Bulletin OEPP/EPPO Bulletin (2019) 49 (2), 175–227 ISSN 0250-8052. DOI: 10.1111/epp.12575

European and Mediterranean Plant Protection Organization Organisation Europe´enne et Me´diterrane´enne pour la Protection des Plantes PM 7/24 (4)

Diagnostics Diagnostic

PM 7/24 (4) Xylella fastidiosa

Specific scope Specific approval and amendment

This Standard describes a Diagnostic Protocol for Xylella First approved in 2004–09. fastidiosa.1 Revised in 2016–09, 2018–04 and 2019–05.2 It should be used in conjunction with PM 7/76 Use of EPPO diagnostic protocols.

presence of the bacterium in Mediterranean plant species, for 1. Introduction example Nerium oleander and Polygala myrtifolia,inthenatural Xylella fastidiosa causes many important plant diseases such as and urban landscape of southern Italy, Corsica, along the Pierce’s disease of grapevine, phony peach disease, plum leaf Mediterranean coast in France and in the Balearic Islands and scald and citrus variegated chlorosis disease, and olive scorch mainland Spain (EPPO, 2018) constitutes an important change disease, as well as leaf scorch on almond and on shade trees in to its geographical distribution and also adds new host plants. urban landscapes, for example Ulmus spp. (elm), Quercus spp. The EFSA database (EFSA, 2018) includes 563 plant species (oak), Platanus sycamore (American sycamore), Morus spp. reported to be infected by X. fastidiosa, for 312 of which the (mulberry) and Acer spp. (maple). Based on current knowledge, infection has been determined with at least two different detec- X. fastidiosa occurs primarily on the American continent tion tests. These species cover hundreds of host plant genera in (Almeida & Nunney, 2015). A distant relative found in Taiwan 82 botanical families (61 botanical families when considering on Nashi pears (Leu & Su, 1993) is another species named only records with at least two different detection methods). The Xylella taiwanensis (Su et al., 2016). However, X. fastidio111sa list of hosts in Europe is regularly updated with the results of has also been confirmed on grapevine in Taiwan (Su et al., surveys (EU, 2019). 2014). The presence of X. fastidiosa on almond and grapevine in Xylella fastidiosa is a member of the family Xanthomon- Iran (Amanifar et al., 2014) was reported (based on isolation adaceae of the Gammaproteobacteria. The genus Xylella con- and pathogenicity tests), but so far strain(s) are not available. tains two species, X. fastidiosa and X. taiwanensis. There are The reports from Turkey (Guldur et al., 2005; EPPO, 2018), three formally accepted subspecies of X. fastidiosa, i.e. Lebanon (Temsah et al., 2015; Habib et al., 2016) and Kosovo fastidiosa, pauca and multiplex (Schaad et al., 2004), based (Berisha et al., 1998; EPPO, 1998) are unconfirmed and are con- on DNA–DNA hybridization data, although only two, sidered invalid. Since 2012, different European countries have fastidiosa and multiplex, are so far considered valid names by reported interception of infected coffee plants from Latin Amer- the International Society of Plant Pathology Committee on the ica (Mexico, Ecuador, Costa Rica and Honduras) (Legendre Taxonomy of Plant Pathogenic Bacteria (ISPP-CTPPB) (Bull et al., 2014; Bergsma-Vlami et al., 2015; Jacques et al., 2016). et al., 2012). Since that publication, several additional The outbreak of X. fastidiosa in olive trees in southern Italy X. fastidiosa subspecies have been proposed based on multilo- (Saponari et al., 2013; Martelli et al., 2016) and the common cus sequence typing (MLST) analysis (Scally et al., 2005; Yuan et al., 2010), including subsp. sandyi (on N. oleander; 1The use of names of chemicals or equipment in this EPPO Standard Schuenzel et al., 2005), subsp. tashke (on Chitalpa implies no approval of them to the exclusion of others that may also be tashkentensis; Randall et al., 2009) and subsp. morus (on mul- suitable. Temperatures given for refrigeration, freezing, growth cham- berry; Nunney et al., 2014a,b). Recently, a revision of the bers etc. are usually approximate. X. fastidiosa subspecies has been proposed (Marceletti & 2 As more experience with the diagnosis of Xylella fastidiosa will be Scortichini, 2016) based on comparative genomic analysis. gathered in the coming months, the EPPO Secretariat intends to sched- The bacterium colonizes two distinct habitats, i.e. the xylem ule a new revision of this Protocol at the next Panel on Diagnostics in Bacteriology in 2019. network of plants and the foregut of insects belonging to the

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 175 176 Diagnostics order Hemiptera, sub-order Auchenorrhyncha (Redak et al., organized as single layer biofilm in the foregut, cibarium and 2004), that feed on xylem fluid (Chatterjee et al., 2008). precibarium (Newman et al., 2003; Backus & Morgan, 2011) Transmission of X. fastidiosa by insects does not require an and do not systemically colonize the insect body. Nymphs lose incubation period in the vector and the bacterium is persis- infectivity with every stage as the foregut is renewed with tently transmitted (Almeida et al., 2005). Both nymphs and moulting. Newly emerged adults must feed on an infected adults can acquire the bacterium by feeding on the xylem fluid plant to become infectious. The bacterium is not transmitted of an infected plant and transmit the pathogen to healthy plants transovarially to the progeny of the vector (Freitag, 1951). immediately after acquisition. Xylella cells are typically However, once infected an insect can transmit the pathogen

Plant sample

Screening test(s) (1) Serological tests, ELISA (Appendix 1), DTBIA (Appendix 1), IF (Appendix 2), Convenonal PCR (Appendix 4)/ real-me PCR test (Appendices 5 to 9) /Isothermal amplificaon tests (Appendix 10 & 11) When two tests are performed they should be based on different biological principles or targeng different parts of the genome

Test(s) negave Inconsistent test At least two tests posive (2) results

Retesng and/or X. fasdiosa detected X. fasdiosa not Resampling detected recommended

Isolaon (Appendix 13)

Negave Posive

Aempt assignaon of subspecies At least two tests by molecular tests on plant extracts Serological tests IF (Appendix 2), DTBIA (Appendix (Appendices 14 to 17) 1) , ELISA(Appendix 1) Convenonal PCR (Appendix 4)/ real-me PCR test (Appendices 5 to 9) (3)

Subspecies X.fasdiosa undetermined idenfied in culture

X. fasdiosa detected Assignment of subspecies by (uncultured) subsp. molecular tests (Appendices 14 to 17) determined X. fasdiosa detected and pathogenicity tests (Appendices (uncultured) subspecies 18 & 19) (oponal, crical cases) undetermined

(1) A molecular test(s) should be performed for the detecon on asymptomac plant material Subspecies from a pest free-area undetermined (2) For tesng of symptomac plants from a known outbreak area or a buffer zone around X. fasdiosa an outbreak a single test including serological confirmed subsp. X. fasdiosa confirmed determined tests (e.g. ELISA) may be considered sufficient. subspecies undetermined For the condions see Secon 3.4 (3) Molecular tests for assignment of subspecies can be used for confirmaon of the idenficaon of X. fasdiosa

Fig. 1 Flow diagram for the diagnostic procedure for Xylella fastidiosa on plant material.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 177

VECTOR(S)

Screening test(s) - Convenonal PCR (Appendix 4)/ real-me PCR test (Appendix 5 to 8) /LAMP (Appendix 10) When two tests are performed they should be based on different biological principles or targeng different parts of the genome

Test(s) negave Inconsistent test At least two tests posive (1) results

Re-collecon of X. fasdiosa not insects in the same X. fasdiosa detected detected site recommended

Assignaon of subspecies (oponal) (2) by: • molecular tests (Appendices 14 to 17)

(1) For tesng of vectors from a known outbreak area or a buffer zone around an outbreak a single test may be considered sufficient. (2) There is lile experience with the assignment of subspecies from insect extracts based on the molecular tests described in Appendix 14 to 17. This is more difficult for insects than plant extracts due to low concentraon of bacteria and limited amount of DNA from a single insect.

Fig. 2 Flow diagram for the diagnostic procedure for Xylella fastidiosa on vectors. during its entire lifetime (Almeida et al., 2005). Winged appear to cause disease in many of these plant species. adults are the major means for spread. Colonization in many hosts is frequently asymptomatic Flow diagrams describing the diagnostic procedure for for a long time after inoculation and does not necessar- X. fastidiosa are presented in Figs 1 and 2. ily result in the development of disease (however, these plants can serve as a source of inoculum). There are also significant differences in susceptibility between 2. Identity hosts. Name: Xylella fastidiosa Wells et al. (1987) Taxonomic position: Bacteria, Gammaproteobacteria, Xan- 3.1. Disease symptoms thomonadales, Xanthomonadaceae. Symptoms depend on the combination of host plant and EPPO Code: XYLEFA X. fastidiosa strain. As the bacterium invades xylem vessels Phytosanitary categorization: EPPO A2 List no. 166; EU it blocks the transport of mineral nutrients and water. Gen- Annex designation I/AII as Xylella fastidiosa, IIAI as citrus erally, symptoms include leaf scorching, wilting of the foli- variegated chlorosis and IVAI as peach phony rickettsia. age, defoliation, chlorosis or bronzing along the leaf margin and dwarfing. Bacterial infections can be so severe as to lead to the death of the infected plants. The bronzing may 3. Detection intensify before browning and drying (Janse & Obradovic, As stated in the Introduction over 300 plant species are 2010). Symptoms usually appear on just a few branches but host to X. fastidiosa. However, the bacterium does not later spread to cover the entire plant. Depending on the

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 178 Diagnostics plant species or cultivar, the presence of yellow spots on leaves, chlorotic foliage, often together with pronounced yellow discoloration between healthy and necrotic tissues, irregular lignification of bark, stunting, premature leaf drop, reduction of production and dimension of fruits, fruit distor- tion, crown dieback or a combination of symptoms may occur. Symptoms can be confused with those caused by other biotic or abiotic factors (other pathogens, environmen- tal stresses, water deficiencies, salt, air pollutants, nutri- tional problems, sunburn etc.); illustrations of possible confusions can be seen at http://agriculture.gouv.fr/sites/mi nagri/files/xylella_fastidiosa_symptomes_et_risques_de_c onfusions_biotiques_et_abiotiques_dgal-1.pdf. Symptoms on various hosts can be seen at https://gd.e ppo.int/taxon/XYLEFA/photos as well as on https://www. ponteproject.eu/category/symptom-xylella/. Symptoms of Fig. 3 Leaf scorch symptoms on almond. Courtesy D. Boscia, CNR – diseases associated with X. fastidiosa in Europe and in the Institute for Sustainable Plant Protection (IT). Americas are presented below (in alphabetical order of dis- 3.1.3. Bacterial leaf scorch of blueberry ease name). The first symptom of bacterial leaf scorch of blueberry is a marginal leaf scorching (Fig. 4). The scorched leaf area 3.1.1. Alfalfa dwarf may be bordered by a darker band (Brannen et al., 2016). The main symptom is stunted regrowth after cutting. This In the early stages of disease progression, symptoms may stunting may not be apparent for many months after initial be localized, but over time symptoms can become uni- infection. Leaflets on affected plants are smaller and often formly distributed throughout the foliage. Newly developed slightly darker (often with a bluish colour) compared with shoots can be abnormally thin with a reduced number of uninfected plants, but are not distorted, cupped, mottled or flower buds. Leaf drop occurs, and twigs and stems have a yellow. The taproot is of normal size, but the wood has an distinct ‘skeletal’ yellow appearance (Fig. 5). Following abnormally yellowish colour, with fine dark streaks of dead leaf drop the plant dies, typically during the second year tissue scattered throughout. In recently infected plants the after symptoms are observed (Chang et al., 2009). yellowing is mostly in a ring beginning under the bark, with a normal white-coloured cylinder of tissue inside the yellowed outer layer of wood. Unlike in bacterial wilt caused by Clavibacter michiganensis subsp. insidiosus, the inner bark is not discoloured, nor do large brown or yellow patches appear. Dwarf disease progressively worsens over 1–2 years after the first symptoms and eventually kills infected plants. Noticeable dwarfing requires 6–9 months after inoculation in the greenhouse, probably longer in the field (http://alfalfa.ucdavis.edu).

3.1.2. Almond leaf scorch The most characteristic symptom of almond leaf scorch is leaf scorching followed by decreased productivity and general tree decline. Usually, a narrow band of yellow (chlorotic) tissue develops between the brown necrotic tis- sue and the green tissues of the leaves; however, when Fig. 4 Scorch symptoms of blueberry with distinct leaf burn the sudden appearance of leaf scorch symptoms is surrounded by a dark line of demarcation between green and dead prompted by hot weather the narrow chlorotic band may tissue. Courtesy P. M. Brennan, University of Georgia (US). not develop. As the disease progresses, affected twigs on branches die back from the tip (Mircetich et al., 1976). 3.1.4. Bacterial leaf scorch of shade trees Even highly susceptible varieties take many years to die, Symptoms of bacterial leaf scorch are similar on different but nut production is severely reduced within a few years tree hosts such as Acer spp., Cornus florida, Celtis in most varieties. occidentalis, Liquidambar strraciflua, Morus alba, Platanus Leaf scorching symptoms have been also reported on spp., Quercus spp. and Ulmus americana (Gould & almond in late summer/autumn in Italy (Fig. 3). Lashomb, 2007). In most cases the disease is identified by

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 179

Fig. 6 Citrus variegated chlorosis (CVC): typical spots caused on sweet orange leaves. Courtesy M. Scortichini, Istituto Sperimentale per la Frutticoltura, Rome (IT).

Fig. 5 Infected blueberry plants with yellow stems and a ‘skeletal’ appearance. Courtesy P. M. Brennan University of Georgia (US). a characteristic marginal leaf scorch where affected leaves have marginal necrosis and may be surrounded by a chloro- tic (yellow) or red halo. Generally, symptoms progress from Fig. 7 Small raised lesions appear on the underside of the citrus leaves. © older to younger leaves, and as the disease progresses USDA and University of Florida (US). branches die and the tree declines. Symptoms first appear in late summer to early autumn. Some plant species may be a hard ring and ripen earlier. The plants do not usually die, killed by the disease. More information and pictures of but the yield and quality of the fruit are severely reduced symptoms can be found in Gould & Lashomb (2007), (Donadio & Moreira, 1998). On affected trees of cv. Pera which is available online. and other orange cultivars, fruits often occur in clusters of

3.1.5. Citrus variegated chlorosis The first symptoms of citrus variegated chlorosis to appear on leaves are small chlorotic spots on the upper surface that correspond to small gummy brown spots on the underside of the leaf. Symptoms are most obvious on developed leaves independently of plant age and mainly on sweet orange cultivars (Figs 6 and 7). Affected trees show foliar interveinal chlorosis on the upper surface that resembles zinc deficiency. Sectoring of symptoms in the canopy occurs on newly infected trees. However, citrus variegated chlorosis generally develops throughout the entire canopy on old infected trees. Affected trees are stunted and the canopy has a thin appearance because of defoliation and dieback of twigs and branches. Fig. 8 Citrus variegated chlorosis (CVC): fruits are smaller and mature Blossom and fruit set occur at the same time on healthy earlier (left side) than fruits from healthy trees (right side). Small raised and affected trees, but normal fruit thinning does not occur lesions appear on the underside of leaves. Courtesy M. M. Lopez, on affected trees and the fruits remain small (Fig. 8), have Instituto Valenciano de Investigaciones Agrarias, Valencia (ES).

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 180 Diagnostics

4–10, resembling grape clusters. The growth rate of multiplex. However, a poor correlation was found between affected trees is greatly reduced, and twigs and branches the symptoms and the presence of X. fastidiosa. Since then, may wilt. Trees in nurseries can show symptoms of varie- X. fastidiosa subsp. multiplex has also been detected in gated chlorosis, as do trees aged over 10 years. Young trees olive in Spain. (1–3 years) become systemically colonized by X. fastidiosa More recently a new olive disorder, consisting of olive faster than older trees. Trees more than 8–10 years old are plants showing leaf scorching and desiccated branches (in- usually not totally affected, but rather have symptoms on cluding partial defoliation and shoot death) and associated the extremities of branches. with the presence of X. fastidiosa, has been reported in southern Italy (Saponari et al., 2013; Giampetruzzi et al., 3.1.6. Coffee leaf scorch 2015), Argentina (Haelterman et al., 2015) and Brazil Symptoms of coffee leaf scorch appear on new growth of (Coletta-Filho et al., 2016). The X. fastidiosa strains in all field plants as large marginal and apical scorched areas on these cases have been assigned to the subspecies pauca recently developed leaves (Fig. 9). Affected leaves drop (Saponari et al., 2017). In southern Italy, this new olive disorder has been termed ‘olive quick decline syndrome’. Olive quick decline syn- drome is characterized by leaf scorching and scattered des- iccation of twigs and small branches which, in the early stages of the infection, are mainly observed on the upper part of the canopy. Leaf tips and margins turn dark yellow to brown, eventually leading to desiccation (Fig. 11). Over time, symptoms become increasingly severe and extend to the rest of the crown, which acquires a blighted appearance (Fig. 12). Desiccated leaves and mummified drupes remain attached to the shoots. Trunks, branches and twigs viewed in cross-section show irregular discoloration of the vascular Fig. 9 Leaf scorch symptoms on Coffea sp. Courtesy M. Bergsma- elements, sapwood and vascular cambium (Nigro et al., Vlami, NPPO (NL). 2013). Rapid dieback of shoots, twigs and branches may be prematurely, shoot growth is stunted and apical leaves are followed by death of the entire tree. Xylella fastidiosa has small and chlorotic. Symptoms may progress to shoot die- also been detected in young olive trees with leaf scorching back. Infection of coffee plants by X. fastidiosa can also and quick decline. lead to the ‘crespera’ disease which was reported from There are limited data on X. fastidiosa infecting olive, Costa Rica (Fig. 10). Symptoms range from mild to severe but evidence indicates that different subspecies can infect curling of leaf margins, chlorosis and deformation of olive (subspecies pauca and multiplex). While X. fastidiosa leaves, asymmetry (see Fig. 10), stunting of plants and is associated with but does not cause disease in olive in the shortening of internodes (Montero-Astua et al., 2008). USA (Krugner et al., 2014), Koch’s postulates have been fulfilled in Italy (Saponari et al., 2016); pathogenicity data are not available from Brazil, Argentina or Spain. Nonethe- less, a strong correlation between leaf scorching symptoms and the presence of X. fastidiosa has been observed in three distant regions around the world (southern Italy, Spain,

Fig. 10 ‘Crespera’ symptoms on Coffea sp. including curling of leaf margins, chlorosis and deformation (asymmetry). Courtesy M. Bergsma-Vlami, NPPO (NL).

3.1.7. Olive leaf scorching and quick decline Xylella fastidiosa infections in olive were first reported by Krugner et al. (2014) in trees exhibiting leaf scorch or branch dieback symptoms in California (US), where infec- Fig. 11 Symptoms of quick olive decline syndrome. Courtesy D. tions were found to be associated with X. fastidiosa subsp. Boscia, CNR – Institute for Sustainable Plant Protection (IT).

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 181

Fig. 14 Symptoms in grapevine leaves caused by Pseudopezicula tracheiphila. Courtesy H. Reisenzein, AGES (AT). Fig. 12 Symptoms of quick olive decline syndrome. Courtesy D. Boscia, CNR – Institute for Sustainable Plant Protection (IT).

Argentina and Brazil) (Coletta-Filho et al., 2016; Landa, 2017).

3.1.8. Pierce’s disease of grapes On grapevine, the most characteristic symptom of primary infection is leaf scorch. An early sign of infection is a sud- den drying of part of a green leaf, which then turns brown while adjacent tissues turn yellow or red (see Fig. 13). The leaf symptoms can be confused with fungal diseases, in particular with Rotbrenner, a fungal disease of grape vines caused by Pseudopezicula tracheiphila (Fig. 14). The desic- cation spreads over the whole leaf causing it to shrivel and Fig. 15 Pierce’s disease of grapevine. Persistent petioles. Courtesy J. drop, leaving only the petiole attached (Fig. 15). Diseased Clark and A. H. Purcell, University of California, Berkeley (US). stems often mature irregularly, with patches of brown and green tissue. Chronically infected plants may have small, distorted leaves with interveinal chlorosis (Fig. 16) and shoots with shortened internodes. Fruit clusters shrivel. In later years, infected plants develop late and produce stunted chlorotic shoots. Symptoms involve a general loss of plant vigour followed by death of part of or the entire vine. Highly susceptible cultivars rarely survive for more than 2–

Fig. 13 Yellowing and desiccation of grapevine leaves and wilting of Fig. 16 Pierce’s disease of grapevine. Spring symptoms in cultivar bunches in the Napa Valley, California (US). Courtesy ENSA – Chardonnay (healthy leaf on the left). Courtesy A. H. Purcell, Montpellier (FR). University of California, Berkeley (US).

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 182 Diagnostics

3 years, although signs of recovery may be seen early in increasingly fewer and smaller fruits until, after 3–5 years, the second growing season. Young vines succumb more they become economically worthless. Fruits may also be quickly than mature vines. More tolerant cultivars may sur- more strongly coloured and will often ripen a few days ear- vive chronic infection for more than 5 years. lier than normal. Infected peach and plum trees bloom sev- eral days earlier than healthy trees and tend to hold their 3.1.9. Phony peach disease and plum leaf scald leaves later into the autumn. The leaves of infected peach On infected peach trees, young shoots are stunted and bear never display the typical leaf scorching seen on infected greener, denser foliage than healthy trees (Fig. 17). Lateral plum trees. Symptoms of plum leaf scald are a typical branches grow horizontally or droop, so that the tree seems scorched and scalded appearance (Fig. 18). Plum leaf scald uniform, compact and rounded. Leaves and flowers appear also increases the susceptibility of the tree to other prob- early and remain on the tree for longer than on healthy lems. Phony peach disease and plum leaf scald can limit trees. Early in summer, because of shortened internodes, the life of peach and plum orchards (Mizell et al., 2015). infected peach trees appear more compact, leafier and dar- ker green than normal trees. Affected trees yield 3.1.10. Other hosts: leaf scorching symptoms seen in other hosts in Europe For a general description of symptoms see Section 3.1 above. Besides olive, X. fastidiosa has been detected in different hosts under natural conditions in the current European out- break areas. Most of these findings refer to symptomatic plants, which display typical leaf scorching symptoms. A list of hosts in which X. fastidiosa has been detected in Europe is available and regularly updated at http://ec.europa.eu/food/ plant/plant_health_biosecurity/legislation/emergency_mea sures/xylella-fastidiosa/susceptible_en.htm. On oleander, necrosis typically develops on the leaf mar- gins (Fig. 19). As in olive, infections may lead to the death of infected plants. Polygala myrtifolia is one of the major susceptible hosts Fig. 17 Phony peach: typical ‘phony peach’ symptom on peach leaves in the current European outbreak. Infected plants show caused by Xylella fastidiosa. Courtesy M. Scortichini, Instituto scorched leaves, with desiccation starting from the tip and Sperimentale per la Frutticoltura, Rome (IT). progressing to the entire blade (see leaf tip desiccation in Fig. 20). An illustration of an infected plant is given in Fig. 21.

Fig. 19 Marginal leaf scorch symptoms caused by Xylella fastidiosa Fig. 18 Plum leaf scald: typical scorched symptom on plum leaf subsp. pauca on oleander. Courtesy D. Boscia, CNR – Institute for caused by Xylella fastidiosa. Reproduced from Mizell et al. (2015). Sustainable Plant Protection (IT).

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 183

Leaf scorching symptoms have been also reported on cherry (Fig. 22) in late summer/autumn in Italy.

3.2. Sampling of plant material and sample preparation in the laboratory 3.2.1. Sampling of plant material 3.2.1.1. Sampling period for symptomatic or asymptomatic plants. The concentration of the bacterium in a plant depends upon environmental factors, strains and the host plant species or cultivars. To maximize the likelihood of detection, sampling should be performed during the period of active growth of the plant (Hopkins, 1981). For tropical plant species grown indoors, such as coffee plants, sam- pling may be performed all year round. For outdoor plants Fig. 20 Symptoms on Polygala myrtifolia. Courtesy B. Legendre, in Europe this active growth period is usually from late Anses, Plant Health Laboratory (FR). spring to autumn. Details based on specific observations during current out- breaks in Europe are presented below (EU, 2015). (a) For Polygala spp., sampling can be performed from late spring to early autumn; (b) For O. europaea and N. oleander, observations con- ducted in Italy (Apulia region) indicated that: • withering, desiccation and leaf scorching symptoms associated with X. fastidiosa infections are more strongly expressed in summer, although persistent dur- ing the entire year • in some cases, symptoms were also observed during winter at the start of new vegetative growth; (c) For deciduous plant species (e.g. Prunus spp.) in Italy (Apulia region) symptoms were consistently recorded, together with a detectable bacterium concentration, in leaves collected during summer. Asymptomatic leaves collected earlier in the vegetative period from the same Fig. 21 Infected Polygala myrtifolia. Courtesy B. Legendre, Anses, trees tested negative whereas, as also shown in Spain Plant Health Laboratory (FR). (Alicante province), in the same period detection has been possible on 1-year twigs of almond trees (Rosello, pers. comm. 2019); (d) If necessary, dormant plants can be sampled by taking mature branches (e.g. woody cuttings), from which the xylem tissue is recovered and processed for detection of X. fastidiosa. Experience in temperate areas in other parts of the world shows that in grapevine or deciduous trees, e.g. cherry and almond, that have been infected for some time, the bac- terium is not detected into the new season’s growth until the middle of summer, when symptoms may also become visible. For example, the most suitable time for searching for symptoms in grapevine is late summer to early autumn when weather conditions are predominantly hot and dry or when grape plants are exposed to drought stress (Galvez et al., 2010).

Fig. 22 Leaf scorch symptoms caused by Xylella fastidiosa on cherry. 3.2.1.2. Sample collection. This section applies to sam- Courtesy D. Boscia, CNR – Institute for Sustainable Plant Protection pling in places of production and in consignments. Guid- (IT). ance on inspection is provided in PM 3/81 Inspection of

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 184 Diagnostics consignments for Xylella fastidiosa (EPPO 2016a) and 3.2.2. Sample preparation in the laboratory for plant mate- PM 3/82 Inspection of places of production for Xylella rial fastidiosa (EPPO, 2016b). ISPM 31 (IPPC, 2008) pro- Samples should be processed as soon as possible after arri- vides useful information on the number of plants to be val at the laboratory. sampled3. If the plant samples originate from areas where infected After samples are taken they should be sent to the labo- vectors may occur, it is recommended to check whether ratory as soon as possible. insects are present in the sample before opening the bags. As X. fastidiosa is confined to the xylem tissue of its If any insects are present, samples should be stored in the hosts, the petiole and midrib recovered from leaf samples refrigerator for approximately 12 h. are the best source for diagnosis as they contain a higher For isolation, samples may be kept refrigerated for up to number of xylem vessels (Hopkins, 1981). 3 days. For other tests, samples may be stored refrigerated However, other sources of tissue include small twigs and or frozen for up to 1 week before processing (Amden roots of peach (Aldrich et al., 1992), blueberry stem and et al., 2010). roots (Holland et al., 2014) and citrus fruit peduncles (Ros- Samples should be inspected for symptoms and, if pre- setti et al., 1990). sent, symptomatic leaves (including their petioles) should Samples for the laboratory should be composed of be selected and processed (removing the necrotic and dead branches/cuttings with attached leaves. The sample should tissue). If no symptoms are noted, leaves should be repre- include mature leaves. Young growing shoots should be sentative of the entire sample received in the laboratory. avoided. Dirty samples should be cleaned. For small plants the entire plant can be sent to the labo- For isolation, samples should be surface disinfected (see ratory. Section 3.6). For sclerotic leaves (e.g. Coffea) individual leaves and petioles can be sampled. 3.2.2.1. Laboratory sample. From the sample received, indications on the minimum number of leaves (including 3.2.1.2.1. Symptomatic plants—The sample should consist their petioles) to be used and the approximate weight of the of branches/cuttings representative of the symptoms seen laboratory sample are given in Tables 1 and 2 for compos- on the plant(s) and containing at least 10 to 25 leaves ite samples or individuals, respectively. depending on leaf size. Symptomatic plant material should The sample is processed according to the test to be used preferably be collected from a single plant; however, a as described in this protocol (see sections 3.4, 3.6 and 4). pooled sample may also be collected from several plants showing similar symptoms. 3.3. Sampling of vectors and sample preparation in the 3.2.1.2.2. Asymptomatic plants—For asymptomatic plants, laboratory the sample should be representative of the entire aerial Field-collected insects can be analysed to detect part of the plant. Recent experimental data on the detec- X. fastidiosa by molecular tests. Serological tests [enzyme- tion of X. fastidiosa in monumental and ancient olive linked immunosorbent assay (ELISA) and immunofluores- trees showed that detection was more reliable when sam- cence (IF)] are not sensitive enough, as the bacterium only pling the mid to upper part of the canopy. For testing colonizes the insect foregut where, in spite of its multiplica- individual asymptomatic plants, the number of branches tion, it is generally present at low levels (Purcell et al., to be collected is at least 4 to 10, depending on the host 2014). and plant size. Evaluations performed in the framework of XF- ACTORS, aiming at verifying the minimum amount of tis- 3.3.1. Sample collection sues to be collected from a plant to get consistent and reli- Adult vectors should preferably be collected with sweep- able detection, have provided detailed information ing nets (adults) or aspirators. Sticky traps are usually not regarding sampling procedures for many plants as presented as effective as active sampling for xylem feeders, but in Table 1 insects may be trapped accidentally, and specimens col- Research on sampling is still ongoing and further out- lected from sticky traps can be used for testing. A key to comes will be considered in a future revision of this Stan- the species of most European Aphrophoridae and Cercopi- dard. dae (except some Mediterranean species) is provided in Holzinger et al. (2003). A video on insect collection has been published by EFSA and is available at https://www. youtube.com/watch?v=Rjh7FFQCtg8. Identification keys with pictures to distinguish suborder Cercopoidea from 3ISPM 31 provides information on the number of units to be sampled, which is considered useful to determine sample sizes for both consign- Delphacidae and Cicadellidae are available online (Purcell ments and places of production. et al., 2014). An EPPO Diagnostic Protocol for Philaenus

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 ª 09OEPP/EPPO, 2019 Table 1. Guidance on sampling for lots of plants for selected species and tissue to be recovered when testing samples composed of large amounts of tissue* (e.g. composite samples from consignment/places of production)

Minimum no. of leaves/ shoots/stems to be No. of plants that Type of tissues to be Volume of extraction

ultnOP/POBulletin OEPP/EPPO Bulletin Host collected per plant can be pooled recovered Tissue to process buffer

Olive† 4 (leaves) Up to 225 Leaf midribs or petioles or Up to 20 g of leaf midribs/petioles/basal part 1:3 w:v leaf basal part can be processed as a single sample (about 800–900 leaf petioles), corresponding to up to 200–225** sampled plants Nerium oleander 2 (leaves) Up to 100 Leaf petioles Up to 20 g of leaf petioles can be processed 1:3 w:v as a single sample (about 200 leaf petioles), corresponding to up to 100 sampled plants Herbaceous plantlets 1 (plantlet) Up to 200 One portion of 1.5–2cmof Up to 40 g can be processed as a single 1:1 w:v or 1:1.5 w:v 49 stem/plant should be excised sample (this amount can be obtained by 175–227 , pooling the stem portions from approximately 200 sampled plants) – Polygala myrtifolia 2 (shoots) Up to 125 One portion of 1.5–2 cm for Up to 20 g of shoots (pieces of 1.5–2 cm) can 1:3 w:v each shoot should be excised be processed as a single sample (this amount can be obtained by pooling pieces of shoots from approximately 125 sampled plants) Lavandula spp.†† 2 (shoots) Up to 100 One portion of vegetative Up to 20 g of shoots (pieces of 1.5–2 cm) can 1:3 w:v shoots of 2.5–3 cm should be be processed as a single sample (this amount excised from each shoot can be obtained by pooling pieces of shoots from approximately 90–100** sampled plants) Prunus dulcis/Prunus avium 2 (shoots) Up to 100 0.1 g of xylem tissue to be Up to 20 g of xylem tissue corresponding to 1:3 w:v recovered from each shoot pooling pieces of shoots from approximately 100 sampled plants Coffea 2 (leaves) Up to 50 Leaf midribs or petioles or Up to 10 g (per sample or sub sample) 1:4 w:v leaf basal part (4) 7/24 PM

*The indications contained in this table are based on the data published by Bergsma-Vlami et al. (2017), for coffee; National Institute of Biology, SI; and Loconsole et al. (2018) for other plants. Validation data is available in the EPPO Diagnostic Database. †When sampling plants from a lot, at least four leaves per plant should be collected.

– fastidiosa Xylella Tests performed on leaves repeatedly failed to detect the bacterium. ††Leaves should be removed either by detaching them from the stem or by cutting out the leaf blade. **The range is calculated based on minimum and maximum weight of the plant portions (petioles/midribs or stem pieces) 185 186 Diagnostics

Table 2. Number of leaves (including their petioles) or other plant material to be used and approximate weight of the laboratory sample when testing individual plants

Minimum no. of Approximate leaves per weight of the Type of sample Host plants/type of tissue laboratory sample laboratory sample

Samples from plants with Basal parts of leaves of large size plants such 5 0.5–1g leaves (symptomatic or as Coffea spp., Ficus spp., Vitis spp., Nerium asymptomatic) oleander Basal parts of leaves of small size such as Polygala 25 0.5–1g myrtifolia and Olea spp. Plant species without petioles or with small petiole 25 0.5–1g and midrib Dormant plants or dormant Xylem tissue N.A. 0.5–1g cuttings Other cuttings Stem N.A. 1 g

spumarius, Philaenus italosignus and Neophilaenus (experiments conducted in France have shown that up to 15 campestris is in preparation. Philaenus spumarius can be pooled for detection of Vectors can be removed from the traps using small for- X. fastidiosa; Olivier, pers. comm. 2019). ceps/pincers and a suitable solvent such as vegetal xylene, For the loop-mediated isothermal amplification (LAMP) Bio-Clear (Bio-Optica, Milano, IT), kerosene or regular fuel test, single captured insects are used (see Appendix 10). (Purcell et al., 2014). After removal from the traps, insects should be rinsed in ethanol/acetone (95–99%). Traps should 3.4. Screening tests be serviced on a weekly basis. Sampling for insects should preferably be done from late Unlike in other EPPO Protocols for bacteria, isolation is spring until early autumn to maximize the likelihood of not recommended as a screening test because the bac- detection of the bacterium. terium in question is very difficult to isolate (see Figs 1 If insects cannot be processed immediately, they should and 2). Samples should be considered as ‘samples with be stored in 95–99% ethanol or at approximately 20°Cor X. fastidiosa detected’ when at least two screening tests 80°C. Sticky traps can also be stored at 20°C. are positive based on different biological principles or tar- geting of different parts of the genome. Subspecies assign- 3.3.2. Sample preparation in the laboratory for vectors ment by the molecular tests included in Section 4.2 and/or Since X. fastidiosa only colonizes the foregut and does not sequencing analysis should then be performed. Isolation systemically spread into the body, only the head of the insect should also be attempted. For areas where the pest is should be used for DNA extraction, thus avoiding the extrac- known to be present or in buffer zones (see below) one tion of several contaminants that may inhibit the enzymatic positive test is sufficient to consider a sample as ‘sample reactions (Purcell et al., 2014). In the previous version of this with X. fastidiosa detected’. In the case of conflicting Diagnostic Protocol a recommendation was made to remove results between two tests, retesting and/or resampling are the eyes as it could affect PCR sensitivity. An interlaboratory recommended. comparison was performed in 2017 where PCR tests were • Symptomatic plant material performed without removing the eyes of Philaenus Serological and molecular tests are both suitable for spumarius. No difference in sensitivity was noted (Legendre, screening of symptomatic plant material. pers. comm. 2018). However, it is recommended that the • Asymptomatic plant material eyes should be removed for larger vectors. (The report can be o Testing asymptomatic plants in a pest-free area accessed at https://upload.eppo.int/download/268obc05d There are limited experimental data available on testing 6355.) asymptomatic plant material. Consequently, the recommen- Before DNA extraction, it is imperative to remove the sol- dations given in this Protocol are derived from data on test- vent (ethanol/acetone). To achieve this, the insects can be ing symptomatic material and test performance studies. In transferred for a few minutes to a dry filter paper and may be most situations, the concentration of X. fastidiosa in further dried in a SpeedVac centrifuge to facilitate evapora- asymptomatic plant material is likely to be lower than in tion of the solvent. Total DNA can be extracted from single symptomatic plant material (Purcell & Saunders, 1999; (or pooled) insect heads following different procedures Almeida & Nunney, 2015). Consequently, molecular test(s) (Appendix 3). Experience in Italy on Philaenus spumarius should be performed for detection on asymptomatic plant shows that up to 5 insects can be pooled to perform one test material.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 187

o Testing asymptomatic plants in other areas The tests listed in this section allow the detection of Testing for asymptomatic plants in an outbreak area or a X. fastidiosa regardless of the subspecies (tests specific for buffer zone around an outbreak often implies that a large subspecies are presented in Section 4). number of tests need to be performed. In such a situation, and given that the concentration of the bacterium is expected 3.4.2.1. Conventional PCR. The test based on Minsavage to be higher than in an area thought to be pest free, a single et al. (1994) is described in Appendix 4. test including serological tests (e.g. ELISA) may be per- formed. In serological tests in Italy in the outbreak area and 3.4.2.2. Real-time PCR. Several real-time PCR tests are the buffer zone around the outbreak area, 5% of the negative recommended and have been validated: samples are also tested using a molecular test. • a test based on Harper et al. (2010) (and erratum 2013) is described in Appendix 5 and can be used in simplex 3.4.1. Serological tests when testing plant material and duplex (Ioos et al., 2009) Serological tests developed over the years include ELISA when testing insects (Sherald & Lei, 1991), membrane entrapment immunofluo- • two tests based on Francis et al. (2006) and described in rescence (MEIF) (Hartung et al., 1994), dot immunobinding Appendix 6 assay (DIBA), Western blotting (Lee et al., 1992; Chang • the real-time PCR test of Ouyang et al. (2013) described et al., 1993) and IF (Carbajal et al., 2004). in Appendix 7 Direct tissue blot immunoassay (DTBIA) was recently • the real-time PCR test of Li et al. (2013) described in reported as an alternative rapid screening test for the detec- Appendix 8 tion of X. fastidiosa in olive samples (Djelouah et al., • triplex real-time PCR of Bonants et al. (2019) is 2014). Recommended kits and performance characteristics described in Appendix 9 for DTBIA are given in Appendix 1. It should be noted that the analytical sensitivity of the Instructions for performing an ELISA (including tissue real-time test of Harper et al. (2010) is higher than the tests print, squash or dot ELISA) are provided in the EPPO Stan- based on Francis et al. (2006). In addition, the TaqMan dard PM 7/101 ELISA tests for plant pathogenic bacteria version of the Francis test does not detect some American (EPPO, 2010). Recommended antisera and validation data strains of X. fastidiosa; Consequently, it is recommended to are given in Appendix 1. perform the real-time test of Harper et al. (2010) first. Instructions for performing an IF are provided in EPPO Standard PM 7/97 Indirect immunofluorescence test for 3.4.2.3. Isothermal amplification tests. 3.4.2.3.1. LAMP— plant pathogenic bacteria (EPPO, 2009). For the IF test, it At the time of this revision LAMP is not widely used in should be noted that bacterial cells of X. fastidiosa might the EPPO region but has been successfully used so far out- not be equally distributed on the window of the IF slide side the EPPO region and in Italy to detect X. fastidiosa in because the cells remain clearly attached to the vascular different plant species (e.g. Citrus spp., O. europaea, system of the plant material. This should be considered Prunus dulcis, Quercus rubra, Vitis vinifera and Vitis when the slide is examined under the microscope (PM 7/ rotundifolia) and insects using standardized extraction pro- 97, point 4.1). Recommended antisera and validation data tocols (Harper et al., 2010, erratum 2013) or without prior are given in Appendix 2. extraction steps (Yaseen et al., 2015). In the EPPO region it is mainly used for the detection of X. fastidiosa in 3.4.2. Molecular tests insects. It can also be used for plants after DNA extraction Several molecular tests have been developed for (see Appendix 3). X. fastidiosa. Only those that are most commonly used in A test based on primers developed by Harper et al. the EPPO region or included in the IPPC Protocol on (2010, erratum 2013) is described in Appendix 10. X. fastidiosa (IPPC, 2018) are described in full. Molecular tests can be performed on plants and insects. Validation 3.4.2.3.2. Xf AmplifyRP XRT kit—The test developed by Li data is available for testing of plants. Some of these tests et al. (2016) can be used on plant extracts and cultures and have been used for detection in insects, validation data has is described in Appendix 11. been produced in the framework of the Euphresco PRO- MODE project. Although several PCR tests have been developed that 3.5. Additional tests effectively detect X. fastidiosa DNA in purified DNA Electron microscopy can be used to detect the bacterium in extract, a recurrent problem with some matrices is the pres- vessels in cross-sections of petioles (Cariddi et al., 2014). ence of inhibitors (Modesti et al., 2017). These effects may be overcome by adequate DNA extraction protocols and dilutions of the extract. 3.6. Isolation The procedures for extracting DNA from plants and Xylella fastidiosa is very difficult to isolate and grow in insects are described in Appendix 3. axenic culture, even from symptomatic plants. The

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 188 Diagnostics bacterium does not grow on most common culture media and requires specific media: PD2 (Davis et al., 1980), BCYE (Wells et al., 1981) or PWG (modified after Hill & Purcell, 1995) are widely used for the isolation from differ- ent host species. Culture media are described in Appendix 12. The use of at least two different media is recommended, in particular when isolation is attempted for new hosts or in the case of a first detection. Based on the experience of dif- ferent laboratories, PWG is considered the best isolation medium for samples from most plants. Samples from olive plants are best isolated on BCYE. It is very important to surface disinfect the sample to avoid growth of saprophytes because X. fastidiosa grows Fig. 24 Collection strain of Xylella fastidiosa subsp. fastidiosa ATCC very slowly (the colonies can take up to 28 days to be visi- 35879 on BCYE medium (size < 2 mm after 3 weeks). ble) and can be readily overgrown by other microorganisms in the plates. Procedures for isolation from plant material are presented in Appendix 13. As a control, whenever possible a suspension of a X. fastidiosa strain (see Section 5) at a concentration of about 106–107 cfu mL1 should be plated onto the same medium. Colonies are small, and depending on the strain the colony size is 1–1.5 mm in diameter after 1–3 weeks of incubation at approximately 28°C. Plates should be sealed or kept in plastic bags to prevent desiccation during incubation. • Colony morphology The colony morphology of X. fastidiosa is variable Fig. 25 Colonies of Xylella fastidiosa subsp. pauca strain CoDiRO (Davis et al., 1981; Chen et al., 2005). Colonies on the (ST53) on BCYE medium after 2 weeks. Courtesy M. Saponari, media recommended in this Protocol are as follows. Institute for Sustainable Plant Protection (CNR). (Other pictures of On all media, colonies are circular, smooth-edged and colonies are available in the EPPO Global database.) slightly convex. On PD2 and BCYE they are opaque and whitish (Figs 23 On modified PWG colonies are shiny and translucent. and 24, respectively). On BCYE they contrast with the They take the colour of the medium (light caramel) black (charcoal) medium (Fig. 25). (Figs 26 and 27).

Fig. 26 Xylella fastidiosa. subsp. fastidiosa isolated from Coffea Fig. 23 Colonies of Xylella fastidiosa subsp. fastidiosa on PD2 canephora on modified PWG medium (size < 2 mm after 3 weeks). medium (size < 2 mm after 3 weeks). Courtesy Anses.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 189

Instructions for performing ELISA are provided in EPPO Standard PM 7/101 ELISA tests for plant pathogenic bacteria (EPPO, 2010). Recommended antisera and valida- tion data are given in Appendix 1. Instructions for performing an IF test are provided in EPPO Standard PM 7/97 Indirect immunofluorescence test for plant pathogenic bacteria (EPPO, 2009). Recommended antisera and validation data are given in Appendix 2.

4.1.2. Molecular tests The following molecular tests can be used for confirmation of a pure culture.

Fig. 27 Xylella fastidiosa subsp. pauca isolated from Coffea arabica on 4.1.2.1. Conventional PCR. The test based on Minsavage modified PWG medium (size < 2 mm after 3 weeks) Courtesy Anses et al. (1994) is described in Appendix 4. (the background is a sheet of black paper below the plate).

• Cell morphology 4.1.2.2. Real-time PCR. The real-time PCR tests which are Under dark field microscopy, the bacterium has a rod-shaped recommended, and which have been validated, are as fol- appearance with the following dimensions: 0.2–0.35 lmby1–4 lows: lm. Under the electron microscope, X fastidiosa shows a char- The test based on Harper et al. (2010), described in acteristic rippled wall (Newman et al., 2003; Alves et al., 2009). Appendix 5. • Interpretation of isolation results Two tests based on Francis et al. (2006), described in The isolation is negative if no bacterial colonies with Appendix 6. growth characteristics and morphology similar to The real-time PCR test of Ouyang et al. (2013), X. fastidiosa are observed. Depending on the different sub- described in Appendix 7. species, colonies can be visible after 2–3 weeks but the The real-time PCR test of Li et al. (2013), described in plates should be observed for up 6 weeks. Appendix 8. The isolation is positive if bacterial colonies with growth The triplex real-time PCR test of Bonants et al. (2019), characteristics and morphology similar to X. fastidiosa are described in Appendix 9. observed within the above-mentioned period on at least one medium. The reference culture should also have been grown on the media used. The presumptive identification of 4.2. Molecular tests for the identification of X. fastidiosa colonies should be confirmed by serological or X. fastidiosa and assignment of X. fastidiosa sub- molecular tests (see Section 4). species

4. Identification and subspecies Although different tests are available for subspecies assign- determination ment, MLST analysis is recommended for new findings (i.e. a new outbreak or new hosts). MLST is described in For this fastidious pathogen, subspecies determination on plant Appendix 14 (Yuan et al., 2010). In other cases, subspecies extracts is performed after positive screening test(s) using assignment may be performed by subspecies-specific PCR-based molecular tests described in Appendices 14, 15, 16 molecular markers (Pooler & Hartung 1995, see and 17. Subspecies determination from insect(s) may also be Appendix 15; Hernandez-Martinez et al. 2006, see Appen- possible, although it is more difficult due to difficulties of dices 16 and 17) or Sanger sequencing. For Sanger amplification (low concentration of bacteria and limited sequencing the PCR product of at least two housekeeping amount of DNA available from a single insect). genes such as rpoD (Minsavage et al.,1994, see When a pure culture is obtained, the identification of X. Appendix 4) and malF (MLST analysis, see Appendix 14) fastidiosa should be performed using at least two tests, or cysG and malF (MLST analysis, see Appendix 14) based on different biological principles or targeting two dif- should be sequenced in both directions. The combination of ferent parts of the genome for molecular tests. Relevant at least two genes allows possible recombinants between tests are described below. subspecies to be detected. Sequence data can be analysed using the Basic Local Alignment Search Tool (BLASTN), X. fastidiosa 4.1. Identification of pure cultures as available at the National Center for Biotechnology Informa- 4.1.1. Serological tests tion (http://www.ncbi.nlm.nih.gov/). Serological tests can be used to identify a pure culture of In the case of atypical/new patterns MLST should be per- X. fastidiosa; however, these tests do not allow the assign- formed with data available in the pubMLST database for ment of subspecies. MLST genes (http://pubmlst.org/xfastidiosa).

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 190 Diagnostics

A phylogenetic tree can be prepared directly from the NCPPB, Fera, York (GB) NCBI server after BLAST analysis against the RefSeq Gen- Q-bank (http://www.q-bank.eu/) includes sequences of ome Database (Organism: Xylella fastidiosa taxid:2371) by MutS for properly documented species and strains present selecting the option ‘Distance tree of results’. With this in collections. option the sequence will cluster with the X. fastidiosa iso- lates showing closer phylogenetic identity and the sub- 6. Reporting and documentation species can be inferred. Alternatively, a dataset containing the target sequences Guidelines on reporting and documentation are given in retrieved from reference strains of different subspecies is EPPO Standard PM 7/77 Documentation and reporting on available (link to fasta file) and can be used to align the a diagnosis. sequences of the rpoD gene region amplified by the primers described by Minsavage. 7. Performance characteristics Another test for the assignment of subspecies pauca (CVC strains) is available (Li et al., 2013) but there is no When performance characteristics are available, these are experience with this test in the EPPO region. provided with the description of the test. Validation data is The tests described above have primarily been developed also available in the EPPO Database on Diagnostic Exper- on pure cultures but can be used on DNA from plants or tise (http://dc.eppo.int), and it is recommended that this insects, except for the multiplex PCR by Hernandez-Marti- database is consulted as additional information may be nez et al. (2006). However, it is recognized that the quan- available there (e.g. more detailed information on analytical tity and quality of target DNA, or the occurrence of specificity, full validation reports, etc.). possible mixed infections, may prevent all amplicons from Reports of test performance studies and proficiency tests being obtained or the clear assignment of subspecies. The performed in the framework of XF-ACTORS, PONTE, addition of bovine serum albumin (BSA) to the PCR mix PROMODE are available: improves the performance of the PCR (Yuan et al., 2010) EU-XF-PT-2017-02 ‘Proficiency testing for the evaluation for amplification of housekeeping genes. As stated before, of molecular and serological diagnosis of Xylella fastidiosa’ this is even more difficult for insects than plant extracts (https://upload.eppo.int/download/217o22631f22a), molecu- due to the low concentration of bacteria and the limited lar detection of Xylella fastidiosa by real-time tests (https:// amount of DNA from a single insect. upload.eppo.int/download/298ocd8b7f525) and 17-XFAST- Additional information for subspecies assignment: EU ‘Interlaboratory test performance study (TPS) for the evaluation of molecular methods to detect Xylella fastidiosa 4.3. Pathogenicity test in the vector Philaenus spumarius’ (https://upload.eppo.int/d ownload/268obc05d6355). Verification of the pathogenicity of X. fastidiosa is some- times difficult and can take several months. The pathogenicity test is described in Appendix 18. 8. Further information Further information on this organism can be obtained from: 4.4. Bioassay Anses-LSV, Unit of Bacteriology, Virology and GMO, 7 Rue Jean Dixmeras, 49044 Angers Cedex 01 (FR). Contact: The bioassay test from Francis et al. (2008) and Pereira et al. B. Legendre ([email protected]) or V. Olivier (va- (2017) on Nicotiana tabacum (tobacco) is described in [email protected]). Appendix 19. Pathogenicity of strains can be evaluated with Institute for Sustainable Plant Protection, CNR, Via N. tabacum (‘Petite Havana SR1’ or ‘RP1’), but this has not Amendola, 122/D 70126 Bari (IT). Contact: D. Boscia (do- been tested for all subspecies. Although comparisons of viru- [email protected]) or M. Saponari (maria.saponar- lence among isolates from different subspecies can be diffi- [email protected]). cult due to the lack of efficient protocols for inoculation and the limited host ranges of isolates, citrus variegated chlorosis 9. Feedback on this Diagnostic Protocol strains of X. fastidiosa are capable of colonizing and causing leaf scorch symptoms in N. tabacum (Lopes et al., 2000; If you have any feedback concerning this Diagnostic Proto- Alves et al., 2003), and X. fastidiosa isolates from almond col, or any of the tests included, or if you can provide addi- and grape showed differences in tobacco colonization and tional validation data for tests included in this Protocol that symptomatology (Francis et al., 2008). you wish to share please contact [email protected].

5. Reference material 10. Protocol revision Reference strains are available at: CIRM-CFBP, Angers (FR) An annual review process is in place to identify the need BCCM/LMG Bacteria Collection, Ghent (BE) for revision of Diagnostic Protocols. Protocols identified as

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 191 needing revision are marked as such on the EPPO website. Temperature. Plant Pathology Fact Sheet University of Kentucky. When errata and corrigenda are in press, this will also be https://plantpathology.ca.uky.edu/files/ppfs-misc-04.pdf [accessed on marked on the website. 11 December 2018] Backus EA & Morgan DJW (2011) Spatiotemporal colonization of Xylella fastidiosa in its vector supports the role of egestion in the Acknowledgements inoculation mechanism of foregut-borne plant pathogens. – This Protocol was originally drafted by M. Scortichini, Fruit Phytopathology 101, 912 922. Bergsma-Vlami M, Bilt van de JLJ, Tjou-Tam-Sin NNA, van de Tree Research Centre, Rome (IT). The first revision was pre- Vossenberg BTLH & Westenberg M (2015) Xylella fastidiosa in pared by an Expert Working Group composed of M. Saponari Coffea arabica ornamental plants imported from Costa Rica and and G. Loconsole Institute for Sustainable Plant Protection, Honduras in the Netherlands. Journal of Plant Pathology 97, 395. National Research Council, Bari (IT); B. Legendre, V. Oli- Bergsma-Vlami M, van de Bilt JLJ, Tjou-Tam-Sin NNA, Helderman vier, F. Poliakoff (French Agency for Food, Environmental CM, Gorkink-Smits PPMA, Landman NM et al. (2017) Assessment and Occupational Health and Safety) Anses-LSV Angers of the genetic diversity of Xylella fastidiosa in imported ornamental – (FR); M. Bergsma-Vlami, National Reference Centre, Coffea arabica plants. Plant Pathology 66, 1065 1074. Berisha B, Chen YD, Zhang GY, Xu BY & Chen TA (1998) Isolation National Plant Protection Organization, Wageningen (NL); of Pierce’s disease bacteria from grapevines in Europe. European R. Gottsberger Austrian Agency for Health and Food Safety Journal of Plant Pathology 104, 427–433. (AGES), Vienna (AT); T. Dreo, National Institute of Biology Bonants P, Griekspoor Y, Houwers I, Krijger M, van der Zouwen P, (NIB), Ljubljana (SI); S. Loreti, Council of Agricultural van der Lee TAJ & van der Wolf J (2019) Plant Disease 103, 645– Research and Economics – Research Centre for Plant Protec- 655. https://doi.org/10.1094/PDIS-08-18-1433-RE. tion and Certification (CREA-DC), Rome (IT); P. Mueller, Brannen P, Krewer G, Boland B, Horton D & Chang J (2016) Bacterial leaf scorch of blueberry, Circular 922, University of Georgia. Julius Kuhn€ Institut (JKI), Kleinmachnow (DE); and M. M. http://plantpath.caes.uga.edu/extension/documents/BlueberryXylella. Lopez, Instituto Valenciano de Investigaciones Agrarias pdf [accessed on 1 June 2016] (IVIA), Valencia (ES). The following experts have also been Bull CT, De Boer SH, Denny TP, Firrao G, Fischer-Le Saux M, consulted and provided comments during the preparation of Saddler GS et al. (2012) List of new names of plant pathogenic the revision of the Protocol: R. Almeida (University of Cali- bacteria (2008–2010). Journal of Plant Pathology 94,21–27. fornia, US), E. Civerolo (USDA/ARS, US, retired), L. de la Carbajal D, Morano KA & Morano LD (2004) Indirect Fuente (Auburn University, US) and H. D. Coletta Filho immunofluorescence microscopy for direct detection of Xylella fastidiosa in xylem sap. Current Microbiology 49, 372–375. (Citriculture Center Sylvio Moreira, BR). The second revi- Cariddi C, Saponari M, Boscia D, De Stradis A, Loconsole G, Nigro F sion was prepared with additional contributions from S. Ces- et al. (2014) Isolation of a Xylella fastidiosa strain infecting olive bron (INRA, FR), A. Cunty (Anses-LSV Angers, FR), B. and oleander in Apulia, Italy. Journal of Plant Pathology 96, 425– Landa (Institute for Sustainable Agriculture, ES), S. Koenig 429. (Julius Kuhn€ Institut (JKI), DE) and J. van Vaerenbergh Chang CJ, Donaldson R, Brannen P, Krewer G & Boland R (2009) (ILVO, BE). Bacterial leaf scorch, a new blueberry disease caused by Xylella fastidiosa. HortScience 44, 413–417. Chang CJ, Garnier M, Zreik L, Rossetti V & Bove JM (1993) Culture References and serological detection of the xylem-limited bacterium causing Aldrich JH, Gould AB & Martin FG (1992) Distribution of Xylella citrus variegated chlorosis and its identification as a strain of Xylella – fastidiosa within roots of peach. Plant Disease 76, 885–888. fastidiosa. Current Microbiology 27, 137 142. Almeida RPP, Blua MJ, Lopes JR & Purcell AH (2005) Vector Chatterjee S, Newman KL & Lindow SE (2008) Cell-to-cell signaling transmission of Xylella fastidiosa: applying fundamental knowledge in Xylella fastidiosa suppresses movement and xylem vessel to generate disease management strategies. Annals of the colonization in grape. Molecular Plant Microbe Interaction 21, – Entomological Society of America 98, 775–786. 1309 1315. Almeida RPP & Nunney L (2015) How do plant diseases caused Chen J, Groves R, Civerolo EL, Viveros M, Freeman M & Zheng Y by Xylella fastidiosa emerge? Plant Disease 99, 1457–1467. (2005) Two Xylella fastidiosa genotypes associated with almond leaf Almeida RPP, Pereira EF, Purcell AH & Lopes JRS (2001) scorch disease on the same location in California. Phytopathology – Multiplication and movement of a citrus strain of Xylella 95, 708 714. fastidiosa within sweet orange. Plant Disease 85, 382–386. Coletta-Filho HD, Francisco CS, Lopes JR, Muller C & Almeida RP Alves E, Kitajima EW & Leite B (2003) Interaction of Xylella (2017) Homologous recombination and Xylella fastidiosa fastidiosa with different cultivars of Nicotiana tabacum:a hostpathogenassociations in South America. Phytopathology 107(3), – comparison of colonization pattern. Journal of Phytopathology 151, 305 312. 500–506. Coletta-Filho HD, Francisco CS, Lopes JRS, De Oliveira AF & Da Alves E, Leite B, Florentino Pascholati S, Ishida ML & Andersen PC Silva LFO (2016) First report of olive leaf scorch in Brazil, (2009) Citrus sinensis leaf petiole and blade colonization by Xylella associated with Xylella fastidiosa subsp. pauca. Phytopathologia fastidiosa: details of xylem vessel occlusion. Scientia Agricola 66, Mediterranea. https://doi.org/10.14601/phytopathol_mediterr-17259 218–224. Coletta-Filho HD & Machado MA (2003) Geographical genetic ~ Amanifar N, Taghavi M, Izadpanah K & Babaei G (2014) Isolation and structure of Xylella fastidiosa from citrus in Sao Paulo state, Brazil. – pathogenicity of Xylella fastidiosa from grapevine and almond in Phytopathology 93,28 34. Iran. Phytopathologia Mediterranea 53, 318–327. Davis MJ, French WJ & Schaad NW (1981) Axenic culture of the Amden BF, Vincelli P & Hartman JR (2010) Real-Time PCR Detection bacteria associated with phony disease of peach and plum leaf scald. – of Xylella fastidiosa is Independent of Sample Storage Time and Current Microbiology 6, 309 314.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 192 Diagnostics

Davis MJ, Purcell AH & Thomson SV (1980) Isolation medium for the Habib W, Nigro F, Gerges E, Jreijiri F, Al Masri Y, El Riachy M et al. Pierce’s disease bacterium. Phytopathology 70, 425–429. (2016) Xylella fastidiosa does not occur in Lebanon. Journal of Denance N, Legendre B, Briand M, Olivier V, de Boisseson C, Phytopathology 164, 395–403. Poliakoff F et al. (2017) Several subspecies and sequence types are Haelterman RM, Tolocka PA, Roca ME, Guzman FA, Fernandez FD & associated with the emergence of Xylella fastidiosa in natural settings Otero ML (2015) First presumptive diagnosis of Xylella in France. Plant Pathology 66, 1054–1064. fastidiosa causing olive scorch in Argentina. Journal of Plant Djelouah K, Frasheri D, Valentini F, D’onghia AM & Digiaro M Pathology 97, 393. (2014) Direct tissue blot immunoassay for detection of Xylella Harper SJ, Ward LI & Clover GRG (2010) Development of LAMP and fastidiosa in olive trees. Phytopathologia Mediterranea 53, real-time PCR methods for the rapid detection of Xylella 559–564. fastidiosa for quarantine and field applications. Phytopathology 100, Donadio LC & Moreira CS (1998) Citrus variegated chlorosis. 1282–1288. Bebedouro, SP, Brazil, FUNDECITRUS/FAPESP 166 p. Hartung JS, Beretta J, Berlansky RH, Spisso J & Lee RF (1994) Citrus EFSA (European Food Safety Authority) (2018) Scientific report on the variegated chlorosis bacterium: axenic culture, pathogenicity and update of the Xylella spp. host plant database. EFSA Journal 16, serological relationships with other strains of Xylella fastidiosa. 5408, 87 pp. Phytopathology 84, 591–597. EPPO (1998) EPPO Reporting Service (98/006). https://gd.eppo.int/ta Hernandez-Martinez R, Costa HS, Dumenyo CK & Cooksey DA xon/XYLEFA/distribution/RS. (accessed on 01 June 2017) (2006) Differentiation of strains of Xylella fastidiosa infecting grape, EPPO (2009) PM 7/97 (1): Indirect immunofluorescence test for plant almonds, and oleander using a multiprimer PCR assay. Plant Disease pathogenic bacteria. EPPO Bulletin 39, 413–416. 90, 1382–1388. EPPO (2010) PM 7/101 (1): ELISA tests for plant pathogenic bacteria. Hill BL & Purcell AH (1995) Acquisition and retention of Xylella EPPO Bulletin 40, 369–372. fastidiosa by an efficient vector, Graphocephala atropunctata. EPPO (2015) EPPO Reporting Service 2015/181 Xylella fastidiosa Phytopathology 85, 209–212. detected in Coffea spp. plants imported into Switzerland. https://gd.e Holland RM, Christiano RSC, Gamliel-Atinsky E & Scherm H (2014) ppo.int/reporting/article-5128 [accessed on 1 June 2016] Distribution of Xylella fastidiosa in blueberry stem and root sections EPPO (2016a) PM 3/81 (1) Inspection of consignments for Xylella in relation to disease severity in the field. Plant Disease 98, 443– fastidiosa. EPPO Bulletin 46, 395–406. 447. EPPO (2016b) PM 3/82 (1) Inspection of places of production for Holzinger WE, Kammerlander I & Nickel H (2003) The Xylella fastidiosa. EPPO Bulletin 46, 407–418. Auchenorrhyncha of Central Europe. Vol 1: Flugoromorpha, EPPO (2018) EPPO Global Database (available online). https://gd.eppo. Cicadomorpha Excl. Cicadellidae. Brill publishers, Leiden (NL). intXylellafastidiosadeclaration from Turkey. [accessed on 12 Hopkins DL (1981) Seasonal concentration of Pierce’s disease February 2018] bacterium in grapevine stems, petioles, and leaf veins. The American EU (2015) Guidelines for the survey of Xylella fastidiosa (Wells et al.) Phytopathological Society 71, 415–418. in the Union Territory. Ioos R, Fourrier C, Iancu G & Gordon TR (2009) Sensitive detection EU (2019) Commission database of host plants found to be susceptible of Fusarium circinatum in pine seed by combining an enrichment to Xylella fastidiosa in the Union territory. http://ec.europa.eu/f procedure with a real-time polymerase chain reaction using dual- ood/plant/plant_health_biosecurity/legislation/emergency_measures/ labeled probe chemistry. Phytopathology 99, 582. xylella-fastidiosa/susceptible_en.htm. [accessed on 5 June 2019] IPPC (2008) ISPM 31 Methodologies for Sampling of Consignments. Ferguson (2016) Characterization of Xylella fastidiosa in rabbiteye FAO, IPPC, Rome (IT). blueberry; Louisiana State University Doctoral Dissertations. https:// IPPC (2018) ISPM 27 Diagnostic Protocols for Regulated Pests Annex digitalcommons.lsu.edu/cgi/viewcontent.cgi?article=5489&conte 25. FAO, IPPC, Rome (IT). xt=gradschool_dissertations [accessed on 7 April 2019] Jacques MA, Denance N, Legendre B, Morel E, Briand M, Mississipi S Francis M, Civerolo EL & Bruening G (2008) Improved bioassay et al. (2016) New variants of coffee-infecting Xylella of Xylella fastidiosa using Nicotiana tabacumcultivar SR1. Plant fastidiosa issued from homologous recombination. Applied Disease 92,14–20. Environmental Microbiology 201582, 1556–1568. Francis M, Lin H, Cabrera-La Rosa J, Doddapaneni H & Civerolo EL Janse JD & Obradovic A (2010) Xylella fastidiosa: its biology, (2006) Genome-based PCR primers for specific and sensitive diagnosis, control and risks. Journal of Plant Pathology 92(1 Suppl), detection and quantification of Xylella fastidiosa. European Journal S135–S248. of Plant Pathology 115, 203–213. Krugner R, Sisterson MS, Chen JC, Stenger DC & Johnson MW Freitag JH (1951) Host range of Pierce’s disease virus of grapes as (2014) Evaluation of olive as a host of Xylella determined by insect transmission. Phytopathology 41, 920–934. fastidiosa and associated sharpshooter vectors. Plant Disease 98, Galvez LC, Korus K, Fernandez J, Behn JL & Banjara N (2010) The 1186–1193. threat of Pierce’s Disease to Midwest wine and table grapes. Online. Landa B (2017) Emergence of Xylella fastidiosa in Spain: current APSnet Features. October 2010 issue, https://doi.org/10.1094/apsne situation. Presentation made at the European Conference on Xylella tfeature-2010-1015. 2017, https://www.efsa.europa.eu/en/events/event/171113 [accessed Giampetruzzi A, Chiumenti M, Saponari M, Donvito G, Italiano A, on 26 February 2018] Loconsole G et al. (2015) Draft genome sequence of the Xylella Lee RF, Beretta MJG, Derrick KS & Hooker MF (1992) Development fastidiosa CoDiRO strain. Genome Announcements 3, e01538–14. of a serological assay for citrus variegated chlorosis – a new disease Gould AB & Lashomb JH (2007) Bacterial leaf scorch (BLS) of shade of citrus in Brazil. Proceedings Florida State Horticultural Society trees. The Plant Health Instructor. https://doi.org/10.1094/phi-i-2007- 105,32–34. 0403-07 Legendre B, Mississipi S, Oliver V, Morel E, Crouzillat D, Durand K Guldur ME, Caglar BK, Castellano MA, Unlu L, Guran€ S, Yılmaz MA et al. (2014) Identification and characterisation of Xylella et al. (2005) First report of almond leaf scorch in Turkey. Journal of fastidiosa isolated from coffee plants in France. Journal of Plant Plant Pathology 87, 246. Pathology 96, 100.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 193

Leu LS & Su CC (1993) Isolation, cultivation, and pathogenicity Nigro F, Boscia D, Antelmi I & Ippolito A (2013) Fungal species of Xylella fastidiosa, the causal bacterium of pear leaf scorch in associated with a severe decline of olive in Southern Italy. Disease Taiwan. Plant Disease 77, 642–646. note. Journal of Plant Pathology 95, 668. Li R, Russell P, Mcowen N, Davenport B & Zhang S (2016) Nunney L, Ortiz B, Russell SA, Sanchez RR & Stouthamer R (2014b) Development of a rapid and reliable isothermal AmplifyRP The complex biogeography of the plant pathogen Xylella fastidiosa: diagnostic assay for specific detection of Xylella fastidiosa. genetic evidence of introductions and subspecific introgression in Phytopathology 106, 109. Central America. PLoS ONE 9, e112463. Li W, Teixeira DC, Hartung JS, Huang Q, Duan Y, Zhou L et al. Nunney L, Schuenzel EL, Scally M, Bromley RE & Stouthamer R (2013) Development and systematic validation of qPCR assays for (2014a) Large-scale intersubspecific recombination in the plant- rapid and reliable differentiation of Xylella fastidiosa strains causing pathogenic bacterium Xylella fastidiosa is associated with the host citrus variegated chlorosis. Journal of Microbiological Methods 92, shift to mulberry. Applied and Environmental Microbiology 80, 79–89. 3025–3033. Loconsole G, Manca L, Potere O, Susca L, Altamura G, Zicca S et al. Nunney L, Vickerman DB, Bromley RRS, Hartman JR, Morano LD & (2018) Implementation of sampling procedures for testing composite Stouthamer R (2013) Recent evolutionary radiation and host plant samples for Xylella fastidiosa. In: Proceedings of 2nd Joint Annual specialization in the Xylella fastidiosa Subspecies Native to the Meeting of H2020 POnTE (Pest Organisms Threatening Europe) and United States. Applied and Environmental Microbiology 79, 2189– XF-ACTORS (Xylellafastidiosa Active Containment Through a 2200. multidisciplinary-Oriented Research Strategy) Projects. Valencia, Nunney L, Yuan X, Bromley R, Hartung J, Montero-Astua M, Moreira Spain, 23-26 October 2018, p.54. L et al. (2010) Population genomic analysis of a bacterial plant Loconsole G, Potere O, Boscia D, Altamura G, Djelouah K, Elbeaino T pathogen: novel insight into the origins of Pierce’s disease of et al. (2014) Detection of Xylella fastidiosa in olive trees by grapevine in the U.S. PLoS ONE 5, e15488 (9 pp). molecular and serological methods. Journal of Plant Pathology 96, Nunney L, Yuan X, Bromley RE & Stouthamer R (2012) Detecting 7–14. genetic introgression: high levels of intersubspecific recombination Loconsole G, Saponari M, Boscia D, D’Attoma G, Morelli M, Martelli found in Xylella fastidiosa in Brazil. Applied Environ.mental GP et al. (2016) Intercepted isolates of Xylella fastidiosa in Europe Microbiology 78, 4702–4714. reveal novel genetic diversity. European Journal of Plant Pathology Ouyang P, Arif M, Fletcher J, Melcher U & Ochoa Corona FM (2013) 146,85–94. Enhanced reliability and accuracy for field deployable bioforensic Lopes SA, Ribeiro PG, Franc SC & Santos JM (2000) Nicotiana detection and discrimination of Xylella fastidiosa subsp. pauca, tabacum as an experimental host for the study of plant-Xylella causal agent of citrus variegated chlorosis using Razor Ex technology fastidiosa interactions. Plant Disease 84, 827–830. and TaqMan Quantitative PCR. PLoS ONE 8, e81647. Marceletti S & Scortichini M (2016) Genome-wide comparison and Pereira WEL, Fischer E, Souza-Neto RR, Saldarelli P, Saponari M, taxonomic relatedness of multiple Xylella fastidiosa strains reveal the Coletta-Filho HD et al. (2017) Characterization of Nicotiana tabacum occurrence of three subspecies and a new Xylella species. Archives as an alternative host for X. fastidiosa subsp. pauca Book of of Microbiology 198, 803–812. Abstracts, European Conference on Xylella 2017. https://www.efsa.e Marchi G, Rizzo D, Ranaldi F, Ghelardini L, Ricciolini M, Scarpelli I uropa.eu/en/events/event/171113 [accessed on 26 February 2018] et al. (2019) First detection of Xylella fastidiosa subsp. multiplex DNA Pooler MR & Hartung JS (1995) Specific PCR detection and in Tuscany (Italy). Phytopathologia Mediterranea, 57,363–364. identification of Xylella fastidiosa strains causing citrus variegated Martelli GP, Boscia D, Porcelli F & Saponari M (2016) The olive chlorosis. Current Microbiology 31, 377–381. quick decline syndrome in south-east Italy: a threatening Purcell AH, Porcelli F, Cornara D, Bosco D & Picciau L (2014) phytosanitary emergency. European Journal of Plant Pathology 144, Characteristics and identification of xylem-sap feeders. Workshop 235–243. Manual Available online https://doi.org/10.5281/zenodo.1407718 Minsavage GV, Thompson CM, Hopkins DL, Leite RMVBC & Stall [accessed on 15 April 2019] RE (1994) Development of a polymerase chain reaction protocol for Purcell AH & Saunders SR (1999) Fate of Pierce’s disease strains detection of Xylella fastidiosa in plant tissue. Phytopathology 84, 45, of Xylella fastidiosa in common riparian plants in California. Plant 6–461. Disease 83, 825–830. Mircetich SM, Lowe SK, Moller WJ & Nyland G (1976) Etiology of Randall JJ, Goldberg NP, Kemp JD, Radionenko M, French JM, Olsen almond leaf scorch disease and transmission of the causal agent. MW et al. (2009) Genetic analysis of a novel Xylella Phytopathology 66,17–24. fastidiosa subspecies found in the southwestern United States. Mizell RF, Andersen PC, Tipping C & Brodbeck BV (2015) Xylella Applied and Environmental Microbiology 75, 5631–5638. fastidiosa diseases and their leafhopper vectors. http://edis.ifas.ufl.ed Redak RA, Purcell AH, Lopes JRS, Blua MJ, Mizell RF III & u/pdffiles/IN/IN17400.pdf [accessed on 26 February 2016] Andersen PC (2004) The biology of xylem fluid-feeding insect Modesti V, Pucci N, Lucchesi S, Campus L & Loreti S (2017) vectors of Xylella fastidiosa and their relation to disease Experience of the Latium region (Central Italy) as a pest-free area epidemiology. Annual Review of Entomology 49, 243–270. for monitoring of Xylella fastidiosa: distinctive features of molecular Rossetti V, Garnier M, Bove JM, Beretta MJG, Teixeira AR, Quaggio diagnostic methods. European Journal of Plant Pathology 148, 557– JA et al. (1990) Presence de bacteries dans le xyleme d’orangers 566. atteints de chlorose variegee, une nouvelle maladie des agrumes au Montero-Astua M, Chacon-Diaz C, Aguilar E, Rodriguez CM & Garita Bresil. Compte Rendu de l’Academie des Sciences Serie III 310, L (2008) Isolation and molecular characterization of Xylella 345–349. fastidiosa from coffee plants in Costa Rica. Journal of Microbiology Safady NG, Lopes JRS, Francisco CS & Coletta-Filho HD (2019) 46, 482–490. Distribution and genetic diversity of Xylella fastidiosa subsp. pauca Newman KL, Almeida RPP, Purcell AH & Lindow SE (2003) Use of a associated with olive quick syndrome symptoms in Southeastern green fluorescent strain for Analysis of Xylella fastidiosa colonization Brazil. Phytopathology 109, 257–264. of Vitis vinifera. Applied and Environmental Microbiology 69, 7319– Saponari M, Boscia D, Altamura G, D’Attoma G, Cavalieri V, 7327. Loconsole G et al. (2016). Pilot project on Xylella fastidiosa to

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 194 Diagnostics

reduce risk assessment uncertainties. EFSA supporting publication fastidiosa causing Pierce’s disease and oleander leaf scorch in the 2016: EN-1013. 60 pp. http://onlinelibrary.wiley.com/doi/10.2903/ United States. Phytopathology 100, 601–611. sp.efsa.2016.EN-1013/pdf (accessed on 01 June 2017) Saponari M, Boscia D, Altamura G, Loconsole G, Zicca S, D’Attoma G et al. (2017) Isolation and pathogenicity of Xylella fastidiosa associated to the olive quick decline syndrome in southern Italy. Appendix 1 – ELISA Nature, Scientific report 7, 17723. Saponari M, Boscia D, Nigro F & Martelli GP (2013) Identification of Instructions for performing ELISA are provided in EPPO DNA sequences related to Xylella fastidiosain oleander, almond and Standard PM 7/101 ELISA tests for plant pathogenic olive trees exhibiting leaf scorch symptoms in Apulia (southern bacteria (EPPO, 2010). Italy). Journal of Plant Pathology 95, 668. Tissue sources for ELISA tests can be leaves (including Saponari M, D’Attoma G, Abou Kubaa R, Loconsole G, Altamura G, petioles), twigs or canes. Zicca S et al. (2019) A new variant of Xylella fastidiosa subspecies Samples can be prepared by macerating the leaves in multiplex detected in different host plants in the recently emerged outbreak in the region of Tuscany, Italy. European Journal of Plant extraction buffer (1:10, w:v) using a mortar and pestle or Pathology https://doi.org/10.1007/s10658-019-01736-9 tissue homogenizer (e.g. Polytron, Homex). Samples can be Scally M, Schuenzel EL, Stouthamer R & Nunney L (2005) Multilocus frozen in liquid nitrogen for homogenization. sequence type system for the plant pathogen Xylella fastidiosa and For twigs and canes, the bark is removed, and pieces of relative contributions of recombination and point mutation to stem can be cut and minced with a razor blade and ground – clonal diversity. Applied and Environmental Microbiology 71, 8491 as described above. 8499. Comment: It should be noted that for some host species Schaad NW, Postnikova E, Lacy G, Fatmi MB & Chang CJ (2004) Xylella fastidiosa subspecies: X. fastidiosa subsp. fastidiosa (e.g. Quercus, Platanus) or some samples (due to the [corrected], subsp.nov X. fastidiosa subsp. multiplex subsp. nov.and microbiota) high background signals resulting in false-posi- X. fastidiosa subsp. pauca subsp. nov. Systematic. Applied tive reactions (not confirmed with molecular tests) can Microbiology 27, 290–300. [Subsp. piercei corrected by occur. In some cases, surface sterilization of the samples subsp. fastidiosain Systematic Applied Microbiology 27, 763]. may help to overcome this problem. Schuenzel EL, Scally M, Stouthamer R & Nunney L (2005) A The report EU-XF-PT-2017-02 ‘Proficiency testing for multigene phylogenetic study of clonal diversity and divergence in the evaluation of molecular and serological diagnosis of North American strains of the plant pathogen Xylella fastidiosa. Applied and Environmental Microbiology 71, 3832–3839. Xylella fastidiosa’ is available at https://upload.eppo.int/d Sherald JL & Lei JD (1991) Evaluation of a rapid ELISA test kit for ownload/217o22631f22a. detection of Xylella fastidiosa in landscaping trees. Plant Disease 75, 200–203. 1) Double antibody sandwich (DAS)-ELISA test Su CC, Chang CJ, Yang WJ, Hsu ST, Tzeng KC, Jan FJ et al. (2012) Specific characters of 16S rRNA gene and 16S-23S rRNA internal Kits for serological detection of X. fastidiosa can be sup- transcribed spacer sequences of Xylella fastidiosa pear leaf scorch plied by different companies. – strains. European Journal of Plant Pathology 132, 132 203. • The ELISA kits from Agritest and Loewe have been Su CC, Deng W, Jan FJ, Chang CJ, Huang H & Chen J (2014) Draft genome sequence of Xylella fastidiosa pear leaf scorch strain in validated for olives, oleander, almond, citrus, oak, Taiwan. Genome Announcements 2, e00166–14. grape and other species (i.e. weeds) (Loconsole et al., Su CC, Deng WL, Jan FJ, Chang CJ, Huang H, Shih HT et al. (2016) 2014 and data from the EPPO Database on Diagnostic Xylella taiwanensis sp. nov., causing pear leaf scorch disease. Expertise section ‘Validation data for diagnostic International Journal of Systematic and Evolutionary Microbiology, tests’). 66, 4766–4771. Temsah M, Hanna I & Saad A (2015) First report of Xylella Analytical sensitivity fastidiosa associated with oleander leaf scorch in Lebanon. Journal Test performance studies have been conducted with differ- of Crop Protection 4, 131–137. ent hosts and preparation of spiked samples or artificially Tolocka PA, Mattio MF, Oter ML, Paccioretti MA, Roca ME, Canteros infected samples. Analytical sensitivity for both Agritest BI et al. (2017) Characterization of X. fastidiosa from different hosts and Loewe varied between 104 and 105 in Argentina. European Conference on Xylella fastidiosa-Finding answers to a global problem. Palma de Mallorca, 13-15 November For more details see the EPPO Database on Diagnostic 2017. https://www.efsa.europa.eu/sites/default/files/event/171113/ Expertise section ‘Validation data for diagnostic tests’. 171113_book-of-abstracts.pdf Note: Loewe indicates an analytical sensitivity with pure Wells JM, Raju BC, Nyland G & Lowe SK (1981) Medium for type strain culture DSMZ10026 of 104 with inactivated isolation and growth of bacteria associated with Plum leaf scald cells and 103 with fresh cells from a plate. and Phony peach diseases. Applied Environmental Microbiology 42, 357–363. Analytical specificity Yaseen T, Drago S, Valentini F, Elbeaino T, Stampone G, Digiaro M Data from Loewe. No cross-reaction noted with: et al. (2015) On-site detection of Xylella fastidiosa in host plants and in Bacteria: 2 Clavibacter michiganensis subsp. sepedonicus “spy insects” using the real-time loop-mediated isother- and Clavibacter michiganensis subsp. michiganensis,2 mal amplification method. Phytopathologia Mediterranea 54,488–496. Yuan X, Morano L, Bromley R, Spring-Pearson S, Stouthamer R & Erwinia spp., 2 Pseudomonas spp., Ralstonia Nunney L (2010) Multilocus sequence typing of Xylella solanacearum,2Xanthomonas spp., Xylophilus ampelinus.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 195

Fungi: Alternaria alternata, Botrytis cinerea, Pythium Bacteria: 1 Pseudomonas syringae pv. syringae,1 paroecandrum, Pythium ultimum, Rhizoctonia solani, P. syringae pv. morsprunorum, Pseudomonas syringae pv. Verticillium albo-atrum. persica,1Xanthomonas arboricola pv. pruni,1X. Agritest: data provided by Research Centre for Plant Pro- arboricola pv. juglandis,1Xanthomonas hortorum pv. tection and Certification (CREA-DC, Rome, IT) pelargonii,1X. hortorum pv. hederae,1Xanthomonas Analytical specificity evaluated on 34 non-target bacterial citri,1Xanthomonas axonopodis pv. viticola, strains. X. axonopodis pv. aurantifolia, Xanthomonas translucens No cross-reaction found with the following plant patho- pv. graminis, Xylophilus ampelinus, 3 saprophytes of gens: Polygala myrtifolia, 3 saprophytes of Cistus monspeliensis, Bacteria: 2 Agrobacterium tumefaciens biovar 1, 1 A. 3 saprophytes de Calicotome villosa, 3 saprophytes of tumefaciens biovar 2, 2 Agrobacterium vitis;1Brenneria Helichrysum italicum. populi,1Brenneria quercina,1Brenneria rubrifaciens;1 Phytoplasma DNA: 1 Bois noir, 1 Flavescence doree Burkholderia andropogonis;1Clavibacter michiganensis subsp. michiganensis;1Erwinia amylovora;1Pantoea Test performance studies have been conducted with dif- agglomerans,2Pantoea stewartii subsp. stewartii;1 ferent hosts (the most common X. fastidiosa-infected hosts Pseudomonas amygdali,2Pseudomonas marginalis pv. in France) and preparation of spiked samples. marginalis,1Pseudomonas savastanoi pv. savastanoi,2 Loewe analytical sensitivity varied between 104 (Cistus Pseudomonas syringae pv. syringae,1P. syringae pv. monspeliensis) and 105 (Polygala myrtifolia, Helichrysum garcae;1Ralstonia solanacearum;1Xanthomonas italicum, Calicotome villosa) according to plant species. arboricola pv. celebensis,1X. arboricola pv. corylina,2 Agritest analytical sensitivity 105 (C. monspeliensis, X. arboricola pv. juglandis,2X. arboricola pv. pruni;1 P. myrtifolia, H. italicum, C. villosa) Xanthomonas campestris pv. citri,1X. campestris pv. To compare: analytical sensitivity of real-time PCR Har- TM populi,1X. campestris pv. vesicatoria,1X. campestris pv. per et al., 2010 after DNA extraction QuickPick is 103 on viticola,2Xanthomonas hortorum pv. pelargonii. same macerates. Diagnostic sensitivity: Institute for Sustainable Plant Pro- Specificity: Loewe and Agritest 100% tection (Bari, IT) Repeatability: Loewe 100%; Agritest 98.41% 100% (with naturally infected samples). Reproducibility: Loewe 100%; Agritest 98.15% Diagnostic specificity: Institute for Sustainable Plant Pro- tection (Bari, IT) 2) Direct tissue blot immunoassay (DTBIA) 100% (with naturally infected samples). DTBIA has been developed for the detection of X. • ELISA kit from Agdia (data from Agdia) fastidiosa in olive plant material for large-scale screening Analytical sensitivity not yet available (evaluation in pro- of symptomatic trees (Djelouah et al., 2014). Fresh cross- gress) sections of young twigs are printed onto nitrocellulose Analytical specificity membranes and the membranes incubated with the specific Cross-reaction noted with: antiserum prior to development. This method has the P. syringae pv. syringae, X. arboricola pv. pruni. advantages of being easy to perform and cost-effective in No cross-reaction noted with: terms of reagents and labour and the membranes can be Bacteria: 2 Acidovorax spp., 2 Agrobacterium spp., printed directly in the field preventing movement of Burkholderia glumae,5Clavibacter michiganensis patho- infected plant materials to other areas. vars, corn stunt spiroplasma, Curtobacterium The following performance characteristics are available: flaccumfaciens subsp. poinsettiae, Dickeya chrysanthemi,2 In a test performance study performed at the Institute for Erwinia spp., 2 Pantoea spp., 2 Pectobacterium spp., 4 Sustainable Plant Protection (Bari, IT), DTBIA was evalu- Pseudomonas spp., Ralstonia solanacearum, Rhizobium ated for the identification of X. fastidiosa strain CoDiRO in radiobacter, Rhizobium rhizogenes, Spiroplasma citri, naturally infected olives (12 samples; 4 laboratories) Stenotrophomonas maltophilia, Xanthomonas albilineans, The DTBIA results were scored as the number of 15 Xanthomonas spp. imprints showing specific purple coloration within the spot- Fungi: 1 Phytophthora sp., Pythium ultimum. ted sections. Two different kits (Agritest and Enbiotech) were com- Data from Anses (FR): pared, which consisted of different detecting antisera. In the Analytical specificity case of the protocol provided by Agritest, the imprints were Inclusivity evaluated on 15 target strains: 100% (tested made by squeezing the cuttings prior to spotting the fresh in duplicate) cut sections on the membrane. Exclusivity evaluated on 26 non-target strains: 100% Following both procedures, the olive samples were cor- No cross-reaction found with the following plant patho- rectly categorized as positive and negative in the four labo- gens: ratories. However, reactions seen with the Agritest kit were

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 196 Diagnostics consistently stronger and easy to assess and interpret, even such as Olea spp. and Quercus spp. Validation data from without observation of the imprinted membrane under the Anses is available on the EPPO Database on Diagnostic microscope. Expertise (http://dc.eppo.int/validationlist.php).

Appendix 2 – Immunofluorescence (IF) test 1) DNA extraction from plant material Instructions for performing an IF test are provided in EPPO CTAB-based extraction Standard PM 7/97 Indirect immunofluorescence test for Weigh 0.5–1 g of fresh small pieces of midribs, petioles, plant pathogenic bacteria (EPPO, 2009) leaf basal part or twigs (1/4 of the indicated amount, if lyo- The IF test is usually performed on plant tissue that is philized), put this into the extraction bags or into suitable mechanically homogenized in extraction buffer (e.g. tubes with 5 mL of CTAB buffer (see Appendix 12) and 50 mM phosphate buffer) or demineralized water. homogenize using a homogenizer (e.g. Homex, Polytron, A commercial polyclonal antibody is available from etc.). For wood and xylem tissues crushing in liquid nitro- Loewe. gen may be needed depending on the type of homogenizer, Analytical specificity on pure cultures (data are provided or if no homogenizer is available. by the supplier, Loewe), with concentrations of up to One millilitre of extract should be transferred into a 1.5- 4 1 10 cfu mL tested on pure cell cultures. mL micro-centrifuge tube and the sample should be heated Inclusivity: 100% at 65°C for 30 min and then centrifuged at 16 000 g for Number of X. fastidiosa strains tested: 5 (X. fastidiosa, 5 min. One millilitre of the supernatant from centrifugation X. fastidiosa, X. fastidiosa subsp. multiplex, X. fastidiosa should be transferred to a new 2-mL micro-centrifuge tube, subsp. fastidiosa, CoDiRO; Lecce, IT). with care being taken not to transfer any of the plant tissue Exclusivity: 100% debris. One millilitre of chloroform:isoamyl alcohol (24:1) Number of non-target strains: 9 (Agrobacterium vitis, should be added and the sample should be mixed well by Clavibacter michiganensis subsp. michiganensis, C. shaking. After centrifugation at 16 000 g for 10 min, michiganensis subsp. sepedonicus, Dickeya chrysanthemi, 700 lL of the supernatant should be transferred to a 1.5- Pseudomonas syringae pv. syringae, Rhodococcus fascians, mL micro-centrifuge tube and 490 lL (approximately 0.7 Xylophilus ampelinus, Xanthomonas vesicatoria, volumes) of cold 2-propanol should be added. After mixing Xanthomonas campestris pv. campestris). by inverting twice, the tube should be incubated at 20°C No cross-reaction observed. for 20 min. Centrifugation of the samples at 16 000 g for A preliminary test performance study on diagnostic sen- 20 min will allow recovery of a pellet that should be sitivity was performed during a workshop in Germany washed with 1 mL of 70% ethanol. An additional centrifu- involving 13 laboratories using naturally infected coffee gation at 16 000 g for 10 min and decantation in 70% etha- plant samples. nol should be performed. Sample should be air- or vacuum- 4 Diagnostic sensitivity: 100% of agreement at 10 cells dried. The pellet should be resuspended in 100–150 lLof –1 mL . TE buffer or RNase- and DNase-free water. Repeatability: 100% Commercial kits • DNeasy Plant Mini Kit-based extraction (Qiagen) Appendix 3 – DNA extraction An aliquot of 200 mg of fresh small pieces of midribs Extraction of DNA for molecular analyses can be achieved and petioles is put into extraction bags with the addition of using standard commercial kits and CTAB buffer. The fol- lysis buffer and homogenized using available equipment lowing commercial kits are widely used and have been val- (Polytron, Homex, etc.). Lysis and purification are carried idated in several European Union (EU) laboratories to out following the manufacturer’s instructions. The protocol process samples from different plant species: DNeasy Plant can be performed manually or automated using a dedicated Mini Kit-based extraction (Qiagen), modified DNeasy workstation. MericonTM Food Standard Protocol (Qiagen), QuickPickTM SML Plant DNA Kit-based extraction (Bio-Nobile). Valida- • Modified DNeasy MericonTM Food Standard Protocol tion data is available in the EPPO Database on Diagnostic (Qiagen) Expertise. This kit, designed for the extraction of total DNA from a In recent experiments, Anses (FR) has noted that the ana- large-scale sample of raw or processed food material, has lytical sensitivity of PCR tests was improved when an addi- been successfully adapted to recover high-quality DNA tional ultrasonication (1 min at 35–40 kHz) is performed from a wide range of plant species. For this purpose, plant on the plant extract prior to DNA extraction (CTAB-based samples should consist of 0.5–1 g of fresh small pieces of extraction or QuickPickTM SML Plant DNA Kit-based midribs, petioles, basal leaf part or twigs (1/4 of the indi- extraction, Bio-Nobile). This has improved the release of cated amount, if lyophilized). The recovered tissue should bacteria from biofilms, in particular with difficult matrices be transferred into the extraction bags or suitable tubes,

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 197

5 mL of Food Lysis Buffer added and then homogenized • Incubate the macerate at room temperature for 30 min using a homogenizer (e.g. Homex, Polytron, etc.); 1 mL of • Recover at least 35 mL of plant sap and transfer to a sap should be transferred into a 1.5-mL micro-centrifuge clean tube tube and incubated for 30 min at 60°C. The sample is then • Centrifuge the sap for 5 min at low speed (3000 g), processed following the manufacturer’s instructions. The recover the supernatant and discard the pellet containing protocol can be performed manually or automated using a the plant debris dedicated workstation. • Centrifuge the supernatant at maximum speed (10 000 g) for 20 min TM • QuickPick SML Plant DNA Kit-based extraction (Bio- • Discard the supernatant and resuspend the pellet in 1.5 mL Nobile) of 19 PBS and transfer to a micro-centrifuge tube Crush 0.5–1 g of fresh small pieces of midribs, petioles, • Centrifuge the micro-centrifuge tube for 20 min at maxi- 1 basal leaf part or twigs in sterile water (5 mL g ), then mum speed (17 000 g) leave to soak for at least 15 min under gentle shaking. • Discard the supernatant and resuspend the pellet in 1 mL Then centrifuge 250 lL of the plant extract for 20 min at of CTAB buffer or 1 ml of lysis buffer and proceed as 20 000 g. The pellet is suspended in 75 lL of lysis buffer indicated above for the extraction of the DNA using with 5 lL of proteinase K and the manufacturer’s instruc- either the CTAB-based protocol or the commercial kit tions followed. The extraction can be conducted manually DNeasy Mericon Food Standard Protocol (Qiagen). or automated. Before transferring the eluate into a new tube, the 3) DNA extraction from vectors absence of magnetic particles should be verified by putting the last tube with the extract on a magnet for 10 s. When CTAB-based extraction extraction is conducted manually, the durations indicated For small vectors (e.g. Philaenus)1–5 heads can be should be strictly followed. pooled and for large vectors (e.g. Cicadella viridis, Cicada orni or Aphrophora spp.) a single insect head (from which the eyes have preferably been removed) 2) DNA extraction from larger amounts of tissue should be used. Extraction efficiency depends on the matrix and this is A single insect head or a pool of 5 heads,, should be reported in the section on performance characteristics of the homogenized in a 2-mL tube with one or two 5-mm tungsten relevant tests. carbide beads [for a maximum of 15–20 s at a frequency of For all PCR tests in addition to the undiluted DNA 24 cycles s–1, in Mill300 mixer/Tissue Lyser II (Qiagen) or extract it is recommended to also use 10- and 100-fold dilu- similar equipment]. Five hundred microlitres of CTAB buffer tions to overcome possible inhibition problems. should be added and the tube should be mixed well by shak- Procedure validated for coffee plants (10 g) ing or vortexing. The sample should be heated at 65°C for The DNA extraction for composite samples has not been 30 min. Five hundred microlitres of chloroform:isoamyl alco- evaluated so far with other DNA extraction methods than hol 24:1 should be added and the sample should be mixed the QuickPickTM SML Plant DNA Kit-based extraction. again by shaking or vortexing. After centrifugation at The extraction methodology is based on initial macera- 16 000 g for 10 min, 400 lL of the supernatant should be tion of approximately 10 g of petioles and midribs (latent transferred to a 1.5-mL micro-centrifuge tube and 280 lL material) and their subsequent homogenization and incuba- (approximately 0.7 volumes) of cold 2-propanol should be tion under agitation for 30 min in phosphate-buffered saline added. After mixing by inverting twice, the tube should be (PBS; 0.01 M pH 7.4) (4 mL g 1). The resulting extract is incubated at 20°C for 20 min. The centrifugation of the subjected to a concentration step, by centrifugation at 4°C samples at 16 000 g for 20 min will allow a pellet to be at 10 000 g for 20 min. The pellet is resuspended in recovered; this should then be washed with 1 mL of 70% 1.5 mL of phosphate buffer (0.01 M pH 7.2). Total geno- ethanol. An additional centrifugation at 16 000 g for 10 min mic DNA is isolated from 75 lL of the acquired plant followed by decantation into 70% ethanol should be per- extract with the QuickPick SML plant DNA kit (Bio- formed. The sample should be air- or vacuum dried. The pel- Nobile), using a King-Fisher isolation robot (Thermo Scien- let should be resuspended in 30–80 lL of TE buffer or tific). DNA is eluted in 50 lL of elution buffer and stored RNase- and DNase-free water, depending on the amount of at –20°C. starting material (single or pooled insect heads). Procedure validated for other plant species (Table 1). Commercial kits • Homogenize the tissue in 19 PBS (see Appendix 12) using a volume ranging from 1:1/1:1.5 (w:v) for herba- • QuickPickTM SML Plant DNA Kit-based extraction (Bio- ceous materials to 1:3 (w:v) for non-herbaceous materials Nobile) (e.g leaves or portions of stems of perennial plants or A single insect head (https://www.youtube.com/watch?v= woody trees or shrubs) as indicated in Table 1; make sure q5DH1q66Llk) or a pool of up to 15 heads should be that the tissue is properly macerated. homogenized in a 2-mL tube with 10 stainless beads

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 198 Diagnostics

(diameter 3 mm) and 200 lL of demineralized sterile water 2.1.4 Extracts of total nucleic acids can be stored at 4°C for 2 min at 30 Hz in a mixer mill MM400 (Restch) or simi- for immediate use or at 20°C for further use. lar equipment. Then microtubes are placed on a magnetic rack and the whole macerate is transferred into a new 2-mL 2.2 Conventional PCR microtube. The microtubes are centrifuged for 20 min at 2.2.1 Master mix 20 000 g. The pellet is suspended in 37.5 lL of lysis buffer The conditions (below) are as implemented in Anses (FR). with 2.5 lL of proteinase K and the manufacturer’s instruc- Other master mixes and PCR conditions (not indicated in this tions followed (buffer volumes: binding buffer 62.5 lL, Diagnostic Protocol) have given similar results. beads 2.5 lL, washing buffer 125 lL, elution buffer 50 lL). Validation of the QuickPickTM extraction is included in the EPPO Database on Diagnostic Expertise. Volume per Working reaction Final Reagent concentration (lL) concentration Several commercial kits are available for insect DNA extraction (e.g. prepGEMTM Insect, ZyGEM, Solana Beach, Molecular-grade water* N.A. 18.6 N.A. CA, US; E.Z.N.A. Insect DNA Kit, Omega Bio-Tek, Nor- Taq DNA polymerase 109 2.5 19 cross, GA, US; EZgeneTM Insect gDNA Kit); however, buffer (Invitrogen) there is no experience so far with these kits for detection of MgCl2 50 mM 0.75 1.5 mM dNTPs 20 mM 0.25 0.2 mM X. fastidiosa in the EPPO region. Forward primer 20 lM 0.375 0.3 lM One to 15 heads can be pooled, and for large vectors (RST31) (e.g. Cicadella viridis or Cicada orni) a single insect head Reverse primer 20 lM 0.375 0.3 lM (from which the eyes have preferably been removed) should (RST33) be used. Platinum Taq DNA 5UlL 1 0.15 0.03 U lL 1 polymerase (Invitrogen) For the LAMP test (Appendix 10), DNA extracted from Subtotal 23 insects can be used or a single insect is used directly with- Genomic DNA 2 out DNA extraction. from plant or from insect Appendix 4 – Conventional PCR (Minsavage tissue extract et al., 1994) or bacterial suspension ‘The test below is described as it was carried out to gener- Total 25 ate the validation data provided in Section 4. Other equip- *Molecular-grade water should preferably be used or prepared ment, kits or reagents may be used provided that purified (deionized or distilled), sterile (autoclaved or 0.22-lm verification (see PM 7/98) is carried out.’ filtered) and nuclease-free water.

1. General information 2.2.2 PCR conditions 1.1 This conventional PCR is suitable for the detection and 95°C for 1 min followed by 40 cycles of (95°C for 30 s, identification of X. fastidiosa. 55°C for 30 s, 72°C for 45 s) and a final step of 72°C for 1.2 The test is based on Minsavage et al. (1994). 5 min. 1.3 The target sequence is located in the 30 end of the gene rpoD, coding for an RNA polymerase sigma-70 factor. 3. Essential procedural information 1.4 Amplicon size 733 bp. 1.5 The forward primer RST31 sequence is 50-GCGTTAA 3.1 Controls TTTTCGAAGTGATTCGATTGC-30; the reverse primer For positive controls, inactivated cultures of X. RST33 sequence is 50-CACCATTCGTATCCCGGTG-30. fastidiosa can be used instead of living cultures. For a reli- able test result to be obtained the following (external) con- 2. Methods trols should be included for each series of nucleic acid 2.1 Nucleic acid extraction and purification extraction and amplification of the target organism and tar- 2.1.1 Matrices: plants, insects or pure culture suspen- get nucleic acid, respectively: sion. • Negative isolation control (NIC) to monitor contamination 2.1.2 See Appendix 3 for extraction procedures from during nucleic acid extraction: nucleic acid extraction and plants and insects. subsequent amplification preferably of a sample of unin- 2.1.3 For pure cultures, a single colony of fresh pure fected matrix, or if not available clean extraction buffer culture is suspended in approximately 1 mL of • Positive isolation control (PIC) to ensure that nucleic acid molecular-grade water; lysis should be performed of sufficient quantity and quality is isolated: nucleic acid at 100°C for 5 min. extraction and subsequent amplification of the plant

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 199

matrix sample that contains the target organism (e.g. nat- A4.4 Data on reproducibility urally infected host tissue or host tissue spiked with the Not available. target organism). For a series of analyses including sam- A4.5 Diagnostic sensitivity data ples from different plant species, whenever possible one Vitis vinifera 81% PIC should be included per plant species to be analysed, Prunus persica 81% or by botanical genus Citrus sinensis 82% • Negative amplification control (NAC) to rule out false Coffea arabica 81% positives due to contamination during the preparation of Coffea canephora: 74% the reaction mix: amplification of molecular-grade water Compared with spiked matrices with bacterial concentra- that was used to prepare the reaction mix tions from 10 to 106 bacteria mL–1: 21 samples per matrix, • Positive amplification control (PAC) to monitor the effi- 63 DNA extractions per matrix, 126 amplifications per ciency of the amplification: DNA of X. fastidiosa, iso- matrix. (On orange tree 18 samples per matrix, 54 DNA lated from a suspension with approximately extractions per matrix, 108 amplifications per matrix.) 105 cfu mL1 A4.6 Diagnostic specificity data 3.2 Interpretation of results Citrus sinensis 100% Verification of the controls: Coffea arabica 100% • NIC and NAC should produce no amplicons Coffea canephora 100% • PIC and PAC should produce amplicons of the expected A4.7 Other information size In 2014, a test performance study was performed on a When these conditions are met: new set of spiked samples. • A test will be considered positive if amplicons of 733 bp Performance characteristics are produced Analytical sensitivity (with a probability of detection of • A test will be considered negative if it produces no band 100% on coffee and orange only): or band(s) of a different size Coffea spp. 104 bacteria mL–1 (100%, 4 labs/4) • Tests should be repeated if any contradictory or unclear Olea europaea 106 bacteria mL–1 (3 labs/4) results are obtained. Vitis vinifera 106 bacteria mL–1 (2 labs/4) Citrus sinensis 102 bacteria mL–1 (100%, 4 labs/4) Prunus persica 104 bacteria mL–1 (3 labs/4) 4. Performance characteristics available Diagnostic sensitivity (based on results on spiked sam- (A) From Anses (FR) using the DNeasy Plant Mini Kit ples to the following concentrations): (Qiagen): Coffea spp. 70% (102–104 bacteria mL–1) A4.1 Analytical sensitivity data Olea europaea 30% (104–106 bacteria mL–1) Vitis vinifera 102 bacteria mL–1 Vitis vinifera 40% (104–106 bacteria mL–1) Prunus persica 102 bacteria mL–1 Citrus sinensis 80% (10–103 bacteria mL–1) Citrus sinensis 103 bacteria mL–1 Prunus persica 60% (102–104 bacteria mL–1) Coffea arabica 104 bacteria mL–1 (diluted DNA 1/10) Note: these results obtained by several laboratories are dif- Coffea canephora 103–104 bacteria mL–1 (non-specific ferent from those obtained in the intra-laboratory evaluation, bands are present near 750 bp; expected band is 733 bp) mainly on grapevine (variability linked to a matrix effect?) The above concentrations gave a probability of detection Test performance study (TPS) performed with extraction of 100%. kit from Qiagen (DNeasy Plant Mini Kit) A4.2 Analytical specificity data Diagnostic specificity: 100% Strain numbers are available on the validation sheet in Reproducibility: 84% the EPPO Database on Diagnostic Expertise section ‘Vali- Repeatability: 95% (from 88–100% according to the 4 dation data for diagnostic tests’ http://dc.eppo.int/validation laboratories) list.php. Four samples per matrix Inclusivity: 100% tested on 10 target strains Two extractions per sample (X. fastidiosa subsp. fastidiosa, X. fastidiosa subsp. pauca, Two amplifications per DNA extract X. fastidiosa subsp. sandyi, X. fastidiosa subsp. multiplex). Exclusivity: 100% tested on 16 non-target stains (B) TPS performed by the Research Centre for Plant Pro- (Xylophilus ampelinus,15Xanthomonas spp.). tection and Certification (CREA-DC, Rome, IT) in collabo- A4.3 Data on repeatability ration with Institute for Sustainable Plant Protection (CNR- Vitis vinifera 80% IPSP, Bari, IT) Prunus persica 92% B4.1 Data on analytical sensitivity: data from Olea 4 1 Citrus sinensis 98% europea 10 cfu mL Coffea arabica 94% B4.2 Analytical specificity: data not available Coffea canephora: 89% B4.3 Data on repeatability

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 200 Diagnostics

Olea europea 80% on undiluted DNA samples; 100% The EU-XF-PT-2017-02 report ‘Proficiency testing for on 10-fold diluted samples (five replicates of olive samples the evaluation of molecular and serological diagnosis of spiked with a low concentration of bacteria, about X. fastidiosa’ performed in the framework of the EU pro- 105 cfu mL1). jects XF-ACTORS and PONTE and of the project Olea europea 56% (data from TPS involving CREA- Euphresco is available at https://upload.eppo.int/download/ DC (IT) and IPSP (IT). 217o22631f22a. DNA (CTAB extraction) from olive extract samples spiked with X. fastidiosa CoDiRO strain suspensions at 103, Appendix 5 – Real-time PCR (Harper et al., 104,106 cfu mL 1 in three repetitions, healthy olive extracts 2010; erratum 2013) simplex or duplex (three repetitions) for a total of 12 samples, tested by 15 laboratories. The test below is described as it was carried out to generate B4.4 Data on reproducibility the validation data provided in Section 4. Other equipment, Olea europea 60% (data from TPS involving CREA- kits or reagents may be used provided that verification (see DC (IT) and IPSP (IT). PM 7/98) is carried out.’ DNA (CTAB extraction) from olive extract samples X. fastidiosa 3 spiked with CoDiRO strain suspensions at 10 , 1. General information 104,106 cfu mL1 in three repetitions, healthy olive extracts (three repetitions) for a total of 12 samples, tested 1.1 This PCR is suitable for the detection and identification by 15 laboratories. of X. fastidiosa. B4.5 Data on diagnostic sensitivity: 1.2 The test is based on Harper et al. (2010). Olea europea 47% 1.3 The target sequence is located in the gene coding for DNA (CTAB extraction) from olive extract samples the 16S rRNA-processing RimM protein. spiked with X. fastidiosa CoDiRO strain suspensions at 103,104,106 cfu mL1 in three repetitions, healthy olive Forward primer XF-F sequence 50-CACGGCTGGTAACGGAAGA-30 extracts (three repetitions) for a total of 12 samples, tested Reverse primer XF-R sequence 50-GGGTTGCGTGGTGAAAT by 15 laboratories. CAAG-30 B4.6 Data on diagnostic specificity Probe XF-P sequence 50-6-FAM -TCG CAT CCC GTG Olea europea 100% GCT CAG TCC-BHQ-1-30 DNA (CTAB extraction) from olive extract samples 3 spiked with X. fastidiosa CoDiRO strain suspensions at 10 , 1.4 This PCR can be used in duplex for testing insects with 4 6 1 10 ,10cfu mL in three repetitions, healthy olive an internal PCR control based on the eukaryote 18S extracts (three repetitions) for a total of 12 samples, tested rDNA (Ioos et al., 2009). by 15 laboratories.

Forward primer 18S Uni-F 50-GCAAGGCTGAAACTTAAAGGAA-30 Additional validation data Reverse primer 18S Uni-R 50-CCACCACCCATAGAATCAAGA-30 0 Performance characteristics obtained by other laboratories Probe 18S Uni-P 5 -Cy5-ACGGAAGGGCACCACCAGG AGT-BHQ-2-30 with the method of Minsavage et al. (1994) with slightly different master mixes are available and can be downloaded from the EPPO Database on Diagnostic Expertise (http:// 1.5 The real-time PCR systems used to generate the valida- dc.eppo.int/validationlist.php). tion data below are Applied Biosystems 7500 Fast, A validation study with non-European X. fastidiosa strains ThermoFisher Scientific (Anses) or CFX 96, Bio-Rad (Harper et al.,2010) showed that the RST31/33 primer failed (Anses, ISPP and CREA). to detect the following American strains from grapes and oaks: X. fastidiosa, Vitis vitifolia, US (PD0001); X. fastidiosa, 2. Methods V. vitifolia, US (R. Almeida); X. fastidiosa, Vitis rotundifolia, US (C. Chang); X. fastidiosa, Quercus laevis,US 2.1 Nucleic acid extraction and purification (OAK0023); X. fastidiosa, Quercus rubra, US (OAK0024); 2.1.1 Matrices: plant, insects or pure cultures X. fastidiosa, Quercus rubra, US (C. Chang). 2.1.2 See Appendix 3 for extraction procedures from Accuracy: Olea europea 60% [data from TPS involv- plants and insects. ing CREA-DC (IT) and IPSP (IT)]. 2.1.3 For pure cultures, 2 lL of bacterial suspension DNA (CTAB extraction) from olive extract samples should be used; lysis should be performed at spiked with X. fastidiosa CoDiRO strain suspensions at 103, 100°C for 5 min. 104,106 cfu mL1 in three repetitions, healthy olive 2.1.4 Extracts of total nucleic acids can be stored at 4°C extracts (three repetitions) for a total of 12 samples, tested for immediate use or at 20°C for further use. by 15 laboratories. 2.2 Real-time PCR

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 201

2.2.1 Master mix for simplex PCR result to be obtained the following (external) controls should be included for each series of nucleic acid extraction Volume and amplification of the target organism and target nucleic Working per reaction Final acid, respectively: Reagent concentration (lL) concentration • Negative isolation control (NIC) to monitor contamina- Molecular-grade water* N.A. 6.48 N.A. tion during nucleic acid extraction: nucleic acid extraction TaqMan Fast Universal 29 10 19 and subsequent amplification of sterile extraction buffer Master Mix, no • Positive isolation control (PIC) to ensure that nucleic acid TM AmpErase UNG of sufficient quantity and quality is isolated: nucleic acid (Applied Biosystems) extraction and subsequent amplification of the plant Forward primer (XF-F) 10 lM 0.6 0.3 lM Reverse primer (XF-R) 10 lM 0.6 0.3 lM matrix sample that contains the target organism (e.g. nat- Probe 1 (XF-P) 10 lM 0.2 0.1 lM urally infected host tissue or host tissue spiked with the Molecular-grade 50 lg lL1 0.12 0.3 lg lL1 target organism). For a series of analyses including sam- BSA (non-acetylated) ples from different plant species, whenever possible one (Invitrogen) PIC should be included per plant species to be analysed, Subtotal 18 or per botanical genus Bacterial suspension 2 • Negative amplification control (NAC) to rule out false or DNA extract Total 20 positives due to contamination during the preparation of the reaction mix: the molecular-grade water that was used *Molecular-grade water should preferably be used or prepared purified to prepare the reaction mix l (deionized or distilled), sterile (autoclaved or 0.22- m filtered) and • Positive amplification control (PAC) to monitor the effi- nuclease-free water. ciency of the amplification: DNA of X. fastidiosa, iso- lated from a suspension with approximately 2.2.2 Master mix for duplex PCR (testing insect). 104 cfu mL 1. 3.2 Interpretation of results Volume Working per Final Verification of the controls: Reagent concentration reaction (lL) concentration • The PIC and PAC amplification curves should be expo- nential Molecular-grade water N.A. 5.78 N.A. • NIC and NAC should give no amplification. TM 9 9 TaqMan Fast Universal 2 10.0 1 When these conditions are met: PCR Master Mix, no • AmpEraseTM UNG A test will be considered positive if it produces an expo- (Applied Biosystems) nential amplification curve Primer XF-F 10 lM 0.60 0.30 lM • A test will be considered negative if it does not produce Primer XF-R 10 lM 0.60 0.30 lM an amplification curve or if it produces a curve which is Probe XF-P 10 lM 0.20 0.10 lM not exponential l l Primer 18S Uni-F 10 M 0.30 0.15 M • Tests should be repeated if any contradictory or unclear Primer 18S Uni-R 10 lM 0.30 0.15 lM results are obtained. Probe 18S Uni-P 10 lM 0.10 0.05 lM Molecular-grade 50 lg lL–1 0.12 0.30 lg lL–1 Comment: some laboratories have noted the occurrence BSA (non-acetylated) of late Ct values (above 35) with this test. Such cases (Invitrogen) should be considered as inconclusive. Retesting and/or Subtotal 18.0 resampling are recommended. DNA 2.0 Total 20 4. Performance characteristics available 2.3 PCR conditions (A) Anses (Angers, FR) Simplex: 95°C for 10 min, followed by 40 cycles of (94°C DNA extraction using the QuickPickTM Plant DNA kit for 10 s and 62°C for 40 s). Heating ramp speed 5°Cs1. (BioNobile) can be performed manually or automated using Duplex: 50°C for 2 min, 95°C for 10 min, followed by KingFisherTM mL (Thermo Scientific). 40 cycles of (94°C for 10 s, 62°C for 40 s). Heating ramp A4.1 Analytical sensitivity data speed 5°Cs1. Vitis vinifera: machine-assisted extraction 103 bacte- ria mL–1; manual extraction 103 bacteria mL–1. 3. Essential procedural information Citrus spp.: machine-assisted extraction 102 bacte- –1 2 –1 3.1 Controls ria mL ; manual extraction 10 bacteria mL 5 For positive controls, inactivated cultures of X. fastidiosa Olea europaea: machine-assisted extraction 10 bacte- –1 5 –1 can be used instead of living cultures. For a reliable test ria mL ; manual extraction 10 bacteria mL .

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 202 Diagnostics

The above concentrations gave a probability of detection 100%: 90 samples gave a negative result out of 90 expected. of 100%. (C) Research Centre for Plant Protection and Certification A4.2 Analytical specificity data (CREA-DC, Rome, IT) in collaboration with Institute for Strain numbers are available on the validation sheet in Sustainable Plant Protection (CNR-IPSP, Bari, IT) the EPPO Database on Diagnostic Expertise section ‘Vali- C4.1 Analytical sensitivity data dation data for diagnostic tests’ (http://dc.eppo.int/validation DNA (CTAB DNA extraction) from two series of olive list.php). Inclusivity 100% evaluated on 19 target strains crude extract spiked with 10-fold dilution of X. fastidiosa belonging to X. fastidiosa subsp. fastidiosa, X. fastidiosa CoDiRO strain suspensions (from 108 cfu mL1 to 10 cfu subsp. pauca, X. fastidiosa subsp. sandyi, X. fastidiosa mL1) (3 laboratories). subsp. multiplex. Olive 102 cfu mL1. Exclusivity 100% evaluated on 29 non-target strains: C4.2 Analytical specificity data (CREA-DC, Rome, IT) 16 Xanthomonas spp., 1 Xylophilus ampelinus,1 Strain numbers are available on the validation sheet in ‘Candidatus’ Liberibacter asiaticus, 1 ‘Candidatus’ Liberib- the EPPO Database on Diagnostic Expertise section ‘Vali- acter africanus, 6 saprophytic bacteria isolated from Cof- dation data for diagnostic tests’ (http://dc.eppo.int/validation fea spp. and 4 saprophytic bacteria on Citrus sinensis.No list.php). cross-reactions were observed. Exclusivity 100% evaluated on 34 non-target bacterial A4.3 Data on repeatability strains: 3 Xanthomonas arboricola pv. pruni,1X. arboricola Vitis vinifera: machine-assisted extraction 96%; manual pv. juglandis,2X. arboricola pv. fragariae,1X. arboricola extraction 100%. pv. corylina,1X. arboricola pv. celebensis,1Xanthomonas Citrus spp.: machine-assisted extraction 100%; manual axonopodis pv. citri,1Xanthomonas campestris pv. extraction 100%. campestris,1X. campestris pv. populi,2 Olea europaea: machine-assisted extraction 100%; man- Xanthomonas hortorum pv. pelargonii,3Pseudomonas ual extraction 88%. savastanoi pv. savastanoi,1Pseudomonas marginalis,4 A4.4 Data on reproducibility Pseudomonas syringae pv. syringae,4Brenneria (species All matrices: machine-assisted extraction 98%; manual rubrifaciens, quercina, salicis, populi), 2 Pantoea stewartii,1 extraction 90%. Pantoea agglomerans,1Erwinia amylovora,3 A4.5 Data on diagnostic sensitivity Agrobacterium tumefaciens,2Rhizobium vitis. Vitis vinifera: machine-assisted extraction 94%; manual DNA (CTAB extraction) from olive extract samples extraction 100%. spiked with X. fastidiosa CoDiRO strain suspensions at Citrus spp.: machine-assisted extraction 100%; manual 103,104,106 cfu mL1 in three repetitions, healthy olive extraction 100%. extracts (three repetitions) for a total of 12 samples, tested Olea europaea: machine-assisted extraction 67%; manual by 15 laboratories extraction 50%. C4.3 Data on diagnostic sensitivity A4.6 Data on accuracy Olea europaea: 100%. Vitis vinifera: machine-assisted extraction 96%; manual C4.4 Data on diagnostic specificity extraction 100%. Olea europaea: 97%. Citrus spp.: machine-assisted extraction 100%; manual C4.5 Data on repeatability extraction 100%. Olea europaea: 99%. Olea europaea: machine-assisted extraction 75%; manual C4.6 Data on reproducibility extraction 63%. Olea europaea: 90%. (B) Institute for Sustainable Plant Protection (Bari, IT) C4.7 Data on accuracy DNA extraction: DNeasy Mericon Food Kit (Qiagen) Olea europaea: 100%. B4.1 Analytical sensitivity data Up to 102 cfu mL1 using dilutions ranging from 107 to Additional validation data 10 cfu mL 1. B4.2 Analytical specificity data The report EU-XF-PT-2017-02 ‘Proficiency testing for the Not available evaluation of molecular and serological diagnosis of Xylella B4.3 Data on repeatability fastidiosa’ is available at https://upload.eppo.int/download/ Repeatability is 100%. 217o22631f22a and ‘Molecular detection of Xylella B4.4 Data on reproducibility fastidiosa by real-time tests’ at https://upload.eppo.int/down Reproducibility is 100%. load/298ocd8b7f525. B4.5 Diagnostic sensitivity data The 17-XFAST-EU interlaboratory TPS for the evalua- 100%: 108 samples gave a positive result out of 108 tion of molecular methods to detect Xylella fastidiosa in expected. the vector Philaenus spumarius is available at https:// B4.6 Diagnostic specificity data upload.eppo.int/download/268obc05d6355.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 203

Real-time PCR

Duplex (Harper et al., 2010, Harper et al. (2010), cut- Ioos et al., 2009), cut- off = 38 off = 38

TPS performance criteria QuickPickTM CTAB QuickPickTM CTAB

Diagnostic sensitivity % 88.46 99.11 84.81 100.00 % (restricted series)* 95.83 99.11 94.37 100.00 No. of labs with false negatives 2 1 3 1 Diagnostic specificity % 96.15 92.86 90.00 91.67 % (restricted series)† 97.92 100.00 100.00 100.00 No. of labs with false positives 2 1 1 1 Accuracy % 91.03 97.02 87.27 96.53 % (restricted series)‡ 96.21 99.36 95.83 99.24 Repeatability % 99.65 98.72 99.31 96.97 Reproducibility % 82.49 95.51 76.37 94.76 % (restricted series)§ 92.94 98.98 91.90 98.78 No. of labs 13 14 10 12

*Results of one laboratory excluded (systematic false negatives). †Results of one laboratory excluded (high number of false positives, about 40% on healthy insects). ‡Results of one laboratory excluded (high number of false positives, about 40% on healthy insects) and of another laboratory excluded (systematic false negatives). §Results of three laboratories excluded: one for a high number of false positives (about 40% on healthy insects), another carried out one repetition only for amplification and a third laboratory gave a systematic false negative.

Appendix 6 – Real-time PCR tests (based on 2.1.2 See Appendix 3 for extraction procedures from Francis et al., 2006) plants and insects. The tests below are described as they were carried out to 2.1.3 For pure bacterial suspensions, a single colony of a fresh pure culture is suspended in 0.9 mL of generate the validation data provided in Section 4. Other PCR-grade water; lysis should be performed at equipment, kits or reagents may be used provided that 100°C for 5 min. verification (see PM 7/98) is carried out. 2.1.4 Extracts of total nucleic acids can be stored at (A) SYBR Green version 4°C for immediate use or at 20°C for later use. 2.2 Real-time PCR 1. General information 2.2.1 Master mix 1.1 This PCR is suitable for the detection and identification of X. fastidiosa. 1.2 The test is based on Francis et al. (2006). 1.3 The target sequence is a conserved hypothetical protein Volume HL gene. Working per reaction Final 1.4 Amplicon size 221 bp. Reagent concentration (lL) concentration 1.5 Forward primer HL5 sequence: 50-AAGGCAA- TAAACGCGCACTA-30; reverse primer HL6 sequence: Molecular-grade water* N.A. 3.88 N.A. 9 9 50-GGTTTTGCTGACTGGCAACA-30. SYBR Select Master Mix 2 5.5 1 (Applied Biosystems) 1.6 The real-time PCR systems used to generate the valida- Forward primer (HL5) 10 lM 0.31 0.28 lM tion data presented below were: Applied Biosys- Reverse primer (HL6) 10 lM 0.31 0.28 lM tems 7500 Fast (ThermoFisher Scientific) or CFX Subtotal 10 9600 (Bio-Rad). Bacterial suspension 1 or DNA extract 2. Methods Total 11 2.1 Nucleic acid extraction and purification *Molecular-grade water should preferably be used or prepared purified l 2.1.1 Matrices: plants, insects or pure bacterial suspen- (deionized or distilled), sterile (autoclaved or 0.22- m filtered) and nuclease-free water. sions.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 204 Diagnostics

2.2.2 PCR conditions When these conditions are met: Pre-incubation at 50°C for 2 min, followed by 95°C for • A test will be considered positive if it produces an expo- 5 min, followed by 40 cycles of (95°C for 20 s and 60°C nential amplification curve and the specific melting peak for 40 s); melt-curve analysis is performed immediately is in the range of 83–85 after the amplification protocol by collecting data over a • A test will be considered negative if it does not produce temperature range of 65–95°C in 0.5°C increments. an amplification curve or if it produces a curve which is not exponential. It should be noted that frequently curves for which the values of Ct (cycle threshold) are between 3. Essential procedural information 35 and 40 do not exhibit a characteristic curve. In this 3.1 Controls case, the result is interpreted as being undetermined For positive controls, inactivated cultures of X. fastidiosa • Tests should be repeated if any contradictory or unclear can be used instead of living cultures. For a reliable test results are obtained. result to be obtained the following (external) controls should be included for each series of nucleic acid extraction 4. Performance characteristics available and amplification of the target organism and target nucleic acid, respectively: Data provided by Research Centre for Plant Protection and • Negative isolation control (NIC) to monitor contamination Certification (CREA-DC, Rome, IT) in collaboration during nucleic acid extraction: nucleic acid extraction and with Institute for Sustainable Plant Protection (CNR-IPSP, subsequent amplification preferably of a sample of unin- Bari, IT). fected matrix or if not available clean extraction buffer 4.1 Analytical sensitivity data • Positive isolation control (PIC) to ensure that nucleic acid Olea europaea plant extracts spiked with 10-fold dilution of sufficient quantity and quality is isolated: nucleic acid of X. fastidiosa subsp. pauca CoDiRO strain suspen- extraction and subsequent amplification of the plant sions 10 cfu mL1. matrix sample that contains the target organism (e.g. nat- 4.2 Analytical specificity data (CREA-DC, Rome, Italy) urally infected host tissue or host tissue spiked with the Strain numbers are available on the validation sheet in target organism). For a series of analyses including sam- the EPPO Database on Diagnostic Expertise section ‘Vali- ples from different plant species, whenever possible one dation data for diagnostic tests’ (http://dc.eppo.int/validation PIC should be included per plant species to be analysed, list.php). or per botanical genus Exclusivity: 100%. Evaluated on 34 non-target bacterial • Negative amplification control (NAC) to rule out false strains: 3 Xanthomonas arboricola pv. pruni,1X. arboricola positives due to contamination during the preparation of pv. juglandis,2X. arboricola pv. fragariae,1X. arboricola the reaction mix: amplification of molecular-grade water pv. corylina,1X. arboricola pv. celebensis,1Xanthomonas that was used to prepare the reaction mix axonopodis pv. citri,1Xanthomonas campestris pv. • Positive amplification control (PAC) to monitor the effi- campestris,1X. campestris pv. populi,2Xanthomonas ciency of the amplification: DNA of X. fastidiosa, isolated hortorum pv. pelargonii,3Pseudomonas savastanoi pv. from a suspension with approximately 104 cfu mL1 savastanoi,1Pseudomonas marginalis,4Pseudomonas Alternative internal positive controls (IPCs) can include: syringae pv. syringae,4Brenneria (spp. rubrifaciens, • Specific amplification or co-amplification of endogenous quercina, salicis, populi), 2 Pantoea stewartii,1Pantoea nucleic acid, using conserved primers that amplify con- agglomerans,1Erwinia amylovora,3Agrobacterium served non-pest target nucleic acid that is also present in tumefaciens,2Rhizobium vitis and Xanthomonas arboricola the sample (e.g. plant cytochrome oxidase gene or pv. celebensis gave an amplification curve corresponding to eukaryotic 18S rDNA) melt peak values of 87°C and 87.5°C, respectively. Pantoea • Amplification of samples spiked with exogenous nucleic agglomerans, Brenneria quercina, Pseudomonas marginalis (control sequence) acid that has no relation with the tar- and Xanthomonas hortorum pv. pelargoni gave an amplifi- get nucleic acid (e.g. synthetic internal amplification con- cation curve with an inconsistent melting peak. trols) or amplification of a duplicate sample spiked with DNA (CTAB extraction) from olive extract samples the target nucleic acid. spiked with X. fastidiosa CoDiRO strain suspensions at 103, Other possible controls: 104,106 cfu mL1 in three repetitions, healthy olive • Inhibition control (IC) to monitor inhibitory effects intro- extracts (three repetitions) for a total of 12 samples, tested duced by the nucleic acid extract. Use the same matrix by 15 laboratories. spiked with nucleic acid from the target organism. 4.3 Data on repeatability 3.2 Interpretation of results Olea europaea: 91%. Verification of the controls: 4.4 Data on reproducibility • The PIC and PAC (as well as IC and IPC as applicable) Olea europaea: extraction 85%. amplification curves should be exponential 4.5 Data on diagnostic sensitivity • NIC and NAC should give no amplification. Olea europaea: 90%.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 205

4.6 Data on accuracy (B) Taqman version Olea europaea: 92%. 4.7 Data on diagnostic specificity 1. General information Olea europaea: 100%. 1.1 This PCR is suitable for the detection and identification of X. fastidiosa. 1.2 The test is based on Francis et al. (2006). Modified Additional validation data protocol developed at the National Institute of Biology, The report EU-XF-PT-2017-02 ‘Proficiency testing for the SI (2007, unpublished). evaluation of molecular and serological diagnosis of Xylella 1.3 The target sequence is a conserved hypothetical protein fastidiosa’ is available at https://upload.eppo.int/download/ HL gene. 217o22631f22a and ‘Molecular detection of Xylella 1.4 Amplicon size: 221 bp. 0 fastidiosa by real-time tests’ at https://upload.eppo.int/down 1.5 Forward primer HL5 sequence 5 -AAGGCAA- 0 load/298ocd8b7f525. TAAACGCGCACTA-3 ; reverse primer HL6 sequence 0 0 The 17-XFAST-EU interlaboratory TPS for the evalua- 5 -GGTTTTGCTGACTGGCAACA-3 ; the probe 0 tion of molecular methods to detect Xylella fastidiosa in sequence is 5 /FAM/-TGGCAGGCAGCAACGA- 0 the vector Philaenus spumarius can be found at https:// TACGGCT-/BHQ1/3 . upload.eppo.int/download/268obc05d6355. 1.6 The validation data below has been generated using the real-time PCR system ViiATM 7 Real-Time PCR Sys- tem (ThermoFisher Scientific).

TaqMan PCR SYBR Green 2. Methods

Francis 2.1 Nucleic acid extraction and purification et al. (2006), 2.1.1 Matrices: plants, insects or pure bacterial suspen- cut-off = 35/ sions Francis melting 2.1.2 For extraction procedures from plants see et al. (2006), peak Appendix 3. This test was not evaluated by NIB = – ° cut-off 38 83 85 C on insects. Quick Quick 2.1.3 For pure bacterial suspension, a single colony of TPS performance criteria PickTM CTAB PickTM CTAB a fresh pure culture is suspended in 0.9 mL of PCR-grade water; lysis should be performed at Diagnostic % 60.42 95.54 56.25 79.17 100°C for 5 min. sensitivity % (restricted 65.91 95.54 56.25 79.17 2.1.4 Extracts of total nucleic acids can be stored at series)* ° ° No. of labs with 8321 4 C for immediate use or at 20 C for later use. false negatives 2.2 Real-time PCR Diagnostic % 100.00 100.00 87.50 100.00 2.2.1 Master mix specificity % (restricted 100.00 100.00 87.50 100.00 series)† No. of labs with 0010 Volume false positives Working per Final Accuracy % 73.61 97.62 66.67 86.11 Reagent concentration reaction (lL) concentration % (restricted 78.33 97.44 66.67 86.11 series)‡ Molecular-grade water* N.A. 1 N.A. Repeatability % 97.73 99.36 100.00 100.00 Real-time PCR buffer 29 519 Reproducibility % 64.77 96.45 72.66 81.94 (TaqMan Universal % (restricted 69.14 96.18 72.66 81.94 PCR Master series)§ Mix, ThermoFisher Number of 12 14 2 3 Scientific, 29) laboratories Forward primer (HL5) 10 lM 0.9 0.9 lM Reverse primer (HL6) 10 lM 0.9 0.9 lM *Results of one laboratory excluded (systematic false negatives). Probe 1 (probe) 10 lM 0.2 0.2 lM † Results of one laboratory excluded (high number of false positives, Subtotal 8 about 40% on healthy insects). Bacterial suspension 2 ‡ Results of two laboratories excluded: one laboratory with a high or DNA extract number of false positives (about 40% on healthy insects) and another Total 10 with systematic false negatives. §Results of three laboratories excluded: one with a high number of *Molecular-grade water should preferably be used, or prepared, purified false positives (about 40% on healthy insects), one with repetition for (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and only one amplification and a third with systematic false negatives. nuclease-free water.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 206 Diagnostics

2.2.2 PCR conditions 3.2 Interpretation of results Pre-incubation (UNG step) at 50°C for 2 min, initial Verification of the controls: denaturation at 95°C for 10 min, followed by 45 cycles of • The PIC and PAC (as well as IC and IPC as applicable) 95°C for 15 s and 60°C for 60 s. amplification curves should be exponential Heating and cooling ramp speed: standard tempera- • NIC and NAC should give no amplification. ture ramping mode, corresponding to 1.6°Con When these conditions are met: 7900HT Fast Real-Time PCR System (Applied Biosys- • A test will be considered positive if it produces an expo- tems) and ViiATM 7 Real-Time PCR System (Thermo- nential amplification curve Fisher Scientific). • A test will be considered negative if it does not produce an amplification curve or if it produces a curve which is not exponentia. 3. Essential procedural information • Tests should be repeated if any contradictory or unclear 3.1 Controls results are obtained. For positive controls, inactivated cultures of X. Comment: some laboratories have noted the occurrence fastidiosa can be used instead of living cultures. For a reli- of late Ct values (above 35) with this test. Such cases able test result to be obtained, the following (external) con- should be considered as inconclusive. Retesting and/or trols should be included for each series of nucleic acid resampling is recommended. extraction and amplification of the target organism and tar- get nucleic acid, respectively: 4. Performance characteristics available • Negative isolation control (NIC) to monitor contamina- tion during nucleic acid extraction: nucleic acid extraction Data provided by NIB (SI), DNA extraction QuickPick and subsequent amplification preferably of a sample of Plant Mini Kit. uninfected matrix or if not available clean extraction 4.1 Analytical sensitivity data buffer Determined on X. fastidiosa DNA dilutions. The lowest • Positive isolation control (PIC) to ensure that nucleic acid concentrations tested in which all replicates were positive was –1 of sufficient quantity and quality is isolated: nucleic acid found to be 2.6, 3.2 and 3.5 [log (target copies of DNA mL ), extraction and subsequent amplification of the plant determined with digital PCR using the same primers and probe matrix sample that contains the target organism (e.g. nat- as in real-time PCR, and corresponding to concentration of –1 urally infected host tissue or host tissue spiked with the cells mL ], X. fastidiosa subsp. multiplex, X. fastidiosa and target organism). For a series of analyses including sam- X. fastidiosa subsp. pauca CoDiRO strain, respectively. ples from different plant species, whenever possible one Plant material (spiked): 94% determined in plant material PIC should be included per plant species to be analysed, prepared as for symptomatic testing (31/33) spiked with X. 5 –1 or per botanical genus fastidiosa at 10 cells mL and 100% determined in plant • Negative amplification control (NAC) to rule out false pos- material prepared as for latent testing (3/3) spiked with 5 –1 itives due to contamination during the preparation of the X. fastidiosa at 10 cells mL . reaction mix: amplification of molecular-grade water that Details on the preparation of the spiked samples are pro- was used to prepare the reaction mix vided in the validation report available through the EPPO • Positive amplification control (PAC) to monitor the effi- Database on Diagnostic Expertise in the section ‘Validation ciency of the amplification: DNA of X. fastidiosa, isolated data for diagnostic tests Xylella fastidiosa’ [LabID NIB- from a suspension with approximately 104 cfu mL1 FITO, complementary files Validation data on the modified Alternative internal positive controls (IPC) can include: real-time PCR for detection of Xylella fastidiosa adapted • Specific amplification or co-amplification of endogenous from Francis et al. (2006) (no. D0002/16)]. nucleic acid, using conserved primers that amplify con- 4.2 Analytical specificity data served non-pest target nucleic acid that is also present in the Strain numbers are available on the validation sheet in sample (e.g. plant cytochrome oxidase gene or eukaryotic the EPPO Database on Diagnostic Expertise section ‘Vali- 18S rDNA) dation data for diagnostic tests’ (http://dc.eppo.int/validation • Amplification of samples spiked with exogenous nucleic list.php). 100% inclusivity. (control sequence) acid that has no relation with the tar- Four X. fastidiosa isolates tested: X. fastidiosa subsp. fastidiosa, get nucleic acid (e.g. synthetic internal amplification con- X. fastidiosa subsp. multiplex, X. fastidiosa subsp. fastidiosa, trols) or amplification of a duplicate sample spiked with X. fastidiosa and X. fastidiosa subsp. pauca CoDiRO strain. the target nucleic acid. 100% exclusivity: Xylophilus ampelinus and five uniden- Other possible controls: tified bacteria isolated from olive plants; DNA extracted • Inhibition control (IC) to monitor inhibitory effects intro- from healthy olive, oleander, rosemary and lavender. duced by the nucleic acid extract. Use the same matrix 4.3 Data on repeatability spiked with nucleic acid from the target organism. No data available.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 207

4.4 Data on reproducibility 2.1.4 Extracts of total nucleic acids can be stored at 97% at an approximate concentration of 105 cells per 4°C for immediate use or at 20°C for further mL of plant extract use. 2.2 Real-time PCR Additional validation data 2.2.1 Master mix Validation studies with non-European X. fastidiosa strains (Harper et al., 2010; and Li et al., 2013) showed that the Volume HL5/6 primer failed to detect some American strains Working per Final from Morus alba (mulberry, US MUL), Acer negundo (box Reagent concentration reaction (lL) concentration elder, US BE1), Quercus rubra (red oak, US OAK0024) and Liquidambar styraciflua (sweetgum, US) and one Molecular-grade water* N.A. 3.3 N.A. PerfeCTa qPCR 29 519 Brazilian strain from Citrus sinensis (sweet orange, Brazil ToughMix 20-1381). (without ROX The report EU-XF-PT-2017-02 ‘Proficiency testing for or UNG), the evaluation of molecular and serological diagnosis of QuantaBio Xylella fastidiosa’ is available at https://upload.eppo.int/d (Quanta Biosciences) l l ownload/217o22631f22a and ‘Molecular detection of Forward primer 10 M 0.3 0.3 M (Xf.Csp6F) Xylella fastidiosa by real-time tests’ at https://upload.eppo. Reverse primer 10 lM 0.3 0.3 lM int/download/298ocd8b7f525. (Xf.Csp6R) Probe (Xf.Csp6P) 10 lM 0.1 0.1 lM Appendix 7 – Real-time PCR (adapted from Subtotal 9 et al Bacterial suspension 1 Ouyang ., 2013) or DNA extract The test below is described as it was carried out to Total 10 generate the validation data provided in Section 4. Other *Molecular-grade water should preferably be used, or prepared purified equipment, kits or reagents may be used provided that (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and verification (see PM 7/98) is carried out. nuclease-free water.

2.2 PCR conditions 1. General information Initial denaturation for 10 min at 95°C, followed by 40 1.1 This PCR is suitable for the detection and identification cycles of (95°C for 15 s and 60°C for 60 s). Heating ramp of X. fastidiosa. speed: 6°Cs 1. 1.2 The test is based on Ouyang et al. (2013). 1.3 The target sequence is the cobalamin synthesis protein- 3. Essential procedural information coding gene. 3.1 Controls For positive controls, inactivated cultures of X. Forward primer Xf.Csp6F 50-CCC ATT ACG CTT CAA CCA TT-30 0 0 fastidiosa can be used instead of living cultures. For a reli- Reverse primer Xf.Csp6R 5 -CCC AAT CCA TAC GAC TTG CT-3 Probe Xf.Csp6P * 50-6-FAM-GGT GTG ATT [ZEN] CGC able test result to be obtained, the following (external) con- AGC AAG GGC-IBFQ-30 trols should be included for each series of nucleic acid extraction and amplification of the target organism and tar- *This probe with an internal ZEN and an Iowa Black FQ quencher can get nucleic acid, respectively: be ordered at Integrated DNA Technologies, Inc. • Negative isolation control (NIC) to monitor contamina- 1.4 The real-time PCR system used to generate the valida- tion during nucleic acid extraction: nucleic acid extrac- tion data below was an Eppendorf Realplex 4 Master- tion and subsequent amplification of sterile extraction cycler S. buffer • Positive isolation control (PIC) to ensure that nucleic acid 2. Methods of sufficient quantity and quality is isolated: nucleic acid 2.1 Nucleic acid extraction and purification extraction and subsequent amplification of the plant 2.1.1 Matrices: plants, insects or pure cultures matrix sample that contains the target organism (e.g. nat- 2.1.2 See Appendix 3 for extraction procedures from urally infected host tissue or host tissue spiked with the plants and insects. target organism). For a series of analyses including sam- 2.1.3 For pure cultures, 2 lL of bacterial suspension ples from different plant species, whenever possible one should be used; lysis should be performed at PIC should be included per plant species to be analysed, 100°C for 5 min. or per botanical genus

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 208 Diagnostics

• Negative amplification control (NAC) to rule out false 4.6 Data on diagnostic specificity positives due to contamination during the preparation of More than 500 natural samples (infected:not infected, the reaction mix: the molecular-grade water that was used 1:10) compared with the real-time PCR test of Harper et al. to prepare the reaction mix (2010): 100%. • Positive amplification control (PAC) to monitor the effi- 4.7 Data on accuracy ciency of the amplification: DNA of X. fastidiosa, isolated Data evaluated by AGES alongside the TPS (EU-XF- from a suspension with approximately 104 cfu mL1. PT-2017-02, Bari) compared with Harper and Li with 3.2 Interpretation of results two different extraction methods [CTAB and Mericon Verification of the controls: Food Kit (Qiagen)] on spiked olive plant sap: 100%. • The PIC and PAC amplification curves should be exponential Also on more than 500 natural samples (infected:not • NIC and NAC should give no amplification. infected, 1:10) compared with the real-time of Harper When these conditions are met: et al. (2010): 100% • A test will be considered positive if it produces an expo- nential amplification curve • A test will be considered negative if it does not produce Appendix 8 – Real-time PCR (Li et al., 2013) an amplification curve or if it produces a curve which is The test below is described as it was carried out to not exponential generate the validation data provided in Section 4. Other • Tests should be repeated if any contradictory or unclear equipment, kits or reagents may be used provided that results are obtained. verification (see PM 7/98) is carried out. 4. Performance characteristics available AGES (Vienna, AT) DNA extraction using the DNeasy 1. General information Plant Mini Kit (Qiagen). 1.1 This PCR is suitable for the detection and identification 4.1 Analytical sensitivity data of X. fastidiosa. Data obtained from the original publication: 8.41 copies 1.2 The test is based on Li et al. (2013). per reaction (bacterial suspension); the number of copies 1.3 The target sequence is 16S rRNA (XF_r01). was calculated according to the 2.679-Mb genome size of 1.4 The amplification conditions have been modified from the X. fastidiosa subsp. pauca (9a5c; GenBank accession num- original paper and adapted to the real-time PCR condi- ber AE003849) using an online calculator (http://cels.uri.ed tions validated for other real-time PCR tests used to detect u/gsc/resources/cndna.html) (Ouyang et al., 2013). Addi- X. fastidiosa. Two different modifications of the TaqMan tional data from AGES is not yet available. probes have been tested: (A) TaqMan probe labeled with 4.2 Analytical specificity data the MGB technology (Applied Biosystem); (B) TaqMan According to the original publication: for inclusivity 27 probe labeled with standard fluorophore and quencher. different X. fastidiosa strains from 5 different host plants tested (including defined subsp. pauca, multiplex and (A) Test with the MGB-TaqMan probe (labeled with fastidiosa), 4 X. fastidiosa strains from leafhopper and for FAM) exclusivity 15 closely related or host related non-targets (13 bacteria strains, 2 fungi) tested. Inclusivity 100% evaluated using strains from ST76 XF16Sf 50-CGG CAG CAC GTT GGT AGT AA-30 (sandyi), a cysG variant of ‘ST76’, ST53 (pauca), ST2 XF16Sr 50-CCG ATG TAT TCC TCA CCC GTC-30 0 0 (fastidiosa) and ST26 (multiplex) (AGES). XF16Sp 5 -FAM-CA TGG GTG GCG AGT GGC-MGBNFQ-3 In an additional analysis along with the TPS (EU-XF- PT-2017-02, Bari) X. fastidiosa subsp. pauca (CODIRO) could be detected by this test (AGES). (B) Real-time PCR (Li et al., 2013) with standard Taq- 4.3 Data on repeatability Man probe Evaluated by AGES alongside the TPS (EU-XF-PT-2017- 02, Bari) with two different extractions methods [CTAB and XF16Sf 50-CGG CAG CAC GTT GGT AGT AA-30 Mericon Food Kit (Qiagen)] on spiked olive plant sap, 100%. XF16Sr 50-CCG ATG TAT TCC TCA CCC GTC-30 4.4 Data on reproducibility XF16Sp 50-FAM-CA TGG GTG GCG AGT GGC-BHQ1-30 100% with two different real-time PCR machines, two operators and two different master mixes. 4.5 Data on diagnostic sensitivity Evaluated by AGES: manual extraction 100% on more 2. Methods than 500 natural samples (infected: not infected; 1:10) com- 2.1 Nucleic acid extraction and purification pared with the real-time data of Harper et al. (2010). 2.1.1 Matrices: plants, insects or pure cultures

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 209

2.1.2 See Appendix 3 for extraction procedures from 2.2 PCR conditions plants and insects. It should be noted that the Pre-incubation at 50°C for 2 min followed by 95°C for diagnostic sensitivity of the test was lower for 10 min, followed by 40 cycles of (94°C for 10 s and 60°C olive samples with the DNA extraction based on for 40 s). the CTAB protocol than with DNA extracted using the DNeasy Mericon Food Kit (Qiagen). A 3. Essential procedural information link to the report is available in Section 4. 3.1 Controls l 2.1.3 For pure cultures, 2 L of bacterial suspension For positive controls, inactivated cultures of X. should be used; lysis should be performed at fastidiosa can be used instead of living cultures. For a reli- ° 100 C for 5 min. able test result to be obtained, the following (external) con- ° 2.1.4 Extracts of total nucleic acids can be stored at 4 C trols should be included for each series of nucleic acid ° for immediate use or at 20 C for further use. extraction and amplification of the target organism and tar- 2.2 Real-time PCR get nucleic acid, respectively: 2.2.1 Master mix • Negative isolation control (NIC) to monitor contamina- (A) Test with the MGB-TaqMan probe (labelled with FAM) tion during nucleic acid extraction: nucleic acid extraction and subsequent amplification of sterile extraction buffer Volume • Positive isolation control (PIC) to ensure that nucleic acid Working per reaction Final of sufficient quantity and quality is isolated: nucleic acid Reagent concentration (lL) concentration extraction and subsequent amplification of the plant

Molecular-grade water* N.A. 6.63 N.A. matrix sample that contains the target organism (e.g. nat- TaqMan Fast Universal 29 10 19 urally infected host tissue or host tissue spiked with the Master Mix (Applied target organism). For a series of analyses including sam- Biosystems) ples from different plant species, whenever possible one Forward primer (XF16Sf) 10 lM 0.5 0.25 lM PIC should be included per plant species to be analysed, l l Reverse primer (XF16Sr) 10 M 0.5 0.25 M or per botanical genus Probe MGB (XF16Sp) 10 lM 0.25 0.125 lM • Negative amplification control (NAC) to rule out false BSA 50 lg lL 1 0.12 0.3 lg lL 1 Subtotal 18 positives due to contamination during the preparation of Bacterial suspension 2 the reaction mix: the molecular-grade water that was used or DNA extract to prepare the reaction mix Total 20 • Positive amplification control (PAC) to monitor the effi- * ciency of the amplification: DNA of X. fastidiosa, isolated Molecular-grade water should preferably be used, or prepared purified 4 1 (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and from a suspension with approximately 10 cfu mL . nuclease-free water. 3.2 Interpretation of results Verification of the controls: (B) Real-time PCR (Li et al., 2013) with standard Taq- • The PIC and PAC amplification curves should be expo- Man probe nential • NIC and NAC should give no amplification Volume When these conditions are met: Working per reaction Final • A test will be considered positive if it produces an expo- Reagent concentration (lL) concentration nential amplification curve • Molecular-grade water* N.A. 6.63 N.A. A test will be considered negative if it does not produce TaqMan Fast Universal 29 10 19 an amplification curve or if it produces a curve which is Master Mix (4364338, not exponential Applied Biosystems) • Tests should be repeated if any contradictory or unclear Forward primer (XF16Sf) 10 lM 0.5 0.25 lM results are obtained. Reverse primer (XF16Sr) 10 lM 0.5 0.25 lM Standard Probe (XF16Sp) 10 lM 0.25 0.125 lM BSA 50 lg lL1 0.12 0.3 lg lL1 4. Performance characteristics available Subtotal 18 Bacterial suspension 2 Fourteen laboratories participated in a comparison of differ- or DNA extract ent real-time PCR tests. This comparison was organized in Total 20 the framework of the EU projects XF-ACTORS and PONTE and a Euphresco project. See ‘Molecular detection *Molecular-grade water should preferably be used, or prepared purified (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and of Xylella fastidiosa by real-time tests’ at https://upload.e nuclease-free water. ppo.int/download/298ocd8b7f525.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 210 Diagnostics

2.1.4 For pure cultures, 2 lL of bacterial suspension Appendix 9 – Triplex real-time PCR (Bonants should be used; lysis should be performed at et al., 2019) 100°C for 5 min. The test below is described as it was carried out to 2.1.5 Extracts of total nucleic acids can be stored at generate the validation data provided in section 4. Other 4°C for immediate use or at 20°C for further equipment, kits or reagents may be used provided that use. verification (see PM 7/98) is carried out. 2.2 Real-time PCR 2.2.1 Master mix 1. General information 1.1 This triplex PCR is suitable for the detection and iden- Volume tification of X. fastidiosa. Working per reaction Final 1.2 The test is based on Bonants et al. (2019). Reagent concentration (lL) concentration 1.3 The target sequences are located in the cobalamin syn- thesis protein coding gene and the gene coding for the Molecular-grade N.A. 3.6 N.A. water* 16S rRNA processing RimM protein. Premix ExTaq 29 10 19 1.4 An internal control is included. Acidovorax cattleyae is (TaKaRa RR390A) a bacterium added in a known quantity to check extrac- Forward primers tion and PCR efficiency. The primer set was originally XF-F 10 lM 0.6 0.3 lM developed by Syngenta and modified by Naktuinbouw. Xf.Csp6F 10 lM 0.6 0.3 lM 1.5 Primer sequences Acat-2-F 10 lM 0.6 0.3 lM Reverse primers XF-R 10 lM 0.6 0.3 lM 0 l l Forward XF-F 5 -CACGGCTGGTAACGGA Xf.Csp6R 10 M 0.6 0.3 M 0 l l primers AGA-3 Acat 2-R 10 M 0.6 0.3 M Xf.Csp6F 50-CCCATTACGCTTCAAC Probe 0 l l CATT-3 XF-P (FAM) 10 M 0.2 0.1 M 0 l l Internal Acat-2-F 5 -TGTAGCGATCCTTCACA Xf.Csp6P (HEX) 10 M 0.2 0.1 M 0 l l control AG-3 Acat 2-P (TR) 10 M 0.2 0.1 M forward primer Subtotal 18 Reverse primers XF-R 50-GGGTTGCGTGGTGAAAT DNA extract 2 CAAG-30 Total 20 Xf.Csp6R 50-CCCAATCCATACGACTT *Molecular-grade water should preferably be used or prepared purified GCT-30 (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and Internal control Acat 2-R 50-TGTCGATAGATGCTCAC nuclease-free water. reverse primer AAT-30 0 Probes XF-P (FAM) 5 -TCGCATCCCGTGGCTCA 2.2.2 PCR conditions: 2 min at 95°C, 40 cycles of (15 sec 0 GTCC-3 at 95°C, 40 sec at 60°C). Xf.Csp6P (HEX) 50-GGTGTGATTCGCAGCAA GGGC-30 0 Acat 2-P 5 -CTTGCTCTGCTTCTCTAT 3. Essential procedural information (Texas Red) CACG-30 3.1 Controls For positive controls, inactivated cultures of X. 1.6 The real-time PCR system used to generate the valida- fastidiosa can be used instead of living cultures. For a reli- tion data below was a Bio-Rad CFX384 thermocycler. able test result to be obtained, the following (external) con- trols should be included for each series of nucleic acid 2. Methods extraction and amplification of the target organism and tar- 2.1 Nucleic acid extraction and purification get nucleic acid, respectively: 2.1.1 Matrices: plant or pure cultures. • Negative isolation control (NIC) to monitor contamina- 2.1.2 See Appendix 3 for extraction procedures from tion during nucleic acid extraction: nucleic acid extraction plants. and subsequent amplification of sterile extraction buffer 2.1.3 The internal control bacterium Acidovorax • Positive isolation control (PIC) to ensure that nucleic acid cattleyae (Acat) is grown in TBS medium to a den- of sufficient quantity and quality is isolated: nucleic acid sity of OD 600 = 0.8. The cell suspension is extraction and subsequent amplification of the plant diluted 1009 with 0.01 M PBS and 5 ll is added matrix sample that contains the target organism (e.g. nat- to the plant extract before DNA extraction, giving urally infected host tissue or host tissue spiked with the a Ct value of about 30 for the Acat TaqMan PCR. target organism). For a series of analyses including

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 211

samples from different plant species, whenever possible 4.5 Other information one PIC should be included per plant species to be anal- Bonants et al. 2019 state that: ‘[the diagnostic] sensitiv- ysed, or per botanical genus ity of the triplex assay was compared with a duplex assay • Negative amplification control (NAC) to rule out false based on a combination of the Harper TaqMan and the positives due to contamination during the preparation of TaqMan for the internal control, using symptomatic tobacco the reaction mix: the molecular-grade water that was used plant material that had been infected artificially with the to prepare the reaction mix CoDiRO strain. In this comparison, the Ct-values of the • Positive amplification control (PAC) to monitor the effi- Harper TaqMan assay in the duplex and triplex format were ciency of the amplification: DNA of X. fastidiosa, isolated largely similar. Thirdly, the [diagnostic] sensitivity of the from a suspension with approximately 104 cfu mL1. triplex assay with a Harper simplex assay was compared The gBlock containing the Harper et al. amplicon using 24 DNA extracts from spiked, artificially inoculated sequence and the Ouyang et al. amplicon sequence as and naturally infected or Xf-free plant extracts from differ- described by Bonants et al. (2019) can be used for detec- ent origins within Europe. Also in this experiment, the Ct- tion of X. fastidiosa. values of the triplex and simplex assay were largely similar The gBlock containing the Acidovorax cattleyae (Acat) indicating the same [analytical] sensitivity.’ internal control amplicon sequence as described by Bonants et al. (2019) can be used to detect the Acat internal control. Appendix 10 – Real-time LAMP test 3.2 Interpretation of results Verification of the controls: ‘The test below is described as it was carried out to gener- • The PIC and PAC amplification curves should be exponential ate the validation data provided in Section 4. Other equip- • NIC and NAC should give no amplification ment, kits or reagents may be used provided that When these conditions are met: verification (see PM 7/98) is carried out.’ • A test will be considered positive if it produces an expo- nential amplification curve 1. General information • A test will be considered negative if it does not produce 1.1 This test is suitable for the detection of X. fastidiosa in an amplification curve or if it produces a curve which is plants or insects. not exponential • 1.2 The test is based on primers developed by Harper et al. Tests should be repeated if any contradictory or unclear (2010; erratum 2013) and was modified by Yaseen et al. results are obtained. (2015). 1.3 The target sequence is located at the 16S rRNA pro- 4. Performance characteristics available cessing gene rimM of X. fastidiosa. 1.4 The following primers are used: external XF-F3 primer Data are from Bonants et al. (2019). 0 0 sequence 5 -CCGTTGGAAAACAGATGGGA-3 ;exter- 4.1 Analytical sensitivity: 10 copies of target DNA. 0 nal XF-B3 primer sequence 5 -GAGACTGGCAAGCGT 4.2 Analytical specificity (inclusivity) 0 0 TTGA-3 ;internalXF-FIPprimersequence5-ACCCCG Inclusivity: 3 strains of X. fastidiosa subsp. pauca (CoDiRo, ACGAGTATTACTGGGTTTTTCGCTACCGAGAACC CFBP 8074, CFBP 8072), 3 strains of X. fastidiosa subsp. 0 0 ACAC-3 ; internal XF-BIP primer sequence 5 -GCG multiplex (LMG 09063, CFBP 8430, CFBP 8434) and 2 strains CTGCGTGGCACATAGATTTTTGCAACCTTTCCTG of X. fastidiosa subsp. fastidiosa (LMG 17159, Temecula) 0 0 GCATCAA-3 ; loop XF-LF primer sequence 5 -TGCA were tested positively with the triplex TaqMan PCR. 0 AGTACACACCCTTGAAG-3 ; loop XF-LB primer Exclusivity: 20 strains of Xanthomonas species (including 0 0 sequence 5 -TTCCGTACCACAGATCGCT-3 . X. fragariae, X. populi, X. arboricola and X. vesicatoria)and 14 strains of other bacteria (including Pantoea, Erwinia, 2. Methods Agrobacterium, Pseudomonas, Clavibacter, Rhodococcus, Bacillus and Dickeya) did not react positively with the tri- 2.1 Nucleic acid extraction and purification plex TaqMan PCR. 2.1.1 Matrices: plants or insects (Yaseen et al., 2015). 4.3 Repeatability: dilution series of the Xylella gBlock and 2.1.2 Plant tissues (thin slices of 1-year-old twigs, 1– DNA of X. fastidiosa subsp. pauca (CoDiRo) and X. 2 mm thick) or single captured insects (whole fastidiosa subsp. multiplex (LMG 09063) were tested specimen) are immersed in 1 mL of extraction buf- many times (>10) with 100% repeatability. DNA fer (1% Triton X-100, 20 mM Tris-HCl, 20 mM extracts from infected plants were tested in duplo with EDTA) and denatured at 95°C for 10 min. triplex TaqMan PCR with the same Ct values. 2.1.3 Alternatively, DNA extracts prepared using dif- 4.4 Reproducibility: samples for repeatablity were tested by ferent extraction procedures (see Appendix 3) three different people with equal results on different days. can be used for plants or for insects, DNA Three real-time PCR thermocyclers (ABI7500, Bio-Rad extracts are prepared from insect heads using CFX384, ThermoFisher Quantstudio) were used. CTAB or Quick Pick.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 212 Diagnostics

2.1.4 Extracts of total nucleic acids can be stored at 4. Performance characteristics available from the 4°C for immediate use or at 20°C for later use. Research Centre for Plant Protection and Certification 2.2 LAMP (CREA-DC, Rome, IT) and the Institute for Sustainable 2.2.1 Ready to use kits are commercially available to Plant Protection, CNR (Bari, IT) perform the test on a specific device or using a 4.1 Analytical sensitivity data standard real-time thermal cycler (e.g. Enbiotech, Olive crude extract spiked with 10-fold dilution of Qualiplante). X. fastidiosa CoDiRO strain suspensions (from 108 to 2.2.2 PCR conditions: follow the manufacturer’s 10 cfu mL 1) (Enbiotech s.r.l. kit: 103–104 cfu mL 1). instructions. DNA (CTAB DNA extraction) from olive extracts spiked with 10-fold dilution of X. fastidiosa CoDiRO strain sus- 3. Essential procedural information pensions (from 108 to 10 cfu mL 1) (Qualiplante SAS kit, 102–103 cfu mL1; Enbiotech s.r.l. kit, 10–102 cfu mL1). 3.1 Controls 4.2 Analytical specificity data For positive controls, inactivated cultures or X. Strain numbers are available on the validation sheet in fastidiosa can be used instead of living cultures. For a reli- the EPPO Database on Diagnostic Expertise section ‘Vali- able test result to be obtained, the following (external) con- dation data for diagnostic tests’ (http://dc.eppo.int/validation trols should be included for each series of nucleic acid list.php). extraction and amplification of the target organism and tar- Exclusivity evaluated by LAMP-PCR (Enbiotech s.r.l. kit) get nucleic acid, respectively: tested on the following bacterial strains: 3 Xanthomonas • Negative isolation control (NIC) to monitor contamina- arboricola pv. pruni,1X. arboricola pv. juglandis,2 tion during nucleic acid extraction: nucleic acid extraction X. arboricola pv. fragariae,1X. arboricola pv. corylina,1 and subsequent amplification preferably of a sample of X. arboricola pv. celebensis,1Xanthomonas campestris pv. uninfected matrix, or if not available clean extraction campestris,1X. campestris pv. populi,2Xanthomonas buffer hortorum pv. pelargonii,3Pseudomonas savastanoi pv. • Positive isolation control (PIC) to ensure that nucleic acid savastanoi,1Pseudomonas marginalis,4Pseudomonas of sufficient quantity and quality is isolated: nucleic acid syringae pv. syringae,4Brenneria spp. (rubrifaciens, quercina, extraction and subsequent amplification of the plant salicis, populi), 2 Pantoea stewartii,1Pantoea agglomerans,1 matrix sample that contains the target organism (e.g. nat- Erwinia amylovora,3Agrobacterium tumefaciens, 2 urally infected host tissue or host tissue spiked with the Rhizobium vitis. No cross-reactions were observed. target organism). For a series of analyses including sam- 4.3 Data on repeatability ples from different plant species, whenever possible one Olive crude extracts spiked with 103,104,106 cfu mL 1 PIC should be included per plant species to be analysed, of X. fastidiosa in three repetitions (15 laboratories) (Enbio- or per botanical genus tech s.r.l. kit): 68%. • Negative amplification control (NAC) to rule out false DNA (CTAB DNA extraction) from olive extracts spiked positives due to contamination during the preparation of with 103,104,106 cfu mL 1 in three repetitions (15 labora- the reaction mix: amplification of molecular-grade water tories): 91%. that was used to prepare the reaction mix 4.4 Data on reproducibility • Positive amplification control (PAC) to monitor the – Olive crude extracts spiked with 103,104,106 cfu mL 1 efficiency of the amplification: DNA of X. fastidiosa, of X. fastidiosa in three repetitions (15 laboratories) (Enbio- isolated from a suspension with approximately tech s.r.l. kit): 63%. 104 cfu mL 1 DNA (CTAB DNA extraction) from olive extracts spiked 3.2 Interpretation of results with 103,104,106 cfu mL 1 of X. fastidiosa in three repeti- Verification of the controls: tions (15 laboratories): 85%. • NIC and NAC should produce no fluorescence 4.5 Diagnostic sensitivity • PIC and PAC: for real-time measurement, a positive reac- Olive crude extract spiked with 103,104,106 cfu mL 1 tion is defined by time of positivity (minutes) and/or of X. fastidiosa in three repetitions (15 laboratories) (Enbio- melting temperature (TM) (°C known variation) as tech s.r.l. kit): 70%. given by the manufacturer. DNA (CTAB DNA extraction) from olive extracts spiked When these conditions are met: with 103,104,106 cfu mL 1 of X. fastidiosa in three repeti- • A test will be considered positive as defined for PIC and tions (15 laboratories) (Enbiotech s.r.l. kit): 90%. PAC reactions (see above) 4.6 Diagnostic specificity • A test will be considered negative, if it produces no fluo- Olive crude extract spiked with 103,104,106 cfu mL 1 rescence. in three repetitions (15 laboratories) (Enbiotech s.r.l. kit): • Tests should be repeated if any contradictory or unclear 97%. results are obtained.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 213

DNA (CTAB DNA extraction) from olive extracts spiked kits or reagents may be used provided that verification (see with 103,104,106 cfu mL1 in three repetitions (15 labora- PM 7/98) is carried out. tories) (Enbiotech s.r.l. kit): 100%. 4.7 Accuracy 1. General information Olive crude extract spiked with 103,104,106 cfu mL 1 in three repetitions (15 laboratories) (Enbiotech s.r.l. kit): 77%. 1.1 This test is suitable for the detection of X. fastidiosa in DNA (CTAB DNA extraction) from olive extracts spiked plants and cultures. The test has not been evaluated on with 103,104,106 cfu mL1 in three repetitions (15 labora- insects. tories) (Enbiotech s.r.l. kit): 92%. 1.2 This test was developed by Li et al. (2016). 4.8 Additional validation data 1.3 The target sequence is located in the disulphide iso- 17-XFAST-EU interlaboratory TPS for the evaluation of merase gene. The probe and primer sequences are pro- molecular methods to detect Xylella fastidiosa in the vector tected by IP. Philaenus spumarius, available at: https://upload.eppo.int/d ownload/268obc05d6355. 2. Methods 2.1 Sample preparation LAMP 2.1.1 Place 300–500 mg of petioles in AMP1 buffer at a 1:10 weight to volume ratio. Grind the petioles Harper et al. (2010) modified by Yaseen et al. (2015), no cut-off using a marker pen and let AMP1 buffer lyse the bacterial cells for 10 min. Thermocycler Portable device 2.1.2 Prior to testing, dilute the extract 1:200 in PD1. 2.1.3 Rehydrate the pellet with 25 lL of the diluted Quick Quick PD1 extract. TPS performance criteria PickTM CTAB PickTM CTAB 2.2 Test procedure Diagnostic % 82.14 89.58 100.00 97.50 2.2.1 Xf AmplifyRP XRT+ kits are commercially sensitivity % (restricted 95.83 89.58 100.00 97.50 available to perform real-time tests (20 min) on series)* a portable fluorometer (AmpliFire, Douglas Sci- No. of labs 3301 entific). with false + negatives 2.2.2 Xf AmplifyRP XRT kits are commercially Diagnostic % 100.00 95.83 100.00 100.00 available to perform end-point tests (20 min) on specificity % (restricted 100.00 100.00 100.00 100.00 a portable heat block (Agdia) followed by plac- series)† ing the completed reaction inside an amplicon No. of labs 0010 detection chamber (20 min) that houses a lateral with false flow strip. positive Accuracy % 88.10 91.67 100.00 98.33 % (restricted 98.33 93.33 100.00 98.33 3. Essential procedural information series)‡ 3.1 Controls Repeatability % 98.61 95.83 100.00 100.00 Reproducibility % 78.13 87.24 100.00 95.50 3.1.1 Negative control 1 (AMP1 buffer): to monitor % (restricted 97.63 92.00 100.00 95.50 contamination. series)§ 3.1.2 Negative control 2 (healthy host tissue): to rule No. of labs 7 6 2 5 out possible background reaction caused by plant tissue. *Results of one laboratory excluded (systematic false negatives). †Results of one laboratory excluded (high number of false positives, 3.1.3 Positive control (inactivated X. fastidiosa bacte- about 40% on healthy insects). rial culture or infected leaf petioles). ‡Results of two laboratories excluded: one had a high number of false 3.2 Interpretation of results positives (about 40% on healthy insects) and another gave systematic 3.2.1 Real-time test result is available next to the well false negatives. designation on the screen: § Results of three laboratories excluded: one had a high number of false (+) = positive for X. fastidiosa positives (about 40% on healthy insects), one had only one repetition (–) = X. fastidiosa not detected for amplification and a third laboratory gave systematic false negatives. (!) = invalid. 3.2.2 End-test result shown on lateral flow strip: Appendix 11 – The Xf AmplifyRP XRT test Positive = control and test lines are both visible (Li et al., 2016) Negative = control line is visible and test line is not vis- The test below is described as it was carried out to generate ible = the validation data provided in Section 4. Other equipment, Invalid control line not visible.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 214 Diagnostics

B4.3 Data on repeatability 4. Performance criteria available 100% detection was obtained for X. fastidiosa-infected (A) Data from INRA (Angers, FR) grapevine, almond and blueberry in the laboratory across Additional data is available in the validation sheet in the 14 replicates for each sample preparation of each spe- EPPO Database on Diagnostic Expertise section ‘Validation cies. data for diagnostic tests’ (http://dc.eppo.int/validationlist.php). B4.4 Data on reproducibility A4.1 Analytical sensitivity (X. fastidiosa cell suspensions 100% detection was obtained for X. fastidiosa-infected spiked in crude petiole extract) grapevine, almond and blueberry in the laboratory across three sample preparations for each species. 6 5 4 3 2 10 cfu 10 cfu 10 cfu 10 cfu 10 cfu B4.5 Diagnostic sensitivity 1 1 1 1 1 Samples mL mL mL mL mL The Xf XRT+ sensitivity was compared with real-time + Prunus dulcis 100 100 89 0 0 PCR. Three replicates for both Xf XRT and real-time Quercus sp. 100 83 50 50 0 PCR were conducted. Xf XRT+ used crude grape petiole Polygala 100 100 22 0 0 extract with spiked X. fastidiosa genomic DNA as tem- myrtifolia plate, whereas real-time PCR used X. fastidiosa genomic Nerium 100 100 83 17 0 DNA as a template. Testing the serial dilutions showed oleander that Xf XRT+ tested positive for samples (6 copies Prunus 89 100 89 11 0 – cerasifera X. fastidiosa genomic DNA) that showed Ct 36 37 for Lavandula sp 100 100 67 17 0 real-time PCR. Olea europaea 100 100 100 17 0 B4.6 Diagnostic specificity Vitis vinifera 100 83 83 17 0 Dr Giuliana Loconsole evaluated the Xf XRT+ kit at Helichrysum 100 100 67 33 0 CNR – Institute of Sustainable Plant Protection (Bari, IT) italicum and confirmed that the kit detected six infected olives (one Citrus 100 100 67 50 0 with Ct 22–24, one with Ct 26). Two healthy olives tested clementina negative.

A4.2 Analytical specificity Appendix 12 – Buffers and media Inclusivity: 100% the test was evaluated with 23 target strains of X. fastidiosa. All buffers and media should be sterilized by autoclaving at ° Exclusivity: 100% no cross-reaction with 30 non-target 121 C for 15 min unless stated otherwise. stains. (A) Buffers A4.3 Repeatability (in progress November 2018) A4.4 Reproducibility (in progress November 2018) Sterile succinate–citrate–phosphate buffer

Disodium succinate (Na2C4H4O4) 1.0 g (B) Data provided by AGDIA Trisodium citrate (C6H5Na3O7) 1.0 g

B4.1 Analytical sensitivity data K2HPO4 1.5 g

The limit of detection (LoD): 22 copies of X. fastidiosa KH2PO4 1.0 g genomic DNA spiked in crude petiole extract Distilled water to 1 L Adjust pH to 7.0 before autoclaving

Positive samples/ Plant species Extraction buffer Host tissue total samples PBS (19)

Citrus AMP1 Petiole/midrib 52/52 NaCl 8 g Vitis vinifera AMP1 Petiole 12/12 KCl 0.2 g • Prunus dulcis AMP1 Petiole/midrib 12/12 Na2HPO4 12H2O 2.9 g Olea europaea AMP1 Petiole/midrib 12/12 KH2PO4 0.2 g Distilled water to 1 L Adjust pH to 7.2 before autoclaving B4.2 Analytical specificity data 4.2.1.1 The test reacts to all X. fastidiosa isolates col- lected by Agdia Inc. Phosphate buffer (0.01 M PB) 4.2.1.2 The test does not react to closely related bacte- rial species. Na2HPO4 (anhydrous) 4.26 g 4.2.1.3 The test does not react to host leaf tissue such KH2PO4 2.72 as Citrus, Vitis vinifera, Prunus dulcis, Olea Distilled water to 1 L Adjust pH to 7.0 before autoclaving europaea, Coffea spp. and Vaccinium spp.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 215

CTAB buffer* Modified BCYE medium (continued)

CTAB 2.0 g Component (supplier/order no.) Quantity TRIS (1 M autoclaved solution pH 8.0) 10 mL EDTA (0.5 M autoclaved solution pH 8.0) 4.0 mL Agar no. 1 (Oxoid/LP011 or Bacto 17 g NaCl (5 M autoclaved solution) 28 mL agar BD DifcoTM/214010) PVP-40 1.0 g Agitate for at least 1 min. The final Distilled sterile water to make up to 100 mL pH is approximately 6.9 Cysteine hydrochloride 5mL *Do not autoclave. It is recommended to keep the buffer for no longer (Sigma/C-7880) than 1 week. Ferric pyrophosphate 15 mL TE buffer (100 mL) (Sigma/P-6526) *Adjust the pH to 6.9 before adding the agar. This is done by adding TRIS (1 M solution pH 8.0) 1.0 mL approximately 40 mL KOH 1 M until the appropriate pH value is reached. EDTA (0.5 M solution pH 8.0) 0.2 mL Adjust the total volume to 980 mL with the demineralized water. Distilled water to 100 mL Stock solutions (filter sterile)

Component Final (B) Media (supplier/order no.) per L Concentration Dissolve in Ingredients should be dissolved in the order given. Cysteine hydrochloride 400 mg 400 mg per 5 mL Distilled water • PD2 medium (Davis et al., 1980) (this medium can be (Sigma/C-7880) used for the isolation of X. fastidiosa from several host Ferric pyrophosphate 250 mg 250 mg per 15 mL Distilled water plants including grapevine) (Sigma/P-6526)

The compound ferric pyrophosphate needs to be heated, under Soy peptone (BD DifcoTM, 0436-01) 2.0 g agitation, at 75°C for approximately 15–20 min. Bacto tryptone (Oxoid, LP0042) 4.0 g Disodium succinate 1.0 g • Modified PWG medium [Anses, based on Hill & Purcell (Sigma, S-2378) (1995) and information provided at the COST Workshop Trisodium citrate (Sigma, S-4641) 1.0 g – Bari 2010 (R. Almeida, pers. comm.)] K2HPO4 1.5 g KH2PO4 1.0 g Gelrite gellan gum (GelzamTM CM; Sigma G 1910) 9.0 g Hemin chloride stock solution 10.0 mL Phytone peptone (BD/211906) 4.0 g (0.1% in 0.05 N NaOH) Bacto tryptone (Fisher Scientific 1.0 g (Sigma, H-5533) 11778143 = BD DifcoTM 211705) Microbiological grade 15.0 g MgSO4•7H2O 0.4 g agar (Oxoid, K2HPO4 1.2 g LP0028 or Bacto KH2PO4 1.0 g TM agar BD Difco ) Stock solution of red phenol (0.2% aqueous 10 mL • MgSO4 7H2O 1.0 g solution), see below Sterile distilled or 1.0 L Stock solution of hemin chloride 10 mL deionized water to (0.1% solution NaOH 0.05 N) Adjust pH to 6.9 Sterile distilled or deionized water 830 mL BSA fraction V (20% w/v)* 10.0 mL BSA (Sigma Aldrich, A7030) 3 g (Sigma Aldrich, A7030) L-glutamine (Sigma Aldrich, G3126) 4 g

*Bovine serum albumin is filter-sterilized and added to the rest of the Use a 2-L bottle and autoclave at approximately 121°C for 20 min. ° medium at 50 C after autoclaving. Ingredients except BSA and L-glutamine are added mixed and dissolved in the order given. After autoclaving, allow the temperature to cool to 50°C and under a horizontal air flow add filtered sterile BSA dissolved in 50 mL of Modified BCYE medium deionized water and L-glutamine dissolved in 100 mL of water at about 50°C. Component (supplier/order no.) Quantity Stock solution of red phenol Demineralized water 940 mL Aces buffer (Sigma/A-3594) 10 g Red phenol (0.2% aqueous solution) 50 mg KOH solution 1 M 40 mL* Sterile distilled or deionized water 25 mL TM Yeast extract (BD Difco /212750) 10 g Store for a maximum of 1 month at 5 4°C Activated charcoal (Sigma/C-9157) 2 g In case of solubility problems in water, dissolving in 70% ethanol is (continued) possible.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 216 Diagnostics

Stock solution of hemin chloride 2. Isolation from several leaves, option 2: up to 10 g of Hemin chloride (0.1% solution NaOH 0.05 N) 50 mg tissue collected from 100–200 leaves Solution NaOH 0.05 N 50 mL – Store for a maximum of 1 month at 5 4°C For each sample, up to 10 g of tissue collected from 100 200 leaves (petioles and midribs or basal leaf portions) is used. Plant material is disinfected by soaking in a bleach solu- tion (0.5% for 5 min or 2% for 2 min), then rinsed three times with sterile water. The plant material is then dried in Appendix 13 – Isolation procedures tissue paper and briefly disinfected with 70% alcohol. Then Isolation procedures as currently implemented in different the material is dried in a flow cabinet. After disinfection, laboratories are presented below. No comparison of these the plant material is crushed in a stomacher bag. Forty procedures has been performed. Consequently, no recom- millilitres of buffer (PBS 0.01 M, see Appendix 12) is mendation can be made so far regarding the advantages and added and agitated for approximately 30 min at room tem- disadvantages of different procedures. perature. The required volume of the extract for screening The conditions for surface disinfection can vary accord- and for isolation is directly used from the extract obtained ing to the plant tissue, the most commonly used procedures after the agitation step. The remaining extract volume is are reported below. subsequently concentrated (centrifugation for 20 min at The implementation of an additional ultrasonication step 10 000 g and 4°C) and resuspended in 1.5 mL PB 0.01 M. before plating has been shown to increase the success of This concentrated extract is also used for screening and for isolation. Ultrasonication is performed on crushed plant isolation. In both cases, i.e. non-concentrated and concen- material at a frequency of 40 kHz for 30 s. Durations of 45 trated extract, isolation is performed by preparation of serial s and 60 s have been tested but duration does not influence dilutions (non-diluted; 1:10; 1:100) and plating on the the number of isolates obtained (Bergsma-Vlami et al., specific medium. Incubation should be done at approxi- 2017). mately 28°C, and plates monitored for colony development for up to 6 weeks. Plates should be sealed or kept in plastic bags to prevent desiccation. 1. Isolation from several leaves, option 1: 0.5–1gof tissue 3. Isolation from individual leaves For each sample, at least 0.5–1 g of tissue (petioles and After disinfection of the leaf with 70% (v/v) ethanol, a peti- midribs or basal leaf portions) is used. ole or midrib approximately 1 cm long is collected with a Soak sequentially the leaf midribs, petioles or twigs in a sterile scalpel. Symptomatic leaves should be used for pref- bleach solution (e.g. 2% for 2 min or 0.5% for 5 min) fol- erence, if available. The midrib or petiole is briefly soaked lowed by immersion in 70% ethanol for 2 min then three in ethanol at 96% (v/v) and flamed very quickly to achieve rinses in sterile distilled water. surface disinfection without causing a significant tempera- After surface sterilization, tissues are cut into pieces, ture rise in the tissues which could kill the bacteria. The placed in a mortar or in a container/test tube with sterile sample is immediately placed in a sterile Petri dish with 1– succinate–citrate–phosphate buffer or PBS (see 2 mL of sterile saline solution or sterile demineralized Appendix 12) at a ratio of 1:10 (w:v). Tissues are then water, comminuted and left to soak for at least 15 min, ground with a homogenizer (Polytron, Homex, etc.). An under gentle shaking. One hundred microlitres of the mac- aliquot of 100 lL of sap is added to 900 lL of sterile erate is plated without dilutions. Plates should be sealed or succinate–citrate–phosphate buffer or PBS and used to kept in plastic bags to prevent desiccation. prepare a serial 10-fold dilution (up to 105). Aliquots of l 2 3 4 100 Lof10 ,10 ,10 dilutions are then plated on Appendix 14 – Multilocus sequence typing ° the specific media, incubated at approximately 28 C and (MLST) (Yuan et al.,2010) monitored for colony development over 6 weeks. Plates should be sealed or kept in plastic bags to prevent desic- The test below is described as it was carried out to generate cation. the validation data provided in Section 4. Other equipment, An alternative procedure can also be followed for isolation kits or reagents may be used provided that verification (see from twigs and branches. A branch (4–5 cm long) is surface PM 7/98) is carried out. sterilized and cut in the middle, the internal cut ends are squeezed with a pair of pliers and the sap blotted onto agar 1. General information plates. BCYE medium is the most commonly used medium with this procedure (Coletta-Filho & Machado, 2003). Plates 1.1 This test is suitable for the assignment of an isolate to are then incubated as described above. one of the known subspecies using DNA from a pure

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 217

bacterial culture. It has been used with DNA from 2.1.4 Extracts of total nucleic acids can be stored at 4°C plant extracts (Loconsole et al., 2016;. Bergsma-Vlami for immediate use or at 20°C for further use. et al., 2017; Denance et al., 2017) or insects. However, it is recognized that the quantity and quality of target 2.2 PCR for MLST (for pure cultures) DNA, or the occurrence of possible mixed infections, 2.2.1 Master mix (per reaction) may prevent all amplicons from being obtained or a clear assignment of subspecies. This is also more diffi- Volume cult for insects than for plant extracts (low concentra- Working per reaction Final l tion of bacteria and limited amount of DNA from a Reagent concentration ( L) concentration single insect). Molecular-grade water* N.A. 35.9 N.A. 1.2 The test on pure culture is based on Yuan et al. PCR buffer (Invitrogen) 109 519 (2010). Modifications may be needed for DNA from MgCl2 50 mM 1.5 1.5 mM –1 –1 plant extracts (see Section 2.3 of this appendix). BSA (non-acetylated) 50 lg lL 0.3 0.3 lg lL 1.3 The target sequences are those of seven housekeeping DNTPs 20 mM 0.5 0.2 mM Forward primers 20 lM 0.75 0.3 lM genes amplified individually: 2-isopropylmalate syn- (leuA-for/petC-for/ thase (leuA); ubiquinol cytochrome c oxidoreductase malF-for, cysG-for/ C1 subunit (petC); ABC transporter sugar perme- holC-for/nuoL-for/ ase (malF); sirohaem synthase (cysG); DNA poly- gltT-for) merase III holoenzyme chi subunit (holC); NADH- Reverse primers 20 lM 0.75 0.3 lM ubiquinone oxidoreductase NQO12 subunit (nuoL); and (leuA-rev/petC-rev/ malF-rev/, cysG-rev/ glutamate symport protein (gltT). holC-rev/nuoL-rev/ 1.4 Amplicon size (without primers): 708 bp for leuA, gltT-rev) 533 bp for petC, 730 bp for malF, 600 bp for cysG, DNA Polymerase 5UlL1 0.3 0.03 U lL1 379 bp for holC, 557 bp for nuoL, 654 bp for gltT. Platinum (Invitrogen) 1.5 The sequences for the primers are as follows: Subtotal 45 Genomic DNA 5 Total 50

Forward primers Reverse primer *Molecular-grade water should preferably be used, or prepared purified (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and 0 0 leuA-for 5 -GGTGCACGCCA leuA-rev 5 -GTATCGTTGTGGCGT nuclease-free water. AATCGAATG-30 ACACTG-30 petC-for 50-GCTGCCATTCG petC-rev 50-GCACGTCCTCCCAAT 2.2.2 PCR conditions (for pure cultures) TTGAAGTACCT-30 AAGCCT-30 95°C for 3 min, 35 cycles of (95°C for 30 s, 65°C for 30 malF-for 50-TTGCTGGTCCT malF-rev 50-GACAGCAGAAGCAC s and 72°C for 60 s) and a final step of 72°C for 10 min. If GCGGTGTTG-30 GTCCCAGAT-30 0 0 the amplicons are of good quality and at the expected size, cysG-for 5 -GCCGAAGCAGT cysG-rev 5 -GCCATTTTCGATCAG a template should be sent for sequencing with reverse and GCTGGAAG-30 TGCAAAAG-30 holC-for 50-ATGGCACGCGC holC-rev 50-ATGTCGTGTTTGTTC forward primers. The results of sequencing should be com- CGACTTCT-30 ATGTGCAGG-30 pared with available sequences on http://pubmlst.org/xfas nuoL-for 50-TAGCGACTTAC nuoL-rev 50-ACCACCGATCCACA tidiosa/ (Scally et al., 2005). GGTTACTGGGC-30 ACGCAT-30 2.3 DNA from plant extracts or insects 0 0 gltT-for 5 -TCATGATCCAAA gltT-rev 5 -ACTGGACGCTGCCTC The test should be performed as described in Section 2.2 0 0 TCACTCGCTT-3 GTAAACC-3 above. If erratic amplification occurs, the following PCR parameters can be adjusted: dilution of the DNA extract (to 1.6 The workflow is described in the PubMLST limit inhibition) or increase of DNA input, use of a differ- X. fastidiosa database (http://pubmlst.org/xfastidiosa). ent Taq polymerase/master mix, decrease of annealing tem- perature from 65°Cto60°Cor58°C or increase of primer concentration from 0.3 to 0.5 lM. 2. Methods 3. Essential procedural information 2.1 Nucleic acid extraction and purification 2.1.1 Nucleic acid source: pure culture plant extract or 3.1 Controls insects. For positive controls inactivated cultures of X. 2.1.2 For pure cultures, a single colony of a fresh pure cul- fastidiosa can be used instead of living cultures. For a reli- ture is resuspended in 0.9 mL of PCR-grade water; able test result to be obtained the following (external) con- lysis should be performed at 100°Cfor5min. trols should be included for each series of nucleic acid 2.1.3 See Appendix 3 for extraction procedures from extraction and amplification of the target organism and tar- plants and insects. get nucleic acid, respectively:

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 218 Diagnostics

• Negative isolation control (NIC) to monitor cross-reaction A table of correspondence between sequence types (ST) with the host tissue and/or contamination during nucleic and subspecies is presented below. acid extraction: nucleic acid extraction and subsequent amplification preferably of a sample of uninfected matrix or, if not available, clean extraction buffer 4. Performance characteristics available • Positive isolation control (PIC) to ensure that nucleic acid Data generated during an intra-laboratory study performed at of sufficient quantity and quality is isolated: nucleic acid Anses. Additional data available in the validation sheet in the extraction and subsequent amplification of the plant EPPO Database on Diagnostic Expertise section ‘Validation matrix sample that contains the target organism (e.g. nat- data for diagnostic tests’ (http://dc.eppo.int/validationlist.php). urally infected host tissue or host tissue spiked with the 4.1 Analytical sensitivity target organism). For a series of analyses including sam- Pure cultures (DNA after thermal lysis): 100% detection ples from different plant species, whenever possible one at 105–106 bacteria mL–1 PIC should be included per plant species to be analysed, Plant extracts: or per botanical genus Two intra-laboratory test performance studies have been • Negative amplification control (NAC) to rule out conducted with a preparation of spiked samples (range 103– false positives due to contamination during the prepara- 106 bacteria mL–1): tion of the reaction mix: amplification of molecular-grade • One (TPS-A) with Polygala myrtifolia, Cistus water that was used to prepare the reaction mix monspeliensis, Helichrysum italicum (the most common • Positive amplification control (PAC) to monitor the effi- X. fastidiosa-infected hosts in France): effect of DNA ciency of the amplification: DNA of X. fastidiosa, isolated dilution on Yuan et al. (2010) PCR sensitivity 5 1 from a suspension with approximately 10 cfu mL . • One (TPS-B) with Lavandula 9 intermedia, Rosmarinus 3.2 Interpretation of results officinalis, Helichrysum italicum [hosts in France with the high- In order to assign results from PCR-based tests the fol- est concentration of inhibitors affecting the Yuan et al. (2010) lowing criteria should be used: PCR]: effect of BSA addition on PCR Yuan sensitivity. Verification of the controls for each PCR: Effect of DNA dilution on the analytical sensitivity of • NIC and NAC should produce no amplicons the Yuan et al. (2010) PCR (detection threshold) without • PIC and PAC should produce amplicons of the relevant the addition of BSA (TPS-A) size (leuA = 749, petC = 576, malF = 773, cysG = 642, holC = 412, nuoL = 599, gltT = 698). When these conditions are met: PCR Yuan/7 genes DNA dilution Detection threshold (100%) • Sequencing is performed when the expected amplicons are produced (see point 1.4) Helichrysum italicum Undiluted DNA No detection (106) – • Subspecies assignment is not possible if no band, a different Diluted 1/10 105 bacteria mL 1 4 –1 number of bands or band(s) of a different size are produced Cistus monspeliensis Undiluted DNA 10 bacteria mL Diluted 1/10 105 bacteria mL–1 • The test should be repeated or adjusted (see Section 2.3) – Polygala myrtifolia Undiluted DNA 104 bacteria mL 1 if any contradictory or unclear results are obtained. Diluted 1/10 105 bacteria mL–1 3.3 Interpretation of sequencing results

ST leuA petC malF cysG holC nuoL gltT Clonal complex Reference

11 1 1 1 1 1 1 fastidiosa Yuan et al. (2010) 21 1 4 1 1 1 1 fastidiosa Yuan et al. (2010) 3 1 1 1 20 1 1 1 fastidiosa Yuan et al. (2010) 41 1 1 4 1 1 1 fastidiosa Yuan et al. (2010) 52 2 2 2 2 2 2 sandyi Yuan et al. (2010) 63 3 3 3 3 3 3 multiplex Yuan et al. (2010) 73 3 3 7 3 3 3 multiplex Yuan et al. (2010) 83 3 5 5 4 3 7 multiplex Nunney et al. (2013) 93 3 5 5 4 3 4 multiplex Yuan et al. (2010) 10 5 4 3 3 6 3 5 multiplex Yuan et al. (2010) 11 7 7 7 9 10 8 8 pauca Nunney et al. (2010) 12 7 7 7 9 13 8 8 pauca Nunney et al. (2012b) 13 7 6 7 9 10 7 8 pauca Yuan et al. (2010)

(continued)

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 219

Table (continued)

ST leuA petC malF cysG holC nuoL gltT Clonal complex Reference

14 8 8 8 11 12 9 9 pauca Yuan et al. (2010) 15 5 3 3 3 4 3 5 multiplex Nunney et al. (2013) 16 7 6 8 10 11 8 8 pauca Nunney et al. (2010) 17 1 1 10 12 18 10 1 fastidiosa Nunney et al. (2010) 18 9 1 9 13 14 5 10 fastidiosa Nunney et al. (2010) 19 10 1 10 14 15 11 1 fastidiosa Nunney et al. (2010) 20 1 1 10 12 17 11 11 fastidiosa Nunney et al. (2010) 21 10 1 10 14 15 11 12 fastidiosa Nunney et al. (2010) 22 3 3 5 12 4 3 3 multiplex Nunney et al. (2013) 23 3 3 5 3 6 3 3 multiplex Nunney et al. (2013) 24 3 3 5 3 4 3 7 multiplex Nunney et al. (2013) 25 3 3 3 17 3 3 3 multiplex Nunney et al. (2013) 26 5 3 3 3 6 3 5 multiplex Yuan et al. (2010) 27 6 3 5 6 7 3 7 multiplex Nunney et al. (2013) 28 6 3 5 18 7 4 7 multiplex Nunney et al. (2013) 29 4 3 6 18 5 4 3 morus Nunney et al. (2014b) 30 4 5 6 8 5 4 3 morus Nunney et al. (2014b) 31 4 3 6 18 8 6 3 morus Nunney et al. (2014b) 32 4 3 5 12 4 4 3 multiplex Nunney et al. (2013) 33 11 9 14 15 19 13 10 fastidiosa/sandyi Yuan et al. (2010) 34 3 3 3 3 3 3 6 multiplex Nunney et al. (2013) 35 3 10 3 3 3 3 3 multiplex Nunney et al. (2013) 36 5 3 5 19 6 3 5 multiplex Nunney et al. (2013) 37 3 3 5 21 4 3 3 multiplex Nunney et al. (2013). 38 3 3 5 16 4 3 7 multiplex Nunney et al. (2013) 39 3 3 5 19 4 3 7 multiplex Nunney et al. (2010) 40 6 3 5 18 7 3 7 multiplex Nunney et al. (2013) 41 3 3 5 18 9 3 3 multiplex Nunney et al. (2013) 42 6 3 5 12 4 3 3 multiplex Nunney et al. (2013) 43 3 3 5 18 4 3 7 multiplex Nunney et al. (2013) 44 3 3 5 5 6 3 4 multiplex Nunney et al. (2013) 45 3 3 5 3 4 3 3 multiplex Nunney et al. (2013) 46 5 3 3 3 6 3 3 multiplex Nunney et al. (2013) 47 13 1 10 23 20 5 1 fastidiosa Nunney et al. (2010) 48 3 3 12 3 6 3 3 multiplex Nunney et al. (2013) 49 3 3 5 3 6 3 7 multiplex Nunney et al. (2013) 50 3 11 13 22 21 14 13 multiplex Nunney et al. (2013) 51 3 3 5 3 4 15 3 multiplex Nunney et al. (2013) 52 10 1 10 14 18 10 1 fastidiosa Nunney et al. (2010) 53 7 6 16 24 10 16 14 pauca Nunney et al. (2014a) 54 11 9 11 25 19 12 1 fastidiosa/sandyi Nunney et al. (2010) 55 1 1 10 12 18 10 10 fastidiosa Nunney et al. (2010) 56 11 9 11 15 17 12 10 fastidiosa/sandyi Nunney et al. (2010) 57 1 1 10 12 18 11 11 fastidiosa Nunney et al. (2010) 58 6 3 5 12 4 3 7 multiplex Nunney et al. (2013) 59 9 1 9 13 14 5 1 fastidiosa L. Nunney (pers. comm.) 60 9 1 1 13 14 5 1 fastidiosa L. Nunney (pers. comm.) 61 11 9 11 15 16 12 10 fastidiosa/sandyi Nunney et al. (2014a) 62 4 3 6 18 5 6 3 morus Nunney et al. (2014b) 63 5 6 3 3 6 3 5 multiplex Coletta-Filho et al. (2017) 64 7 7 7 9 10 7 8 pauca Coletta-Filho et al. (2017) 65 7 6 7 9 10 8 8 pauca Coletta-Filho et al. (2017) 66 7 8 8 10 11 8 8 pauca Coletta-Filho et al. (2017) 67 5 3 8 3 12 3 5 multiplex Coletta-Filho et al. (2017) 68 14 8 8 11 12 9 8 pauca Coletta-Filho et al. (2017) 69 7 6 7 9 23 17 8 pauca Coletta-Filho et al. (2017) 70 14 7 8 11 22 9 8 pauca Coletta-Filho et al. (2017)

(continued)

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 220 Diagnostics

Table (continued)

ST leuA petC malF cysG holC nuoL gltT Clonal complex Reference

71 5 8 8 11 12 9 9 pauca Coletta-Filho et al. (2017) 72 12 12 15 26 24 18 1 sandyi Loconsole et al. (2016) 73 7 6 8 27 10 16 8 pauca Loconsole et al. (2016) 74 7 6 8 28 25 16 8 pauca Jacques et al. (2016) 75 9 1 10 29 1 19 1 fastidiosa Jacques et al. (2016) 76 12 13 15 26 24 18 1 sandyi Loconsole et al. (2016) 77 1 1 6 30 26 5 1 fastidiosa Bergsma-Vlami et al. (2017) 78 7 6 7 9 23 8 8 pauca Tolocka et al. (2017) 79 3 3 3 26 3 3 3 multiplex Denance et al. (2017) 80 7 6 17 31 10 16 15 pauca B. Landa (pers. comm.) 81 3 3 3 32 3 3 3 multiplex B. Landa (pers. comm.) 82 3 3 5 12 4 3 16 multiplex Ferguson (2016) 83 6 3 5 33 7 4 7 multiplex Ferguson (2016) 84 7 6 7 34 10 20 8 pauca Safady et al. (2019) 85 7 6 8 10 10 8 8 pauca Safady et al. (2019) 86 7 6 8 10 11 20 8 pauca Safady et al. (2019) 87 5 3 5 3 3 21 3 multiplex Marchi et al. (2019), Saponari et al. (2019)

Effect of the addition of BSA on the analytical sensitivy of 4.3 Repeatability (criteria calculated for a target concen- the Yuan et al. (2015) PCR (detection threshold) (TPS-B) tration higher than or equal to the detection thresh- old) BSA 0.3 TPS-A: –1 PCR Yuan/7 genes lg lL Detection threshold (100%) • undiluted DNA: 100% (Polygala, Cistus, Helichrysum)

6 • 1/10 diluted DNA: 100% (Polygala, Cistus, Helichrysum italicum Without Not reached (68% for 10 bacteria mL–1) Helichrysum) Undiluted DNA With 104 bacteria mL–1 (89% for 103 TPS-B: – bacteria mL 1) • without BSA: between 70.4% (Helichrysum/malF), 6 Rosmarinus officinalis Without Not detected (86% for 10 85.2% (Helichrysum/petC/holC/nuoL; Rosmarinus / –1 bacteria mL ) leuA/petC/malF/cysG/gltT) and 100% (other genes Undiluted DNA With 105 bacteria mL–1 (98% for 104 – on Helichrysum and Rosmarinus, all genes on bacteria mL 1) Lavandula 9 intermedia Without 106 bacteria mL–1 (89% for 105 Lavandula) –1 bacteria mL–1) • with 0.3 lg lL BSA: 100% (Helichrysum, Rosmarinus, Undiluted DNA With 104 bacteria mL–1 (94% for 103 Lavandula). – bacteria mL 1) 4.4 Reproducibility (criteria calculated for a target con- centration higher than or equal to the detection It is important to note that the addition of BSA con- threshold) tributes to a better quality of the amplicon and, conse- TPS-A: quently, to sequencing success. A figure with pictures of • undiluted DNA: 100% (Polygala, Cistus, Helichrysum) gels is shown in Fig. 28. • 1/10 diluted DNA: 100% (Polygala, Cistus, Helichrysum) Further information is available in the EPPO Database TPS-B on Diagnostic Expertise section ‘Validation data for diag- • without BSA: between 56% (Helichrysum/leuA/malF/ nostic tests’ (http://dc.eppo.int/validationlist.php). cysG/gltT) and 100% (other genes Helichrysum; all 4.2 Analytical specificity (same results with/without BSA) genes on Rosmarinus, Lavandula) Inclusivity evaluated with 14 target strains (all sub- • with 0.3 lg lL1 BSA: 100% (Helichrysum, species): 100%. Rosmarinus, Lavandula). Exclusivity evaluated with 39 non-target strains (24 plant 4.5 Other informationInformation on diagnostic sensitivity pathogenic bacteria and 15 saprophytes): 100%. and specificity is available from the validation sheet For details see the validation sheet in the EPPO Database in the EPPO Database on Diagnostic Expertise sec- on Diagnostic Expertise section ‘Validation data for tion ‘Validation data for diagnostic tests’ (http://dc.e diagnostic tests’ (http://dc.eppo.int/validationlist.php).) ppo.int/validationlist.php).

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 221

Naturally infected undiluted1/10 1/100 1/10 with BSA samples

Lavandula sp Ct:26

Lavandula sp Ct:28-29

Cistus monspelliensis Ct:30

Lavandula sp Ct:30

Fig. 28 Pictures of gels for different plant species with and without BSA.

2.1.2 See Appendix 3 for extraction procedures from Appendix 15 – Conventional PCR (Pooler & plants. Hartung, 1995) 2.1.3 For pure cultures, a single colony of a fresh pure 1. General information culture is suspended in 0.9 mL of PCR-grade water; lysis should be performed at 100°C for 5 min. 1.1 This conventional PCR is suitable for the detection and 2.1.4 Extracts of total nucleic acids can be stored at identification of X. fastidiosa and assignment of subsp. 4°C for immediate use or at 20°C for further pauca in planta or for an isolate. There is little experi- use. ence for insects (low concentration of bacteria and lim- 2.2 Conventional PCR ited amount of DNA from a single insect). 2.2.1 Master mix 1.2 The test is based on Pooler & Hartung (1995). 1.3 The primers target a gene coding for a hypothetical Volume protein (BLASTing; CVC strain X. fastidiosa 9a5c). Working per Final 1.4 Amplicon size: 500 bp. Reagent concentration reaction (lL) concentration 1.5 Primers Molecular-grade water* N.A. 18.3 N.A. Taq DNA polymerase 109 2.5 19 Forward primer CVC-1 50-AGATGAAAACAATCATGCAAA-30 buffer (Invitrogen) Reverse primer 272-2-Int 50-GCCGCTTCGGAGAGCATTCCT-30. MgCl2 50 mM 0.75 1.5 mM dNTPs 20 mM 0.25 0.2 mM Forward 20 lM 0.5 0.4 lM 2. Methods primer (CVC-1) 20 lM 0.5 0.4 lM 2.1 Nucleic acid extraction and purification 2.1.1 Tissue source: plant, pure culture suspension or (continued) insects.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 222 Diagnostics

Master mix (continued) isolated from a suspension with approximately 105 cfu mL1. Volume 3.2 Interpretation of results Working per Final Verification of the controls: Reagent concentration reaction (lL) concentration • NIC and NAC should produce no amplicons • PIC and PAC should produce amplicons of the expected Reverse primer (272-2-Int) size. Platinum Taq DNA 5UlL1 0.2 0.04 U lL1 When these conditions are met: polymerase (Invitrogen) • A test will be considered positive if amplicons of 500 bp Subtotal 23 are produced Genomic DNA from 2 • A test will be considered negative if it produces no band plant extract (final or band(s) of a different size concentration and its • Tests should be repeated if any contradictory or unclear 10- and 100-fold dilutions) or bacterial results are obtained. suspension Total 25 4. Performance characteristics available *Molecular-grade water should preferably be used, or prepared purified (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and In France two different strains, isolated from coffee and nuclease-free water. identified as subsp. pauca by MLST (Yuan et al., 2010), have tested positive with the Pooler & Hartung (1995) 2.2.2 PCR conditions method. It has not been possible to test other strains, in par- ° ° 94 C for 4 min followed by 30 cycles of (94 C for ticular from Brazil, as these are not available in reference ° ° 1 min, 62 C for 1 min, 72 C for 1 min) and a final step of collections. 72°C for 10 min.

Appendix 16 – Conventional simplex PCR 3. Essential procedural information (Hernandez-Martinez et al., 2006) 3.1 Controls For positive controls, inactivated cultures of X. fastidiosa 1. General information subsp. pauca can be used instead of living cultures. For a reliable test result to be obtained the following (external) 1.1 This conventional PCR is suitable for assignment of controls should be included for each series of nucleic acid subspecies in planta and assignment of an isolate to extraction and amplification of the target organism and tar- X. fastidiosa subsp. fastidiosa, multiplex and sandyi get nucleic acid, respectively: isolates. A multiplex PCR for isolates is described in • Negative isolation control (NIC) to monitor contamination Appendix 17. There is little experience for insects (low during nucleic acid extraction: nucleic acid extraction and concentration of bacteria and limited amount of DNA subsequent amplification preferably of a sample of unin- from a single insect). fected matrix or if not available clean extraction buffer 1.2 The test is based on Hernandez-Martinez et al. • Positive isolation control (PIC) to ensure that nucleic (2006). acid of sufficient quantity and quality is isolated: nucleic 1.3 The target sequences are a gene that encodes a putative acid extraction and subsequent amplification of the plant methyltransferase of the restriction/methylation system matrix sample that contains the target organism (e.g. for the XF1968 primers, a gene that encodes a putative naturally infected host tissue or host tissue spiked with fimbrial protein for the XF2542 primers (these were the target organism). For a series of analyses including assigned to the CVC X. fastidiosa 9a5c strain) and a samples from different plant species, whenever possible gene that encodes an intergenic region between the one PIC should be included per plant species to be anal- genes coding for a conserved hypothetical protein and ysed, or per botanical genus a glycine cleavage H protein for the ALM primers (this • Negative amplification control (NAC) to rule out false target area was assigned to the genome of the ALS positives due to contamination during the preparation of strain M12). the reaction mix: amplification of molecular-grade water 1.4 Amplicon size in base pairs: 638 bp with subsp. sandyi that was used to prepare the reaction mix and multiplex; 521 bp with subsp. multiplex; 412 bp • Positive amplification control (PAC) to monitor the with subsp. fastidiosa and multiplex. efficiency of the amplification: DNA of X. fastidiosa, 1.5 Oligonucleotides for subsp. sandyi, multiplex:

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 223

Forward primer XF1968-L 50-GGAGGTTTACCGAAGACAGAT-30 3. Essential procedural information 0 0 Reverse primer XF1968-R 5 -ATCCACAGTAAAACCACATGC-3 3.1 Controls For positive controls, inactivated cultures of X. fastidiosa 1.6 Oligonucleotides for subsp. multiplex: can be used instead of living cultures. For a reliable test result to be obtained, the following (external) controls Forward primer ALM1 50-CTGCAGAAATTGGAAACTTCAG-30 should be included for each series of nucleic acid extraction Reverse primer ALM2 50-GCCACACGTGATCTATGAA-30 and amplification of the target organism and target nucleic acid, respectively: 1.7 Oligonucleotides for subsp. fastidiosa and multiplex: • Negative isolation control (NIC) to monitor cross-reac- Forward primer XF2542-L 50-TTGATCGAGCTGATGATCG-30 tions with the host tissue and/or contamination during Reverse primer XF2542-R 50-CAGTACAGCCTGCTGGAGTTA-3 nucleic acid extraction: nucleic acid extraction and subse- quent amplification preferably of a sample of uninfected matrix or, if not available, clean extraction buffer 2. Methods • Positive isolation control (PIC) to ensure that nucleic acid of sufficient quantity and quality is isolated: nucleic acid 2.1 Nucleic acid extraction and purification extraction and subsequent amplification of the plant matrix 2.1.1 The test can be performed on DNA extracts sample that contains the target organism (e.g. naturally (plants or insects) or on pure culture suspension. infected host tissue or host tissue spiked with the target 2.1.2 See Appendix 3 for extraction procedures from organism). For a series of analyses including samples from plants. different plant species, whenever possible one PIC should 2.1.3 For pure cultures, a single colony of a fresh pure be included per plant species to be analysed, or per botani- culture is suspended in 0.9 mL of PCR-grade cal genus water; lysis should be performed at 100°C for • Negative amplification control (NAC) to rule out false 5 min. positives due to contamination during the preparation of 2.1.4 Extracts of total nucleic acids can be stored at the reaction mix: amplification of molecular-grade water 4°C for immediate use or at 20°C for further that was used to prepare the reaction mix use. • Positive amplification control (PAC) to monitor the effi- 2.2 Conventional simplex PCR ciency of the amplification: DNA of X. fastidiosa, isolated 2.2.1 Master mix from a suspension with approximately 105 cfu mL 1 3.2 Interpretation of results Volume per In order to assign results from PCR-based tests the fol- Working reaction Final lowing criteria should be used: Reagent concentration (lL) concentration Verification of the controls: • NIC and NAC should produce no amplicons Molecular-grade water* N.A. 6 N.A. • PIC and PAC should produce amplicons of the relevant size. FIREPol master mix 59 219 ready to load with When these conditions are met: • 7.5 mM MgCl2 A test will be considered positive if amplicons of 638 bp (Solis Biodyne) (subsp. sandyi and multiplex), 521 bp (subsp. multiplex) Forward primer 10 lM 0.5 0.5 lM or 412 bp (subsp. fastidiosa and multiplex) are produced (XF1968-L or ALM1 • Subspecies assignment is not possible if no band, a different or XF2542-L) number of bands or band(s) of a different size are produced Reverse primer (XF1968-R 10 lM 0.5 0.5 lM • or ALM2 or XF2542-R) Tests should be repeated if any contradictory or unclear Subtotal 9 results are obtained. Genomic DNA extract 1 Total 10 4. Performance characteristics available from the *Molecular-grade water should preferably be used, or prepared purified (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and Austrian Agency for Health and Food Safety (AGES, nuclease-free water. AT) This test was established at the AGES lab and has been in use 2.2.2 PCR conditions there since 2014. It was tested on symptomatic and asymp- 95°C for 3 min, 40 cycles of (95°C for 30 s, 55°C for 30 tomatic samples. Bacterial suspensions of different s and 72°C for 30 s) and a final step at 72°C for 5 min X. fastidiosa subspecies, e.g. DSM 10026 (fastidiosa)and before cooling at 15°C. LMG 9063 (multiplex) can be used as controls. More than 100

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 224 Diagnostics routine samples including olives, coffee, deciduous trees, ole- 1.6 Oligonucleotides for subsp. multiplex: ander, Carex spp. and Polygala spp. have been tested. All Forward primer ALM1 50-CTGCAGAAATTGGAAACTTCAG-30 samples were run in duplicates (undiluted and 1:20). Xylella 0 0 fastidiosa subsp. sandyi was detected in 10 coffee samples. Reverse primer ALM2 5 -GCCACACGTGATCTATGAA-3 4.1 Analytical sensitivity data Sensitivity data were not provided in the original publi- 1.7 Oligonucleotides for subsp. fastidiosa and multiplex: cation because the test was developed for subspecies deter- Forward primer XF2542-L 50-TTGATCGAGCTGATGATCG-30 mination and applied on pure cultures. 0 Reverse primer XF2542-R 5 -CAGTACAGCCTGCTGGAGTTA-3’ At the AGES lab this test had the same diagnostic sensitiv- ity as the test described by Minsavage et al. (1994) when used for detection and subspecies determination. 2. Methods 4.2 Analytical specificity data In the original publication the PCR was successfully tested 2.1 Nucleic acid extraction and purification on 53 X. fastidiosa strains isolated from Cercis spp., Citrus 2.1.1 For pure cultures, a single colony of a fresh pure spp., Gingko spp., Hemerocallis spp., Jacaranda spp., culture is suspended in 0.9 mL of PCR-grade ° Lagerstroemia spp., Liquidambar spp., Magnolia spp., Morus water; lysis should be performed at 100 C for spp., Nandina spp., Nerium spp., Olea spp., Prunus spp., 5 min. ° Pyrus spp., Quercus spp., Spartium spp. and Vitis spp. from 2.1.2 Extracts of total nucleic acids can be stored at 4 C ° the USA, Brazil and Taiwan attributed to the X. fastidiosa for immediate use or at 20 C for further use. subsp. fastidiosa, sandyi and multiplex (for details see Hernan- 2.2 Multiplex PCR dez-Martinez et al., 2006). 2.2.1 Master mix 4.3 Data on repeatability 100% when using PACs of X. fastidiosa subsp. fastidiosa Volume and multiplex. Working per Final 4.4 Data on reproducibility Reagent concentration reaction (lL) concentration 100% when using PACs of X. fastidiosa subsp. fastidiosa and multiplex. Molecular-grade water* N.A. 10.25 N.A. PCR buffer (Promega) 109 2.5 19

MgCl2 50 mM 1.25 2.5 mM Appendix 17 – Conventional multiplex PCR dNTPs 20 mM 1 0.8 mM (Hernandez-Martinez et al., 2006) Forward primers 20 lM 1.25 for each 1 lM (XF1968-L, (total 3.75) ALM1, XF2542-L) 1. General information for each l l 1.1 This conventional PCR technique is mainly used for Reverse primers 20 M 1.25 for each 1 M (XF1968-R, ALM2, (total 3.75) assignment of an isolate to X. fastidiosa subsp. XF2542-R) for each fastidiosa, multiplex or sandyi. There is little experi- Promega Taq DNA 5UlL1 0.5 0.1 U lL1 ence for insects (low concentration of bacteria and lim- polymerase ited amount of DNA from a single insect). Subtotal 23 1.2 The test is based on Hernandez-Martinez et al. (2006). Genomic DNA extract 2 1.3 The target sequences are a gene that encodes a putative Total 25 methyltransferase of the restriction/methylation system for *Molecular-grade water should preferably be used, or prepared purified the XF1968 primers, a gene that encodes a putative fim- (deionized or distilled), sterile (autoclaved or 0.22-lm filtered) and brial protein for the XF2542 primers (these were assigned nuclease-free water water. to the CVC X. fastidiosa 9a5c strain) and a gene that encodes an intergenic region between the genes coding for 2.2.2 PCR conditions a conserved hypothetical protein and a glycine cleavage H 94°C for 5 min, 40 cycles of (94°C for 1 min, 55°C for protein for the ALM primers (this target area was assigned 1 min and 72°C for 1 min) and a final step at 72°C for to the genome of the ALS strain M12). 10 min before cooling at 4°C. 1.4 Amplicon size: 638 bp with subsp. sandyi and multiplex, 521 bp with subsp. multiplex and 412 bp 3. Essential procedural information with subsp. fastidiosa and multiplex. 1.5 Oligonucleotides for subsp. multiplex and sandyi: 3.1 Controls For positive controls, inactivated cultures of X. fastidiosa Forward primer XF1968-L 50-GGAGGTTTACCGAAGACAGAT-30 0 0 can be used instead of living cultures. For a reliable test Reverse primer XF1968-R 5 -ATCCACAGTAAAACCACATGC-3 result to be obtained, the following (external) controls

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 225 should be included for each series of nucleic acid extraction • Tests should be repeated if any contradictory or unclear and amplification of the target organism and target nucleic results are obtained. acid, respectively: • Negative isolation control (NIC) to monitor cross-reac- 4. Performance characteristics available tions with the host tissue and/or contamination during nucleic acid extraction: nucleic acid extraction and From the DNA extraction method available with the Qiagen subsequent amplification preferably of a sample of DNA Tissue Kit (Qiagen, Valencia, CA, US): uninfected matrix, or if not available clean extraction 4.1 Analytical sensitivity data buffer Not available, but this is not critical as the test is mainly • Positive isolation control (PIC) to ensure that nucleic acid performed on cultures. of sufficient quantity and quality is isolated: nucleic acid 4.2 Analytical specificity data extraction and subsequent amplification of the plant Inclusivity 100% evaluated on 15 strains of X. fastidiosa matrix sample that contains the target organism (e.g. nat- subsp. fastidiosa, 12 strains of X. fastidiosa subsp. sandyi urally infected host tissue or host tissue spiked with the and 25 strains of X. fastidiosa subsp. multiplex. target organism). For a series of analyses including sam- 4.3 Data on repeatability ples from different plant species, whenever possible one No data available. PIC should be included per plant species to be analysed, 4.4 Data on reproducibility or per botanical genus No data available. • Negative amplification control (NAC) to rule out false 4.5 Data on diagnostic sensitivity positives due to contamination during the preparation of Oleander: 100% the reaction mix: amplification of molecular-grade water Grape: 100% that was used to prepare the reaction mix • Positive amplification control (PAC) to monitor the effi- Appendix 18 – Pathogenicity test ciency of the amplification: DNA of X. fastidiosa, isolated from a suspension with approximately 105 cfu mL1. General guidance on a pathogenicity test for X. fastidiosa is 3.2 Interpretation of results provided. Plant growing conditions are specific to the host Verification of the controls: used and only examples are provided. • NIC and NAC should produce no amplicons 1) Test plants • PIC and PAC should produce amplicons of the relevant Pathogenicity tests use host plants grown in pots. The size. plants should not be herbaceous and xylem tissue should be When these conditions are met: well differentiated. Optimal stages for inoculation are illus- • A test will be considered positive if amplicons of 638 bp trated in Fig. 30. When known, the most susceptible culti- (subsp. sandyi and multiplex), 521 bp (subsp. multiplex) vars should be selected. Examples for some hosts are given or 412 bp (subsp. fastidiosa and multiplex) are produced. below. Some strains of subsp. multiplex have two bands (638 bp Olea europaea: successful inoculation has been obtained and 531 bp, Type ST6) and others three bands (638 bp, with Cellina di Nardo, Frantoio, Leccino, Coratina (Sapo- 531 bp and 412 bp, Type ST7) (see Fig. 29) nari et al., 2016, 2017). • Subspecies assignment is not possible if no band, a differ- Vitis vinifera: Chardonnay, Cabernet Sauvignon, Chenin ent number of bands or band(s) of a different size are Blanc and Pinot Noir are recommended. All these varieties produced develop symptoms of Pierce’s disease within a short period (1–3 months) after inoculation with X. fastidiosa subsp. fastidiosa. Citrus sinensis: Pera, Hamlin, Natal and Valencia. Coffea: Coffea arabica (the cultivar Nana is used in the NRC, NPPO-NL), Coffea canephora (no data is available to allow recommendation of specific cultivars). Actively growing susceptible plants should be maintained in an insect-proof greenhouse or growth chamber at 25– 28°C. For inoculations, the soil in the pots should be dry and experimental conditions should favour plant transpira- tion (i.e. the inoculation should be done on a sunny day). Ideally each experiment should include 10–15 inoculated Fig. 29 Electrophoretic analysis of PCR amplicons obtained from plants and at least 3–5 controls, but this can vary according samples of Polygala myrtifolia (Pm646.1) by Hernandez-Martinez et al. to the test plants. Conditions after inoculation are as before (2006). It should be noted that although the test is not recommended for the detection of Xylella fastidiosa subsp. pauca some sequence inoculation. Water stress may favour the appearance of types of subsp. pauca can produce bands with this PCR symptoms.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 226 Diagnostics

Fig. 30 Illustration of the size of plants used for the inoculations. Courtesy M. Saponari, CNR – Institute for Sustainable Plant Protection (IT). The ruler in the figures is 30 cm long.

2) Inoculation succinate–citrate buffer (see Appendix 12). The bacterial Inoculation techniques should ensure infiltration directly suspension should contain a high bacterial concentration into the xylem vessels in order for symptoms to develop. The (approximately 109 cfu mL1). most widely used method for plant inoculation is by needle A drop (10–50 lL) of inoculum is placed on a leaf axil puncture in the stem at the base of the petiole (Fig. 31). and punctured through several times with a fine needle. A general inoculation procedure consisting of the pin- After inoculation, plants should be maintained in a horizon- prick inoculation method (Hill & Purcell, 1995; Almeida tal position for 5–10 min to allow absorption of the inocu- et al., 2001) is described below. lum. Inoculation should be made in different parts of the Low-passage (2–3) cultures of the bacterium grown for test plants. Control plants are treated in the same way 8–10 days on the most suitable medium (see Appendix 12) except that buffer is used instead of bacterial suspension. at 28–30°C should be used for inoculation. Bacteria are Another conventional procedure consists of the inocula- removed from solid media and resuspended in PBS or tion of plants using a syringe (i.e. a 1-mL tuberculin syr- inge) to infiltrate droplets of inoculum containing X. fastidiosa at approximately 108 cfu mL1. Alternative methods for inoculating citrus are: (A) raise a flap of bark tissue by cutting tangentially upward with a razor blade, and apply 10–30 lL of suspen- sion (108 cfu mL1) under the flap; (B) excise a piece of bark tissue and place it in an Eppendorf tube containing 500 lL of bacterial suspension for 2 h then replace the tissue piece and wrap with grafting tape. If plants have multiple stems (e.g. Polygala myrtifolia or blueberry) inoculations should be performed on at least two stems. To increase the effectiveness of the inoculations, the plants can be subjected to a second round of inoculation 3– 8 weeks after the first inoculations. 3) Symptom monitoring Symptoms usually appear (see Section 3.1) 60–80 days after inoculation in grapes and 8–10 months in citrus. In Fig. 31 Needle inoculation. Courtesy M. Saponari, CNR – Institute for Brazil it took 6 years to complete the pathogenicity tests Sustainable Plant Protection (IT). (and fulfil Koch’s postulates) for the X. fastidiosa strains

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227 PM 7/24 (4) Xylella fastidiosa 227

(A) Nicotiana tabacum ‘Petite Havana SR1’ or ‘RP1’ seeds are germinated at temperatures of approximately 20–25°C and under a day length of 14 h or under natural daylight if greater. After approximately 1 month, 50 seedlings are trans- planted into small individual pots (10 cm2). From this point onward plants are fertilized occasionally when yellowing of leaves (deficiency) is observed. These conditions, which can be considered as stressful for tobacco plants, result in the rapid development of symptoms. Around 1 month after transplant, tobacco plants are pre- pared for inoculation by cutting the top of the stem and removing the lower juvenile leaves so that only three healthy adult leaves in the lower portion of the plant (B) remain (numbered 1–3). Bacterial inoculum is prepared from X. fastidiosa cul- tured on solid media at 28°C for about 1 week. Bacteria from two plates are scraped off and resuspended in 1.5 mL of succinate–citrate–phosphate buffer (Appendix 12). A 1-mL tuberculin syringe with a 23-gauge needle is used to inject half of the plants with approximately 20 lL of inoculum in each remaining tobacco petiole, near the axils. The other half of the tobacco plants (control plants) are injected in the same manner with buffer only. Plants continue growing from the site where the stem was cut. Leaves are classified according to their appearance as control (healthy) or senescent (showing browning symp- Fig. 32 Symptoms on Nicotiana tabacum cv. SR1 after inoculation toms) from buffer-inoculated control plants and asymp- with Xylella fastidiosa Pierce’s disease Temecula-1 strain. Symptoms tomatic (healthy) or symptomatic (marginal leaf scorch) were fully developed 6 weeks after inoculation. (A) The control plant from X. fastidiosa-inoculated plants. mock inoculated with water (left) and plant inoculated with Symptoms start to develop 10–14 days after inoculation X. fastidiosa Temecula-1 (right). (B) Advanced symptoms at flowering (leaf scorch symptoms). Francis et al. (2008) reports that – time (2 3 months after inoculation). The water mock-inoculated control tobacco inoculated with stains associated with almond leaf plant is showing normal leaf senescence (left) and the X. fastidiosa- scorch and Pierce’s disease showed typical symptoms inoculated plant is showing marginal leaf scorching and a chlorotic halo around the edge of the scorch symptoms (right). Reproduced from resembling those of grapes and almond infected with Francis et al. (2008). X. fastidiosa (Fig. 32). A reduction of plant size after inoculation with three strains of X. fastidiosa subsp. pauca, namely CoDiRO infecting coffee. In Italy, symptoms on the most susceptible (ST53), 9a5c (ST13) and MF01 (ST16), is reported on cultivars of olive started to appear after 13 months. both cultivars by Pereira et al. (2017). Symptoms of The test plants showing symptoms should be tested as leaf yellow blotch were mainly found in RP1. The recommended in Section 3.4 and isolation should be strain X. fastidiosa subsp. pauca CoDiRO induced the attempted, although it may not be successful. lowest percentage of infections with respect to the other As it is not easy to obtain symptoms, the testing of X. fastidiosa strains, with a higher percentage in RP1 asymptomatic test plants is also recommended. (78%) than in Petite Havana (53%) (Pereira et al., 2017). Appendix 19 – Bioassay on tobacco plants (Francis et al., 2008; Pereira et al., 2017) Tobacco plants are propagated in a greenhouse and inocu- lated with X. fastidiosa as described below.

ª 2019 OEPP/EPPO, Bulletin OEPP/EPPO Bulletin 49, 175–227