then, Then, 1b. Fig. in seen is blue in d y cellcell interactions between the between interactions cellcell y determined produced myelinating myelinating produced determined l icbtd fxd lble (e.g. labelled fixed, incubated, el, . . o dpiae eie fr each for devices duplicate 8 to fr te eevi idctd in indicated reservoir the form d Experimental see 2012; al., et oetschman et al., 1985) seeded seeded 1985) al., et oetschman orpi ctkns n re to order in cytokines rotrophic rnlk cls eg toe that those e.g. cells; uronlike ie wt te nuo” side “neuron” the with vice, c s bihil iae of image brightfield a is 1c n is 1 ad d using 1d) and 1b Figs. in cells (mESC) into neuron- into (mESC) cells gradient flow to nourish the nourish to flow gradient t a as tse i the in tested also was nt uce the neuronlike cells in in cells neuronlike the uce t nuoie el and cells neuronlike oth

ouetd htgahcly n aaye b MetaMor by analyzed and photographically documented b cell Neurofilamentpositive alone. DHA including concentration the at conditions neuroninducing all t on differentiation of neuronal evidence molecular eie. htgah o te muolble cls w cells immunolabelled the of Photographs devices. processe and cells TUJ1) or (neurofilament labelled photomicr endstage and videomicrography timelapse mic the in cells celllike Schwann the toward cells pre were processes many how or addition bythe markedly wasenhanced Fasciculation clumps the in bodies determine to difficult often was it 2), Fig. 2012, fa in found were processes the and together clumped becaus However, DHA. with enhanced MIF agents inducing or CNTF NGF, to response in processes neuronal 1 mdu aoe cnrl (i. ) a w hd also Bank 2012). al., et 2008; had 2007, al., et Ramamurthy we as 2), (Fig. (control) alone medium F12 differentiation neuronal any if little contrast, By Devices Microfluidic in sectors cell” “Schwann the from observed is Outgrowth Neurite Directional conditions using MetaMorph using conditions photogra TUJ1), or Neurofilament to antibodies with channel inlet to the outflow port (depicted in the the in (depicted port outflow the to inlet channel concentrationdep showed cells stem embryonic mouse analyses these in used photomicrographs the taking III II, Rows 1b). and 1a Figs. V; IV, III, II, (I, virtua we analyses, these For software. ImageJ NIH fe oe ek n h mcolii dvcs w saw we devices, microfluidic the in week one After After 23 weeks, we observed that more than 75% of of 75% than more that observed we weeks, 23 After o eemn i tee a peeeta nuie outg neurite preferential was there if determine To

Accepted Article

This article isprotected by copyright. All rights reserved. © software. software. Developmental Dynamics John Wiley& Sons,Inc. and IV were divided into three columns for for columns three into divided were IV and was seen at 1 week in the presence of presence the in week 1 at seen was the actual numbers of neuronlike cell neuronlike of numbers actual the cartoon in (Fig. 1b) as a round green round a as 1b) (Fig. in cartoon he “neuronal” side of the device under device the of side “neuronal” he s tested (see experimental methods), methods), experimental (see tested s odies with extensive processes were processes extensive with odies

olii dvc (i. a, e used we 1a), (Fig. device rofluidic s on the “Schwann cell” side of the the of side cell” “Schwann the on s lly sectioned the device into 5 rows rows 5 into device the sectioned lly phed and analyzed for each set of set each for analyzed and phed of DHA. DHA. of scicular bundles (e.g. Bank et al., al., et Bank (e.g. bundles scicular (see the cartoon in Fig. 1b). The The 1b). Fig. in cartoon the (see r aaye b MetaMorph by analyzed ere rvosy ouetd (Roth, documented previously Neuron-like cells towards the towards cells Neuron-like endent differentiation from the the from differentiation endent gah t ietf immuno identify to ography te nuoie cls were cells “neuronlike” the e ph s el s o n o these of any to as well as rowth from the neuronlike neuronlike the from rowth © or NIH ImageJ software. software. ImageJ NIH or oh opooia and morphological both the mES cells exhibited exhibited cells mES the sent in the fascicles. fascicles. the in sent © or Page 14of72 Page 15of72 softw ImageJ NIH or software byMetaMorph© analyzed microscop confocal using processes the of outgrowth We photomicrography. endstage and cinematography observed device. We the of sections other the with exhibited also right) I 1a (Fig. I row in lawn cell II, I, 1a (Fig. markers protein specific type cell with cells celllike Schwann and cells neuronlike facilit inlets the near predominated media inducing of concentrations highest the which in device, the al., et (Pan cells stem undifferentiated for marker et (Roth Oct4 expressed still which of many cells, t indicating myelination, of evidence there was nor fo markers express not did V region in Cells 2008). (a 4) Fig. also (see cells” “Schwann were they that r my for in stained be cells could were but 1a) There (Fig. neurofilament IV). 1a (Fig. region this in neu for labelled be could also IV row in cells like s (blue lawn cell Schwann the towards directionally pro few the however, processes; neuronal of numbers R in differentiated that cells neuronlike positive et Roth (see lawns cell Schwann engineered such on typic also is lawn cell Schwann the over cells like o extension The below). We 2 (Fig. 2008). studies additional al., et (Ito eye and 2012) al., et (Bank sub neuronal different many for factor survival and MIF, produce cells celllike Schwann since image), cell like Schwanncell the toward neurites extended neuron became that cells The II). I, 1a: (Fig inlet morph neuronal on took cells ES bottom. the at area

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. III). Neurites extending over the Schwann the over extending Neurites III). the most neurite fasciculation compared fasciculation neurite most the ow III (Fig. 1 a: III middle) had minimal minimal had middle) III a: 1 (Fig. III ow rofilament but no processes developed developed processes no but rofilament like in sectors I, II and any found in III in found any and II I, sectors in like a much higher expression level of their levelof expression higher much a al of the behaviour of primary neurons neurons primary of behaviour the of al 2002). The gradient profile created in created profile gradient The 2002). he undifferentiated ES status of these of status ES undifferentiated he types, including those in the inner ear inner the in those including types, f ramifying processes of the neuron the of processes ramifying f al., 2007 2008; Bank et al., 2012), a 2012), al., et Bank 2008; 2007 al., ide of the device Figs.1a,b). Neuron Figs.1a,b). device the of ide cell differentiation by both timelapse timelapse both by differentiation cell neuroninducing and Schwann cell Schwann and neuroninducing s in our previous work, Roth et al., et Roth work, previous our in s r either Schwann cells or neurons; or cells Schwann either r ln ai poen B, indicating MBP, protein basic elin ts S el’ dfeetain into ’differentiation cells’ ES ates hc i bt a ert outgrowth neurite a both is which ologies in areas closest to the left the to closest areas in ologies ow IV that were not stained for for stained not were that IV ow tested the role of MIF directly in in directly MIF of role the tested lawns (e.g. Fig. 1a Row I right right I Row 1a Fig. (e.g. lawns al., 2007 fig. 5b). Neurofilament Neurofilament 5b). fig. 2007 al., are (Experimental Procedures). Procedures). (Experimental are ess ht ee rsn grew present were that cesses y and light photomicrography, photomicrography, light and y measured the total neurite neurite total the measured

caption to Fig. 2). Fig.to2). caption neurotrophi various the for statistics the (compare a 2), (Fig. MIF was agent inducing the if seen were outgrowth process extensive more However, 2007). si “neuron” the on used was agent inducing neuronal ifrnitd Ue f ihr en o ihbtn M inhibiting of means either “Schwann of Use and differentiated. (“neuronlike types cell both the once i (seen device the of side cell Schwann the on MIF ONLY These 2012). al., et (Bank previously described m functionblocking MIF a 2) or 2012) al., et w (Shen M, 0.1 of 4iodo6phenylpyrim concentration final a inhibitor, at Netherlands), MIF biochemical The downstrea MIF blocking by directly this examined We or 2007) al., et Roth 5B, (Fig. neurons primary by fo impetus major a provide to appears Neuregulin by different the by production MIF 2012), al., et Bank was a significant significant a was Sc a induce to used been had Neuregulin if However, Neuregul to exposed (not mESC undifferentiated were dev the of side cell” “Schwann the on cells no were “neuronind the of any under seen was device the of outg directional no or little antibodies, secondary process outgrowth outgrowth process t appears cells cell-like Schwann by production MIF aiiain f nuoie poess vr h Sc the over processes “neuronlike” of ramification Sch mES 2). (Fig. [ESSC] Neuregulin with like cell mESC towards outgrowth with [mESC] lawns cell undi stem the towards outgrowth process the Compare 2). As we had demonstrated in our previous studies (Rot studies previous our in demonstrated had we As

Accepted Article Neuro to antibody an with stained were devices When

directional

This article isprotected by copyright. All rights reserved. process outgrowth towards the Schwann cell lawns ( lawns cell Schwann the towards outgrowth process Developmental Dynamics John Wiley& Sons,Inc. rowth towards the “Schwann cell” side cell” “Schwann the towards rowth iated Schwann cell like cells induced induced cells like cell Schwann iated stem cellderived “neurons” (Fig. 2). 2). (Fig. “neurons” cellderived stem F ontem fet rdcd the reduced effects downstream IF hwann cell lawns, no matter matter no lawns, cell hwann ice. This was also the case if there if case the also was This ice. wann cell differentiation resulted in resulted differentiation cell wann idcn aet icue i the in included agents inducing c ncoa atbd, lo sd as used also antibody, onoclonal as used as described previously previously described as used as r this process extension, whether whether extension, process this r nd the difference was significant significant was difference the nd ucing” conditions (Fig. 2) if there if 2) (Fig. conditions ucing” de (see also Fig. 5B Roth et al., et Roth 5B Fig. also (see de and more extensive fasciculation fasciculation extensive more and m effects in one of two ways: 1) 1) ways: two of one in effects m hwann celllike phenotype, there phenotype, celllike hwann lcig taeis ee used were strategies blocking Bu i te ato i Fg 1) Fig. in cartoon the in Blue n in) on the “Schwann cell” side. side. cell” “Schwann the on in) celllike”) had phenotypically phenotypically had celllike”) fferentiated mouse embryonic embryonic mouse fferentiated dn (P; pc, Delft, Specs, (4IPP; idine nue t bcm Schwann become to induced pa a oe n directional in role a play o h, Ramamurthy et al., 2007; al., et Ramamurthy h, filament and appropriate appropriate and filament which Fig. Fig.

Page 16of72 Page 17of72 factor (Bank et al., 2012). 2012). al.,et (Bank factor show also have We 2007). al., et Ramamurthy (Roth, subtypes neuronal many for factor outgrowth neurite receptors into adulthood (Bank et al., 2012). We h We an 2012). al., et 2012) (Bank adulthood into al., receptors et Bank 2012; a al., neurons et (Shen derived receptors cell stem MIFinduced and neurons statoacoust vertebrate Furthermore, 2012). al., et al., et (Bianchi 1 protein chemoattractant monocyte known 2002)as al., et Bank 2002; al., et Nishio 2002a,b; are cells Schwann all since surprising not is directional neurite outgrowth than the mESC, ES SC+ ES mESC, the than outgrowth neurite directional signi a has condition SC ES the MIF) and NGF (CNTF, ie f h dvc. hs ifrne a particular was below calculations significance (Fig. 2; “neurons” difference This device. the of side w Neuregulin) (no mESC undifferentiated or cells no cel “Schwann the over outgrowth “neurite” of extent assessed by appearance of neuronal markers measured markers neuronal of by appearance assessed devel devices microfluidic the in cells Neuron-like undifferentiated conditions (Fig. 3a). conditions undifferentiated downr Oct4 fourfold a showed neurotrophins and/or t cells and expression gene Oct4 of downregulation o cytokines with treated Cells (Fig.3a). conditions down was and added) media und differentiation levels neuronal expression high at remained Oct4 2012). al., et (Roth studies previous our in as RTqPCR by exp (Oct4 cells ES undifferentiated for and markers

nlss f ernl ifrnito uig rmr p primer using differentiation neuronal of Analysis

Developmental Dynamics John Wiley& Sons,Inc. in the caption). caption). the in well as another neurotrophic cytokine, cytokine, neurotrophic another well as r neurotrophins alone showed a 2fold 2fold a showed alone neurotrophins r 2005; Roth et al., 2007, 2008; Bank 2008; 2007, al., et Roth 2005; ic ganglion neurons, spiral ganglion ganglion spiral neurons, ganglion ic ression; Pan et al., 2002) was done was 2002) al., et Pan ression; 2007; Roth et al., 2008; Bank et al., et Bank 2008; al., et Roth 2007; ave shown that MIF is a a is MIF that shown ave l” lawns to levels seen when either either when seen levels to lawns l” , particularly those in the inner ear inner the in those particularly , y infcn fr h MIFinduced the for significant ly egulation when compared with the the with compared when egulation ere plated on the “Schwann cell” cell” “Schwann the on plated ere 4iPP, and and 4iPP, reated with DHA as well as MIF MIF as well as DHA with reated op neuronal characteristics as characteristics neuronal op o rdc MF Hag t al., et (Huang MIF produce to t cniu t epes these express to continue to d ta i i a ernl survival neuronal a is it that n euae udr differentiation under regulated r rlfrtv cniin (no conditions proliferative er ficantly higher mean value for value mean higher ficantly is Tbe ) o neuronal for 1) (Table airs e nw t epes MIF express to known re with RTqPCR with α MIF conditions. This conditions. MIF

directional otrophin

huh t poie oeua sgas ht eit t mediate that signals molecular provide to thought (the spiral ganglion neuronal precursors) (Fig. 3b) (Fig. precursors) ganglion neuronal spiral (the expression of expected be can what with consistent t suggests MIF+DHA and alone MIF with treated cells NGF+DHA CNTF+DHA, Pron with (Fig.3b). DHA without conditions with compared treated cells in basal upregulated F12 with compared conditions differentiation mES cells grown in the F12 basal medium. basal medium. F12 cells the grown in mES exp NeuroD increased significantly MIF+DHA cellderivedn NGF+DHA, stem of survival and wi differentiation alone MIF that suggests levels expression NeuroD and NGF+DHA CNTF+DHA, with alone, MIF with treated cells Expression (Fig.3b). with conditions) (undifferentiated upregu compared was when expression conditions Ngn1 differentiation found we studies, these e (Nayagam sequentially expressed are Nfil of forms hbt e a. 21: ee e a. 2008) al., et Reyes 2011: a al., et et Shibata Nayagam 2007; al. upr et are (FloresOtero (Nfil) development neurofilament and NeuroD Ngn1. gene cochlear developing and precursors neuron ganglion hbt e a. 21; ag t l, 01. Upregula 2011). al., et Yang 2011; al., et Shibata neurotrophins two upregulated the of significantly either of were supplementation Prphn and TrkC TrkB, Sh 2011; al., et (Nayagam adult the in regeneration synthe its and ear, inner the in development during expres also is Peripherin 2011). al., et Yang 2011; neurons vestibular and auditory differentiating for have TrkC) and (TrkB neurotrophins for receptors as A number of transcription factors (GATA3, Brn3a, Ng Brn3a, (GATA3, factors transcription of number A n eea, ertohn (lrsOeo t l 2007 al. et (FloresOtero neurotrophins general, In

Accepted sig upregulated was expression (Nfil) Neurofilament Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. . In spiral ganglion neurons, three different different three neurons, ganglion spiral In (Nayagam et al., 2011; Shibata et al., et Shibata 2011; al., et (Nayagam . sed concomitantly with axonal growth growth axonal with concomitantly sed f erD a urgltd n cells in upregulated was NeuroD of ibata et al., 2011; Yang et al., 2011). al., et Yang 2011; al., et ibata eurons. CNTF, MIF, CNTF+DHA, CNTF+DHA, MIF, CNTF, eurons. i apas eesr fr axonal for necessary appears sis eural gene marker upregulation in upregulation marker gene eural in statoacoustic ganglion neurons neurons ganglion statoacoustic in been defined as mature markers mature as defined been e uvvl f neurons of survival he hat the cells’ expression profile is profile expression cells’ the hat a. 21;ag t l, 01. In 2011). al., et 2011;Yang al., t tion of these “mature” neuronal neuronal “mature” these of tion or MIF (Nayagam et al., 2011; 2011; al., et (Nayagam MIF or neurons express the proneural proneural the express neurons rw i F2 aa media basal F12 in grown eim Ni epeso was expression Nfil medium. hu DA ol spot the support could DHA thout l., 2011; Yang et al., 2011; 2011; al., et Yang 2011; l., gltd al i inr ear inner in early egulated ression when compared with compared when ression ne cniin o DHA of conditions under MIF+DHA (Fig.3b). A rise in in rise A (Fig.3b). MIF+DHA n1, NeuroD, islet1) as well well as islet1) NeuroD, n1, lated under all neuronal neuronal all under lated ; Bank et al., 2012) are are 2012) al., et Bank ; iiaty ne al the all under nificantly n MFDA when MIF+DHA and . n mice, In Page 18of72 Page 19of72 3d. 3d. neuronal system auditory selected some and markers and MIF-derived “neurons”: “neurons”: MIF-derived and t in seen is Myelination in Steps Early of Evidence were to prove adequate substitutes for lostor dise for substitutes adequate prove wereto be would criteria Such neurons. ganglion spiral of deve were cells the g that indicates properties these spiral define exclusively not do properties MIFind in these found all were device the in b myelination multiple with outgrowth neurite robust neurites), total neurite outgrowth measurements). outgrowthmeasurements). neurite total NGF+ CNTF+DHA, with treated cells did as cells like outgrow neurite healthy showed device the of region different the All agents. inducing the as used were whi in conditions under Nfil200 and VgluT1 both for (Nfil200kDa). neurofilament w and VgluT1 which transporter, neurites, of bundles fasciculated extensive wi or neurotrophins with conditions Differentiation neurot the of was than outgrowth either neurite extensive more MIF, exhibited or CNTF NGF, with treated Differentiati 3). Fig. 1, (Fig. 2008) 2007, al., et neuroninteract mature, labels which (MBP), neu protein (a 200 Neurofilament ear), inner the of neurons rsne f cwn clie el. hn neuronli When cells. celllike Schwann of presence myelinatio of evidence showed CNTF by induced cells cell Schwann of presence the or 4 Fig (NGF+DHA: DHA to (up experiments these of course time the during Differentiated neuronlike cells were stained for V for stained were cells neuronlike Differentiated A substantial increase in glutamatergic properties properties glutamatergic in increase substantial A f G ws sd s h idcn aet ltl evide little agent, inducing the as used was NGF If

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. n odtos ne wih el were cells which under conditions on ased spiral ganglion neurons neurons ganglion spiral ased th MIF supplemented with DHA have DHA with supplemented MIF th loping at least some of the properties properties the of some least at loping ive myelinating Schwann cells (Roth (Roth cells Schwann myelinating ive ch CNTF, NGF, MIF or DHA alone alone DHA or MIF NGF, CNTF, ch critical if the “neuronal” population population “neuronal” the if critical gluT1 (a marker for spiral ganglion ganglion spiral for marker (a gluT1 y otat fw erts stained neurites few contrast, By 30 days), even in the presence of presence the in even days), 30 nlo nuos dvlpet of development neurons, anglion ae nuoie el i te mid the in cells neuronlike iated he Microfluidic Devices in CNTF CNTF in Devices Microfluidic he th over the lawn of Schwann cell Schwann of lawn the over th ace a wl a eiec of evidence as well as ranches DHA and MIF+DHA (see Fig.2 for Fig.2 (see MIF+DHA and DHA cd ernlk cls Although cells. neuronlike uced eg icesdVlT tiig of staining VgluT increased (e.g. seen in the F12 Basal medium. medium. Basal F12 the in seen markers are seen in Figs. 3c and 3c Figs. in seen are markers e el wr idcd ih the with induced were cells ke oa mre) n mei basic myelin and marker) ronal r pstv fr h glutamate the for positive ere like cells. However, neuronlike neuronlike However, cells. like n with and without DHA in the the in DHA without and with n c o meiain a seen was myelination of nce rophins+DHA, or MIF+DHA MIF+DHA or rophins+DHA, in vivo in . .

aginc xlns iial rmf oe sc a st a such over ramify similarly explants ganglionic earlie our recapitulates observation This right). celllike Schwann the towards outgrowth directional the with grown cells neuronlike the that differen suggests two the of pattern overall The phenomenon. based is flow the of operation the since guaranteed Sta device. flow slow our in achieved also is which was and supply nutrient replenished a require still in even that note to important is It barrier. brain wh ne myelinate cells Schwann not and oligodendrocytes body), the in flow lymphatic even or flow (blood fro separated remain and in develop usually Neurons strengt diffusion to respect with flow interstitial phenotype in embryonic stem cells (Roth et al., 200 al., et (Roth cells stem in embryonic phenotype produced lawn cell” “Schwann a and between neurons ganglion interactions in myelination in steps h early We 2015). 2012, Salzer, 2007; al., et Roth 1994; mol and interactions cellcell capabl required of sequence neurons of influence the requires production e Kidd 2013; Talbot, and Glenn 2015; 2012, (Salzer, entirely in (approximately) real time time real (approximately) in entirely gre DHA of celllik the Schwann of presence in the myelination presence the MIF, cytokine, neurotrophic Even Even mature and mutually influence the other population’ other the influence mutually and mature immunola stagespecific by and video lapse time by int the study to begin now can We lineages. two the b can cells the which in microenvironment a created Howev 2011). al, et (Callizot observe to difficult motnl, h so fo faue f u dvc, w device, our of feature flow slow the Importantly, The process of myelination is extremely difficult t difficult extremely is myelination of process The in vitro in

Accepted ArticleSchwan and neurons of cultures cell primary using ,

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. in vivoin , without sacrificing large numbers of animals. animals. of numbers large sacrificing without , such flowfree environments, neurons neurons environments, flowfree such , s hsooia fr ernl cells. neuronal for physiological is h, er, in the microfluidic device, we have have we device, microfluidic the in er, te clearing by minimal convective flow, convective minimal by clearing te e cells (Fig. 4). (Fig. 4). cells e r finding that neurites from primary primary from neurites that finding r 8). 8). ecular cross talk (Bodhireddy et al., et (Bodhireddy talk cross ecular em cellderived Schwann cell lawn lawn cell Schwann cellderived em eraction between the two cell types types cell two the between eraction s development, as happens happens as development, s simply on osmosis, a very stable stable very a osmosis, on simply iiy f h fo i te hne is channel the in flow the of bility target cells (e.g. Fig. 1a Row 1 1 Row 1a Fig. (e.g. cells target e differentiated concomitantly into into concomitantly differentiated e belling (Roth et al., 2007) as they as 2007) al., et (Roth belling t al., 2013). Schwann cell myelin myelin cell Schwann 2013). al., t o follow at the cellular level in its its in level cellular the at follow o urons, is maintained by the blood the by maintained is urons, Schwann celllike cells exhibited exhibited cells celllike Schwann c a lat o te N, where CNS, the for least at ich d rvosy on eiec of evidence found previously ad primary inner ear statoacoustic statoacoustic ear inner primary e of carrying on the complex complex the on carrying of e tiated cell types in the device device the in types cell tiated m high flow rate environments environments rate flow high m by inducing the Schwann cell cell Schwann the inducing by ty nacd vdne of evidence enhanced atly hich closely approximates approximates closely hich n cells, the process is process the cells, n in vivo in

Page 20of72 Page 21of72 rpris f ernlk cls ifrnitd y M ear inner for strategies replacement to themselves by differentiated cells neuron-like of Properties whether the neuronlike cells derived from mES cell mES derivedfrom cells neuronlike the whether cel “Schwann and “neurons” differentiating these as the of evidence ample is There 2007). al., et (Roth however, agree with our RTqPCR data (see Table 1). (see Table data RTqPCR our with agree however, (data n well defined less was staining the although the in expressed wasKv3.1also staining); nuclear neurit the along and the over somas all distributed cell prepar same the on channel ion Kv3.1 potassium for withantibodies expression protein channel ion and/o MIF the labelled also were We found. currents condition. NGF+DHA in the made werealso recordings cu outward any or or inward responses active no and (basal medium) alone media F12 cells in the whereas in the times MIF/ response active withlong current voltag detected electrophysiology. We voltageclamp Na of properties voltagedependent the investigated no such factors, any differentiation without medium mES the if Bycontrast, morphology. neuronal witha was properties excitable withmeasurable population t that had cells of 80% in the wasidentified cells weeks, After an (CNS). 3 system central nervous the impl cochlear a from information frequency encoding andthere potentials action for requirement minimum inwardout and gated voltage showed that properties Coating of SC cells on Cochlear implants using hydr using implants on Cochlear cells SC of Coating

Acceptedelectrophy these of underlying cause the explore To Article electrophysiological clamp patch usedwholecell We

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. aken on a neuronal morphology. The The neuronal morphology. a aken on es, as well intracellularly (potentially (potentially well intracellularly as es, sodium ion channel SP19 and and channel SP19 ion sodium DHA exposed “neurons” (Fig. 5c) (Fig.“neurons” 5c) exposed DHA ot shown). This finding does, does, shown). finding This ot cell body and along the processes, processes, the along bodyand cell coulddocumented. be properties s induced with MIF had excitable excitable had with MIF induced s ls” interact. ls”interact. early stages of myelination (Fig. 4) 4) (Fig. myelination of stages early + and K+ currents using wholecell wholecell using currents +and K+ C were exposed to the F12 basal basal F12 the to wereexposed C fore render these cells capable of of capable cells these render fore approximately 25% of the cells cells the of 25% approximately r DHAinduced neuronlike cells for cells for neuronlike DHAinduced r ant electrode and conveying it to andto conveying it electrode ant ward currents. This would be the the would be This wardcurrents. excitable population of neuronlike neuronlike of population excitable e dependent inward and outward inward and dependent e rrents. Electrophysiological Electrophysiological rrents. ation (double labeling). SP19 was SP19 labeling). (double ation showed no neuronal morphology neuronal no showed

neurons neurons However, no inward or outward or inward no However, ogel layering layering ogel IF or MIF+DHA could lend lend could MIF+DHA or IF siological changes, we changes, siological recordings to determine determine to recordings

utrd ih ) nat rmr ebync os sta mouse embryonic primary intact a) with cultured cochlear mic digital by lapse seen time implant was cochlear cell-coated cell-like Schwann the towards o ganglion statoacoustic mouse primary of Extension 6c) or undifferentiated ES cells (control; not show not (control; cells ES undifferentiated or 6c) (gr w coated layers hydrogel cells the in found were (orange) healthy of numbers Large (LIVE/ CA). calcein Invitrogen, and bromide ethidium with cells dead Fig. encapsu The head. ball electrode the of photograph 5b. Fig. in seen are cells celllike Schwann electrode. same the of photographs are All studies. cochlear of type the of photographs are 6d through discer readily are layers (5 layers hydrogel the in patients human in used type the of implant cochlear l hydrogel the in mESC undifferentiated with coated hydrogel in coated uncoated, either were electrodes with supplemented were cultures The 6). (Fig. weeks coat of types undifferen both scaffold; a as or hydrogel alginate cells celllike Schwann with “coated” Surgery Neck and Head Otolaryngology Dept. Pfingst, that would attract SGN. SGN. would attract that neur with coated be could CIs that demonstrated had these “coated” implants implants “coated” these th of interaction the followed then We cells. like CI “coating” to proceed to neurons, ganglion spiral cou that features had cells these showed that cells oher mln eetoe o te al ye en i seen type ball the of electrodes implant Cochlear

Two different types of platinum iridium electrodes electrodes iridium platinum of types different Two

Accepted Article preliminary the by encouraged sufficiently were We

This article isprotected by copyright. All rights reserved. in vitro in . Earlier work by Shepherd’s group (Pettingill et a et (Pettingill group byShepherd’s work Earlier . Developmental Dynamics John Wiley& Sons,Inc. n) at 6 weeks in culture. in weeks 6 at n) MFidcd ernlk cls with cells neuronlike MIFinduced e ed CIs were grown in culture for two for culture in grown were CIs ed s with MIFproducing Schwann cell Schwann MIFproducing with s , coated with Schwann celllike cells celllike Schwann with coated , Five layers of hydrogel containing containing hydrogel of layers Five a of photograph a is 6a Fig. ayers. ned in this photograph). Figs. 6b 6b Figs. photograph). this in ned lated cells were stained for live and live for stained were cells lated ld potentially serve in the place of place the in serve potentially ld ith the Schwann celllike cells (Fig. (Fig. cells celllike Schwann the ith otrophinexpressing Schwann cells Schwann otrophinexpressing c i a ls u pae contrast phase up close a is 5c, fresh media every week. Control Control week. every media fresh ocutc agi o itc post intact or ganglia toacoustic aes ihu cl icuin or inclusions cell without layers sodium 1% using mESC tiated mln eetoe sd n animal in used electrode implant roscopy: roscopy: e) n vr fw ed cells dead few very and een) DEAD® Cell Viability Assays, Assays, Viability Cell DEAD® Uiest o Mcia) were Michigan) of University , (kindly provided by Dr. Bryan Bryan Dr. by provided (kindly analyses of MIFneuronlike MIFneuronlike of analyses sia gnlo neurites ganglion spiral r Fg 5 wr te co then were 5bd Fig. n implant but not a bare bare a not but implant l., 2007) 2007) l., Page 22of72 Page 23of72 oher mlns ne ay odtos B contras By conditions. outgr any under directed implants cochlear No implant. the towards ganglion the exten neurite of evidence any observe to images the interva min 20 at dish prog the over waslocations different camera video a and dish culture tissue the bare a and explant SAG a or implant cochlear coated S cocultured implants A cells. celllike cochlear Schwann contained toward outgrowth neurite directed primary ganglia. ganglia. primary th of addition after hrs 24 every photographed also dir and migration Neurite days. 514 over stage the cnrl cniin (ae mln, yrgl u no but hydrogel neurit the hydrogels), the implant, in mESC undifferentiated (bare conditions “control” fr emerging seen were processes some Although mESC. with coated implants or cells not but hydrogel with “bare” towards seen was whatever outgrowth neurite ex neurons ganglion statoacoustic both from implant Schw the directiona on processes neuronal of showed contact extensive ganglia statoacoustic and implant specially designed microscope with a gassupplied ( gassupplied a with microscope designed specially t by interaction entire the monitored We implants. outgrowt directional demonstrate would neurites the from dissociated neurons b) or ganglia spiral natal direction. direction. cells glial underlying without and (with themselves spli cases some in itself explant the that observed was outgrowth some days 2 first the during if even ce Schwann the towards direction the took processes e is tse wehr rmr saocutc gangl statoacoustic primary whether tested first We

Accepted cellli Schwann of wks) (2 coculture longterm The Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. ls over 514 days. We then analyzed then We days. 514 over ls hydrogels containing undifferentiated undifferentiated containing hydrogels e cochlear implants to cultures of the of cultures to implants cochlear e random and nondirectional. We also We nondirectional. and random these ganglia to determine whether determine to ganglia these mgae i h ccla implant’s cochlear the in migrated ) ectional outgrowth trajectories were trajectories outgrowth ectional 5% CO5% imelapse digital videography on a a on videography digital imelapse AG explant and the Schwann cell Schwann the and explant AG i hl ad oe f h neurons the of some and half in t h towards the cell coated cochlear coated cell the towards h e processes were short, emerged emerged short, were processes e implant were placed 1 cm apart in apart cm 1 placed were implant lllike cellcoated cochlear implant, implant, cochlear cellcoated lllike sion or directional outgrowth from from outgrowth directional or sion , fe 2 as 8% 4 o the of 4% 87%+ days, 2 after t, lns n dsoitd el. No cells. dissociated and plants ann celllike cellcoated cochlear cellcoated celllike ann cochlear implants, those coated coated those implants, cochlear owth was seen towards bare bare towards seen was owth amd o atr iae at images capture to rammed coated with hydrogels that that hydrogels with coated om the ganglia under the three three the under ganglia the om otrwh f erts and neurites of outgrowth l cl cae ipat or implant coated cell t 2 ) tissue culture incubator on incubator culture tissue ) e elcae cochlear cellcoated ke o nuos exhibited neurons ion

rud h cutr f prl agin ernl cell neuronal ganglion spiral of cluster the around primary statoacoustic ganglia, at least some outgro some least at ganglia, statoacoustic primary coatedcoch cell celllike Schwann the towards seen direc that found we Again, DAPI. and neurofilament experiment the At imaging. cell live timelapse by bo outgrowth directional any document and extension photograp and cinematographic techniques, culturing undifferentia or cells celllike hyd Schwann with containing or implants, cochlear bare with cocultured ietoa otrwh f erts rm G ws seen was SGN targets: from neurites of outgrowth Directional (Fig.layers 7c). cell Schwann see are withDAPI stained that bodies cell neuronal ( cells like cell Schwann the to belong to seen and conce heavily are nuclei stained DAPI the where 7c, photogr nuclei. cell doublelabelled celllike Schwann the with associated this In bodies. cell few a used was (red) (Nfil) 150kDa Neurofilament 7a Fig. par same the of 7b) (Fig. micrograph contrast phase fl are b and a 7 Fig. layers. hydrogel the in cells la hydrogel the penetrated had and 7) (Fig. implant throughout the experiment. the experiment. throughout stai positively be could bodies cell migrating some the towards migrate to and implants cochlear coated in the turn to wereobserved ganglia statoacoustic extension even after 2 2 weeks. even after extension showed and explants the of sides all from randomly prl agi ioae fo te a od postnata old 6day the from isolated ganglia Spiral y w wes te ttaosi gnlo nuie h neurites ganglion statoacoustic the weeks, two By

Accepted Articlepr neuronal onwards, 3 day from contrast, marked In

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. These are more clearly visible in Fig. Fig. in visible clearly more are These uorescence micrograph (Fig. 7a) and 7a) (Fig. micrograph uorescence direction of the Schwann celllike cell celllike Schwann the of direction ned for neurofilament marker protein marker neurofilament for ned n in the area above the concentrated concentrated above area the the in n s end, the cultures were stained for stained were cultures the end, s to label the neuronal processes and and processes neuronal the label to wth of neurites was observed 360 observed was neurites of wth t of the coated electrode surface. In surface. electrode coated the of t ois Atr h 3 the After bodies. e mS. e sd h same the used We mESC. ted ntrated close to the electrode head electrode the to close ntrated opr Fg 7 wt 7) A few A 7a). with 7c Fig. compare yers containing Schwann celllike celllike Schwann containing yers lear implants. Initially, as with the the with as Initially, implants. lear p, h bu sann (AI is (DAPI) staining blue the aph, hic techniques to observe neurite neurite observe to techniques hic tional neurite outgrowth was only was outgrowth neurite tional th under the light microscope and microscope light the under th rogel coated cochlear implants implants cochlear coated rogel m. The emerging neurites and and neurites emerging The m. no directionality or appreciable appreciable or directionality no mue ohe wr also were cochlea mouse l ocesses emerging from the from emerging ocesses ad reached the cochlear cochlear the reached ad towards a variety of of variety a towards rd a o co of day 0

Page 24of72 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Page 25of72 ugot wt te out ert otrwh emergin outgrowth neurite robust the with outgrowth Org type wild the ne towards growing branches multiple of clusters showed explants Corti of Organ mouse ugot twrs h ccla ipat 7+1 o t of (71+11% implant cochlear the towards outgrowth process long showed implant cellcochlear celllike c neuronlike contrast In implant. cochlear coated cells encapsulated (no hydrogelcoated the implant, outgr neurite directional no and processes emerging The cells. without implant cochlear coated hydrogel mouse undifferentiated with coated implant cochlear coated implant cochlear A c) implant; cochlear bare s previous our in described as mouse) out knock MIF coc mouse postnatal old day 6 from derived explants directiona and migration directional for coculture Neuron- like mESC-derived cells’ directional outgro directional cells’ mESC-derived like Neuron- M for 2012). al., et (Bank adulthood into neurons receptors that demonstrated previously had we could endogenous an of neurites implant attract to cues molecular cochlear cellencapsulated celllike measurements of total “oriented” processes became d became processes total of “oriented” measurements proc these However, implant). cochlear the towards shown). even all undifferen at outgrowth directional no with and extension coated one or implant cochlear bare ga spiral from outgrowth Neurite culture. in days 9 and implant cochlear cellcoated celllike Schwann show neurites the of %) (91+6 majority the culture,

MIFinduced neuronlike cells cocultured with the the with cocultured cells neuronlike MIFinduced The MIFinduced/DHA enhanced neuronlike cells were cells neuronlike enhanced MIFinduced/DHA The

Accepted Articled studies outgrowth directional and migration These For Peer Review Peer For This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. l outgrowth towards: a) Organ of Corti of Organ a) towards: outgrowth l ed directional outgrowth towards the towards outgrowth directional ed after 2 weeks in coculture (data not (data coculture in weeks 2 after processes reached the implant by 8 by implant the reached processes nglion neurons in the presence of a of presence the in neurons nglion embryonic stem cells (mESC); e) A e) (mESC); cells stem embryonic es, rapid migration and directional directional and migration rapid es, ls oclue wt te Schwann the with cocultured ells adult spiral ganglion. Importantly, Importantly, ganglion. spiral adult esses became so fasciculated that fasciculated so became esses an of Corti (Fig. 8b). Compare this Compare 8b). (Fig. Corti of an with Schwann celllike cells; d) A d) cells; celllike Schwann with ccla ipat r h mESC the or implant cochlear ) hleae (wild type or derived from a from derived or type (wild hleae ifficult over time. time. overifficult fo a id ye rmr spiral primary type wild a from g neuronlike cells exhibited few few exhibited cells neuronlike wth towards targets: wth wh oad h br cochlear bare the toward owth uis Bn e a. 21) b A b) 2012); al., et (Bank tudies tiated mES cells showed little little showed cells mES tiated potentially deliver directional directional deliver potentially urites with growth cones and and cones growth with urites IF remain on spiral ganglion ganglion spiral on remain IF he processes were oriented oriented were processes he 6day old postnatal wild type wild postnatal old 6day emonstrate that a Schwann Schwann a that emonstrate assessed after a week of week a after assessed

en tse eetohsooial. oee, direc However, implanted electrophysiologically. thorough be to remain function electrophysiological tested being cytokine MIF and DHA can migrate towards appropriat towards migrate can DHA and MIF cytokine w 3 after derived cells neuronlike MIF/DHAinduced 2012 al., et (Bank explant Corti of Organ out knock ganglion spiral nor neurites O ganglion statoacoustic and neurons primary with finding our recapitulate a from came explant Corti of Organ the if seen was dir no and processes of emergence random outgrowth, Cor of Organ wildtype the towards neurons ganglion

Accepted Articlevivo in

in animal models. inmodels. animal

ly tested when such electrodes are electrodes such when tested ly neurites emerged towards a MIF MIF a towards emerged neurites MIF knock out mouse. These data These mouse. out knock MIF ). These studies indicate that the that indicate studies These ). eeks exposure to the neurotrophic neurotrophic the to exposure eeks i xln se i Fg 8. Little 8a. Fig. in seen explant ti e targets targets e rgan of Corti explants. Neither Neither explants. Corti of rgan cinl ugot o neurites of outgrowth ectional tional outgrowth and and outgrowth tional in vitro in . Functionality is Functionality . Page 26of72 Page 27of72 microfluidic device microfluidic an cells neuron-like of differentiation Concomitant 2012) or, as we show here in microfluidic devices, microfluidic in here show we as or, 2012) conventi either in MIF by induced cells neuronlike in MIF for receptors appropriate the retain neurons demonst previously also had We 2012). al., et (Bank responsib is it and outgrowth neurite that directional and neurogenesis 2012), al., et Bank 2012; al., inne developing the in expressed neurotrophin first previou had we because was This experiments. based mode microfluidic the in both here detailed studies n inducing the as MIF used we studies, microfluidic ernlk ad cwn clie el simultaneou device. cells celllike Schwann and 2007, neuronlike al., et Roth 1985; al., et (Doetschman (mESC) population common a differentiated have We studies. lo hearing sensorineural alleviate to used be could nue h mS t bcm Shan ellk o the on device. microfluidic celllike Schwann become to mESC the induce ( Neuregulin used also we studies, these In 2012). et Roth CNTF: (NGF, agent inducing the as used was characteristics different with phenotypes neuronal mouse induced also We 2008). 2007, al., et (Roth nonmy and myelinating the both of model based cell lab Our studies. differentiation such for culture Although both NGF and CNTF served as the “control” “control” the as served CNTF and NGF both Although Two novel stem cellbased therapeutic strategies fo strategies therapeutic cellbased stem novel Two

Accepted w which Article in work earlier on based were studies These

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. DISCUSSION DISCUSSION had produced the first embryonic stem embryonic first the produced had onal tissue culture dishes (Bank et al. et (Bank dishes culture tissue onal to adulthood (Bank et al., 2012). The The 2012). al., et (Bank adulthood to can bear significant resemblance to resemblance significant bear can r ear (Holmes et al, 2011; Shen et Shen 2011; al, et (Holmes ear r eurotrophic cytokine in most of the of most in cytokine eurotrophic depending on which neurotrophin neurotrophin which on depending that it is a neuronal survival factor factor survival neuronal a is it that rated that inner ear spiral ganglion spiral ear inner that rated s ae en sesd n these in assessed been have ss le for the earliest steps in both both in steps earliest the for le ad n diinl ise culture tissue additional in and l s n oh t l, 07 20) to 2008) 2007, al., et Roth in as embryonic stem cells to take on take to cells stem embryonic al., 2007, 2008; MIF: Bank et al., et Bank MIF: 2008; 2007, al., o os mroi se cells stem embryonic mouse of sly in a slow flow microfluidic microfluidic flow slow a in sly Shan ellk cls n a in cells cell-like Schwann d sly demonstrated that MIF is the the is MIF that demonstrated sly r producing cell populations that populations cell producing r lntn Shan el n 2007 in cell Schwann elinating 08 Bn e a. 21) into 2012) al., et Bank 2008, neuroninducing agents in the in agents neuroninducing Shan el sd o the of side cell” “Schwann e used conventional tissue tissue conventional used e

auain f uh nuos i cnetoa tissue devices. conventional in “neurons” such of maturation inner ear spiral ganglion neurons (Bank et al., 201 al., et (Bank neurons ganglion spiral ear inner Wbr t l, n rprto) s n oe comprehen more 20 in Glennand Talbot, 2013; (Hanal.,et myelination as preparation) in al., et (Weber model in and devices microfluidic these in studied 201 al., et (Porrello dysmyenination cause to known downst be to known pathways Disrupting systems. of m they do myel in MIF of role The course neurons. except environment of nor, components; myelin develop documented. documented. a side” by “side differentiate populations cell two cells—neuronlike ES of population common the from differ two the between interactions for allows also accelerate were rate flow the if device the through fac paracrine and autocrine of accumulation the for populations as it is it as populations d for critical as is device the in populations cell Th 2008). al., et ( (Roth experiments culture tissue myelination of steps s early and outgrowth early directional such demonstrated the in resulted cells’ betwe interactions and 1a) (Fig. lawns cell Schwann Neuron d). 1c, Figs. in cartoons the (see factors continuously a supply reservoirs the because saving both spare devices These themselves. devices the in molecular morphological, in documented and seen was one of two ways: use of the biochemical MIF inhibit MIF biochemical the of use ways: two of one i by device the of side cell” “Schwann the to cells n h mcolii dvcs cnoiat ernl c neuronal concomitant devices, microfluidic the In We addressed the role of MIF in the observed direct observed the in MIF of role the addressed We

Acceptedmicroflui the in maintained flow slow extremely The Article in vivo in This article isprotected by copyright. All rights reserved. . Without intimate contact with neurons, Schwann ce Schwann neurons, with contact intimate Without . Developmental Dynamics John Wiley& Sons,Inc. evelopment of mature properties in both in properties mature of evelopment like cells extended processes over the the over processes extended cells like nhibiting MIF’s down stream effects in effects stream down MIF’s nhibiting nd interactions between them can be can them between interactions nd entiating cell populations that emerge that populations cell entiating 13). 13). e proximity of the two differentiating differentiating two the of proximity e d (Park et al., 2009). This slow flow flow slow This 2009). al., et (Park d tors that would ordinarily be washed washed be ordinarily would that tors or 4iPP as we had done previously done had we as 4iPP or 2). 2). cells and reagents and are labour are and reagents and cells teps in myelination in conventional conventional in myelination in teps 1). Such pathways can be easily be can pathways Such 1). ination is under study in a number number a in study under is ination organisms such as the zebrafish zebrafish the as such organisms delivered source of medium and and medium of source delivered and Schwann cell like cells. The cells. like cell Schwann and culture and in the microfluidic microfluidic the in and culture n h ‘ern’ n ‘Schwann and ‘neurons’ the en ream of MIF, such as Jab1, are Jab1, as such MIF, of ream and electrophysiological assays assays electrophysiological and

i. ) W hd previously had We 4). Fig. dic device over 3 weeks allows allows weeks 3 over device dic The use of DHA enhances the enhances DHA of use The ie tde o te vns in events the of studies sive elltype specific differentiation differentiation specific elltype ional outgrowth of neuronlike neuronlike of outgrowth ional yelinate any cells in their their in cells any yelinate lls do not not do lls Page 28of72 Page 29of72 infcn ipoeet n ern fnto cud b could function hearing in improvement significant improvement of a malfunctioning auditory system was system auditory amalfunctioning of improvement al et (Reyes model animal an in implanted also were charac functionali electrophysiological including some neurons, have to found were neurons These s and GDNF. 1 neurogenin of expression transient by cells hearing loss. loss. hearing t neurons such of source a as 2010) al., ow et (Oshima patient’s a using potentially patients, human in lo replace potentially could that cells neuronlike of that to neuron. ganglion resemblance some has phenotypically that stem-cel a Producing objective: long-term a Meeting 2012). The effect of blocking MCP1 was not tested tested wasnot MCP1 blocking of effect The 2012). survival their and neurons ear inner from outgrowth sho have we which and 2012) al., et (Bank ear inner prod is also which (MCP1) 1 protein chemoattractant another produce to known are cells Schwann because outgrowt neurite directed eliminate totally not did enhanced were MIF if or agent inducing the was MIF Howe 2). (Fig. phenotype neuronlike the induce to ma no lawn, cell Schwann the over outgrowth neurite ifrnitd no cwn clie el, e cou we cells, celllike Schwann into differentiated device the of side cell Schwann the on means these f We 2012). al., et (Bank studies previous in done functionblocking a using by or 2012) al., et (Shen oe rmsn ltr tde fo te iot group Rivolta the from studies later promising More Researchers have previously attempted to develop gl develop to attempted previously have Researchers

Accepted stem a produce to is studies these of objective One Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. st or damaged spiral ganglion neurons ganglion spiral damaged or st h over the Schwann cell lawn. This is This lawn. cell Schwann the over h ty (Reyes et al., 2008). The ‘neurons’ The 2008). al., et (Reyes ty in these experiments. experiments. these in antibody to MIF, again as we had had we as again MIF, to antibody ound that blocking MIF by either of either by MIF blocking that ound ver, the greatest effect was seen if seen was effect greatest the ver, wn to affect both directional neurite directional both affect to wn (Bianchi et al., 2005; Bank et al., et Bank 2005; al., et (Bianchi once the embryonic stem cells had had cells stem embryonic the once ld significantly reduce reduce significantly ld demonstrated. demonstrated. with DHA. Note that blocking MIF MIF blocking that Note DHA. with ahee i a efnd gerbil deafened a in achieved e idcd lrptn se cells stem pluripotent induced n tter which neurotrophin was used was neurotrophin which tter uced by sensory hair cells of the of cells hair sensory by uced hat could alleviate sensorineural sensorineural alleviate could hat plmnain ih DF and BDNF with upplementation neurotrophic cytokine, monocyte monocyte cytokine, neurotrophic , 08, lhuh o functional no although 2008), ., l-derived neuronal population neuronal l-derived utamatergic neurons from ES from neurons utamatergic eldrvd ouain of population cellderived eosrtd ht some that demonstrated eitc o sia ganglion spiral of teristics h inr a’ spiral ear’s inner the directional

directional signals and sustain their survival. survival. their signals and sustain directional of extending “neurites” “neurites” extending of woul population “neuronal” substitute implanted any cells of the inner ear (Bank et al., 2012). The neu The 2012). al., et (Bank ear inner the of cells se each underlie that cells supporting the by Corti 2012). al., et Bank 2012; al., et Shen 2011; al., sufficiently similar to the cells they replace to b to replace they cells the to similar sufficiently were to be successful. successful. be wereto meeting population “neuronal” the involve of connections functional which of some and itself optim in procedure incurred be would which of some met, be to successf be to is paradigm this However,if adults. senso damaged or lost replace to future the in used strat A replacement Potential: neuronal Therapeutic demonstrate also 2012). al., (Bank MIF et for receptors have we because nerve largely other cytokines, of use the to preferable is population co inn cytokine the neurotrophic al et Bank 2012; al., et (Shen ear inner vertebrate is this MIF that that and emphasizing neurotrophin worth is It wi 2012). step single a only requires studies previous our neuron to ES the protocols, differentiation complex implan before differentiation neuronal for protocol from human inner ear stem cells required a complex complex a required cells stem ear inner human from Ho animals. deafened the into implanted were cells huma when 2012) al., et Jongkamonwiwat (Chen, model MIF is exactly such a neuronal directional outgrowt directional neuronal a such exactly is MIF First, the cells must have cellular, molecular and and molecular cellular, have must cells the First,

Accepted DHAinduced and MIF from derived cells Neuronlike Article

This article isprotected by copyright. All rights reserved. in vivo in , towards a source of molecular cues that could pro could that cues molecular of source a towards , Developmental Dynamics John Wiley& Sons,Inc. e functionally “competent” “competent” functionally e MIF is produced in the native Organ of Organ native the in produced is MIF ., 2012). Its use in eliciting a neuronal neuronal a eliciting in use Its 2012). ., ul, several important hurdles will have willhave hurdles important several ul, nsory hair cell and by the Schwann the by and cell hair nsory ig h cls B cnrs t these to contrast By cells. the ting d have to remain viable and capable and viable remain to have d rite outgrowth documented in these in documented outgrowth rite to the Organ of Corti if the implant the if Corti of Organ the to ovrin ecie hr ad in and here described conversion ry neurons of the spiral ganglion in ganglion spiral the of neurons ry h eobnn MF Bn e al. et (Bank MIF recombinant th ee, h drvto o neurons of derivation the wever, rwh atr (G, NF or CNTF) (NGF, factors growth h and survival factor (Holmes et (Holmes factor survival and h egy egy izing the neuronal cell implant implant cell neuronal the izing uttp ay week many multistep electrophysiological properties properties electrophysiological ntrols gangliogenesis in the the in gangliogenesis ntrols rtcl rtra o monitoring for criteria critical er ear’s earliest expressed expressed earliest ear’s er ES cells could potentially be potentially could cells ES ta AUT G retain SGN ADULT that d ebync ne er stem ear inner embryonic n in situ in . Second . n vitro in vide

Page 30of72 Page 31of72 cochlear implant could also provide such cues and i cues such and provide could also implant cochlear MIFprodu Sc A outgrowth. directed the cells’ neuronlike towards cells ce Schwann the by neuronlike production MIF that demonstrating these of outgrowth e Shen (4IPP, 4iodo6phenylpyrimidine inhibitor, et (Bank MIF to antibody functionblocking a Either neuronl the c Schwann that (MIFproducing) chemoattractantproducing demonstrates studies microfluidic ant om tmr r eifrnit ad prolifer and benign. is forms eventually dedifferentiate or tumor a form cannot woul criteria critical additional two and optimized sensory each cup ha that cells supporting producing th in cells tissue hair (surviving target the reach require are days many however over “neurons” viable be minimized. minimized. be time. longer much a for cytokine the provide could Us contacts. functional form and implant the reach spira of number maximum a that ensure to MIF supply know not is It exhausted. be eventually would gels r slow with even but implants, cochlear the coat to releas that 2009) al., et Inaoka (e.g. gels release be presumably would which of debris cell the 2012), coch the Schwan the eliminate to triggered be could cassette contacted have processes neuronal ganglion prl agin ern udr h cniin o the of conditions the under neurons ganglion spiral neuron mESCderived the in properties some inducing The number of surviving “neuronlike” cells has to to has cells surviving “neuronlike” of number The In the future, in order to prevent tumor formation formation tumor prevent to order in future, the In How far have we come towards realizing these criter these realizing towards we come have Howfar

Accepted Corti, of Organ native the is tissue target the If Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. e Organ of Corti presumably via the MIF the presumably Corti via of Organ e e recombinant MIF could also be used used be also could MIF recombinant e d have to be met: the implanted cells implanted the met: be to have d The possibility of infection must also must infection of possibility The s discussed later in this section. section. later this in discussed s n how long it would be necessary to to necessary be would it long how n ing a stem cellbased source of MIF MIF of source cellbased stem a ing n celllike cells (e.g. Li, Zhang et al., et Zhang Li, (e.g. cells celllike n ir cell) or the cochlear implant. cochlear the or ir cell) lae te upy f I i these in MIF of supply the elease, l, 02 o te iceia MIF biochemical the or 2012) al., cing Schwann cell like cellcoated cellcoated like cell Schwann cing a. 21) a peet directed prevent can 2012) al., t h ipat ie ol hv t be to have would site implant the be sufficient to provide functionally providefunctionally to sufficient be removed by macrophages. Slow macrophages. by removed ate, even if the cell bolus that that bolus cell the if even ate, d for their neuronal processes to processes neuronal their for d ll like cells is a key feature of the of feature key a is cells like ll n h inr a, ne h spiral the once ear, inner the in xeiet Tee nld: 1) include: These experiment. ia? MIF and DHA are capable of capable DHA are and MIF ia? ls n h mcolii devices. microfluidic the in ells l ganglion neuronal processes processes neuronal ganglion l ta ae iia t toe of those to similar are that s k cls lo epn to respond also cells ike er mln, cl suicide cell a implant, lear hwann cell target cells, cells, target cell hwann

oeta o ECdrvd cwn cl-ie el fo loss hearing cells cell-like Schwann ESC-derived of Potential therapy. implant cochlear for candidates gang withlow patients spiral in therapy cellbased pot could DHA and MIF mESCusing derived from cells Corti explants Organ of knock MIF out mouse the not coated celllike Schwann the both towards outgrowth from the neuronlike cells induced by either NGF or byeither cells induced the neuronlike from electrop when werefound currents outward or inward e promising with population neuronal a induce could ce whole electrophysiological preliminary the by encouraged by evaluated were properties physiological immunocytoche by level protein the at and RTqPCR by potentia action of possibility the and excitability of source viable a provide also could which of each (CNT factor neurotrophic ciliary or (NGF) factor and protein, which was documented in MIF and DHA in DHA MIF and in waswhichdocumented protein, and the of neurons ganglion spiral for marker (a VgluT1 explanted Organ of Corti targets under under Cortiof targets Organ explanted with cocultured when outgrowth neurite directional odtos W hv nt e dcmne ato poten action documented yet th in attempted willrecordings be such conditions; not have We conditions. ucinly aue rpris n omn ih spira with common in properties mature functionally labeling experiments than potassium ion channel exp channel ion potassium than experiments labeling define better was expression protein channel sodium et (Greenwood neurons ganglion spiral for expected hs eprmns eosrt ta tee neuronlik these that demonstrate experiments These h cls lo xrse in hnes sdu ad p and (sodium channels ion expressed also cells The oee, h tasotr s lo xrse t te s the to expressed also is transporter the However,

Accepted cells mESCderived neuronlike mature Functionally Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. in vitro in conditions. They exhibited directional directional exhibited They conditions. ls: Ion channel expression was assessed assessed was expression channel Ion ls: lion counts who are not presently not arewho counts lion e future. e future. a cochlear implant or primaryimplant or cochlear a F) induced mESCderived neurons, neurons, mESCderived induced F) NGF+DHA. NGF+DHA. experiments showing that MIF+DHA MIF+DHA that showing experiments cochlear implant and wild type but wildbut type and implant cochlear in culture. Therefore, neuronlike neuronlike culture. Therefore, in ression on the neurites. the on neurites. ression hysiological recordings were made made were recordings hysiological ne er tasotr expression transporter ear) inner ‘neurons’. 2) Electrophysiological Electrophysiological 2) ‘neurons’. l ganglion neurons under under neurons ganglion l etohsooia poete. No properties. lectrophysiological entially be implanted as a stem stem as a implanted entiallybe duced neuronlike cells. cells. neuronlike duced l, 07 Xe t l, 07, but 2007), al., et Xie 2007; al., d in the immunohistochemistry immunohistochemistry the in d were experimentally tested for tested wereexperimentally l ac capn. e were We clamping. patch ll mistry. The neuronlike cells’ cells’ neuronlike The mistry. r alleviating sensorineural sensorineural alleviating r ame extent in nerve growth growth nerve in extent ame tsim hnes ta are that channels) otassium il udr n o these of any under tials e cells express express cells e n vitro in some

Page 32of72 Page 33of72 2005; see also Wissel et al., 2008). 2008). al., et also see Wissel 2005; neuronal promoting for candidates likely are cells effect sec neuritogenic be clear showed to medium known conditioned factors isolated of range a against “neur on tested was medium cellconditioned Schwann Taylo and (Bampton outgrowth “neurite” and survival neurona for model a estimations investigators’ some compo model quasineuronal a on examined were cells 2015; Salzar, 2012, al,2013; Kidd et 1989; Bunge, prolifera (e.g. quiescent, differentiation of state 2013) al., et Gambarotta 2006; Field, and (Bhatheja Schwann cells on the implant to the engineered neur engineered the to implant the on cells Schwann attracting spiral ganglion neurons to the implant ( implant the to neurons ganglion spiral attracting coch a coat to used was cells Schwann of population Pettingil 2007; al., et Golden 2005; al., cells, et Girard Schwann implanting by neurotr of delivery sustained provide to engineered loss hearing of models ganglion neurons and a Schwann celllike cellcoate Schwann and a neurons ganglion connections of number the improve could that MCP1, oetal cpbe of capable c potentially Schwann mESCderived of production the is studies studied for their ability to “attract” neurites fro neurites “attract” to ability their for studied improved hearing or better speech perception in pat in implant. perception speech better or hearing improved cochlear a of functionality the enhance to Eventually ganglion. spiral mature the and ganglion In earlier studies by other investigators, the effe the investigators, other by studies earlier In oee, h gop trbtd h atato o the of attraction the attributed group the However, Other groups have reported enhanced survival of spi of survival enhanced reported have groups Other h scn ebync tm el ae teaetc ap therapeutic based cell stem embryonic second The cwn cls r kon o e motn fr periphe for important be to known are cells Schwann

Accepted Article coc cellcoated celllike Schwann studies, these In

This article isprotected by copyright. All rights reserved. otnos production continuous Developmental Dynamics John Wiley& Sons,Inc. m both both m ting or mature Schwann cells) (Baehr and (Baehr cells) Schwann mature or ting f oeua ce, nldn MF and MIF including cues, molecular of Pettingill et al., 2008). 2008). al., et Pettingill e a. 20) Sc a engineered an Such 2008). al., et l ophins such as BDNF (Bunge, 1993; 1993; (Bunge, BDNF as such ophins Grigoryan and Birchmeier, 2015). 2015). Birchmeier, and Grigoryan , such a strategy might be employed employed be might strategy a such , ients experiencing hearing loss. loss. hearing experiencing ients d cochlear implant. implant. cochlear d regeneration (Bampton and Taylor, Taylor, and (Bampton regeneration cts of factors secreted by Schwann Schwann by secreted factors of cts . These properties depend on their on depend properties These . otrophin expression and release by release and expression otrophin lear implant, with some success in success some with implant, lear f ucsfl ti cud ed to lead could this successful, If cls wih ee etdfr cell for tested were which cells, l primary ad ugse ta Schwann that suggested and s , 05. n hs experiments, these In 2005). r, spiral ganglion neurons to the the to neurons ganglion spiral sed of PC12 cells, which are, in in are, which cells, PC12 of sed t” ugot fo P1 cells PC12 from outgrowth ite” reted by Schwann cells. This This cells. Schwann by reted ral ganglion neurons in animal in neurons ganglion ral between any remaining spiral spiral remaining any between lie el. hs cls are cells These cells. elllike hlear implants implants hlear which were molecularly molecularly were which rah ecie i these in described proach embryonic statoacoustic statoacoustic embryonic ral nerve regeneration regeneration nerve ral n vitroin were

attraction. attraction. ma the either was MIF MIF, express cell Schwann all r the be indeed could this While cells. Schwann the would presumably function normally, but this has no has this but normally, function presumably would cochlea the cells, the all releasing after degraded neurons. ganglion spiral the protect to serve also sustained provide potentially could o which perilymph implant, the in cells the release might hydrogel th but cells, encapsulated hydrogel the of presence impedan electrical introduced, was implant cochlear strategies cell based stem Combining living a animal. Conclusions Conclusions studies. et al., 2002, Bank et al., 2012). The research stud research The 2012). al., et Bank 2002, al., et c Schwann engineered these including cells, Schwann a coat to used of be could capable MIF like are factors supporting that cells celllike Schwann derived al et (Oshima i (iPSC) cells could stem pluripotent sources induced cell stem Potential be has loss. degeneration complete cell hair which in ear inner an ce stem embryonic ganglionlike) spiral potentially odtos i te uue hs prah a b appl be can approach this future the in conditions; r aae sia gnlo nuos Frhroe Ne Furthermore, neurons. ganglion spiral damaged or ganglion spiral resemble could that neurons derived f hs el otd oher mln srtg were strategy implant cochlear coated cell this If Various combinations of these approaches could be u be could approaches these of combinations Various

hs suis rvd frt tp twrs producing towards steps first provide studies These Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. llderived cells could be implanted into implanted be could cells llderived ies outlined here are limited to limited are here outlined ies r implant’s own electrical stimulation electrical own implant’s r t been examined either either examined been t biodegradable and biocompatible e eason, it is also possible that since that possible also is it eason, ne h hdoe hs completely has hydrogel the Once neurotrophin release, which would would which release, neurotrophin neurons sufficiently to replace lost replace to sufficiently neurons oher mln. eal ht all that Recall implant. cochlear , 00. lentvl, tm cell stem Alternatively, 2010). ., e hud e ihr u t the to due higher be should ce ae sronig h cochlear the surrounding area r ied in animal models in in models animal in ied in source of or contributed to the to contributed or of source in elllike cells produce MIF (Huang (Huang MIF produce cells elllike cue hmn ain’ own patient’s human a nclude u bt o yt rgesd to progressed yet not but gun rglnidcd cwn cell Schwann uregulininduced utie dlvr o critical of delivery sustained to be successful, initially after after initially successful, be to sed. Neuronlike (especially (especially Neuronlike sed. Inue se cell stem MIFinduced in vitro in n vivoin in vitro in or in or

Page 34of72 Page 35of72 could that cells repair. system auditory of populations two form to induced could future the in which but cells, stem embryonic cells “stem of population common a Thus 2012). al., subt neuronal both that demonstrated earlier had We aud mature and immature both which to MIF of source “coat” to used be could MIF produce that cells like

Accepted Article

a cochlear implant that provides a provides that implant cochlear a be host derived iPS cells, can be can cells, iPS derived host be ypes retain MIF receptors (Bank et (Bank receptors MIF retain ypes ”, which in this report are mouse mouse are report this in which ”, provide viable approaches for for approaches viable provide tr sse nuos respond. neurons system itory

ernlk nuos Rt e a. 20) 1 gL ner µg/L 1 2007); al., et (Roth neurons neuronlike fa neurotrophic ciliary µg/L 1 types: cell neuronal µg/L 5 IL7, µg/L 1 USA), MN, Minneapolis, Systems, pyruva sodium 2% (Invitrogen), B27 2% (Invitrogen), 1% (Invitrogen), F12 95% differentiation: Neuronal Differentiation of mES cell into various neuron-lik various into cell mES of Differentiation Systems). 10 (Invitrogen), Gentamycin L 58 FBS, Inactivated ( extract embryo chick of 11 Day 6% consisted 41061029), (GIBCO medium The 2008). 2007; al., et (Roth produ to used were methods published previously Our Differentiation of mES cell into Schwann cell-like cell-like Schwann into cell mES of Differentiation ( USA). ESGRO U/mL 1,000 Aldrich), (Sigma mercaptoethanol Aldrich, Sigma stock, (2% pyruvate sodium 1% USA), (Atl FBS 15% (Invitrogen), acids amino nonessential includin but red, phenol without USA) CA, Carlsbad, ( Proliferating/undifferentiated Preparation: Media day. third dif cell Schwann basa and media differentiation neuronal fed were (controls) cells mES Undifferentiated previouslyreported our using period, threeweek a (Falcon plates Primaria® well 48 (Sigma) gelcoated cell D3 mESC 10,000 1985). al., et Doetschman 1934; wa studies these for used line cell The lines: Cell cells mES Culturing

Accepted Article

This article isprotected by copyright. All rights reserved. EXPERIMENTAL PROCEDURES PROCEDURES EXPERIMENTAL Developmental Dynamics John Wiley& Sons,Inc. ES medium): 81% DMEM (Invitrogen, DMEM 81% medium): ES ctor (CNTF; R&D Systems) for motor for Systems) R&D (CNTF; ctor s the D3 mES cell line (ATCCCRL line cell mES D3 the s ferentiation medium were fed every every fed were medium ferentiation methods (Roth et al., 2007; 2008). 2007; al., et (Roth methods te (2% stock), 0.5 µg/L bFGF (R&D (R&D bFGF µg/L 0.5 stock), (2% te anta Biological, Lawrenceville, GA, GA, Lawrenceville, Biological, anta over differentiated were cells and ) cells cells e cell types cell e ve growth factor (NGF; Millipore, Millipore, (NGF; factor growth ve Pen/Strep (Invitrogen), 1% N2 N2 1% (Invitrogen), Pen/Strep 1 LGu, % e/te, 1% Pen/Strep, 1% LGlut, 1% g s were plated onto 0.1% porcine 0.1% onto plated were s mdu diy wie el in cells while daily, medium l L Neuregulin1 (NRG1) (R&D (R&D (NRG1) Neuregulin1 L G (im) o fr specific for or (Sigma), IGF1 ce Schwann cell differentiation differentiation cell Schwann ce 0 m apa oiid MEM modified alpha mL 500 prepared in house), 10% Heat 10% house), in prepared St. Louis, MO, USA), 7 µL/L µL/L 7 USA), MO, Louis, St. in vitro in hmcn Tmcl, CA, Temecula, Chemicon, in vitro in

Page 36of72 Page 37of72 After three weeks of growth, cells were labeled for labeled were cells growth, of weeks three After Assessing directed differentiation of D3 cells into cells D3 of differentiation directed Assessing differentiated. side cell Schwann the cell on ONLY used Schwann were strategies the to added were 2012) al., et (Bank our under antibody monoclonal functionblocking MIF Netherlands) Delft, Specs, bi (4IPP; phenylpyrimidine the either cells, celllike Schwann from release (Bank DHA M 5 and MIF DHA, M 5 and NGF DHA, M 5 suppleme DHA USA). MN, Elysian, Inc., Prep Nucheck 5 + Systems), (R&D µg/mL 1 (MIF) factor inhibitory Roth cells; neuronlike (sensory CA) MA, Billerica 0.1% porcine geltreated Primaria geltreated porcine 0.1% The 2012). al. et Bank 2004; Raz, and (Bianchi PBS 2 al., et (Germiller described previously as ears 2 Statoacousti (E1 embryos mouse mouse Balb/C from ganglia Statoacoustic primary of ganglion) (statoacoustic culture and Isolation (Kv3.1). channel potassium (Abcam, antibodies with expression protein channel t ICC reported previously our by labeled were cells microscope fluorescence sep in times three least inverted at conditions experimental Leica a on filters m light a with taken were Photomicrographs nucleus. DA and CA) (InVitrogen, dilution 1:200 at 590 Fluor foll dilution 1:500 at systems) (R&D NF150 antibody (S paraformaldehyde 4% in fixed were Cells (Sigma). tween20/pho 0.1% in (Chemicon) serum goat normal 5% Antibodi marker). differentiation (neuronal (NF150)

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. @ plates or 0.1% porcine gel coated glass cover slip cover glass coated gel porcine 0.1% or plates 004; Bank et al., 2012) and rinsed in rinsed and 2012) al., et Bank 004; arate experiments. The differentiated The experiments. arate expression of neurofilament marker neurofilament of expression echniques (Roth et al., 2007) for ion for 2007) al., et (Roth echniques et al., 2007); macrophage migration macrophage 2007); al., et s Ceio, A wr dltd in diluted were MA) (Chemicon, es PI (1:1000 dilution) stain for the cell the for stain dilution) (1:1000 PI at 0.1M (Shen et al., 2012) or the or 2012) al., et (Shen 0.1M at owed by secondary antibody Alexa Alexa antibody secondary by owed CA) to sodium channel (SP19) and (SP19) channel sodium to CA) ceia MF niio, 4iodo6 inhibitor, MIF ochemical neuron-like cells neuron-like whole ganglia were then plated on plated then were ganglia whole M ooaeani ai (DHA; acid docosahexaenoic M rvosy ecie conditions described previously of the device once the cells had had cells the once device the of igma), and treated with primary primary with treated and igma), 5.517.5) were isolated from the from isolated were 5.517.5) nted media included: CNTF and CNTF included: media nted icroscope or using appropriate appropriate using or icroscope eevi. hs MF blocking MIF These reservoir. W rpae ec st of set each repeated We . sphate buffered saline (PBS) saline buffered sphate et al., 2012). To block MIF block To 2012). al., et Gnla Neuron Ganglia c s

nuae oengt o atcmn a 37 at attachment for overnight incubated F12 0.5ml of addition the with 2008) al., et (Roth ne sm cniin, h saocutc agi we (Bianchi aspreviouslydescribed neurons individual ganglia statoacoustic the conditions, some Under incubator overnight. overnight. incubator incu and media basal F12 with0.5mL plates (Falcon) o positioned were explants OC isolated and The unwound. held was base the forceps fine c Using basal labyrinth. the visualize to exposed was Corti of organ careful was labyrinth bony The microscope. surgical and dish mm 50 plastic new a to transferred and PBS and bone tem The removed. were temporal bone temporal the surrounding the expose to bisected were brain neo a using 6 removed was skin Day outer the and 2012). decapitated al., et (Bank described previously (20 al., et Parker of method the of modification A culture explant and Corti of Organ of Isolation withNaOH. 7.2 pH to buffered and glucose 16 KC 5 NaCl, 137 mM): (in contained solution external buffe and ATP, Na2+ 5 HEPES, 10 EGTA, 11 CaCl2, 0.1 co solution internal an with filled were Electrodes achi to FL) Sarasota, Instruments, Precision (World were electrodes Glass Devices). (Molecular software Data CA). Sunnyvale, Devices, (Molecular digitizer w amplifier 200B Axopatch an using temperature room processe long with morphology neuronlike bipolar a we recordings voltageclamp and current Wholecell recording cell whole neu mESC-derived of recordings Electrophysiological

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. 0 i a el utr icbtr ih % CO 5% with incubator culture cell a in C neuronal basal media (InVitrogen) and (InVitrogen) media basal neuronal 10) was used to isolate mouse OC as OC mouse isolate to used was 10) ntaining (in mM): 112 KCl, 2 MgCl2, 2 KCl, 112 mM): (in ntaining et al., 2005; Bank et al., 2012). 2012). al., Banket 2005; al., et eve an electrical resistance of 36 M. 36 of resistance electrical an eve bated at 5%CO2 in a tissue culture culture tissue a in 5%CO2 at bated l, 1.7 CaCl2, 1 MgCl2, 10 HEPES, 10 MgCl2, 1 CaCl2, 1.7 l, pulled from borosilicate capillaries borosilicate from pulled at made were recordings These s. the cochlea was removed under a under removed was cochlea the re performed on cells selected for selected cells on performed re ly separated and the apex of the the of apex the and separated ly were acquired using pCLAMP 9 9 pCLAMP using acquired were n 1% porcine gel coated Primaria coated gel porcine 1% n h O crfly eoe and removed carefully OC the cla fe te eoa o the of removal the after ochlea the and skull The blade. scalpel poral bone was rinsed in sterile sterile in rinsed was bone poral e iscae ad ltd as plated and dissociated re ith a Digidata 1200 or 1322A 1322A or 1200 Digidata a ith natal Balb/C mice were first first were mice Balb/C natal red to pH 7.2 with KOH. The The KOH. with 7.2 pH to red ron-like cells; patch clamp patch cells; ron-like the tissue and the bones bones the and tissue the 2 . Page 38of72 Page 39of72 i bbl frain t l sae o laig cell loading, of stages all at formation bubble Air overnight in order to promote attachment as as previou attachment promote to order in overnight w plates culture tissue Primaria coated gel porcine tissue SGN blade. scalpel a using minced was tissue t of modiolus the isolated, was explant OC the Once Gang Spiral and Ganglia primaryof Spiral Isolation to flow slowly into the main channel without produc without channel main the into slowly flow to pr and port, outlet the into wasinserted pipettetip positive under init formation hood bubble air prevent culture To contamination. tissue a in done was o and Assembly hydrophilic. was channel the that so subsequen and stud autoclaved were chambers microfluidic previous in used procedures sterilizing UV and wer equipment and reservoirs) as (used tips pipette microfluidi The Maintenance: and Preparation Device device microfluidic a cells neuron-like of differentiation Simultaneous ensuing analysis. ensuing devices dur or initially either bubbles/locks many air developed the of None microscopically. examined seeded into devices at a density of 10,000 cells/mL 10,000 of density a at devices into seeded mES seeding. cell before light UV under h 2 for gel preve thereby D tips. pipette of connection to due or evaporation device, the of top on medium) culture av were out bubbles Air the flow. gravitydriven into by tip chamber pipette L 1000 a inserting by PBS tubi and respe treatment, UV and plasma oxygen by sterilized chambers Microfluidic 2009). al., et (Park The microfluidic devices were designed according to according designed were devices microfluidic The

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. by the force of gravity; PBS was allowed wasallowed gravity; PBS of force bythe ing the course of the experiment or the the or experiment the of course the ing evices were coated with 0.1% porcine porcine 0.1% with coated were evices chwann cellells were trypsinized and and trypsinized were cellells chwann ith 0.5mL F12 media and incubated and media F12 0.5mL ith seeding and growth was carefully carefully was growth and seeding sly described (Bank et al., 2012). 2012). al.,et (Bank described sly e sterilized by the same autoclaving autoclaving same the by sterilized e and allowed to adhere overnight at overnight adhere to allowed and al, PS ouinfle 10 L 1000 solutionfilled PBS a ially, ing any air bubbles in the channel. the in bubbles air any ing ctively. Devices were prefilled with wereprefilled ctively.Devices he cochlea was cut in half and the and half in cut was cochlea he peration of the microfluidic system microfluidic the of peration oided by maintaining liquid (PBS, (PBS, liquid maintaining by oided nd Schwann cell-like cells in a a in cells cell-like Schwann nd lion Neurons Neurons lion ng were made hydrophilic and and hydrophilic made were ng e ad loig B t fl the fill to PBS allowing and let explants were placed on 0.1% 0.1% on placed were explants tly were oxygenplasma treated, oxygenplasma were tly e (ak t l, 09. PDMS 2009). al., et (Park ies tn bbl frain u to due formation bubble nting previous specifications (Fig. 1) 1) (Fig. specifications previous c device itself and all tubes, tubes, all and itself device c sue o rvn possible prevent to essure used in these experiments experiments these in used

t aiu tm pit drn te ek eid ce period, 3week the during points time various At CMO smlto ws efre t creae simu correlate to performed was simulation COMSOL A 37 COMSOL simulation simulation COMSOL myelination. of evidence any well as as device c celllike Schwann mESCderived the over extension der cells neuronlike the from outgrowth neurite of microfluidic the of sections 5 2008; of taken were images 2007, al., et Roth 1994; al., mark et a (Bodhireddy protein, basic myelin (c) and neurons, like” h putative a VgluT1, (b) neurofilament neurons, for marker general to antibody (a) either with labeled andmyelina differentiation type cell of Assessment onceevery replaced being reservoirs inlet and PEG soluble factors to the observed growth patterns in in patterns growth observed the to factors soluble n PG eevis wr icbtd t 37 at incubated were reservoirs, PEG and Devices 2009). al., et (Park inlets appropriate the dif cell Schwann or differentiation neuronal either mL 1 and channel outlet the at tubing to connected 1000 times greater than 0.06 than greater times 1000 en profile, developed fully a ensure To Materials). viscosity “Medium in described as measurements flow an µm/s) (1.4 inlets two the at set were velocities measuremen previous on based set were viscosity and 4.2 Multiphysics COMSOL into imported was geometry relevant soluble factors were analyzed by the dilut the by analyzed were factors soluble relevant lami separate two the of interface the at cytokines diffu allowed flow slow extremely the to due which, solve flow laminar A respectively. diameter, tubing o

Accepted Article CO 5% and C 2 We te EC ee ul atce, n soi pum osmotic an attached, fully were mESC the When . This article isprotected by copyright. All rights reserved. Re Developmental Dynamics D, where where D, John Wiley& Sons,Inc. Re o ad % CO 5% and C and D are Reynolds number of flow and and flow of number Reynolds are D and d outlet (2.8 m/s) based on volumetric on based m/s) (2.8 outlet d nar streams. Concentration profiles of profiles Concentration streams. nar ferentiation media were inserted into into inserted were media ferentiation device to observe the overall pattern overall the observe to device r was used to generate flow profiles, profiles, flow generate to used was r icuig soi pms n inlet and pumps osmotic including , e species transport model. Diffusion model. transport species e marker for mature “auditory system “auditory mature for marker rne n ei lnts ee e to set were lengths exit and trance 7 days. days. 7 vd rm h mS ad neurite and mESC the from ived ie iig f rwh atr and factors growth of mixing sive azr 21, 05. Fluorescent 2015). 2012, Salzer, l wr fxd ih % F and PFA 4% with fixed were lls ay hi poen 20D) a (200kDa), protein chain eavy er for Schwann cell myelination myelination cell Schwann for er ell lawns in the other side of the the of side other the in lawns ell tion in a microfluidic device device microfluidic a in tion pipette tip reservoirs containing containing reservoirs tip pipette h device. the measurement” (Supplemental (Supplemental measurement” (COMSOL, Inc.). Fluid density Fluid Inc.). (COMSOL, ae cnetain rfls of profiles concentration lated s n lmnr lw average flow laminar and ts 2 over three weeks with the the with weeks three over

Microfluidic device device Microfluidic was p Page 40of72 Page 41of72 Neurite measurement measurement Neurite and concentration profiles within the channel for s channel for the within profiles concentration and 3.1x10 sys mesh quad A respectively. similar), are weights al., et Lawrence NGF( and 2002) al., et (Culbertson cell body size before calculating the above paramet above the calculating sizebefore body cell T20029) documented: corporation, imaging (Universal ( grayscale background the above 50% were detection adjusted were thresholds Briefly, 2). and 1 (Figs. “neur of length and outgrowth neurite total measure http internet: the from (downloaded software ImageJ Coating a cochlear implant with hydrogel-encapsulat implant with cochlear a Coating ‘ex ‘method’ the exactlyusing werecomputed levels t using performed were tests tailed Single Matlab. MannW using analyzed were groups treatment between conditi all for n=8 (e.g. triplicate in minimum the data ImageJ and MetaMorph the of quantification For analysis Statistical ind are cells that the clusters mES of from extends numb cell to normalized be not could outgrowth mean measur neurite the representing size, pixel maximum analy to able were we software ImageJ or MetaMorph® t in 20x of magnification at taken were photographs weights: 1.5x10 weights: result previous match to selected were coefficients ihr h MetaMorph the Either vn huh erts xedd ny irmtr i t in micrometers only extended neurites though Even 7

Accepted Articlegenerated was mm 0.154 of size element maximum and

10 , 4.25x10 ,

This article isprotected by copyright. All rights reserved. 10 , and 1.27x10 and , © Nuie ugot Maueet porm r NIH or program Measurement” Outgrowth “Neurite Developmental Dynamics John Wiley& Sons,Inc. 10 m 2 teady laminar flow.laminar teady /s for MIF (Durand et al., 2009), DHA DHA 2009), al., et (Durand MIF for /s so that intensity levels for fluorescent fluorescent for levels intensity that so ividually indistinguishable. ividuallyindistinguishable. s for molecules with similar molecular similar with molecules for s he ranksum function and significance significance and function ranksum he Differences 2). Fig. in analyzed ons ers. he Leica inverted microscope. Using microscope. inverted Leica he act’ option. option. act’ tem with minimum element size of of size element minimum with tem 2009) (or CNTF, since molecular molecular since CNTF, (or 2009) ts ne avrey f conditions of variety a under ites” :/mgjnhgvi/ ws sd to used was s://imagej.nih.gov/ij/) . Settings were then optimized for optimized then were Settings . , all the experiments were run at run were experiments the all , ement in microns in length. The The length. in microns in ement MetaMorph® instruction manual instruction MetaMorph® ze the photomicrographs at the at photomicrographs the ze r bcue ert outgrowth neurite because ers ed Schwann cell-Like cells cell-Like Schwann ed iny tss efre in performed tests U hitney e irfudc device, microfluidic he to fully capture flow flow capture fully to

cod 0m CaCl 200mM icecold cochlea and cell – hydrogel whole the Then coating. implant cochlear the on mixture hydrogelcell cover mixture cell – hydrogel the in dipping by followed various inducing agents/cytokine. agents/cytokine. inducing various mESCde with studi or neurons culture ganglion spiral co or ganglion for used then was implant cochlear li the for (green Calcein for (In and cells) stained dead indicates stain were cells Live/Dead The the protocol. manufacturer’s using viability for survivabilit checked for tested was population cell enca cell Schwann Schwann the that observed we After 2007). medi cell Schwann with days two for grow to allowed (35m plate culture tissue a on placed was electrode modification of the method of Winter et al. (2007) al. et Winter of method the of modification order in hydrogel with coated was implant cochlear eemnd o e % oim liae n 20M calci 200mM and alginate sodium 1% polymerization. be to via cell” determined “Schwann for conditions Optimized 300mM). concentratio different with achieved polymerization 1 at SCs the encapsulating for used was which 2.0%, concent different g tested first had we gels culture alginate to concentration tissue hydrogel the (hydrogel) bring to alginate Novomatrix) Sodium 2% mL 1 Sch of mL 1 in resuspended was pellet cell The min. a cells/mL 10,000 to diluted and counted were cells trypsi and 2007) al., et (Roth procedures published fro differentiated were cells celllike Schwann The of the electrode. The electrode was initially dippe initially was electrode The electrode. the of ce Schwann if determine to microscope light a under

Accepted p and alginate with mixed thoroughly were cells The Article

2 This article isprotected by copyright. All rights reserved. ouin o 1 mn Oc plmrzto ws compl was polymerization Once min. 10 for solution Developmental Dynamics John Wiley& Sons,Inc. d in an icecold 200mM CaCl 200mM icecold an in d

and each implant was monitored daily monitored was implant each and rations of sodium alginate from 0.5 – 0.5 from alginate sodium of rations nized using 0.5% trypsin EDTA. The The EDTA. trypsin 0.5% using nized e el) Te cwn cl coated cell Schwann The cells). ve to support Schwann cell growth by a a by growth cell Schwann support to solution. This step was repeated to repeated was step This solution. m Falcon) and the encapsulated SC encapsulated the and Falcon) m up to 23mms up to 56 layers of of layers 56 to up 23mms to up mS floig u previously our following mESC m wann cell differentiation media and media differentiation cell wann ns of calcium chloride (50mM – – (50mM chloride calcium of ns ll growth was limited to the vicinity the to limited was growth ll 0,000 cells/mL. We also tested gel tested also cells/mL. We 0,000 d etiue a 10RM o 5 for 1000RPM at centrifuged nd r implant setup was placed in an in placed was setup implant r . h ecpuae cls were cells encapsulated The y. um supplementation (Roth et al., et (Roth supplementation um 1%. To optimize cell growth in in growth cell optimize To 1%. tiim ooie (orange homodimer Ethidium rived “neurons” induced by the the by induced “neurons” rived es with primary statoacoustic statoacoustic primary with es slto ws ucsfl the successful, was psulation iiy n gl imes were firmness gel and bility vitrogen, CA) following the the following CA) vitrogen, rade (Pronovo SLG100, SLG100, (Pronovo rade laced in an ice bath. The The bath. ice an in laced m hoie o gel for chloride um 2 solution, t, the ete, Page 42of72 Page 43of72 explant using a live cell imaging station Delta vi Delta station imaging cell live a using explant d 24 for imaging lapse time live in monitored also moni inter neuron ganglion spiral were and implant) (cochlear implant cochlear usin intervals hr 24 at bare taken were photomicrographs or neurite implant and outgrowth cochlear Neurite explant. SG the from cochlear cell”encapsulated “Schwann the pl or implant gelcoated porcine 0.1% the to attachment strong implant, (ES)-cochlear implant and (Schwanncell-co and implant (ES)-cochlear implant, spira or cells neuron-like MIF-induced of Coculture ta were microscope. fluorescence Photomicrographs CA). 488conjug (Invitrogen, Fluor antibody Alexa by followed antibody primary m primary as marker neurofilament by followed 4%PFA perfo was stage” “end at ICC minutes. 20 every dish mode timelapse in taken were photomicrographs and day 5 for cells neuronlike differentiated the with cochlear coated cell celllike Schwann mESCderived monitor were implant cochlear cell”coated “Schwann Interaction betatubulin. III class neuronspecific end at and, micrography digital timelapse by both an days 5 for media basal F12 t with fed and cultured towards outgrowth neurite directional study to cm Prim Falcon 35mm same the in placed were described) Organ mouse weeks; 3 2 for coverslips glass coated “Schwann cell”-coated cochlear implants cochlear cell”-coated “Schwann explants, OC with cells- neuron-like of Cocultures

Spiral ganglion (mouse P3) explants were cultured a cultured were explants P3) (mouse ganglion Spiral ernlk cls ee ifrnitd rm E cell mES from differentiated were cells Neuronlike

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. s between the neuronlike cells and the and cells neuronlike the between s sion microscope in the Microscopy and Microscopy the in microscope sion s. Directional outgrowth was observed observed was outgrowth Directional s. ays post positioning of the ganglion the of positioning post ays actions and neurite outgrowth was was outgrowth neurite and actions stage, by ICC staining for TuJ1 for TuJ1 for staining ICC by stage, g a light microscope. Schwann cell Schwann microscope. light a g d neurite outgrowth was observed observed was outgrowth neurite d implant or bare cochlear implant cochlear bare or implant mln ws lcd c away cm 1 placed was implant rmed by fixing the preparation in preparation the fixing by rmed e agt O) Te el were cells The (OC). target he at various locations in the culture the in locations various at d n ra tm” y lcn the placing by time” “real in ed with bare cochlear implant or implant cochlear bare with f ot epat (rprd as (prepared explants Corti of t ad hn br cochlear bare a then and ate ated) cochlear implant implant cochlear ated) aria TC plate at a distance of 1 of distance a at plate TC aria ouse antibody followed by Tuj1 by followed antibody ouse l ganglia with bare cochlear cochlear bare with ganglia l e uig Lia inverted Leica a using ken ated anti mouse secondary secondary mouse anti ated contact with (Schwann cell) cell) (Schwann with contact wt MF n porcinegel on MIF with s lone for 2 days to promote promote to days 2 for lone oe fr dy and days 5 for tored

lapse images at 20 min intervals. The actual setup actual setup intervals. The min 20 at images lapse around revolve to programmed was camera The plate. differen visit to computer) (by assigned was camera Developme and Cell the of Laboratory Analysis Image publications. publications. usin 2011), al., et Chen in methods of modification e (Germiller methods published previously our using mark SGN“specific” of variety a of expression The expression marker SGN putative ofAssessment RTqPCR the PCR products was confirmed in Universityin the of wasconfirmed PCR products the contro nontemplate and transcriptaseminus reverse tre I DNase included Controls Biosystems). (Applied ampli and (Invitrogen), transcriptase reverse minus reversetranscri (Qiagen), kit mini RNeasy an using al., et Roth in (as lawns SC mESCderived on grown coc from d) or period; day 30 a over intervals day a DHA (+ cultures neuronal mESCderived c) ganglia; o sm o te o canl aaye i hr studie her in analyzed channels ion the of some for mar SGNspecific of identification for pairs primer Ro Dr. thank to disc extensive for University Rutgers Neuroscience, like would authors The 2010101926). (P Biotechnology) in (Microfluidics 5T32EB00558205 DE NIHT32 (KFB); (DRF) Foundation Research Deafness (NIH NIH NS (KFB)), the DC00643604A2 R01 and from 3R01DC00418408W12 grants by supported was work This Acknowledgements Total RNA was extracted from: a) whole statoacousti whole a) from: extracted was RNA Total

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. kers, as well as providing primer pairs pairs primer providing as well as kers, of the experiment is shown in Fig. 6. Fig. 6. in shown is experiment the of fied using SYBR Green based PCR based Green SYBR using fied g the primer pairs specified in those in specified pairs primer the g ussions and advice on the design of design the on advice and ussions Michigan’s DNA Sequencing Core. Core. Sequencing DNA Michigan’s ultures of mESCderived “neurons” “neurons” mESCderived of ultures e wt Sprcit I Ns H RNase II Superscript with bed ls during PCR). The sequences of sequences The PCR). during ls atment during RNA isolation) and and isolation) RNA during atment t al., 2004; Bank et al., 2012 and 2012 al., et Bank 2004; al., t lctos eetdy rud the around repeatedly locations t R), NSF DGE 0718128 (JBW, ID: (JBW, 0718128 DGE NSF R), ers was performed by RTqPCR RTqPCR by performed was ers 2008). Total RNA was extracted extracted was RNA Total 2008). s described above) at roughly 3 roughly at above) described s ; r See H Gen f the of Green H. Steven Dr. s; tl ilg Dprmn. The Department. Biology ntal h epat n cpue time capture and explant the /NIDCD 2RO1DC0418404, 2RO1DC0418404, /NIDCD 007057 (TEAM) (PR); NIH NIH (PR); (TEAM) 007057 i Dvs Dprmn of Department Davis, bin c ganglion; b) whole spiral spiral whole b) ganglion; c

F (IOS 0930096 (KFB)); 0930096 (IOS F Page 44of72

Page 45of72 comment for approaches experimental additional labs for suggestions Takayama and Barald the of figures members the of some of redesign for computations, for Science Computer and Statistics of Departments D characteristics; stagespecific their and neurons the on discussions extensive for Iowa of University

Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. using microfluidics. microfluidics. using r. Ethan M. Jewett, UC Berkeley Berkeley UC Jewett, M. Ethan r. development of Spiral Ganglion Ganglion Spiral of development and for editing the manuscript; manuscript; the editing for and h saitcl td dsg and design study statistical the o te aucit and manuscript the on s

References • • • • • • • • • Bianchi LM, Daruwalla Z, Roth TM, Attia NP, Lukacs Attia TM, Roth Z, Daruwalla LM, Bianchi Bhatheja K, Field J (2006) Schwann cells:origins Schwann (2006) FieldJ K, Bhatheja Baehr M, Bunge RP (1989) Functional status status influen Functional (1989) RP M, Bunge Baehr BerminghamMcDonogh O, Rubel EW (2003) r cell Hair EW Rubel O, BerminghamMcDonogh Bampton ET, Taylor JS (2005) Effects of Schwann ce Schwann of Effects (2005) TaylorET,JS Bampton Altschuler RA, O'Shea KS, Miller JM (2008) ce Stem (2008) MillerJM KS, RA,O'Shea Altschuler Altschuler RA, Cho Y, Ylikoski J, Pirvola U, Magal U, Y, Pirvola YlikoskiRA,J, Cho Altschuler Bank, LM, Bianchi, LM, Ebisu, F, LermanSinkoff, D LermanSinkoff, F, Ebisu, LM, Bianchi, LM, Bank, Barald KF, Kelley MW. (2004). From placode to pola to placode From (2004). MW. Kelley KF, Barald Allen SJ, Barald KF. (2005). Immortalized mouse inn Immortalizedmouse (2005). KF. Barald SJ, Allen Annals of the New York Academy of 884:305 Sciences of New Academy the York of Annals ganglion neurons. JARO 6(4):35567. 6(4):35567. JARO neurons. ganglion de growth of the in promoting chemokines role for a 38:19951999. 38:19951999. journal bioc of international The regeneration. and ear development. Development, 131(17):411930. 131(17):411930. Development, development. ear Neurol 106:2740. 106:2740. Neurol cell su ganglion rat retinal adult support to cells way towards a sound future. Current opinion in neur Current opinion future. sound a waytowards cell neuritogenesis and survival. Journal of neurob of andJournal survival. neuritogenesis cell nerve replacement. Hearing research 242:110116. 242:110116. Hearingresearch replacement. nerve and regrowth of sensory nerves following deafferent sensory following regrowthof nerves and

Accepted1000). of in Faculty (Cited 4674. D inner avian ears. and mammalian developing the in a (MIF)acts Factor Migration Inhibitory Macrophage ( KF Barald, JA and Germiller, Koch, A, EM, Jewett, Ma Kanicki,A, J, Benson, Dolan, DF, AP, Chervenak, Co C, Sharples, BB, Holmes, Llewellyn,GN, L, Feng, Fl CR, Beck, Roth, TM, DL, P, Thompson, Ramamurthy, Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. rvival and axonal regrowth. Exp Exp regrowth. axonal rvivaland and role in axonal maintenance maintenance axonal rolein and E, Miller JM (1999) Rescue Rescue (1999) MillerJM E, hemistry & cell biology cell & hemistry iology 63:2948. iology63:2948. veloping statoacoustic statoacoustic veloping , Smiley, EC, Shen, Y, EC, Shen, , Smiley, 2012). The cytokine The 2012). obiology 13:119126. obiology13:119126. ation by neurotrophic factors. factors. byneurotrophic ation s a neurotrophin for neurons neurons neurotrophin s for a ces the ability of Schwann Schwann ability cesthe of NW, Richards AL, White IO, Richards NW, AL, White rization: new tunes in inner inner in new rization: tunes ll transplantation for auditory for lltransplantation er ear cell lines demonstrate lines demonstrate cell ear er utinhoBudd, J, Linn, SA, SA, J, Linn, utinhoBudd, evelopment 139(24):4666 evelopment ll secreted factors on PC12 on factors llsecreted rtin, C, Altschuler, R, R, Altschuler, rtin,C, 311. egeneration: winging our wingingour egeneration: ynn, MJ, Teller, RS, RS, MJ, Teller, ynn, Page 46of72 Page 47of72 • • • • • • • • • • • Bianchi LM, Raz Y (2004) Methods for providing the providing for Methods Raz Y (2004) LM, Bianchi Bodhireddy SR, WD Lyman, WK Rashbaum and KM Rashbaum and Weiden Lyman, SR, WK WD Bodhireddy Bodmer D (2008) Protection, regeneration and repla and regeneration Protection, (2008) D Bodmer Boomkamp SD, MO Riehle, J Wood, MF Olson and SC SC Ba and Olson MF J Riehle, MO SD, Wood, Boomkamp Breuskin I, Bodson M, Thelen N, Thiry M, Nguyen L, N, Nguyen M, M, Thiry I,Thelen Bodson Breuskin Bunge R, Moya F, Bunge M (1981) Observations on thon Observations (1981) M F, Moya Bunge R, Bunge Bunge RP (1991) Schwann cells in central regenerat central in cells (1991)Schwann RP Bunge Bunge RP (1993) Expanding roles for the Schwann ce Schwann the roles for (1993)Expanding RP Bunge Bunge RP (1994) The role of the Schwann cell tr the in Schwann of role (1994)The RP Bunge Burns JC, Corwin JT. (2013). A historical to preseto A historical (2013). Corwin JT. JC, Burns Callizot N, M Combes, R Steinschneider and Poind and P Steinschneider R Combes, M N, Callizot 199. 199. DrugTargets Curr neurons. spiralganglion damaged neuropathology and experimental neurology53:1449. experimental and neuropathology spinal fetal human trimester in second myelination prote basic myelin of detection Immunohistochemical Med Wkly 138:708712. 138:708712. Med Wkly s treatment of future forthe implications cochlea: myelination. Glia 60:44156. Glia myelination. neur on ROCKinhibitors Rho and of effects additive cord spinal in of rat vitroa of model development progenitors and critical genes. Hear Res 236:110. 236:110. HearRes critical genes. and progenitors ce regenerate hair to Strategies (2008) B Malgrange 28:229242. 28:229242. B Adv in interactions. Schwann cellaxon secretion celli 633:229233. 633:229233. celli myelination, trophism and regeneration. Curr Opin N Curr Opin regeneration. and trophism myelination, regeneration. J Neurol 242:S1921. Neurol J 242:S1921. regeneration. regeneration?". Hear Res. 297:5267. 297:5267. Hear Res. regeneration?". mamma on the brakes puts "whatquestion: the answer

term in vitro model of myelination. Experimental ce Experimental myelination. of in vitro model term Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. ensorineural hearing loss. Swiss hearing loss. ensorineural injury demonstrating the the injurydemonstrating ntday account of efforts to to efforts of ntdayaccount ll research llresearch 317:237483. cord. Journal of Journal cord. ophic support and support ophic iochem Psychopharmacol Psychopharmacol iochem ite outgrowth and outgrowthand ite rapeutic agents treat to agents rapeutic cement of hair cells in the the cells in cement hair of lls: identification of of identification lls: PP, Lefebvre Belachew S, eurobiol 3:805809. 3:805809. eurobiol ion. Ann N Y Acad Schwann Schwann YN Acad Ann ion. in is a sensitive marker of of issensitive marker in a ron. (2011). A A long new (2011). ron. CNS Neurol Disord 3:195 Disord Neurol CNS

ll: ensheathment, ensheathment, ll: e role of Schwann cell cell roleSchwann of e lian haircell rnett. (2012). The The (2012). rnett. heim. (1994). heim.

• • • • • • • • • • Cao D, Kevala K, Kim J, Moon HS, Jun SB, Lovinger SB, HS, Jun Moon Kim J, K, Kevala D, Cao Chen W, Jongkamonwiwat N, Abbas L, Eshtan SJ, John SJ, Eshtan L, Abbas Jongkamonwiwat N, Chen W, Chen WC, Xue HZ, Hsu YL, Liu Q, Patel S, Davis Patel S, RL. Q, Liu Hsu YL, HZ, Xue Chen WC, Chen WC, Davis RL. (2006). Voltagegated and twop and Voltagegated (2006). Davis RL. Chen WC, Chen WC, Xue HZ, Hsu YL, Liu Q, Patel S, Davis Patel S, RL. Q, Liu Hsu YL, HZ, Xue Chen WC, Coleman B, Fallon JB, Pettingill LN, de Silva MG, SilvaMG, de LN, Pettingill JB, B,Fallon Coleman Corrales CE, Pan L, Li H, Liberman MC, Heller S, E Heller MC, S, Liberman Li L, H, Pan CE, Corrales Culbertson CT, Jacobson SC, Ramsey JM. (2002). Dif Ramsey (2002). JM. SC, Jacobson CT, Culbertson Davis RL, Liu Q. (2011). Complex primary afferents primary Complex (2011). Q. Liu DavisRL, de Felipe MM, Feijoo Redondo AF, GarciaSancho J, J, GarciaSancho AF, Redondo Feijoo MM, Felipe de synaptic function. Journal of neurochemistry 111:51 Journalneurochemistry of function. synaptic neuronal hippocampal promotes acid Docosahexaenoic progenitors. Nature. 490(7419):27882 Nature. 490(7419):27882 progenitors. E byhuman responses evoked auditoryof Restoration Rivo HD, Moore Marcotti PW, W, Andrews JK, Thurlow ganglion. Hearing Research, 278(12):52–68. 278(12):52–68. Research, Hearing ganglion. chan calcium voltagegated of patterns distribution channels in murine spiral ganglion neurons. Hearing neurons. spiralganglion in murine channels laryngologica, 127(1):8–12. 127(1):8–12. laryngologica, spiralgan in murine channels calcium voltagegated neurons. Exp. Cell Res. 313, 232–243. 313, Res. Cell Exp. neurons. the different promote cocultures explant cell hair 66, 1489–1500. 66, the into growth processes of trunk: nerve cochlear cellderived stem embryonic of differentiation and measurements in microfluidic devices. Talanta 56:36 Talanta devices. in microfluidic measurements about peripheral neural coding. Hear Res.276:3443. Hear neuralcoding. peripheral about t within phenotypes electrophysiologicallyrelevant

Histopathology. 26(7):92340. 26(7):92340. Histopathology. e to inner approaches genetherapy and (2011).Cell Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. iation of stem cells into bipolar cellsbipolar into stem of iation neural progenitor cells in the the in progenitor cells neural Shepherd RK. (2007).Auditory RK. Shepherd he spiral ganglion tells us us ganglion tells spiral he nel αsubunits in the spiral spiral in the αsubunits nel organ of Corti. J. Neurobiol. J. Corti. Neurobiol. organ of : What the distribution of the distribution : What 021. dge AS. (2006). Engraftment (2006). Engraftment dge AS. glion cells. Acta oto Acta cells. glion Research, 222(12):89–99. 222(12):89–99. Research, 573 573 ar repair. Histology & repair. ar

D, Kim HY. (2009). HY.(2009). Kim D, (2011). Complex (2011). (2007). Subunits of of Subunits (2007). Schimmang T, Alonso MB. MB. Alonso T, Schimmang oredomain potassium potassium oredomain fusion coefficient coefficient fusion Scellderived otic otic Scellderived lta MN. (2012). (2012). MN. lta development and and development son SL, Kuhn S, Milo M, M, Milo son S, Kuhn SL, Page 48of72 Page 49of72 • • • • • • • • • • Duran Alonso MB, FeijooRedondo A, Conde de Felipe Conde de A, MB,FeijooRedondo Alonso Duran Durand NF, E Saveriades and P Renaud. (2009). Dete (2009). Renaud. and P Saveriades NF, E Durand Géléoc GS, Holt JR. (2014). Sound strategies for h strategies for Sound (2014). HoltJR. GS, Géléoc Defourny J, Lallemend F, Malgrange B. (2011). Stru (2011). B. Malgrange F, Lallemend J, Defourny Evans AJ, Thompson BC, Wallace GG, Millard R, O'Le R, Millard GG, BC, Thompson AJ, Wallace Evans Germiller JA, Smiley EC, Ellis AD, Hoff JS, DeshmuJS, Hoff AD, EC, Ellis Smiley JA, Germiller Doetschman TC, Eistetter H, Katz M, Schmidt W, Kem KatzSchmidt M, H, Eistetter W, TC, Doetschman FloresOtero J, Xue HZ, Davis RL. (2007). Reciproc (2007). DavisXue RL. HZ, J, FloresOtero Gambarotta G, Fregnan F, Gnavi S, Perroteau I. (2 I. Perroteau Gnavi S, F, G,Fregnan Gambarotta Gingras M, Beaulieu MM, Gagnon V, Durham HD, Berth HD, Durham V, MM, Gagnon Beaulieu M, Gingras AS, GarciaSancho J, Rivolta MN, Giraldez F, Schimm J,F, Giraldez MN, Rivolta GarciaSancho AS, cells. Regenerative Medicine. 7(6):76983. 7(6):76983. Medicine. Regenerative cells. marrowderived bone sensorycells from ear inner of bioanalytical chemistry 394:4215. 394:4215. chemistry bioanalytical nanocha in a diffusion steadystate using formation 2014: 344(6184):1241062 344(6184):1241062 2014: Physiology. 301(4):C75061. 301(4):C75061. Physiology. American mammals. innervationin afferent cochlear biomedical materials research Part A 91:241250. 91:241250. A Part research materials biomedical polypyrrole/BDNFcoa using explants neuron ganglion neurite Promoting (2009) RT RK,Richardson Shepherd from mouse early embryonic inner ear. Dev231( Dyn. ear. inner earlyembryonic mouse from conditionally of characterization Molecular (2004). visceral yolk sac, blood islands and myocardium. J J and myocardium. islands blood yolksac, visceral ce stem embryonic blastocystderived of development Neurosci. 27: 1402314034. 27: Neurosci. ganglio spiral bipolar in proteins postsynaptic and regeneration. International Review of Neurobiology Review International of regeneration. applications potential and regulation cell Schwann

dimensional tissueengineered model. Glia 56:35464 Glia model. tissueengineered dimensional of motor and myelination migration axonal of study Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. n neurons by neurotrophins. J. J. byneurotrophins. neurons n immortalized cell lines derived derived cell lines immortalized to promote peripheral nerve nerve peripheral promote to earing restoration. Science. Science. earingrestoration. nnel. Analytical and and Analytical nnel. neurons in a in a three neurons Emb Exp Morph 87:27–45. 87:27–45. Morph Exp Emb . 108:22356. 108:22356. . 013). Neuregulin 1 role in role 1 Neuregulin 013). kh I, Allen SJ, Barald KF. KF. Barald SJ, Allen kh I, al regulation of presynaptic of regulation presynaptic al cture and development of of development and cture human mesenchymal stem stem mesenchymal human Journal of Physiologyof Cell Journal . 4):81527. 4):81527. ll lines: Formation of of Formation lllines: ted electrodes. Journal of of Journal electrodes. ted ang T. (2012). Generation Generation (2012). ang T. ler R. (1985). The in vitro in The (1985). R. ler cting proteins complex complex proteins cting ary SJ, Clark GM, GM, Clark arySJ, M, Carnicero E, Garcia Garcia E, Carnicero M, outgrowth from spiral outgrowth from od F. (2008). In vitro In (2008). F. od

• • • • • • • • • Greenwood D, Jagger DJ, Huang LC, Hoya N, Thorne P N,Hoya Thorne LC, Jagger Huang D, DJ, Greenwood Goodman I, Golden G, Flitman S, Xie K,XieMcConville S, G,Flitman I, Golden Goodman Holmes KE, Wyatt MJ, Shen YC, Thompson DA, Barald Barald DA, YC,Thompson MJ, Shen KE, Holmes Wyatt Grigoryan T, Birchmeier W. (2015). Molecular signa Molecular (2015). Birchmeier T, W. Grigoryan Han H, Myllykoski M, Ruskamo S, Wang C, Kursula P. C, S,Kursula MyllykoskiRuskamo Wang M, H, Han Golden KL, Pearse DD, Blits B, Garg MS, Oudega M, M, Oudega MS, B, Garg DD, Blits Pearse KL, Golden Heinen A, Kremer D, Hartung HP, Kury P. (2008). p5 (2008). Kury HP, P. D, Hartung Kremer A, Heinen Girard C, Bemelmans AP, Dufour N, Mallet J,Mallet Bachel N, Dufour AP, Bemelmans C, Girard Glenn TD, Talbot WS. (2013). Signals regulatingmy Signals (2013). Talbot TD, WS. Glenn Association 8:2130. Association spinal cord injury. Exp Neurol 207:203217. 207:203217. Neurol Exp injury.cord spinal axongrowth promote cells Schwann Transduced (2007) Schwann cell cycle control. Cell Cycle 7:27816. Cell cyclecontrol. cell Schwann Development 134:14071417. 134:14071417. Development the in development neuron ganglion spiral mediated P2X receptor (2007) GD. Housley AF,Ryan K, Pak BF, suspected Alzheimer's disease. Journal of the Ameri Journal of disease. Alzheimer's suspected me protein thread neural urine study of prospective (2007 P. Averback A, Minagar R, Richter Z, Lebedeva 10.3791/2466. 10.3791/2466. Jan 2011 Vis J Exp. development. ear inner affects byinjec otocyst into zebrafish the morpholinos MIF communication in the peripheral nervous system. Bio system. nervous the peripheral in communication 23(6):10418. 23(6):10418. Op Current injury.to cell response Schwann the and Biofactors. 39(3):233241 Biofactors. membrane of group structurally diverse A proteins:

Accepted Article 7933. spina mouse demyelinated the recovery of functional p 3transduced neurotrophin and factor neurotrophic F (2005)Grafts Lachapelle EvercoorenA, BaronVan

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. tion and electroporation electroporation and tion asurements in patients with in patients asurements interacting molecules. molecules. interacting ling mechanisms of axonglia of lingmechanisms 7;(47). pii: 2466. doi: doi: 2466. 7;(47). pii: elination in peripheral nerves in peripheral elination rimate Schwann cells lead to lead cells rimate Schwann inion in Neurobiology. in inion can Medical Directors Medical can M, Levy S, Zimmerman E, Zimmerman Levy M, S, neonatal rat cochlea. ratcochlea. neonatal l cord. J25:7924 Neurosci cord. l in C, NaitOumesmar B, NaitOumesmar C, in 7 kip2's role role beyond kip2's 7 essays. 37(5):50213. 37(5):50213. essays. of brainderived brainderived of Wood PM, Bunge MB MB PM, Bunge Wood ). A multicenter blinded blinded A multicenter ). (2013). Myelinspecific Myelinspecific (2013). signaling inhibits BDNF inhibits signaling and myelination after myelination and R, Wildman SS, King King SS, R, Wildman KF. Direct delivery of Direct of delivery KF. Page 50of72 Page 51of72 • • • • • • • • • • Hu Z, Ulfendahl M, Olivius NP (2004a) Central migr M,(2004a) OliviusNP Ulfendahl Z, Hu Hu Z, Ulfendahl M, Olivius NP (2004b) Survival of of Survival M,(2004b) OliviusNP Ulfendahl Z, Hu Hu Z, Ulfendahl M, Olivius NP (2005) NGF stimulate NGF M,(2005) OliviusNP Ulfendahl Z, Hu Houle JD, Ye JH (1999) Survival of chronicallyinj of (1999) Survival JH Ye JD, Houle Huang T, J Qin, S Xiong, L Yu, X Huo, H Liao, J Li Liao, J H X Huo, Yu, Xiong, S L Qin, J T, Huang Hurley PA. Crook JM. Shepherd RK. (2007). Schwann RK.Schwann (2007). JM. Shepherd Crook HurleyPA. Inaoka T, Nakagawa T, Kikkawa YS, Tabata Y, Ono K, Y,Ono Tabata YS, Kikkawa Nakagawa T, T, Inaoka Huang T, Qin JQ, Huo XK, Yu L, Xiong SH, Liu DY,LiuZ XiongSH, HuoJQ, L, Yu XK, Qin T, Huang micro the of Fabrication (2009). Ni. HC and SH Hsu Ito J, Endo T, Nakagawa T, Kita T, Kim TS, Iguchi Kim TS, Kita Nakagawa T, T, J, T, Endo Ito journal of surgery] 40:702707. surgery]of 40:702707. journal by treatment with neurotrophic factors. Neuroscienc factors. withneurotrophic bytreatment Brain research 1026:6873. 1026:6873. research Brain alon cells stem followingtransplantation embryonic 14. 14. inner ear rat the adult into implantation xenograft engineering. Part A 15:138190. 15:138190. A Part engineering. nerve conduits peripheral substrates as polylactide into the adult rat inner ear. Neurobiology of disea of Neurobiology inner ear. rat the adult into ganglionneuro root dorsal implanted from outgrowth Zhonghua wai ke za zhi [Chinese journal of surgery]of journal [Chinese zazhi wai ke Zhonghua inhibitory migration fact macrophage of [Expression 26(7):18131821. 26(7):18131821. cochlea. rat deafened the in phenotypes myelinating by Schwann cells after peripheral nerve injury] Zho injury] nerve peripheral after cells bySchwann inhibit migration contentmacrophage of in [Changes laryngologica 129:453457. 129:453457. laryngologica lossin hearing noiseinduced attenuates hydrogels hepatocyte of application (2009) Local J Ito A, Ido

related specialties 67:272275. 67:272275. specialties related for journal ORL; ear. the to inner application drug Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. . Experimental neurology185:7 Experimental . se se 18:184192. otorhinolaryngology and its its and otorhinolaryngology ured neurons can be prolonged prolonged can be neurons ured growth factor using gelatin gelatin using factor growth neuronal tissue tissue following neuronal and D Liu. (2002). D and Liu. F (2005) A new method for new for A method (2005) F and in vivo evaluation. Tissue Tissue vivo in evaluation. and nghua wai ke za zhi [Chinese za wai ke nghua zhi[Chinese g the adult auditory nerve. adult gthe ation of neuronal tissue and and neuronaltissue of ation or mRNA in Schwann cells]. Schwann cells]. in or mRNA grooved/microporous grooved/microporous guinea pigs. Acta oto Acta pigs. guinea e 94:929936. e 94:929936. 40:699701. 40:699701. s extensive neurite extensive s European J. Neuroscience. J. Neuroscience. European ory factor secreted secreted oryfactor ns following transplantation ns followingtransplantation hong SZ. (2002) SZ. hong Yoshida M, Tsubouchi H, H, M, Yoshida Tsubouchi cells revert to non torevert cells

• • • • • • • • • • • Jarjour AA, Zhang H, Bauer N, FfrenchConstant C, N, FfrenchConstant Bauer H, Zhang AA, Jarjour Ito K, Yoshiura Y, Ototake M, Nakanishi (2008). Nakanishi T. M, Y,Ototake K,Yoshiura Ito Jhaveri SJ, Hynd MR, DowellMesfin N, Turner JN, S N, JN, Turner DowellMesfin MR, Hynd SJ, Jhaveri Jiang H, Sha SH, Forge A, Schacht J (2006) J Caspase Schacht A, Forge SH, Sha H, Jiang Khedr EM, Farghaly WM, Amry Sel D, Osman AA. (2004 Osman D, AA. Sel Amry Farghaly EM, Khedr WM, Jun SB, Hynd MR, DowellMesfin NM, AlKofahi Y,Ro AlKofahi NM, DowellMesfin MR, Hynd SB, Jun Kidd GJ, Ohno N, Trapp BD. (2013). Biology of Schw Biology(2013). of N, BD. Trapp Ohno GJ, Kidd Kondo T, Johnson SA, Yoder MC, Romand R, Hashino E Hashino R, Romand MC, Yoder Johnson SA, T, Kondo Kyritsis N, Kizil C, Zocher S, Kroehne V, J V, Kaslin S, Kroehne Zocher C, Kizil Kyritsis N, Landry TG, Wise AK, Fallon JB, Shepherd RK.(2011) Shepherd JB, AK, Fallon TG, Landry Wise Lawrence BJ, M Devarapalli and SV Madihally.(2009 SV and Devarapalli M BJ, Lawrence modeling of central nervous system myelination and and myelination central system nervous of modeling Comp. Immunol. 32, 664672. 32, Immunol. Comp. developmen for essential (MIF)is factor inhibitory effect on the differentiation of neural cells. cells. Biom neural of differentiation the on effect HEMA hydrogelc from factor nerve growth of Release hair cell death induced by kanamycin in vivo. Cell Cell vivo. in bykanamycin induced death cell hair breastfed and formulafed infants. Acta paediatrica Acta infants. and formulafed breastfed hydrogelcoated microelectrode arrays. J Neural Eng Neural J arrays. microelectrode hydrogelcoated using networks neural cultured of Modulation (2008) Clinical Neurology. 115:5579, 2013. 2013. 115:5579, Neurology. Clinical USA 102, 4789–4794. 102, USA stemcells.Pr pluripotent marrowderived bone from promote synergistically acid retinoic and hedgehog adult zebrafish brain. Science: 38(6112):13536. 38(6112):13536. Science: brain. zebrafish adult r initiatesthe inflammation (2012).Acute M. Brand treatment. Hearing Research. 282(1):303313. 282(1):303313. HearingResearch. treatment. cochlea follo deafened in the function survivaland

bioengineering 102:93547. 102:93547. bioengineering scaffolds engineering tissue containing bioreactors Accepted Article

acromolecules 10:174183. 10:174183. acromolecules , Freudenreich D, Iltzsche A, IltzscheA, D, Freudenreich , t of zebrafish, Danio rerio. Dev. Danio rerio. zebrafish, of t Death Differ 13:2030. Differ13:2030. Death wing chronic neurotrophic neurotrophic wingchronic Macrophage migration migration Macrophage egenerative response in the response egenerative 93:734738. 93:734738. . Biotechnology and Biotechnology . and sensory fate specification specification sensoryfate oc. Natl Acad. Schwann celli. celli. Schwann Natl Acad. oc. neurotrophin release from release from neurotrophin Williams A. (2012). In vitroIn (2012). A. Williams remyelination. Glia 60:112. 60:112. remyelination. Glia 5:203213. hain W, Ober CK (2009) Ober (2009) CK hain W, ann cells. Handbook ofHandbook cells. ann ). Flow dynamics in in Flow ). dynamics . Spiral ganglion neuron neuron ganglion Spiral . independent pathways of of independent pathways oated substrates and its its and substrates oated ysam B, Shain W, Kim SJ SJ Kim B,Shain ysam W, ) Neural maturation of of Neural ) maturation . (2005). Sonic Sonic (2005). . Page 52of72 Page 53of72 • • • • • • • • • • Liazoghli D, Roth AD, Thostrup P, Colman DR. Colman (2012 P, AD, Thostrup Roth D, Liazoghli Li H, Liu H, Heller S. (2003). Pluripotent stem ce Pluripotent (2003). S. H, Heller Liu H, Li Li H, Roblin G, Liu H, Heller S. (2003) Generation (2003) S. G,H, Liu Heller Roblin H, Li Li J, Zhang G, Liu T, Gu H, Yan L, Chen B. (2012) B.(2012) Chen L, Yan H, Gu Liu G, T, Zhang J, Li Liu Q, Chen P, Wang J. (2014). Molecular mechanism Molecular J. (2014). Chen P, Q, Liu Wang Mellado Lagarde MM, Wan G, Zhang L, Gigliello AR, AR, GiglielloL, Zhang G, MM, Wan Lagarde Mellado Mena MA, Garcia de Yebenes J. (2008) Glial a Glial J.cells (2008) Yebenes de MA, Garcia Mena Merkus P, Di Lella F, Di Trapani G, Pasanisi E, Be G,E, Pasanisi F, Lella Trapani DiDi P, Merkus Miller JM, Miller AL, Yamagata T, Bredberg G,Alts Bredberg Yamagata T, AL, Miller MillerJM, Monzack EL, Cunningham LL. (2013). Lead roles for roles for Lead (2013). LL. Cunningham EL, Monzack journal bringing neurobiology, neurology and psychi and neurobiology,neurology bringing journal the "good," the "bad," and the "mysterious" glia. T "mysterious" the the and "bad," "good," the neuroscience 3:9095. 3:9095. neuroscience Myel Studyto System Cell Culture Vitro New in a as ear. Nature Med. 9, 1293–1299 1293–1299 9, Med. Nature ear. 13495–13500. 13495–13500. Natl cells.Proc. stem embryonic of differentiation antitumor effects. Exp Ther Med. 4(3):442448. 4(3):442448. Med. Exp Ther effects. antitumor hTE and yCDglyTK gene suicide fusion the expressing 101. 101. sensory into cells h stem ear inner differentiating Natl. Acad. Schwann celli. 111(47):1691924. celli.111(47):1691924. Schwann Acad. Natl. he ensures ablation neonatal after cells supporting rege (2014).Spontaneous J,G. Corfas Zuo D, Bergles of OtoRhinoLaryngology. 271(1):313. 271(1):313. OtoRhinoLaryngology. of cases. illustrative review systematic and implants: contraindications and Indications (2014). M. Sanna and depolarization are effective in vivo. in Audiology are effective depolarization and deafness: after nerve auditory regrowththe of and

functions of inner ear supporting cells. Hear Res. Hear cells. supporting ear inner of functions Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. lls from the adult mouse inner inner adult mouse the from lls air cells. Dev Biol. 390(2):93 DevBiol. cells. air Acad. Schwann celli. USA 100, 100, celli. USA Schwann Acad. of hair cells bystepwise cells hair of 303:209. 303:209. he Neuroscientist : a review : a Neuroscientist he & neurootology 7:175179. 7:175179. neurootology & [Review]. European Archives Archives [Review].European ltrame MA, Zanetti D, Negri M, D, Zanetti MA, ltrame aring in the adult mouse. Proc. Proc. adult mouse. the in aring chuler RA. (2002) Protection RA.(2002) Protection chuler neurotrophins, antioxidants antioxidants neurotrophins, Construction of a novel vector vector a ofnovel Construction of auditory brainstem brainstem auditoryof atry 14:54460. atry14:54460. ination. ACS chemical chemical ACS ination. s players in parkinsonism: parkinsonism: in players s supporting actors: critical critical actors: supporting ). Substrate Micropatterning Micropatterning ).Substrate McInnis JJ, Zhang Y,Zhang JJ, McInnis neration of cochlear of neration s and potentials for for and potentials s RTshRNA and its RTshRNA

• • • • • • • • • • • Oshima K, Shin K, Diensthuber M, Peng AW,PengRicciAJ M, Diensthuber K, K, Shin Oshima Park JY, Kim SK, Woo DH, Lee EJ, Kim JH, Lee SH. ( SH. JH, Lee Kim EJ, Lee DH, SK, Kim JY, Park Woo Paino CL, FernandezValle C, Bates ML, Bunge MB. ( Bunge MB. ML, Bates C, CL,FernandezValle Paino Paivalainen S, Nissinen M, Honkanen H, Lahti O, Ka O, H, Lahti Honkanen M, S,Nissinen Paivalainen Pan GJ, Chang ZY, Schöler HR, Pei D. (2002). Stem D. Stem (2002). Pei HR, Schöler ZY,ChangGJ, Pan O'Leary SJ, Richardson RR, McDermott HJ. (2009b) P (2009b) HJ. McDermott RR, Richardson SJ, O'Leary Nishio Y, Nishihira J, Ishibashi T, Kato H, Minami H, Kato T, Ishibashi J, Y,Nishihira Nishio CellAxon I Schwann Roleof The (2015). U. Namgung O'Leary SJ, Richardson RR, McDermott HJ. (2009a) P (2009a) HJ. McDermott RR, Richardson SJ, O'Leary Nayagam BA, Muniak MA, Ryugo DK. (2011). The spira The (2011). Ryugo DK. Muniak MA, BA, Nayagam Nave KA, Werner HB. (2014). Myelination of the ner the of Myelination HB. (2014). KA, Nave Werner J Neural Eng 6:055002. Eng Neural J selectivity the improving for approaches biological stem cells. Cell 141, 704–716. 141, cells. Cell stem embryoni from cells hair celllike Mechanosensitive Cells 27:264654 27:264654 Cells chipgene a cells microfluidic in progenitor neural cells. J Neurocytol 23:433452. 23:433452. Neurocytol J cells. byimp promotion cord: ratspinal adult lesioned in 78. 78. cel and Molecular cell cocultures. ganglion/Schwann in mouse Myelination AM.Heape(2008). S, Peltonen transcription factor Oct4.Cell Res. 2002 Dec;12(56 2002 Res. Oct4.Cell factor transcription Journal of neural engineering 6:055002. 6:055002. neural engineering of Journal selectivity the improving for approaches biological cells. Mol Med. 2002 Sep;8(9): 50920. 50920. Sep;8(9): 2002 Med. Mol cells. th and nerve regeneration delay of induces antibody ner peripheral (MIF)in inhibitoryfactor migration Nerve Regeneration. Cells Tissues Organs. 200(1):6 Organs. Cells Tissues Regeneration. Nerve the peripheral and central auditory systems. Hearin centralsystems. auditory and peripheral the

Accepted Article& Development Cell Annual of Review functions. and

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. ve regeneration: antiMIF veregeneration: rated cytokine gradient. Stem Stem gradient. cytokine rated A. (2002). Role of macrophage macrophage of Role (2002). A. of cochlear implant electrodes. electrodes. implant cochlear of of cochlear implant electrodes. electrodes. implant cochlear of lants of cultured Schwann Schwann cultured of lants c and induced pluripotent pluripotent induced and c g Research. 278(12):220. 278(12):220. gResearch. ):3219. ):3219. vous system: mechanisms mechanisms system: vous e apoptosis of Schwann of eapoptosis lular neurosciences 37:568 neurosciences lular ngas SM, Peltonen J, SM, Peltonen ngas 12. 12. al Biology. 30:50333. 30:50333. Biology. al cell pluripotency and pluripotency cell and dorsal root root dorsal , Heller S. (2010). S. Heller , 1994) Regrowth of axons Regrowth of 1994) 2009) Differentiation of Differentiation 2009) nteraction in Peripheral in Peripheral nteraction rinciples of design and and designof rinciples rinciples of design and and designof rinciples l ganglion: connecting connecting ganglion: l Page 54of72 Page 55of72 • • • • • • • • • • Parker M, Brugeaud A, Edge AS. (2010) Primary cult (2010) AS. Edge A, Brugeaud M, Parker Parkins CW. (1985) The bionic ear: principles and and principles ear: bionic (1985) The CW. Parkins Pettingill LN, Minter RL, Shepherd RK. (2008)Schw RK. RL,Shepherd Minter LN, Pettingill Pettingill LN, Richardson RT, Wise AK, O'Leary AK, SJ, RT, Richardson LN, Wise Pettingill Pettingill LN, Wise AK, Geaney MS, Shepherd RK. (2 RK. Shepherd MS, AK, Geaney LN, Pettingill Wise Pfingst BE, Zhou N, Colesa DJ, Watts MM, Strahl SB Strahl MM, DJ, Colesa Zhou N, BE, Watts Pfingst Phan PA, Tadros SF, Kim Y, Birnbaumer L, G Housley Y,Birnbaumer Kim SF, PA, Tadros Phan Porrello E, Dina G, Panattoni M, Triolo D, Cerri D, M, F Triolo DinaG,Panattoni E, Porrello Ramekers D, Versnel H, Grolman W, Klis SF. (2012) (2012) SF. Klis Grolman Versnel H, D, W, Ramekers Reyes JH, O'Shea KS, Wys NL, Velkey JM, Prieskorn Prieskorn JM, NL,Velkey KS, O'Shea JH, Reyes Wys JoVE. JoVE. Corti. ofJourn organ the of murine electroporation prostheses. Neurosurgery 16:853865. Neurosurgery 16:853865. prostheses. Neuroscience 152:821828. 152:821828. Neuroscience ganglionne spiral promote neurotrophins express to upon findings in the auditory system. IEEE Trans Bi IEEE Trans auditory the system. in findings upon potenti neural prostheses: and factors Neurotrophic PLoS One 6:e18733. One PLoS treatment BDNF cellbased survival following neuron health for implant function. Hearing Research. 322: HearingResearch. implant function. for health (2015) Y,Zwolan TA. Raphael CL, Budenz KC, Leyzac Histochemistry and cell biology, 133(4):437–48. cell133(4):437–48. biology, and Histochemistry m in the expression channel ion of TRPC3 regulation Nervous System. 16 Supplement 3:S111S112. 3:S111S112. Supplement 16 System. Nervous neur peripheral dysmyelinating causes cells Schwann SC.( Previtali A, Quattrini R, ML, Pardi Feltri L, in the cochlea. Hearing Research. 288(12):1933. 288(12):1933. HearingResearch. cochlea. the in

12631. 12631. J in vivostudies. vitro and GDNF: in and withBDNF of expression transient cells after stem embryonic di neuronal Glutamatergic RA.(2008) Altschuler JM, Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. 2011). CSN5/Jab1 inactivation in inactivationin CSN5/Jab1 2011). , Del Carro U, Comi F, F, Comi U, Wrabetz Carro Del , al of visualized experiments : visualizedexperiments al of neurogenin 1 and treatment and treatment 1 neurogenin current status of cochlear cochlear statusof current 7788, 7788, Shepherd RK. (2007a) Shepherd al clinical applications based based clinical applications al omed Eng 54:11381148. Eng 54:11381148. omed . Neurosci. 28, 12622– Neurosci. 28, . ann cells genetically modified genetically cells modified ann uron survival vitro. in uron fferentiation of mouse of mouse fferentiation in the deaf guinea guinea pig. the deaf in ure and plasmid plasmid and ure ouse cochlea. cochlea. ouse , Garadat SN, SN, Schvartz, Garadat 011) Enhanced auditory Enhanced 011) Neurotrophins and their role role their and Neurotrophins opathy. J. Peripheral Peripheral opathy.J. DM, Wesolowski K, Miller K, DM, Wesolowski D. (2010). Developmental Developmental (2010). D. Importance of cochlear cochlear of Importance

• • • • • • • • • • Roth TM, Ramamurthy P, Ebisu F, Lisak RP, F, Bealmear Lisak Ebisu RamamurthyP, TM, Roth Roehm PC, Hansen MR. (2005) Strategies to preserve to Strategies MR.Hansen (2005) PC, Roehm Salzer JL. (2012). Axonal regulation of Schwann ce Schwann of regulation Axonal (2012). JL. Salzer Roehm PC, Xu N, Woodson EA, Green SH, Hansen MR. ( MR. SH, Green Hansen EA, N, Xu PC, Woodson Roehm Roth TM, Ramamurthy P, Muir D, Wallace MR, Zhu Y, MR, Zhu D, Muir RamamurthyP, Wallace TM, Roth Salzer JL. Schwann cell myelination. (2015). Col (2015). cell myelination. Schwann JL. Salzer Sato T, Doi K, Taniguchi M, Yamashita T, Kubo T, T T, Kubo T, Yamashita M, K, Doi Taniguchi T, Sato Shen Y, Thompson DL, Kuah MK, Wong KL, Wu KL, Linn KL, MK, Wu DL,Kuah Wong Y,Thompson Shen Shi F, Edge ASB. (2013) Prospects for replacement replacement for (2013)Prospects ASB. Edge F, Shi Shibata SB, Budenz CL, Bowling SA, Pfingst BE, Rap BE, Pfingst BowlingSA, BudenzCL, SB, Shibata formation. Glia, 55(11):112333. 55(11):112333. Glia, formation. cel Schwann in type 1 roleneurofibromatosis of the cell difSchwann of stemcell model embryonic mouse 13:294300. 13:294300. in otolaryngology Current opinion neurons. ganglion myelination. J. Peripheral Nervous System. 17 Supp 17 System. Nervous Peripheral J. myelination. 37(2): 376–387. 37(2): cal and channels sensitivecalcium voltage of types groneurite ganglion spiral inhibits depolarization 281(12):5664. 281(12):5664. cochlea the damaged in regeneration and maintenance expressing variable levels of neurofibromin. Dev Dy neurofibromin. of levels variable expressing cells and stem embryonic derivedfrom cells Schwann metabolite and hormone hormones of Influence (2008) in biology. 7(8):a020529, 7(8):a020529, biology. in 1091:224234. 1091:224234. mutatio carrying mice a in loss hearing Progressive rerio. Dev. Biol 363(1):8494. 363(1):8494. Biol Dev. rerio. developing the inne in a neurotrophin as (MIF)acts macrophage cytokine (2012)The KF. AC, Barald Chien

cells. Hearing Res. 297:106112. 297:106112. Res. Hearing cells. Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. wth via activation of multiple multiple of wthvia activation d Spring Harbor perspectives perspectives SpringHarbor d r ear of the zebrafish, Danio Danio zebrafish, the of ear r pain. Mol Cell Neurosci. MolNeurosci. Cell pain. n in the p75 gene. Brain Res Brain gene. p75 in the n l development and tumor and l development ll ensheathment and and llensheathment n. 237(2):51324. 237(2):51324. n. & head and neck surgeryand head & ohyama M. (2006) (2006) M. ohyama of auditory neurons by stem bystem auditory neurons of l 3:149.l ferentiation for studies of of studies for ferentiation on tumor cell lines cell tumor on hael Y. (2011) Nerve Y.(2011) hael s on the growth of growth of the on s or regenerate spiral spiral regenerate or Chang L, Barald KF. BaraldKF. L, Chang BM, Barald KF. (2007) A A (2007) BM,Barald KF. . Hearing Research. HearingResearch. . migration inhibitory factor inhibitory factor migration SA, Jewett EM, Shu JewettEM, SA, 2008) Membrane Membrane 2008) Page 56of72 Page 57of72 • • • • • • • • • • • Taupin P. (2011) Neurogenic drugs and compounds to compounds and Neurogenicdrugs (2011) P. Taupin Uauy R, Hoffman DR, Peirano P, Birch DG, BirchEE. DG, P, Birch DR, Peirano Hoffman R, Uauy Torisawa YS, Chueh BH, Huh D, Ramamurthy P, Roth T RamamurthyRoth D, P, BH,Huh Chueh YS, Torisawa Wan G, Corfas G, Stone JS. (2013). Inner Inner suppo ear (2013). JS. G,Stone Corfas G, Wan Wei Y, Gong K, Zheng Z, Liu L, Wang A, Zhang L, Ao L, Zhang A, L, Liu Z, Zheng K, Y,Wang Gong Wei Winter JO, Cogan SF, Rizzo JF. (2007) Neurotrophin (2007) RizzoSF, Cogan JO,JF. Winter Winter JO, Gokhale M, Jensen RJ, Cogan SF, RizzoSF,Cogan J RJ, M, Gokhale JO,Jensen Winter Wise AK, Fallon JB, Neil AJ, Pettingill LN, Geaney LN, Pettingill AJ, Neil JB, Fallon AK, Wise Wise AK, Fallon JB, Neil AJ, Pettingill LN, Geaney LN, Pettingill AJ, Neil JB, Fallon AK, Wise Wise AK, Hume CR, Flynn BO, Jeelall YS, Suhr CL, S CL, Suhr YS, Jeelall Flynn CR, BO, Hume AK, Wise Wissel K, Stover T, Hofmann NS,Chernajovsky Y,Da Hofmann K, Stover T, Wissel A, Lenarz T, Gross G, Hoffmann A. (2008)Fibroblast A. G, Gross Hoffmann T, Lenarz A, a compartmentalized microchannel device. Lab Chip. Lab device. microchannel compartmentalized a uniform of formation Efficient (2007). S. Takayama disorders. Central nervous system agents in medicin agents system nervous Central disorders. in visual and brain development. Lipids 36:885895. Lipids development. brain and visual in silent majority. Semin Cell Dev Biol. 2013 May;24(5 2013 DevBiol. Cell Semin majority. silent indirect coculture with Schwann cells in vitro. in Ce cells withSchwann coculture indirect ratofa like differentiation cell Schwann (2010). 563. 563. R Mater Biomed J electrodes. stimulating neural for Hydrogel Coatings. Mater Schwann celli Eng C Mater celli Eng Mater C Schwann Mater HydrogelCoatings. Neur Retinal Prosthesis: to the Applied Engineering Neural Survival. Neurotherapeutics. Survival. Neurotherapeutics. Neural Neur and Therapies Combining CellBased (2011a) RK. Experimental NeuroTherapeutics 8:774787. NeuroTherapeutics Experimental of journal : the survival. Neurotherapeutics neural neur therapies and Combining cellbased (2011b) RK.

Ther 18:11111122. 18:11111122. Ther resproutingin neuron ganglion spiral on expression local (2010) of Effects RT. RK,Richardson Shepherd Accepted Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. diposederived stem cells by cells stem diposederived ll proliferation 43:60616. 43:60616. llproliferation the American Society for Society for the American MS, Skinner SJ, Shepherd SJ, Skinner Shepherd MS, MS, Skinner SJ, Shepherd SJ, Skinner Shepherd MS, sized embryoid bodies using using bodies embryoid sized the deafened cochlea. Mol Mol cochlea. deafened the ):44859. ):44859. es B Appl Biomater 81:551 Biomater Appl es B otrophinEluting Polymeric Polymeric otrophinEluting

al chemistry 11:3537. 11:3537. chemistry al rting cells: rethinking the the rtingrethinking cells: mediated delivery of GDNF GDNF delivery mediated of eluting hydrogel coatings coatings hydrogel eluting ized neurotrophin gene gene neurotrophin ized (2001) Essential fatty acids acids fatty (2001) Essential Q, Gong Y, Zhang X.Y,Zhang Q, Gong 7(6):7706 7(6):7706 ly G, Sasse S, Warnecke S, Sasse Warnecke G, ly Biol Appl 28:448453. 28:448453. Appl Biol al prostheses to promote promote to prostheses al gro BE, O'Leary BE, gro SJ, F. (2008) Tissue Tissue (2008) F. treat CNS diseases and diseases CNS treat al Prostheses to Promote Promote Prosthesesto al M, Barald KF, Barald M,

• • • • •

• • • Yang L, Su J, Zhang X, Jiang C. (2008) Hypercapnia (2008) C. J,X,Jiang Zhang Su L, Yang Yang T, Kersigo J, Jahan I, Pan N, FritzschB.(20 N, I,Pan Jahan KersigoJ, T, Yang Zhang H, Yang R, Wang Z, Lin G, Lue TF, Lin CS. (2 CS. Lin G,Lue TF, Lin R, Z, Yang H, Wang Zhang Zhang X, Zeng Y, Zhang W, Wang J, Wu J, Li J. (200 Li J. J, J, Y,Zhang Wu X,Zeng Wang W, Zhang Zhang YQ, Zeng X, He LM, Ding Y, Li Y, Zeng YS. (2Y,Zeng YS. DingY,Li X,He LM, Zeng YQ, Zhang Yang IH, Gary D, Malone M, Dria S, Houdayer T, Bel T, S,Houdayer Dria M, Malone GaryD, IH, Yang Zhong SX, Liu ZH. (2004). Immunohistochemical loca Immunohistochemical ZH. (2004). Liu SX, Zhong Xie D, Hu P, Xiao Z, Wu W, Chen Y, Xia K. (2007). (2007). Chen Y,K. Xia Z, Xiao P, W, Hu Wu D, Xie 160:14759. 160:14759. Respirat neurons. brainstem cultured of interaction Corti. Hearing Research. 278(12):2133. 278(12):2133. Research. Hearing Corti. connecting them and ganglion neurons spiral making regeneration. The journal of sexual medicine medicine 8:437 sexual of journal The regeneration. withneurotrophic cytokine CXCL5 cells secrete stem compartmentalized cell culture platform. Neuromolec platform. culture cell compartmentalized sti electrical and Axon myelination (2012) N. Hakor cord. Journal of Neurotrauma 24:18631877. 24:18631877. Neurotrauma of Journal cord. c Schwann and NT3overexpressing stemcells neural differentiate into neuronlike cells in vitro.Anat in cells neuronlike into differentiate mesenchyma modified gene promote cells TrkC Schwann sodium channel in the rat inner ear. HearingResear ear. inner the rat in channel sodium 481. 481. cells.Otol PC12 in outgrowth neuronallike induces

Accepted Articlecells.A ganglion spiral in murine channels calcium

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. Schwann celli Int 85:6167. celli 85:6167. Int Schwann 11) The molecular basis of basis molecular The 11) cta Otolaryngol. 127(1):812. 127(1):812. Otolaryngol. cta ory physiology & neurobiology neurobiology & oryphysiology mulation in a microfluidic, amicrofluidic, in mulation ogy & neurotology 29:475 neurotology ogy & Subunits of voltagegated voltagegated of Subunits 46. 46. ch 193(12):1–8. ch 193(12):1–8. ular medicine 14:1128. 14:1128. ular medicine modulates synaptic synaptic modulates effects on cavernous nerve cavernous on effects egu V, McDonald JW, JW, V,McDonald egu 011) Adipose tissuederived tissuederived Adipose 011) 010) NT3 gene modified modified gene NT3 010) 7) Cotransplantation of Cotransplantation 7) to hair cells of the organ of organ of the of cells hair to lization of the of epithelial lization ells in transected spinal spinal in transected ells l stem cells to stemcellsl to Page 58of72 Page 59of72 Figure 1. Figure Figure 2 Figure 2009). al., et (Park dime channel chip and microfluidic (b) illustration cartoon of A (d) device. microfluidic the in cells of outgrowth directional the indicate (a) arrowsin any into spe not differentiate did apparently cells intermixing and most media withthe (those tworows cell” sectors “Schwann towardsthe (green) neurites differe neuronal show significant III) II, rows (I, cell myelinatio Schwann of –evidence Protein Basic (g kDa– neurites 150 neurofilament for wasstained in cartoon (b) the in as boxes depicted device the cells.. celllike Schwann and neuronlike both into and in Shen et al., 2012). 2012). inal., et Shen and MIF inhibi biochemical withthe weretreated device cell “Schwann differentiated the conditions, these the derived from cells” “Schwann Neuregulininduced cellderivedS Stem = Embryonic ESSC device. the of c (D3) stem embryonic mouse =undifferentiated mESC fiel photographed 10 of a minimum using experiments th for software or ImageJ MetaMorph® using measured l cell” “Schwann the over and towards directionally celllike withSchwann cocultured cells neuronlike the mi in DHA without withand factors neurotrophic studies (Bank et al., 2012). al., (Bank et studies antibody( antiMIF a offunctionblocking addition . Neurite measurements of the neuronlike cells dif cells the neuronlike of Neurite measurements .

Accepted Articlethon seeded cells (mESC) stem embryonic mouse The

Developmental Dynamics John Wiley& Sons,Inc. FIGURE LEGENDS LEGENDS FIGURE

ntiation as well as directional outgrowth of of outgrowth directional aswell as ntiation the microfluidic device. The gradient gradient device.flow The the microfluidic cific lineage (IV and V). The white The (IV and V). lineage cific nsions depicted in (d) are adapted from adapted from inare (d) nsions depicted mES (c)Undifferentiated neurites. αMIF) as we had done in previous in done wehad as αMIF) (a) Photomigrographs of the areas of of the areas of Photomigrographs (a) lawns on the Schwann cell side of the the cell of side Schwann the on lawns were taken after the whole device device whole the after weretaken cells in the microfluidic device grew device microfluidic the in cells awn. Total process lengths were processlengths Total awn. tor 4iPP (as described in Methods Methods in (as described 4iPP tor crofluidic device. The “neurites” of “neurites” The device. crofluidic (those on the right). In the bottom the right).bottom the In (those on reen); Dapinucleus (blue); Myelin (blue); Dapinucleus reen); n (red). After 3 weeks, the top top three 3 After the nweeks, (red). least preserved gradients), the the least gradients), preserved mESC. ESSC +4iPP: under ESSC +4iPP: mESC. chwann cells; these are are these cells; chwann ds of view in each were used. wereused. view each ds of in ells on the “Schwann cell” side side cell” “Schwann the on ells 8 outgrowth; directional is ferentiated with different withdifferent ferentiated e device differentiated differentiated e device

undifferentiated conditions and F12 (basal) medium. (basal) F12 and conditions undifferentiated differentiation neuronal the in highlyupregulated mar neuronal auditoryof (d). Expression condition. M condition, differentiation NGF+DHA ND: condition, c differentiation DHA D: condition, differentiation N: condition, CNTF C: differentiation media, basal conditions under higher much are levels expression the all neuron in upregulated are cells neuronlike g marker neuronal mature of Expression (c). (D3ES). but not cells, neuronally differentiated in higher Ngn1,Neur cells. cells in genes neuronlike marker (con culture neuron spiral ganglion (SAG) ganglion: Undifferen cells.D3: mES from differentiated cells in undiffere expression OCT4 (a). cells neuronlike DHA alone: (mESC vs ESSC, p =0.0023; ESSC+4iPP vs E ESSC+4iPP p=0.0023; vs ESSC, (mESC alone: DHA wi groups treatment these amongst found differences Matlab. The in performed tests U MannWhitney using data these for Calculations Significance Figure 3. Figure x10 =7.7700 p vs αMIF ESSC, ESSC+ x10 p=5.4390 vs ESSC, (mESC alone: MIF =0.0052) p vs MIF ESSC, vs E ESSC+4iPP p=0.0050; vs ESSC, (mESC alone: NGF 5 x10 =1.5540 p vs ESSC, (mESC alone: CNTF x10 =5.4390 p vs αMIF ESSC, ESSC+ ; ESSC+ αMIF vs ESSC, p = 7.7700 x10 =7.7700 p vs αMIF ESSC, ESSC+ ; Differences between treatment groups and statistica and groups treatment between Differences

Acceptedin markergeneofexpression RTqPCRquantification Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. 4 5 ) ) 5 ) 4 ; ESSC+4iPP vs ESSC, p = 7.7700 x10 =7.7700 p vs ESSC, ESSC+4iPP ; 4 detected in undifferentiated condition condition in undifferentiated detected ; ESSC+4iPP vs ESSC, p =7.7700 x10 =7.7700 p vs ESSC, ESSC+4iPP ; ondition, CD: CNTF+DHA differentiation differentiation CNTF+DHA CD: ondition, conditions compared to compared conditions al differentiated conditions and conditionsand al differentiated tiated condition, statoacoustic statoacoustic condition, tiated NGF differentiation condition, M: MIF MIF M: condition, NGF differentiation neuronlike cells and ntiated mES kers, GabaAR, VgluT1 and SP19 are are SP19 and VgluT1 kers, GabaAR, oD and Nfil expression is much much is expression Nfil and oD trol). (b). Expression of proneural proneural of (b). Expression trol). VgluT1 expression is much higher much is expression VgluT1 Neuronal F12: addition. withDHA D: MIF+DHA differentiation differentiation MIF+DHA D: enes: TrkB, TrkC, Prph in the the in Prph TrkC, TrkB, enes: th p values as indicated below: values as indicated p th re were statistically significant werestatistically significant re l significance wereanalyzed significance l SSC, p = 3.1080 x10 p =3.1080 SSC, SSC, p =0.0015; ESSC+ α ESSC+ p =0.0015; SSC, the differentiated the differentiated 4 ; ; 5 ; ; Page 60of72 Page 61of72 Figure 5. Figure Fig.1. shown also is which RowII, devices(c multilabelled of images Merged (b) acid inhibitory migration MIF=macrophage factor; growth CNTF=ciliary basal medium, F12=the (green). VgluT1 (NFH) (red kDa Heavy 200 neurofilament for stained Microfluid the of in the midsection interact cells Figure 4. Figure 2012). al., et Shen al. et2012; Bank 2011; al., d ear’s first inner MIF the is given that expected, differe other the all than condition MIF+DHA the in current. outward maintained bya dominated andth cell wasthe depolarized, as got faster that byt dominated are steps voltage small to responses chan potassium nor sodium neither and levels normal ionicconditions were steps).The voltage the after capa residual a(although small protocol P/8 witha w currents capacity linear the of and most currents wer currents outward and maintained currents inward holding pote a from depolarization step to response Voltage dep cell. bipolar neuronlike in a currents times active response long with current outward and cellsES sh DHAtreated and MIF electrode. pipette werepatchcla morphology neuronal bipolar a having cell neuronlike differentiated groupof a of image neuro a as having cells identified of membrane cell rhoda fluorescent werefilled with ionic Electrodes

Patch clamp studies performed on the neuronlike c neuronlike the on performed studies clamp Patch

Accepted Articlec neuronlike as onset myelination of Observations

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. ic device Row II. The cultures were cultures The Row II. device ic ifferentiation “neurotrophin” (Holmes et (Holmes “neurotrophin” ifferentiation endent changes were seen in in seen changeswere endent as wereidentified that cells the s; e response to large steps was large steps to response e mine dye and used to patch clamp the clamp patch to and used dye mine set so that ENa and EK were at wereat EK and that ENa so set ntiation conditions, which was to be be waswhichto conditions, ntiation ere removed during data acquisition acquisition duringdata removed ere city transient is visible immediately visibleimmediately is citytransient nal morphology. b. Phase contrast contrast Phase b. morphology.nal ) Cartoon showing the location of of location the showing Cartoon ) ntial of –80 mV. Both transient transient Both –80 ofntialmV. owed voltage dependent inward dependent voltage owed ransient inward sodium currents currents inward sodium ransient voltagedependent demonstrating , factor; DHA=docosahexaenoic DHA=docosahexaenoic factor; ), Myelin Basic Protein (blue) and and (blue) Protein MyelinBasic ), mped using a fire polished glass a polished using fire mped e observed. The linear leak leak linear observed. The e nels were blocked, so the sothe wereblocked, nels neurotrophic factor; NGF=nerve factor; neurotrophic ells and Schwann celllike Schwann ells and ells induced by MIF. a. a. byMIF. induced ells

neurite outgrowth was seen when the statoacoustic g statoacoustic when the was seen outgrowth neurite channel. "blue" the of thismicrograph in “coats” cells celllike Schwann of nuclei the DAPIstained ganglionand statoacoustic the from processes/cells the (b) ph nuclei. celllike cell Schwann labelled at labelling of crescent blue implant. The cochlear extensive the labels (red) 580 (AlexaFlor antibody (Nfil) 150kDa Neurofilament for immunocytochemistry cell some (and days.Neurites 13 at(a) weretaken implant a cochlear the reached cell bodies neuronal 2week entire the over cinematography digital lapse coa cell withthe Interactions dish. culture tissue cochlear coated Schwann celllike the away from cm the the experiment of beginning the At culture. in a on layers hydrogel the cells in celllike Schwann Figure 7. Figure (d). (c) and both to image, applies fluorescence viabi checked then for and form encapsulated the in wh Schwann cells, withhydrogelencapsulated coated stain live the to AMwascalcein used and (orange) homod Ethidium cells. dead living from distinguish in pictured impant cochlear same the of micrograph bal a on layers hydrogel imgethe of contrast phase (a) implants cochlear both on layers 56 visiblein 2 weeks hydrogels for alginate sodium in electrodes celllike Schwann differentiated The studies animal withiridium electrode Platinum b. patients. human eight iridium cells:Platinum a. celllike Schwann Figure 6 Figure . Two types of cochlear implants coated withhydrog coated implants cochlear of types . Two

Acceptedstatoacous 12.5) (Eday mouse embryonic Neurites of Article

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. ts on the impants were followed by time bytime were impants followed the ts on ase contrast micrograph view of these view these of micrograph contrast ase No directional statoacoustic ganglion ganglion statoacoustic No directional array electrode of the type used in in type used the of arrayelectrode and (b). (c) Higher magnification magnification (c)Higher (b). and statoacoustic ganglion was placed 1 1 wasplaced ganglion statoacoustic the bottom represents the DAPI DAPI the represents bottom the ball type cochlear implant at 2 weeks weeks 2 at implant cochlear type ball are seen in blue within the the hydrogel within in blue seen are processes that had reached the reached that had processes a ball at the end of the type used in used type the of end the at ball a imer was used to stain dead cells cells dead stain to wasimerused cells were grown in layers on the the on layers in weregrown cells cells (green). The implant was implant The (green). cells bodies) were labelled by werelabelled bodies) l implant. (d) Fluorescence Fluorescence (d) implant. l period. The processes and some and processes The period. fter 45 days. These photographs photographs These days. 45 fter lity. The scale bar in (d), the the bar scale (d), in The lity. the implant (same field as (a). (c) (a). as (same implant field the ; Healthy Schwann celllike cells are cells celllike Schwann Healthy ; (c). Live/Dead staining was used to wasused (c).staining Live/Dead anglion explants were cocultured explants werecocultured anglion coated gel aporcine on implant protein marker and a secondary a and marker protein ich were maintained for 2 weeks weeks 2 for weremaintained ich els with encapsulated encapsulated with els tic ganglion interact with ganglioninteract tic Page 62of72 Page 63of72 Fig.6). 2012 al., et g primary spiral for wasdemonstrated also (as mice was seen outgrowth such lower No (at left) Corti of right) the form (approaching neurites fasciculated of wildOrgan withtype a cultured (green) tubulin MIFinduced (b) thatpaper). in (Fig. 6 2012, al., in separate wasdemonstrated also shown).This (not a towards was seen outgrwoth directional No left). a toward directionally neurites extensive extending prim a of image Polarized (a) culture. in explants cell neurite neuronlike MIFinduced from processes Figure 8. Figure cells. stem undifferentiated containing imp cochlear witha or implant cochlear bare witha

Accepted Article(m neurites ganglion spiral primary of Interaction

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. neuronlike cells stained with acetylated withacetylated stained cells neuronlike ary mouse spiral ganglion (right) ganglion spiral arymouse Corti explant for a week showed showed a week Cortifor explant growing towards the wildtype Organ wildtype Organ the towards growing wild type Organ of Corti explant (at (at explant Corti wildOrgan of type towards OC explants from MIFKO MIFKO from explants OC towards MIF knock out mouse Organ of Corti Corti Organ of mouse knock MIF out lant coated with hydrogel layerswith hydrogel coated lant anglion neuronal processes in Bank Bank in processes neuronal anglion s (b) with wild type Organ of Corti Corti Organ of (b) s type with wild experiments detailed in Bank et Bank et in detailed experiments ouse post natal day 3 (a) and (a) and 3 day post natal ouse

Accepted Article

Page 64of72 Page 65of72

Accepted Article

Page 66of72 Page 67of72

Accepted Article

Page 68of72 Page 69of72

Accepted Article

Page 70of72 Page 71of72

Accepted Article

Auditory neuronal neuronal Auditory markers markers markers markers neuronal Mature markers neuronal stage Early marker Cell Undifferentiated

AcceptedInne and General Assessing Pairs for 1Primer Table Article

orNAV1.1) orNAV1.1) (SP19 channel ion gated sodium Voltage (VgluT1) 1 transporter glutamate Vesicular AGAGGCAAAGGAAT TCGACAGCTGAAGGAAGAGA Prph Peripherin (Trkc) type 3 receptor kinase tyrosine Neurotrophicc TGTTCCTCGTCCTGAGAACT GCAAGGTTCTCCCATG AGGCTCCAGGGTTATGAGAT GGAATTCGCCAGTTTCCTGA Neurofilament NeuroD (GABA-AR) (GABA-AR) receptor A acid Gamma-aminobutyric C4 (Trkb) type 2 receptor kinase tyrosine Neurotrophicc AAAGTACCCTCC GAGCCGGCTGACAATACAAT Neurogenin1(Ngn1) OCT4

This article isprotected by copyright. All rights reserved. Developmental Dynamics John Wiley& Sons,Inc. AACCATCACGAGAAAGCCTG ACCATCTCCACCTCTGCTTA ACCATCTCCACCTCTGCTTA AACCATCACGAGAAAGCCTG ACCATAAACCACGGCATGAG CCGTGAAGCAGAGTTCAACA CCGTGAAGCAGAGTTCAACA ACCATAAACCACGGCATGAG CCATGATGGTGGAAACGGAT AGATGAGCTTGAGCACACAC AGATGAGCTTGAGCACACAC CCATGATGGTGGAAACGGAT ACCTTGCTGATCTCAAAGCC CCAAGCTCATGAACCCTGTT TCATCCTCAACGCCATGAAC TCACCTCTCTGCTGTCTTGA TCACCTCTCTGCTGTCTTGA TCATCCTCAACGCCATGAAC Differentiation Differentiation r Ear Specific Neuronal rSpecific Neuronal Ear

AGTCCAG AGTCCAG GAACCG GAACCG AACA AACA Page 72of