MECHANISM OF ACTION OF ID4 AS A TUMOR SUPPRESSOR

A DISSERTATION

SUBMITTED TO THE FACULTY OF CLARK ATLANTA UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR

THE DEGREE OF DOCTOR OF PHILOSOPHY

BY

SHRAVAN KUMAR KOMARAGIRI

DEPARTMENT OF BIOLOGICAL SCIENCES

ATLANTA, GEORGIA

DECEMBER 2016 ------

© 2016

SHRAVAN KUMAR KOMARAGIRI

All Rights Reserved ABSTRACT

BIOLOGICAL SCIENCES

KOMARAGIRI, SHRA VAN K. M.S. CLAFLIN UNIVERSITY, 2009

MECHANISM OF ACTION OF ID4 AS A TUMOR SUPPRESSOR

Committee Chair: Jaideep Chaudhary, Ph.D.

Dissertation dated December 2016

Initial studies demonstrated that Inhibitor of DNA binding/differentiationprotein

4 (Id4) acts as a tumor suppressor in prostate cancer (PCa). To further confirmand investigate the mechanism by which ID4 acts as a tumor suppressor, herein we concentrated on two differentapproa ches. In the first approach we investigated ID4 role as a tumor suppressor by regulating AKT/PI3K pathway. In the second approach, we examined the role ofld4in blocking the tumorogenic properties of metastatic PC3 cells.

Phosphoinositide 3-kinase/Protein kinase B (PB/AKT) pathway regulates multiple biological processes leading to cell survival, proliferation and growth in cancerous cells.

We performed immunohistochemistry (IHC) to determine AKT, pAKT and PTEN protein expression in Id4 knockout mouse prostates and PCa cell lines. IHC on Id4 knockout mouse prostates demonstrated a significantdecrease in PTEN expression as compared to normal mouse prostates. Consistent with decrease PTEN, the expression of pAKT expression increased. Similar pattern was observed in PCa cell lines: DU145 cells lacking Id4 had low PTEN as compared to ld4 over-expressing DU I 45 cells. In addition, Chromatin immunoprecipitation (Ch!P) analysis also demonstrated an increase in the binding of acetylated p53 on PTEN promoter in the presence of Id4.

The second approach demonstrated the tumor suppressor functionof Id4 in highly tumorogenic and metastatic PC3 cell line. Interestingly, this study demonstrated that overexpression of Id4 in PC3 cells results in decreased tumorogenecity in part through increased expression of Androgen receptor (AR) and its target genes Cyclin dependent inhibitor I (p21) and FK506-binding protein 51 (FKBPS l ). Apoptosis, migration and cell proliferation decreased in the Id4 overexpressed PC3 cells. Mice injected with PC3 + Id4 cells showed decreased tumor size and volume. IHC studies on tumor xenografts demonstrated increased levels of AR, Ki67, and p21 in Id4 overexpressed xenograft.

Collectively, our data indicate that 1D4 acts as tumor suppressor by regulating the levels of PTEN by prompting the binding ofacetylated p53 onto PTEN promoter which eventually results in inhibiting P13K/AKT pathway. Furthermore, Id4 not only increases the expression of AR in PC3 cells but also regulates the factorsresponsible forAR tumor suppressor activity.

II ACKNOWLEDGEMENTS

With God everything is possible. First, I would like to thank God forgiving me the wisdom to put you in the center of things I do. I would like to thank my mentor and doctoral advisor, Dr. Jaideep Chaudhary, for his kindness, dedication, invaluable support and advice during my matriculation at Clark Atlanta University. I would also like to thank my committee members: Ors. Cimona Hinton, Valerie Marah, Joann Powell, and

Shailesh Singh, for their accolades, affirmations, and criticisms required along this journey. I would like to thank all the former/current members of Dr. Chaudhary's lab and graduate students in Departmentof Biological Sciences. Finally, I would like to thank my beloved mother and father fortheir unconditional love, sacrifice and support. I would like to thank my wife, brother, sister and my family for their endless love, support and great encouragement at all times throughout my studies. 1 would also like to thank the financial,academic and technical support of the Clark Atlanta University, the chair and the staffof the Department of Biological Sciences and Center for Cancer Research and

Therapeutic Development. This work was funded by NIH/NCRR/RCMI grant

#Gl2RR03062 and NIH grant #R0ICA128914 and the Department of Biological

Sciences forsupporting my doctoral thesis.

111 TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... iii

LIST O FIGURES...... viii

LIST OF TABLES ...... x

LIST OF ABBREVIATIONS ...... xi

CHAPTER

PART I: ROLE OF ID4 IN PTEN/AKT PATHWAY

I. INTRODUCTION ...... 1

II. LITERATURE REVIEW ...... 5

2.1 Cancer Epigenetics and Genetic Instability ...... 5

2.2 Structure I Function of Prostate ...... 6

2.3 MolecularBiology and Histology of Prostate ...... 7

2.4 PCa ...... 7

2.5 PCa Incidence ...... 8

2.6 Risk Factors ...... 8

2. 7 Progression ...... 9

2.8 Treatment ...... 10

2.9 Tumor Promoters in PC a ...... I 0

2.10 Tumor Supressors in PCa...... 11

2.11 Tumor Supressor: PTEN ...... 12

2.12 PTEN Structure ...... 13

2.13 PTEN Localisation (in the Nucleus) ...... 14

IV CHAPTER

2.14 PTEN and Regulation of the PJ3K/AKT/mTOR Pathway-PCa ...... 15

2.15 PJ3K/AKT/mTOR-lndependent Functions of PTEN ...... 17

2.16 Function of PTEN ...... 17

2.17 Transcriptional Role ofPTEN ...... 18

2.18 Post-Transcriptional Role of PTEN ...... 19

2.19 Post-Translational Role of PTEN ...... 19

2.20 Helix Loop Helix (HLH) and Basic HLH (bHLH) Proteins ...... 20

2.21 Inhibitor of Differentiation/Inhibitorof DNA Binding (ID) Proteins ....20

2.22 Inhibitor of DNA Binding 4 (ld4) Protein ...... 24

2.23 Id4 Expression in Normal Prostate ...... 27

2.24 Id4 is Epigentically Silenced in Cancer ...... 28

2.25 ID4 is Epigentically Silenced: Acetylation Study ...... 29

2.26 Id4 Acts as a Tumor Suppressor ...... 30

2.27 PTEN/AKT Pathway and Id4 ...... 32

2.28 Id4 Regulates PTEN/AKT Pathway ...... 33

III. MA TE RIALS AND METHODS ...... 3 7

3.1 1D4 Overexpression and Silencing in PCa Cell Lines ...... 37

3.2 Reverse Transcriptase ...... 38

3.3 Quantitative Real Time PCR (qRT-PCR) ...... 38

3.4 Protein Extraction ...... 39

3.5 WesternBlot Analysis ...... 39

V CHAPTER

3.6 Cell ProliferationAssay ...... 41

3.7 Statistical Analysis (Proliferation)...... 41

3.8 Apoptosis Assay ...... 41

3.9 Statistical Analysis (Apoptosis) ...... 41

3.10 AKT Kinase Assay ...... 42

3.11 Migration Assay ...... 42

3.12 Tunel Assay ...... 43

3.13 Luciferase Reporter Gene Assay ...... 43

3.14 Immunohistochemistry (IHC) ...... 44

3.15 DNA Methylation Analysis ...... 44

3.16 BisulfiteSequencing ...... 45

3.17 siRNA Transient Transfections ...... 45

3.18 Chromatin lmmunoprecipitation (ChIP) Assay ...... 45

3.19 Statistical Analysis (ChIP) ...... 46

3.20 lmmuno-Cytochemistry ...... 46

3.21 Site-Directed Mutagenesis ...... 47

IV. RESULTS ...... 48

4.1. ld4 Regulates PTEN Expression/Function...... 48

4.1.1. Methylation and Acetylation of PTEN Promoter ...... 49

4.1.2. Id4 and p53 Acetylation ...... 50

4. I .3. Binding of Acetyl p53 on PTEN Promoter ...... 5 I

VI CHAPTER

4.2. Role of PTEN-pAKT Axis in Regulating ld4 Phosphorylation ...... 52

4.2.1. Kinase Assay: Id4 Regulates PTEN/AKT Axis ...... 53

4.2.2 Treatment with Pl3K Inhibitor Lead to Id4 Expression in DUl45 Cells ...... 54

V. DISCUSSION AND CONCLUSION ...... 56

PART II: ID4 PROMOTES AR EXPRESSION AND BLOCKS

TUMORIGENICITY OF PC3 PROST A TE CANCER CELLS

VI. INTRODUCTION ...... 59

VII. LITERATURE REVIEW ...... 60

7.1 AR in Prostate ...... 60

7.2 AR as Tumor Suppressor and Tumor Promoter ...... 61

7.3 AR Regulated Transcriptional Factor: FKBP51 ...... 62

7.4 ID4 and AR ...... 63

VIII. RESUL TS ...... 66

8.1. Generation of!D4 Expressing PCa Cell Line ...... 66

8.2. Effect of ID4 on Morphology, Cell Proliferationand Migration ...... 66

8.3. ID4 Promotes AR Expression ...... 68

8.4. ID4 Results in Decreased Tumor Growth In Vivo ...... 70

IX. DISCUSSION AND CONCLUSION ...... 72

REFERENCES ...... 74

Vil LIST OF FIGURES

Figure

I. Domain structure of HLH family...... 4

2. The adult prostate and surroundingstructures ...... 6

3. Regulation of PTEN transcription ...... 13

4. AKT pathway ...... 16

5. bHLH transcription factors...... 22

6. Oncomine database ...... 27

7. Expression ofld4 in normal prostate ...... 27

8. PCa tissue microarrays...... 28

9. Id4 promoter methylation ...... 29

I 0. Treatment with NaBr ...... 30

11. ld4 induces apoptosis in DU 145 cells ...... 31

12. Id4 promotes senescence in DU 145 cells ...... 31

13. IHC data on PTEN, AKT and phospho-AKT (p-AKT) ...... 33

14. PTEN mRNA data ...... 34

15. PTEN protein expression ...... 34

16. Expression levels ofphospho AKT and AKT ...... 34

17. ID protein sequences ...... 35

18. NetPhosK 1.0 Server ...... 36

Vlll Figure

19. Predicted Id4 phosphorylation model ...... 36

20. PTEN promoter methylation and acetylation ...... 49

21. IHC on Id4-/- with p53, Acetyl p53 and p2 l ...... 51

22. Ch!P Assay: Increase in the binding of Acetylated p53 to PTEN Promoter...... 52

23. Kinase Assay ...... 53

24. Treatment with L Y294002 ...... 55

25. Kinase Assay showing pAKT activity ...... 55

26. Id4 Phosphorylation ...... 55

2 7. Androgen receptor expression analysis ...... 64

28. Gene expression changes in DU145+ld4 cell lines ...... 65

29. Stable overexpression of1D4 with pCMV-1D4 in PC3 cells ...... 67

30. 1D4 regulates migration ...... 68

31. ID4 regulates expression of AR ...... 69

32. Stable overexpression of 1D4 in PC3 cells suppresses tumor growth in vivo ...... 71

IX LIST OF TABLES

Table

I. ld4 Modulation in Cancer ...... 3

2. qRT-PCR and Ch!P Primers Used in the study ...... 39

3. Antibodies for Western Blotting, Co-IP, IHC, ICC, and ChiP Analysis ...... 40

X LIST OF ABBREV IATIO NS

ANOVA Analysis of Variance

AP-2 Activating Protein 2

AR Androgen Receptor

BCS Bovine Calf Serum

Bp Base Pair

BPH Benign Prostatic Hyperplasia

BCRP Breast Cancer Resistance Proteins

BMP Bone Morphogenetic Protein

BRCAI Breast Cancer I

BSA Bovine Serum Albumin

CBFI Centromere Binding Factor I cDNA Complementary Deoxyribonucleic Acid

Ch!P Chromatin lmmunoprecipitation

Ct Cycle Threshold

DAPl 4'-6-Diamidino-2- Phenylindole

DNA Deoxyribonucleic Acid dNTP Dinucleotide Triphosphate

ECL Enhanced Chemiluminescence

XI EGF Epidermal Growth Factor

Egrl-1 Early GrowthResponse

ER Estrogen Receptor

ERK Extracellular Signal- Regulated

FBS Fetal Bovine Serum

FKBPSI FK506-Binding Protein

HLH Helix Loop Helix

ICC Immunocytochemisty

ID Inhibitor of DNA Binding

ERK Extracellular Signal-Regulated Kinases

EZH2 Enhancer of Zesta Homolog 2

H3K27Me3 Tri Methylation of Histone 3 at Lysine 27

IHC Immunohistochemistry

MDM2 Mouse Double Minute 2 Homolog

MMP Matrix Metalloproteinase mRNA Messenger Ribonucleic Acid

MS-PCR Methylation Specific-PolymeraseChain Reaction

NF-Kb Nuclear Factor KappaB

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

PJ3K Phosphoinositide 3-Kinase

PIN Prostatic-Intraepithelial Neoplasia

PPAR-y Peroxisome Proliferator-Activated Receptor Gamma

XII PSA Prostate Specific Antigen

PTEN Phosphatase and Tensin Homolog

PVDF Polyvinylidene Difluoride

RT Reverse Transcriptase

RT-PCR Reverse Transcription Polymerase Chain

RNA Ribonucleic Acid

Xlll PART I

ROLE OF 104 IN PTEN/AKT PATHWAY CHAPTER!

INTRODUCTION

The helix-loop-helix (HLH) family of transcription factorscomprises >200

2 members, which have been identified in organisms from yeast to man_ 1- The basic helix­ loop-helix (bHLH) family of transcription factors are key players in many developmental processes,3 such as differentiation of various cell types, such as in Band T-lymphocytes,

4 5 muscle lineages, pancreatic B cells, neurons and osteoblasts. · Most (bHLH) proteins that form a large super familyof transcription factors that regulate tissue-specific transcription,6 positively regulate sets of genes during cell fate determination and cell differentiation. Members ofthis family have two highly conserved domains. The carboxyl terminal end ofbHLH contains the HLH domain involved in homo or hetero dimerization with other bHLH proteins that regulate transcription and the amino terminal end which contains the basic domain facilitates binding to DNA containing the canonical

'E box' recognition sequence, CANNTG and 'N box' sequence, CACNAG 2 or Ets recognition sequence, GGAA/T present in the promoter regions of regulated proteins.4

Thus bHLH proteins form a large super family of transcription factorsthat regulate tissue-specifictranscription. 6 The bHLH hetero-homo dimer plays an important role in many physiological processes including cellular differentiation,apoptosis, cell cycle arrest and regulate critical developmental processes.7 A distinct subfamily ofHLH proteins, the Inhibitor of differentiation (ID) proteins, lack these basic DNA-binding

I 2

region and instead functionsolely by dimerization with other transcriptional regulators,

principally those of the bHLH type and such ID-bHLH heterodimers are unable to bind to

8 9 DNA, and hence ID proteins act as dominant negative regulators ofbHLH proteins. • Ids

are known to interact with other bHLH proteins such as E2A, E2-2, or HEB, and also

with factorssuch as RB (retinoblastoma) family members that have a role in cell cycle.4

In highly proliferating cells, ID proteins are typically expressed while there

expression levels decrease in differentiatedcells. Ids are known to be positive regulators

of cell growth and negative regulators of cell differentiation.10 ID proteins play key roles

in the regulation of lineage commitment, cell fatedecisions, 11 and also have a role in cell

signaling, DNA damage control, and apoptosis. They also act in the timing of

differentiationduring neurogenesis, lymphopoiesis and neovascularisation (angiogenesis)

and are essential for embryogenesis and cell cycle progression. 11 ID proteins that consists

of!D I, ID2, ID3 and ID4 are dominant negative transcriptional regulators of basic Helix

Loop Helix (bHLH) transcription factorsthat lack the basic DNA binding domain but

have intact HLH domain that is conserved in all ID proteins. 12 Out of four ID proteins,

ID4 appears to act primarily as a tumor suppressor in most cancers as opposed to ID I,

13 14 ID2 and ID4, which in most cases acts as tumor-promoters or supporting oncogenes. · •

Previous studies from our lab, demonstrated that Id4 acts as a tumor suppressor in PCa via regulating not only various tumor suppressors and tumor promoters but also through

15 20 various regulatory pathways such as PTEN/AKT, p53 and AR pathways. • Id4 has been shown to act differentlydepending on the tumor type as shown in Table 1. 3

Table 1: ld4 Modulation in Cancer

Kind of Modulation Kind of Analysis Tumor Type Downregulated mRNA Prostate Down Regulated in Low Protein Prostate Grade Cancer vs Hyperplasia Upregulated in High Grade vs Low Grade Cancer Hypermethylation Promoter, DNA Leukemia Hypermethylation Promoter, DNA Lymphoma Downregulated Protein Breast Hypermethylation Promoter, DNA Breast

Study between ld4 and PTEN expression suggests that there is some cross-talk between AKT pathway and ld4. In this study loss of Id4 in mouse prostates resulted in decreased expression of PTEN leading to increased pAKT expression levels. 18

Previous studies demonstrated, binding of p53 to PTEN promoter can enhance the regulation of PTEN and thus can mediate cell cycle arrest and apoptosis by promoting

21 22 stabilization, acetylation andtetramerization ofp53. • Id4 that regulates PTEN activity and expression, and vice-versa pAKT expression levels, might play a role when PTEN inactivation increases the expression and activity levels of Mouse double minute 2

(MDM2) a known p53 repressor by PBKJAKT dependent pathway.23 In the presence

PTEN, p53 gets upregulated through translational mechanisms mediated by mTORCI.24

Previously we have shown that ld4 has a role in p53 pathway where ld4 restores p53 transcriptional activity. 15 HLH domain is shown to be conserved in all ID proteins that is involved in DNA binding and transcriptional activity ofID proteins.25 Domain structure 4 of HLH protein family has HLH domain, and ld4 which belongs to HLH family lack the basic domain, which is shown in Figure 1. Serine residue at position 5 in ld2 is the one to get phosphorylated, that inturn makes Id2 to act as a tumor promoter and vice-versa.26 ld4 which has the same HLH domain and serine 5, might also act in similar fashion as Id2 when it gets phosphorylated. To study this, we investigated, whether the association between PTEN and ld4 in PCa, has any effecton AKT pathway.

helt:x-loop-hc::lLx

hllf .II

(cl Ill.II

Figure I. Domain structure of HLH family. A represents HLH domain that also contains basic amino group needed to bind to DNA. B represents HLH domain that lack basic amino group, which is seen in ID proteins. CHAPTER II

LITERATURE REVIEW

2.1 Cancer Epigenetics and Genetic Instability

Disruption of regulatory circuits which maintain cellular homeostasis leads to development of cancer. The hallmarks of cancer include, insensitivity to anti-growth signals, evasion of apoptosis, limitless replicative potential, sustained angiogenesis, tissue invasion and metastasis.27 Genes can be inactivated as a result of deletions, mutations or epigenetic mechanisms and also can be deregulated by amplificationsor chromosomal translocations.28

There is often more than one genetic aberration present in many cancers. Cancer cells acquire somatic mutations as part of normal development which differ from any germline mutations. Those mutations which give proliferativeand/or survival responses to cells are acquired as part of an on-going process during development. These somatic mutations are categorised as 'drivers' or 'passengers'. 'Drivers' are definedas those mutations which give the cells a survival advantage. 'Passenger' mutations are those mutations which allow the ancestryof the cell to be mapped but are not beneficialfor the cells survival.29 According to the classical mechanism, genomic instability (deletions or translocations) due to inactivating mutations in tumor suppressor genes or gain of function mutations in oncogenes resulting in uncontrolled growth is considered as a tumor initiating event.

5 6

More recently, loss of function (expression) through epigenetic changes due to

altered pattern of DNA methylation and histone modification, is gaining significant

attention as an additional pathway involved in cancer initiation and progression.30-32

These epigenetic changes could predispose the inherited genome of subsequent generations to mutagenic/genotoxic alterations leading to the development of sporadic

PCa.33 Thus, combined genetic and epigenetic changes are now considered as cancer

initiating events.

2.2. Structure I Function of Prostate

The prostate gland which weighs approximately 40 grams, is a walnut sized gland in the male reproductive system just below the bladder that supplies fluid for the sperm

during ejaculation.34 A newborn male's prostate is very small about the size of a grain of wheat. At the onset of puberty it begins to grow dramatically until around the age of twenty and fairly constant until the forties, then due to dihyrotestosterone (DHT) and estrogens the prostate begins to bulk up. It is divided into 2 lobes and contains smooth

muscle cells capable of contracting to expel the prostatic fluid.35 The structure and the

normal vs cancer of prostate is shown in Figure 2.

A Normal prostate

PCa

Figure 2. The adult prostate and surrounding structures. TI1e base of the prostate is located at the bladder neck. The urethra bisects the prostate. (B) Illustration showing, two examples of PCa: the top, which grew up next to the urethra causing its compression and to the bottom showing it comes out of urethra causing urinary problems. 7

2.3 Molecular Biology and Histology of PCa

Anatomically prostate is composed of the central, transition, peripheral zones, and

a region of the anterior fibromuscular stroma, which is the most anterior prostatic

structure. Posterior to the stromal region are the paired central zones. Interior to the

central zones are the transition zones which are located on either side of urethra. The

transition zones represent the smallest zone in the normal prostate. And lastly the

peripheral zone is the largest region of the normal adult prostate, which is located on the

posterior side of the prostate. Benign prostatic hyperplasia (BPH), a nonmalignant

overgrowth that is fairlycommon among aging men, occurs mainly in the transition zone,

whereas prostate carcinoma arises primarily in the peripheral zone.36

Histolgically, prostatic glands are composed of different cell types. The luminal

36 37 epithelial cells which are androgen-dependent, produce prostatic secretions. • Luminal

epithelial cells are characterized by expression of androgen receptor and cytokeratins 8

and 18. Basal cells that form a continuous layer between the luminal cells and basement

membrane are most abundant cells with cytokeratins 4, 14 and p63 as markers.36 The

third cell type is neuroendocrine cells which are androgen independent and are dispersed

throughout the basal layer.38 Strama that surrounds the epithelial glands is composed of

smooth muscle fibers, fibroblastic, neuronal, vascular and lymphatic cell types, and can be identifiedusing alpha-actin and vimentin as markers.39

2.4 PCa

PCa also known as adenocarcinoma develops mostly from gland cells that make prostate fluid which is added to the semen.40 Other types of cancers such as sarcomas, 8 small cell carcinomas and transitional cell carcinomas which are rare can also start in the prostategland. Most PCa's grow slowly, and don't cause any health problems in men who have them.41

2.5 PCa Incidence

PCa is the second leading cause of cancer deaths in men. 42 In the year 2013 there are an estimated 238,590 new cases of PCa and predicted deaths are almost 29,750 in the

United States. Of all the cancer deaths, PCa deaths account forapproximately 5.1 percent with 15.3 percent of men will be diagnosed with PCa at some point during their lifetime.43 AfricanAmerican men are twice more likely to have PCa incidence compared to that of Caucasians and Asian men and have nearly a two-foldhigher mortality rate thanCaucasian men.44 Most PCa related deaths are due to spread of malignant cells to tissues other than prostate, known as metastasis. 45

2.6 Risk Factors

A risk factor separates patients without known diseaseinto those at increased or decreased likelihood for disease and for men who develops aggressive cancer there is a great need forsuch factors. Risk factors can be classifiedas endogenous or exogenous.

Endogenous risk factors forpro state include family history, hormones, race, aging and oxidative stress. Diet, environmental agents, occupation and other factors such as smoking, energy intake, sexual activity, marital status, vasectomy, social factors, physical activity and anthropometry come under exogenous risk factors,46 forPCa. Any study of risk of PCa depends on fiveunique characteristics that contribute to its unpredictable and paradoxical clinical behavior. First, PCa is a slow growing, with a doubling time of 3-4 9 years. Secondly PCa is remarkably age related that rarely appears before40 years of age and typically identifiedin men around 70 years of age.46 A Spanish study on

Mediterraneanmen stated 33% of men in their 8th decade had evidence of PCa at necropsy and died withthe disease, but not fromit. 47 Third, PCa usually is multifocal,so that most men withPCa die not justbecause of it but because ofother cancers or disease conditions. Fourth, PCa and PIN are heterogenous in their morphology and genotype, virtually the entire genome participates in prostatic carcinogenesis.46

2. 7 Progression

The development of prostatic tumor in men is generally slow, taking up to 4 to IO years to develop a 0.4 inch-size tumor.48 Multiple molecular events have been associated with the development of PCa. An early event in PCa progression is the loss of a region of chromosome 8p, which occurs in approximately 80% oftumors.49 Another step in PCa progression occurs with the loss of chromosome I Oq and the tumor suppressor PTEN

(Phosphatase and Tensin deleted on chromosome IO), which accounts for 50% - 80% of prostate tumors, thus supporting the role of PTEN in PCa progression.50 A third common event in PCa progression that results in carcinoma is the loss of chromosome l 3q which includes Retinoblastoma tumor suppressor gene, that occurs in 50% ofprostate tumors.51

Progression of PCa is also based on androgen-based pathways that continue to have a clinically significant role in the progression of castrate-resistant PCa. 52 Mostly all men eventually develop progressive disease following androgen deprivationtherapy (ADT),

53 4 leading to castrate-resistant PCa. -5 ADT might also be because of adrenal glandand testis that produce several enzymes involved in the synthesis of testosterone and 10 dihydrotestosterone that are highly expressed in tumor tissue in addition to androgen production. 55

2.8 Treatment

The therapeutic approaches such as radical prostatectomy and radiotherapy are considered curative forlocalized disease, yet no treatments forme tastatic PCa is available that can significantly increases patient survival.56 PCa treatment is primarily by

48 57 surgery and/or radiotherapy due to the intimate organ localization. • A prostatectomy usually leads to an excellent prognosis with low risk of death fromPCa aftersurgery. 58

However, deregulated production and secretion of growth factors by stromal cells within the PCa microenvironment, as well as mutations in androgen signaling pathway components and furtherphysiological modifications,including angiogenesis, local migration, invasion, intravasation, circulation, and extravasation of the tumor, potentially lead to systemic recurrence of the cancer, including the appearance of focaltumor in

59 3 advanced stage. -6 Maximal therapeutic efficacy in the treatment of castration-resistant

PCa will require novel agents or drugs that act by inhibition of the enzymes responsible forandrogen production, as well as agents that inhibit the androgen receptor that target intracrine steroidogenic pathways within the prostate tumor microenvironment. 52

2.9 Tumor Promoters in PCa

Development of any neoplasm reflectsa progressive and cumulative alteration in various genes. Oncogenes function in a dominant mode, whereas tumour suppressor genes (TSGs) are recessive.64 If the protein is over-active and contributes to prostate carcinogenesis, or metastasis, it could be termed a prostate-specific 'oncogene.64 Of the 11 oncogenes, the RAS gene tamily and neuroblastoma (N) RAS), have been most widely studied in PCa.65 C-ERB-B2 oncogene, as a tumor marker or therapeutic target remains unclear in PCa. The MYC family of oncogenes, in particular C-MYC involved in differentiationhas high level of mRNA in proliferating cells of PCa.66 The polycomb group protein, 'enhancer ofzeste homologue 2', is activated in advanced PCa that causes generalized reduction in transcription by increasing histone deacetylation via histone deacetylase-2.67 Members of the RAF oncogene family that encode serine/ threonine kinases, which activate the mitogen-activated Mitogen- activated protein kinases

(MAPK) or Extracellular signal- regulated (ERK) kinases through direct phosphorylation are the other kind of genes that are also expressed in PCa. 68

2.10 Tumor Suppressors in PCa

PCa progression occurs due to the inactivation, deletion or mutation of tumor suppressor genes such as PTEN, p53, retinoblastoma (RB), which are notable tumor

69 suppressors. •73 RB was the first identified gene productto suppress cell division by preventing cells in G 1 phase fromentering S phase,74 Protein p53, named after the 53- kDa gene product, is a nuclear phosphoprotein that can produce growth arrest at the GI­

S checkpoint, allowing DNA repair, 75 is frequently mutated in PCa. 76 PTEN which is the second most deleted gene afterp53 has a protein phosphatases activity that can act as either positive or negative regulator during signal transduction or cell transformationand

71 77 acts as a marker for metastatic progression. • ------

12

2.11 Tumor Suppressor: PTEN

PTEN is an enzyme that is found in almost every tissue in the body. As a tumor

suppressor, its primary role is to stop cells fromdividing. Inactivation of PTEN results in

uncontrolled proliferation of cells leading to the growth of tumors. PTEN plays a major

role in the development ofthe nervous system and has been implicated in diseases such

as autism and brain development.78 Germline PTEN mutations are primarily found in

80% of patients with the autosomal dominant Cowden disease (CS),79 80 and60% of

individuals with Bannayan-Riley-Ruvalcaba syndrome (BRRS) another autosomal

dominant hamartoma syndrome.81 However, PCa has not been found associated with

Cowden syndrome and germlinePTEN loss, 82 perhaps providing credence to the

understanding that loss of PTEN is a late event in PCa. 71

PTEN also known as MMACJ (mutated in multiple advanced cancers I) and

TEP I (TGF- beta regulated and epithelial cell enriched phosphatase 1),83 is mutated in

multiple advanced cancers and was identifiedin 1997 when cloned and mapped to I 0q23,

a region undergoing frequent somatic deletion in tumors.84 Genome wide linkage analysis

and loss ofheterozygosity (LOH) studies have also identified 10q23.3 as one of the

potential PCa (PC) susceptibility loci, 85 which is oftendeleted in PCa.

PTEN is also deleted or inactivated in many tumors such as renal, melanoma,

prostate, breast, lung, bladder and thyroid.86 Both monoallelic and biallelic deletions of

PTEN occur in PCa cell lines and non-cultured human prostate tumor specimens. 87

Decreased PTEN expression correlates with increased tumor grade, advanced disease

stage and poor prognosis. Human PTEN promoter is GC rich and lacks TAT A box with 13 several transcriptional start sites that contain binding sites fortranscription factorssuch as

Specificity protein 1 (SP-I), Tumor protein p53 (p53), Centromere binding factorI

(CBF-1), Snail familytranscriptional factor l (Snail 1), Proto-oncogene Jun in humans

(C-Jun), Early growth factor (Egr-1) and Activating protein 2 (AP-2) whereas Nuclear factorkappaB (NF-kB) and Peroxisome proliferator- activated receptor gamma (PPAR­ y) regulate PTEN expression.88 Mutation in PTEN gene can lead to protein formationbut that PTEN is not active as it cannot dephosphorylate pAKT to AKT.89 PTEN can be regulated at differentlevels, transcriptionally, translationally post-translationally and also at the protein level. Figure 3 shows PTEN can be regulated by differentgenes transcriptionally.

4 NOT CH

M:r2 �1: /

I I l ..!f..orm lR-21 DJ-1 TGF� c \JUN NF,B HES•1 CBF 1 11 111 1 1 PTEN --�- _ AAAAAA promoter �···-• i i i i PTEN mRNA EGR-1 PPAR1 p53 MYC I IOF•2 NOTCHI

Figure 3. Regulation of PTEN transcription. Numerous genes regulate PTEN transcription both positively (EGR-1, PPARy, Myc, and p53) and negatively (NFKB, c-Jun, HES, and TGF� signaling). NOTCH I may be able to activate or repress PTEN transcription depending on the cellular context. Recently, miR-21 wasidentified as the first microRNA to regulate the expression of PTEN.

2.12 PTEN Structure

PTEN is a 47 k.Da (403 aa) protein with nine exons. The PTEN amino acid sequence resembles dual specific protein phosphatases and tensin, a chicken cytoskeletal 14

C2 domain that mediates membrane attachment of cell signaling proteins. Other three functional domains of PTEN, include short phosphatidylinositol-4,5-bisphosphate (PIP2) binding domain on the N terminus, PEST sequences and a PDZ interaction motif on the

C-terminal tail that regulate protein stability and binding to PDZ domain containing proteins, are thought to be central to its biological functions.90 The phosphatase domain, directly responsible for removing a phosphate group fromthe lipid PIP3, is evolutionarily conserved. Almost 40% of the cancer associated mutations in PTEN are found in the phosphatase domain.80 91 Tumorigenic mutations also occur on C-terminal C2 domain and tail sequence, highlighting the role of C terminus in maintaining PTEN protein stability.92 PTEN loss in PCa is commonly fromsomatic mutations generated through copy number loss, rather than point mutation.93 With the absence of PTEN there is reduced survival in PCa patients.94

2.13 PTEN Localization (in the Nucleus)

PTEN contains dual nuclear localization signal like sequences, regulate cell cycle progression and genomic integrity in the nucleus, 95 by inducing GI cell cycle arrest in part by reducing cyclin DI levels through its phosphatase activity,96 or through MAPK signaling.97 There is a marked reduction in nuclear PTEN in rapidly cycling cancer cells in comparison to resting or differentiated cells.98 Nuclear export of PTEN is inhibited by oxidative stress, a process dependent on phosphorylation ofSer380.99 p53 transcriptional activity and stability can be regulated by nuclear PTEN, independent of its phosphatase

100 activity, leading to p53 mediated GI growth arrest and cell death.21· Nuclear PTEN itself is sufficient to reduce human prostate xenograftgrowth in-vivo in a p53 dependent 15

manner.99 Nuclear expression of PTEN can reduce nuclear levels of pAKT, but whether

this is a Pl3K dependent or independent mechanism is not known. 101 Through its

phosphatase independent mechanism, nuclear PTEN increases the activity of RADS, a

protein involved in double strand break repair, 102 and also increases E3 ligase activity of

APC/C with its activator CDHJ, 103 that is involved in degrading oncogenic proteins

104 105 PLK I and Aurora kinases. -

2.14 PTEN and Regulation of the P13K/AKT/mTOR Pathway-PCa

PI3K/AKT pathway which is active in human cancers, controls cell growth,

migration, differentiationand survival at cellular level. 106 The major substrate of PTEN is

phosphatidylinositol (3,4,5)-triphosphate (PIP-3), a lipid second messenger molecule

generated by the action of PI3Ks. PTEN by its lipid phosphatase activity removes

phosphate fromthe D3 position of PIP3, thus antagonizing the action of PI3K, 107 and

thereby stops cell division. In the absence of PTEN, PIP3 accumulates at plasma

membrane. This results in the recruitment and activation of kinases such as

phosphoinoside-dependent kinaseI (POK I) and AKT that are involved in cell growth and survival via their pleckstrin homology (PH) domains. 101-108 AKT (isoforms 1,2, 3) which gets phosphorylated at Thr308 by POK!, 109 and Ser473 by mammalian target of rapamycin complex2 (mTOR), 110 drives cell survival, proliferation,growth, angiogenesis, and metabolism by phosphorylating downstream signaling proteins which include inhibitory phosphorylation of GSK3 beta, FOXO, BAD, p21, p27, and PGCI, and activating phosphorylation ofmTORI, IKK beta, MDM2, ENTPDS, SREBPIC, AS160

110 111 and SKP2. - AKT promotes cell cycle progression and proliferation by inhibiting 16

110 111 and SKP2. • AKT promotes cell cycle progression and proliferationby inhibiting

p21, p27 and alleviating GSK.3-betainduced cycl in D1 degradation, 111-112 and can also

evade apoptosis by phosphorylating pro-apoptotic protein BAD. 113 mTOR signaling also

triggers a negative feedbackloop that inhibits PI3K/AKT pathway through

phosphorylation that degrades insulin receptor substrate 1 by S6K.114 Conversely

inhibiting mTORl results in activation of PI3K/AKT pathway through RAS/MAPK

pathway .115 Figure 4 describes mechanism of PTEN function can in the AKT pathway.

Ra8/Raf activation COC42 t

disorganization of actln cytoskeleton glycolysls I Krebs cycle+

Figure 4. AKT pathway: The solid arrows mark the directional change of proteins (up- or down­ regulation). Doted arrows mark hypothesized change in protein expression/activity. CDC42, cell division cycle 42; G3BP 1, GTPase-activating protein SH3-domain-binding protein 1; GDl-2, Rho GDP dissociation inhibitor 2; LIMK, LIM domain kinase; MAPK, mitogen-activated protein kinase; MCM7, mini chromosome maintenance protein 7; MSH2, MutS homolog 2; NORG I, N-myc downstream regulated gene I; p2 I, cyclin-dependent kinase inhibitor IA; PCNA, proliferatingcell nuclear antigen; PI3 K, phosphoinositide 3-kinase; PTEN, phosphatase and tensin homolog; Rb, retinoblastoma protein; RhoA, Ras homolog gene family member A.

ln both heritable and sporadic cancers, when PTEN is absent or dysfunctional,

Akt phosphorylation and activity are significantlyincreased In vitro and In vivo.116 PTEN inhibits phosphorylation of Akt, which, in turn, stimulates AR phosphorylation and 17 domain/Hinge domain and inhibits AR nuclear translocation and AR-mediated transcriptional activity in PCa cells. 118

2.15 PI3K/AKT/mTOR- Independent Functions of PTEN

The PTEN C2 domain that lacks phosphatase activity can interact directly with p53 to enhance p53 mediated cell cycle arrest and apoptosis by promoting stabilization,

21 acetylation and tetramerization of p53. -22 And also the same domain can regulate cell motility. 119 PTEN inactivation increases the expression and activity levels of MDM2 a known p53 repressor by Pl3K/AKTdependent pathway,23 but when PTEN is present it upregulates p53 through translational mechanisms mediated by mTORCl. 12° Conversely, p53 can also regulate PTEN at the transcriptional level, 121 and in PTEN null mouse model, deletion of p53 accelerated PTEN null PCa by reducing cellular senescence. 122

PTEN also regulates NJOO.I, a tumor suppressor whose functionis lost as an early event in PCa initiation. 123

2.16 Function of PTEN

Lipid phosphatase activity of PTEN is important to its tumor suppressor role.

PTEN as a dual specificphosphatase with activity towards acidic substrates, removes phosphates fromboth lipids and proteins and thus acts as a multifunctionalprotein. 84

Reconstitution of PTEN expression to certain PTEN null cells results in an increase in the population of cells at GI phase of the cell cycle,124 but in other PTEN null cells it resulted in the induction of apoptosis suggesting the evidence of lipid phosphatase activity of

PTEN, 125 that is associated with tumor suppression. PTEN phosphatase activity can be inhibited by direct binding of DJ 1. 126 PTEN is also capable of dephosphorylating 18

phosphorylated serine, threonine and tyrosine residues on peptide substrates in vitro, 127 as

1 8 129 130 1 well as protein substrates such as FAK , 2 CREB, Elf2, and SRC, 31 in vivo, thereby

inhibiting cell survival, proliferation and migration.

2.17 Transcriptional Role of PTEN

PTEN is one of the most frequently mutated genes in cancer afterp53, with

inactivating mutations found in many solid tumor types. 132 The PTEN gene has been

shown to be inactivated through somaticand germline mutations as well as

transcriptionally suppressed through epigenetic mechanisms, 133 and oftenlost in late­

stage human cancers, especially those of the brain, prostate and endometrium. 134

Epigenetic inactivation of PTEN expression has been described in cancer xenografts,

where loss of PTEN protein is a result of promoter methylation. 50 Transcriptionally,

TGF-beta regulates PTEN expression depending on Ras/MAPK pathway. In late stage

aggressive diseases, when Ras/MAPK pathway is active, TGF-beta suppresses PTEN

through Smad4 independent pathway, 135 and also through c-Jun. 136 In the case when

Ras/MAPK pathway is blocked, TGF-beta induces PTEN expression through Smad

dependent pathway. 137 Mitogen activated protein kinase kinase 4 (MKK-4) inhibits

PTEN transcripton by activating Nf-kB, a transcriptional suppressor of PTEN. 138

Epithelial to mesenchymal transition (EMT) transcription factor SNAIL, that negatively regulates PTEN expression competes with p53 to bind to PTEN promoter and leads to

activation of PTEN transcription during p53 mediated apoptosis. 139-140 PTEN

transcription is also regulated by transcription factors such as PPAR-gamma, 141 EGRI, 142 19

BMJ, 143 whereas activated NOTCH! both positively and negatively regulates PTEN through MYC and CBFI. 144-145

2.18 Post-Transcriptional Role of PTEN

Post-transcriptionally, PTEN mRNA at miRNA loci is regulated by both miR-22 and miR-106B-25 cluster, that are overexpressed in human PCa.146 PTENPI the PTEN pseudogene which shares vast homology with PTEN mRNA acts as a decoy for PTEN targeting miRNAs and therefore sequesterand inhibit negative regulatory effectsof miRNAs on PTEN mRNA,and thus PTENPI influencePTEN expression through a coding independent function.147-148

2.19 Post-Translational Role of PTEN

Post-translationally, in inactive state PTEN is phosphorylated at various serine and threonine residues on its C-terminal tail, that increases PTEN stability. 149 This modificationreduces its plasma membrane localization, 150 and its ability to form complex with PDZ domain-containing proteins,151 and as a result there is a decrease in its PIP3 lipid phosphatase activity. 152 Whereas when PTEN is dephosphorylated at C-terminal tail, it opens its phosphatase domain and interacts with binding partners, that makes PTEN more unstable,153 and this open state is more prone to ubiquitin mediated proteosomal degradation at Lysl 3 and Lys289 that is mediated by NEDD4-1, E3 Jigase. 101- 154

Phosphorylation of different amino acids in C-terminal tail of PTEN has different effects and functions that are phosphorylated by different mechanisms. Ser3 70 can be phosphorylated by tyrosine protein kinase SRC, and protein kinase CK2, 155 while Thr366 by GSK3-beta.156 Phosphorylation at Ser229 and Thr32 I targets PTEN to plasma 20

157 159 membrane by protein kinase ROCK, - whereas phosphorylation at Tyr336 by RAK can lead to its tumor suppressor activity. 160

2.20 Helix Loop Helix (HLH) and Basic HLH (bHLH) Proteins

The helix-loop-helix (HLH) family of transcription factors comprises >200

2 members, which have been identifiedin organisms fromyeast to man. 1- The basic helix­ loop-helix (HLH) familyof transcription factorsare key players in many developmental proccsses,3 such as differentiation in various cell types, such as in Band T-lymphocytes,

4 5 muscle lineages, pancreatic B cells, neurons and osteoblasts. - Most basic helix-loop­ helix (bHLH) proteins positively regulate sets of genes during cell fate determination and cell differentiation form a large super family of transcription factors that regulate tissue­ specific transcription.6 Members of this familyhave two highly conserved domains. The carboxyl terminalend of bHLH contains the helix loop helix (HLH) domain involved in forminga homo or hetero dimerization with other bHLH proteins that regulates transcriptional regulation and the amino terminal end contains the basic domain that binds to DNA sequences called E-box, 19 that plays a very important role in many physiological processes including cellular differentiation,apoptosis, cell cycle arrest and regulate critical developmental processes.7

2.21. Inhibitor of Differentiation/Inhibitorof DNA Binding (ID) Proteins

Id proteins are typically expressed in highly proliferatingcells and their expression levels decrease in differentiated cells. Ids are known to be positive regulators of cell growth and negative regulators of cell differentiation. 10 ID proteins play key roles in the regulation of lineage commitment, cell fate decisions, 11 and also have a role in cell 21

signaling, DNA damage control, and apoptosis. They also act in the timing of

differentiationduring neurogenesis, lymphopoiesis and neovascularisation (angiogenesis)

and are essential for embryogenesis and cell cycle progression. 11

HLH proteins that positively regulate sets of genes during cell fate determination

and cell differentiation, possess a region high in basic amino acids adjacent to HLH

domain, that facilitates binding to DNA containing the canonical 'E box' recognition

sequence, CANNTG and 'N box' sequence, CACNAG, 2 or Ets recognition sequence,

GGAA/T present in the promoter regions of regulated proteins,4 and thus forma large

super family oftranscription factors that regulate tissue-specific transcription. 6 However,

a distinct subfamilyof HLH proteins, the ID proteins, lack these basic DNA-binding

region and instead functionsolely by dimerization with other transcriptional regulators,

principally those of the bHLH type and such ID-bHLH heterodimers are unable to bind to

8 9 DNA, and hence ID proteins act as dominant negative regulators ofbHLH proteins. .

Ids areknown to interact with other bHLH proteins such as E2A, E2-2, or HEB, and also

with factorssuch as RB (retinoblastoma) family members that have a role in cell cyclc.4

The Id family consists of four isoforms, Id I, Id2, Id3, and Id4,4 that act as negative

regulators of basic bHLH transcription factors, by inhibiting the binding of ID-bHLH

complex to DNA. Structurally, the core HLH domain between Id and bHLH proteins is

highly conserved that allows efficient Id-bHLH dimerization. However, the ld-bHLH dimer is transcriptionally inactive due to the lack of DNA-binding basic domain in Id proteins 161 (see Figure 5). The interferenceof Id proteins with the key regulatory bHLH proteins is thereforean important interaction forpro liferation and differentiation. 22 A 8

Figure 5. bHLH transcription factors: Part A, represents Basic helix loop helix domain ofbHLH transcription factors containing DNA-binding domain. Part B, represents bHLH proteins that bind to DNA. Id proteins lacking DNA binding domain, binds to E-proteins, but the complex cannot bind to DNA.

In man, the Id 1,Id2, Id3, and Id4 genes map to same chromosome at positions 20q 11, 162

162 I63 12 2p25, 1p36 , and 6p21.3-22 , where all of them share considerable homology to one

1 another and seem to have derived from a common ancestral gene. 64

Widespread expression of Id 1, Id2 and Id3 genes was demonstrated throughout

from early gestation to birth during mouse development, with considerable overlap of Id 1

165 166 and Id3, with distinct ld4 expression limited to nervous system. - Deletion ofldl

gene in mice, failedto generate phenotype, and ld2 null mice possessed defects in immunity due to lack of lymph nodes, while mice null for Id3 had defectsin B cell

167 I68 proliferationand humoral immunity. - Mice null for both Id 1 and Id3 possessed embryonic lethality with aberrant neuronal differentiation and angiogenesis. 169 Id 1, Id2 and Id3 which are identifiedas mitogen responsive,3 are furtherimplicated in cell cycle progression when antisense Id constructs are introduced into serum stimulated NIH3T3 cells.3 Id1 had shown to inhibit, E-protein and ETS mediated activation of the CDK inhibitor p 16/INK4a.170 ld2 and Id3 have been shown to get phosphorylated in late GI stage of cell cycle by cyclin dependent kinase 2 (CDK2), 171-112 and Jd2 by interacting via 23 its HLH domain with retinoblastoma protein (pRb ), p 107 and p 130, reverses cellular growth inhibition.3 Id proteins induce apoptosis in accordance with their expression.

Expression ofldl in dense mammary epithelial cell cultures, 173 Id3 in B-lymphocytes,174 and Id4 in astrocyte-derived cell line, 175 induces apoptosis.

In general, the expression of Id proteins is high in proliferating cells as Id proteins

10 176 (Jdl-Id3) promote cell proliferation, - and expression is down regulated during differentiation. 177 Id I, Id2, and Id3 are upregulated arein pancreatic cancers, 178 colorectal cancers,179 astrocytic tumors, 180 and squamous cell carcinomas of head and neck. 181 Id4 expression is seen to decrease in many cancers, 182 due to promoter hyper methylation, 183 except in testicular seminomas where all Id genes are upregulated. 184 As key regulators of cell cycle and differentiation. Id proteins have shown a vast regulatory functionacross diverse cellular functionsincluding cell cycle, apoptosis, senescence and tumorigenesis in cancer. 185

ID2 and 1D3 contain an N terminal region targeted by Cyclin A and Cyclin E cdk2 complexes for phosphorylation, and that region is encoded by a Salmonella typhimurium virulence gene regulator (SPVR) site of which a serine residue is phosphorylated, the SPVR region is also present on ID4 but absent in ID! . 172

Phosphorylation of ID2 inhibits the binding to E proteins, whereas the phosphorylation of

ID3 changes the specificity of the binding to either E 12 homodimers or E 12-MyoD heterodimers in B-cells. 171 The inhibition of the phosphorylation of either ID2 or ID3 also affects their ability to promote S phase entry and therefore affects the proliferative potential of the ID2 and ID3. 186 The half�life of the JD proteins varies between 15 24 minutes to !hour depending on cell type and cellular localization. 187 The degradation of the ID proteins has been linked to the ubiquitin proteasome system. This system relies on an ubiquitin activating enzyme, El, an ubiquitin carrier protein, E2, and an ubiquitin ligase, E3. The addition of multiple molecules ofubiquitin then targets the protein for degradation via the proteasome. 188 This process of degradation is apparent with ID 1, ID2 and ID3, and also 1D4. However, ID4 that is ubiquitinated, is dependent on EI enzyme fordegr adation. 188

2.22 Inhibitor of DNA Binding 4 (ld4) Protein

Id4 mRNA and protein, which are primarily expressed in the nervous system, 189 progressively decrease as the precursor cells proliferate in vitro and in vivo and do so more quickly when the cells are cultured at 33°C compared with at 37°C. The progressive decrease in Jd4 transcription may be part of the cell-intrinsic timer that helps determine when oligodendrocyte precursor cells withdraw from the cell cycle and differentiate. 190

The human 1D4 has two coding exons and produces a protein predicted to be approximately l 7kDa. In mice, ld4 RNA is expressed predominately in developing and mature neuronal tissue, bladder and bone marrow that differs from the expression patterns ofldl, Jd2 and [d3, 189 while low levels ofld4 RNA (with all the other ID transcripts) is seen in in vitro embryonic stem cell line cultures, but this disappeared as the cells differentiatedinto blast colonies. 191

1 1D4 expression in PCa is associated with an increased risk ofmetastasis. 92 A recent study by Sharma et al. found Jd4 promoter methylation in PCa. 183 Another study from our lab shows, ectopic expression ofld4 results in cell cycle arrest. 19 Id4 promoter 25 methylation and loss of expression has also been documented in colorectal

193 adenocarcinomas. Id4 expression has been linked to breast tumourigenesis and Id4

194 protein down-regulates BRCAJ expression, and its expression is inversely correlated

195 with estrogen receptor expression in breast cancer malignancies. ld4 promoter methylation which is evident in breast cancer demonstrates its role as a potential tumour

1 suppressor and oncogene in a context dependent manner. 96

The sub-cellular localisation of the Id proteins is considered nuclear, but differs

197 with cell type, differentiationstage and post translational modification. In normal rat breast tissue ld4 sub-cellular localisation changes with the differentiationstage of the epithelia, with more nuclear staining in proliferatingepithelia and in all other stages it is

198 either mostly cytoplasmic or very weakly expressed. In PCa cell lines, it shows that ld4 protein has a differenteffect on the cell cycle to the other Id proteins. Id4, when ectopically over-expressed in PCa cell lines, induced S phase arrest and apoptosis and this was attributed to Id4 up-regulating the expression of E2A which in tum increased the levels ofp21 andp27 expression. Id4 has also been demonstrated to increase cyclin e

199 levels in cdkn2a -/- astrocytes, which drives their proliferation. In neural precursors,

200 Id4 protein is required forthe GI to S phase transition in the cell cycle.

ld4 plays an important role in nervous system and in particularly in oligodendrocyte differentiation by directly binding to OLIG I and OLIG2 proteins

201•202 responsible for in neural progenitor cells, and acts as a tumor suppressor in breast

203 cancer. The specific nature ofld4 protein expression in cancer has not been clarified, however studies support that Id4 has both pro-tumor and anti-tumor activity. Epigenetic 26

204 196 205 206 silencing ofld4 in leukemia, breast, · colorectal, mouse and human chronic

207 208 209 lymphocytic leukemia (CLL), and gastric cancer, - tend to support its antitumor activity. It is highly expressed in bladder and rat mammary gland carcinomas suggesting

2 that it may have pro-tumor activity. 10 All knockout Id4 mice studies revealed that ld4 plays an essential role in neural stem cell proliferationand differentiation,200 and normal brain development. 211

The t(6;14)(p22;q32) translocation was initially identified using fluorescence 'in situ' hybridization (FISH) and inverse PCR in one case of adult B cell precursor acute lymphoblastic leukaemia (BCP-ALL) and showed ID./RNA expression,212 and also over­ expression of 104 protein by immunohistochemical staining in four other cases of BCP­

ALL which harboured other genetic abnormalities such as a t(8;14) translocation, a P53 mutation, 46XYI 2p- and hyperdiploidy.

The involvement of ID./ in an immunoglobulin heavy chain locus (IGH) translocation was identified in 13 patients with BCP-ALL.210 The t (6;14) (p22;q32) was cloned from3 cases using long distance inverse PCR (LDI-PCR) and showed the translocation of IGHJinto the centromeric 3' portion of the ID./ gene resulting in the over expression of ID4 RNA in BCP-ALL. The current literature and preliminary gene expression experiments therefore suggest that ID-I may be a tumor suppressor or an oncogene in a context dependent manner. 27

2.23 Id4 Expression in Normal Prostate

Oncomine database suggested that Id4 is highly expressed in the lurninal epithelial cells of the adult normal prostate and its expression decreases in PCa (Figure 6) and that was also seen in mouse prostate (Figure 7). To furtherelucidate this phenomenon, a tissue microarray (TMA) also showed that Id4 is highly expressed in normal prostate whereas its expression decreases with increase in cancer progression

(Figure 8). Majorityof studies have suggested that Id4 acts a potential tumor suppressor in many other cancers such as breast, leukemia, glial neoplasia, gastric cancer, pancreatic cancer, colorectal adenocarcinoma, and malignant lymphoma. "

\• ... t! • ... I ,. c IO· ::, T , C 1 · .• : T ... •· .,...... I ... z . •· ,, " " . O.s, • PC •-P( ..,. "' ..-P( A[- ..-... PC n " 61 • l ' I n ' 11 II 10 1101 :j T ••-...t 1011 Ull (OOf"\.tM OS,8,1 ..... 11(17 1117 71£ 6 1(1 - .. " " ., Figure 6. Oncomine database: Shows that ld4 expression is down regulated in PCa.

+ .., + � i

Figure 7. Expression of ld4 in normal prostate: In normal mouse prostate ld4 is highly expressed. 28

' J . ....,.. • • ..... ,.. - .. . -·� H Figure 8. PCa tissue microarrays. They were used to investigate ld4 expression. ld4 was highly expressed in normal prostate (A) 200X and (B) 400X as seen by intense brown staining in the nuclei. Overall, ld4 expression decreased with increasing grade of PCa (C) grade I (200X), (D) grade I (400X), (E) Grade JI (200X), (F) grade II (400X), (G) Grade lil (200X), and (H) Grade Ill (400X). The sections are also representative of scores used to quantify staining intensity: A and B - score 3; C and D - score 2; E - score 0. ld4 is mostly nuclear as seen by intense nuclear staining (brown, indicated by red arrow in D). At higher stages a clear large nucleus with no apparent brown staining is observed (yellow arrow in D and F). The sections were counterstained with hematoxylin that is reflected in the blue nuclei observed primarily in PCa sections with undetectable Jd4 expression. The 400X images in panels B, D, F, and H are corresponding images of boxed regions shown in panels A, C, E, and G (2009). The inset in panel G is the 4009 image of the region showing high ld4 expression in normal prostate adjacent to cancer (stage III).

2.24 Id4 is Epigenetically Silenced in Cancer

Studies performed in other cancers such as breast, colorectal and lymphoma have showed that Id4 is epigenetically silenced due to promoter hyperrnethylation. EZH2 is a transcriptional repressor that plays a vital role in maintaining the homeostatic balance between gene repression and expression.213 In PCa EZH2 is involved in epigenetic silencing of many tumor suppressor genes such as DAB2 interacting protein

(DAB2IP),214 Adrenoceptor Beta 2 (ADRB2),215 E-Cadherin (CDHl),216 and KLF2. 217 30

ld4 gene levels Annexin Gene Levels C 100 0 c: 40 ·� 80 .9 41 a.... 60 �30 X CV 41 40 �20 > ·,.:; CV 10 � 20 . ? � 0 ...... 0 • - 0 5 10 CV ctrl 5mm trt 5mm trt 10mm a:-10 Sodium Butyrate (mM) Sodium Butyrate mM

Figure 10. Treatment with NaBr: Relative expression levels of Annexin and ld4 gene levels increased in dose dependent manner when treated with Na Br in DU I 45 cells. Annexin is used as positive control for the treatment.

2.26 Id4 Acts as a Tumor Suppressor

The specific nature of Id4 protein expression in cancer has not been clarified, however studies support that Id4 has both pro-tumor and anti-tumor activity. Epigenetic silencing ofld4 in leukemia,204 breast, 203 colorectat,206 mouse and human chronic lymphocytic leukemia (CLL),207 and gastric cancer,208 tend to support its antitumor activity.

PCa by promoting apoptosis through caspase 3/7, cytochrome c and p53 dependent pathways. 16• 19 Also, we have shown that Id4 promotes senescence by promoting E2F I expression. 16 Id4 has also been shown to attenuate cell proliferation by increasing the expression of cyclin dependent kinase inhibitors p 16 and p27 expression and inhibits migration by down-regulating MMP2 expression.221 Nkx3. l, a marker of epithelial differentiationthat regulates rate of proliferating luminal epethilialcells in prostate,222 is downregulated in LNCaP - Id4 cells, (Id4 was silenced with gene specific 31

shRNA) whereas it is upregulated in DU145+Id4 cells (Id4 is ectopically expressed).

PTEN that acts as a negative regulator of AKT is upregulated in DU145+Id4 cells. 18

Sox9 whose expression is observed in early stages of prostate hyperplasia and is a part of

prostate development that gets reactivated in prostate neoplasia is upregulated in LNCaP­

223 224 ld4 cell and vice versa in DU145+1d4 cells. - Our studies from lab show that Id4

overexpression in DU 145 cells promoted apotosis and scenecence (Figures 11 and 12).

Overall these studies show that in PCa cell models, in which Id4 was either silenced or

over-expressed, Id4 acts as a tumor suppressor. 18

Viable Cells 73% 30%

Apoptotic 24% Cells

Dead Cells 3% 6%

Figure: 11. ld4 induces apoptosis in DU 145 cells. DU 145 + ld4 cells have almost three times more apoptotic cells than DU 145 cells, along with more 50% more dead cells

Cells B-gal Staining

Figure: 12. ld4 promotes senescence in the DUl45 cells. Cells (DU 145 and DU 145+ld4) cells were stained with SA-b-galactosidase. The blue nuclei due to SA-b-galactosidase staining were counted in 15 randomly-selected fields and are expressed as mean+SEM (panel F). The flattened nuclei with intense blue staining were classified as cells with advanced senescence and smaller light blue nuclei were counted as cells with moderate senescence. ***p<0.00 I, t-test performed for columns "a" and "b" 32

2.27 PTEN/AKT Pathway and ld4

Study between ld4 and PTEN expression, suggest that there is some cross-talk between AKT pathway and Id4. 18 Recent study by Sharma et al suggested that loss ofld4 in mouse prostates resulted in decrease in expression levels of PTEN and vice-versa pAKT expression levels increased in the absence of ld4 suggesting its role in the AKT pathway. In Id2 and ld3 the serines in Salmonella typhimurium virulence gene regulator

(SPVR) site are being phosphorylated.26 Id2 acts as a growth suppressor in myoblasts when one of its serine at position 5 in SPVR region gets dephosphory lated. 26 ld4 also possess similar sequence containing the serine's at the same positions as seen in ld2. So these findings led us to investigate whether Id4 functions in the similar fashion as Id2.

From previous study, 18 and from preliminary studies (data shown below) we know that ld4 plays a role in regulating PTEN and pAKT expressions.

p53 binding to PTEN promoter can enhance the regulation of PTEN by ld4 and thus can mediate cell cycle arrest and apoptosis by promoting stabilization, acetylation

21 and tetramerization ofp53. ·22 ld4 that regulates PTEN activity and expression, might play a role when PTEN inactivation increases the expression and activity levels of

MDM2 a known p53 repressor by PBK/AKT dependent pathway23, but when PTEN is present it upregulates p53 through translational mechanisms mediated by mTORCI. All this studies along with some bioinformatics studies made us to investigate the role of

PTEN/AKT pathway in regulating Id4 phosphorylation and vice-versa the role ofld4 in regulating PTEN/AKT pathway. 33

2.28 ld4 Regulates PTEN/ A.KT Pathway

IHC studies on prostates from 6-8 weeks old ld4-/- mice were analyzed. Data

suggested the loss or decreased PTEN expression in Jd4-/-prostates as compared to wild

type. f n Id4 -/-, expression levels of pAKT increased compared to wild type with no

significant change in AKT levels. Jd4 -/- leads to PIN like lessons suggesting ld4s role in

PCa initiation and progression as shown in Figure 13. These results lead us to investigate

AKT, pAKT and PTEN mRNA and protein levels in PCa cell in context ofld4

expression.

Fi2ure 13. IHC data on PTEN, AKT and phospho-AKT (p-AKT). Expression in wild type (ld4+/+) and ld4 knockout (ld4-/-) mice A: Pten was expressed at high level in the normal prostate both m the nucleus and cytoplasm of ld4+/+ prostate. B and C: Ptcn expression was significantly reduced or undetectable (black arrowheads) in the ld4-/- prostate ducts. Note the hyperplastic regions in Panel B. Occasionally, few Pten positive cells were observed that were primarily localized to epithelial cells near the basement membrane (Inset in Panel B). Ptcn expression was observed in the urethra (asterisk, Panel C) but not in prostatic ducts. The inset in Panels A and B arc enlarged boxed regions m corresponding panels. Panels D-F: Lobe specificexpression of phospho-Akt in ld4-/- mice. Increased phospho-Akt was observed in dorsal prostate (Panel D) but not in ventral (E and inset)) and lateral ( F) prostate. Phosphorylation of Akt correlated with total Akt expression (G-1) m ld4-/- prostate. Akt expression was undetectable m lateral and ventral prostate (G) but was detectable in dorsal prostate (II and I) from ld4-/- mice. Panels J-L: Total Akt expression in wild type mice prostate. Aki expression was highly variable within the glandular epithelium (J). Regions of undetectable to high Akt expression ,1cre juxtaposed ( K and L) Similar expression profile (low to high) of phospho-Akt was observed m ,1 lid type prostates (Panels M-0). The cells stammg positive for phospho-Akt ,1erc counted in tubules that also stained pos111ve for Al..t. The ratio of pAkt/Akt positive cells is shown in Panel L ( .. •: P < 0.00 I). Representative images are shown. The scale bar is I00 um 34

In comparision with DU 145 cell line, in DU l 45+ld4 (Id4 ectopically expressed), pAKT levels decreased and AKT levels remained the same as seen in Figures 14, 15, and

16. PTEN levels increased, in DU145+Id4 as compared to DU145 cells, suggesting that these results are similar to those obtained in ld4 -/- mice prostates.

1.4 PTEN Gene Levels C 1.2 .2 � 1 I '-cu Q. 0.8 )( cu 0.6 > l'O 0.4 cu a: 0.2 0 LNCaP LN-ID4 DU145 DUtID4

Figure 14. PTEN mRNA data. Showing increase in PTEN expression in the presence ofld4 in RT PCR. There is increase in PTEN mRNA in DU 145+1d4 compared to DU 145, with no change in LNCaP and LNCaP-ld4.

.... � c! ;,, � ,I j -S' -S' i � s <:) <:) p .._ -- ..... PTEN �� _, GAPH Figure 15. PTEN protein expression. Data showing increase in PTEN expression in the presence of ld4 in DU 145. GAPDH was used as a loading control

I --- NCT .-r---

Figure 16. Expression levels ofphospho AKT and AKT. LNCaP- ld4 cells show more expression of pAKT when compared to LNCaP cells. DU 145 + Id4 cells have less expression pAKT when compared to DU 145 cells. Total AKT remained similar in comparative cell lines. GAPDH was used as a loading control. 35 Till now, no studies have been performed to address the mechanism by which Id4

act as a tumor suppressor (Prostate) or tumor promoter (Glioblastoma). All Ids have

conserved HLH domain with variables C and N terminals as shown in Figure 17. Id2 which belongs to the same family as Id4 is known to act as tumor promoter when it is

phosphorylated at serine 5 of SPVR region and as tumor promoter when it is phosph­

oablated.

I di I d2 I d3 I d4

I di I d2 I d3 I d4

I di 114 I d2 I d3 I d4

Figure 17. ID protein sequences. Conserved HLH domain in all Id proteins shown in Red box. Yellow box is the serine at position 5 that is phosphorylated in ld2 and present in ld4.

Analysis of data from different Bioinformaticstools like NET PhosK 1.0 Server

(Figure 18) predicted the possible phosphorylation sites in Id4. This results along with the

role Id4 role in regulating phospho-AKT via PTEN prompted us investigate the role of

PTEN/AKT pathway in Id4 phosphorylation. Thus these findings led us to propose a

model (Figure 19) whereby, Id4 could regulate PTEN/AKT pathway via phosphorylation.

Collectively, the initial data prompted us to investigate the role of Id4 in regulating PTEN

and AKT pathway, and whether this study can answer the Id4 form of action in PCa is

through phosphorylation or not. 36

NetPhosK 1.0 Server - prediction results Technical University of Denmark

Meehod: �eePho•K w1ehoue ESS r11eerino: Quer¥= q1_ee1546_qb_AAA73923.1_ S.1.ee------Kinase Score S-5 cd.lc5 0.61 s-10 PKC o.�e S-16 c

Figure 18. NetPhosK 1.0 Server. Showing ld4 Predicted phosphorylation sites with highest score at Serine5 and Serine I 0.

Growth Promoter ..... Ex: Glioblastoma

Tumor Suppressor t Ex: Prostate Cancer

Figure 19. Predicted ld4 phosphorylation model: This graphical representation shows possible phosphorylation of ld4. In the presence of PTEN. pAKT is converted back to AKT leading to dephosphorylation of Id4, that now acts as a tumor suppressor as seen in PCa. In the absence of PTEN, AKT gets phosphorylated and as result it leads to ld4 phosphorylation, that now acts as a tumor promoter as seen in Glioblastoma. Now ld4 that is in dephosphorylated form intum upregulates PTEN vice-versa, thus forminga positive feedback loop. CHAPTER III

MATERIALS AND METHODS

3.1 1D4 Overexpression and Silencing in PCa Cell Lines

The PCa cell lines LNCaP, DU145 and PC3 were purchased from ATCC and cultured as per A TCC recommendations. Human Id4 was over-expressed in DU 145 cells

19 as previously described. ID4 was stably silenced in LNCaP cells using gene specific sh RNA retroviral vectors (Open Biosystems #RHSl 764 -97196818, -97186620 and

9193923 in pSM2c, termed as Id4shRNA A, Band C respectively). The cells transfected with non-silencing shRNA (RHS 1707) was used as control cell line. Transfections and selection of transfectants(puromycin) were performed as suggested by the supplier.

SuccessfulID4 gene silencing was confirmedby qRT-PCR, Westernblot analysis, and

ICC.

The pCMV + ID4 vector and pCMV vector alone was transfected in sub­ confluent (60%) PC3 cells grown in six well plates using Trans!T-prostate transfection reagent cocktail (IO µL Trans!T prostate reagent, 5 µL prostate boost reagent (Mirus Bio) and 2 µg pCMV-Id4 DNA in 200 µL of serum free media) for around 5 to 6 hours. The culture media which was without serum and antibiotics was changed. Once after an overnight that is after 12 hours incubation with the cocktail. Forty-eight hours after transfection, the cells with incorporated pCMV + ID4 were selected by incubation in the fresh media containing antibiotic named G4 I 8 with about 15 to 20 days with changing

37 38 fresh media containing 350 µg/mL 0418 (Invitrogen) for one week with media change every 2 days. Following this selection cycle, the transfectedcells were passaged once in

F12-BCS-Antibody and then re-exposed to F12-BCS-Antibody with 350 µg ofO418/ml for an additional week (second 0418 selection). This approach ensured the survival of only transfected cells. Simultaneous experiments were also performedin which cells were transfected with no DNA (control, parental) or with pCMV DNA (transfection control). The 0418 selection procedure described above resulted in no surviving PC3 parental cells. The cells were grown to confluence (80%), trypsinized (0.25% v/v trypsin and 0.03% w/v EDT A in calcium- and magnesium free phosphate buffered saline), counted, and plated at a l :2 dilution in new l 00-mm plates.

3.2 Reverse Transcriptase

RNA (2 µg or 4µg) was reverse transcribed in a final volume of 25 µl as per standard protocols 18· 225 (RT-Mix: 1.25 mM each of dNTP's; 250 ng oligo dT (Promega,

Madison, WI), IO mM dithiothreitol, and 200 U MMLV reverse transcriptase

(Invitrogen) in the MMLV first-strandsynthesis buffer (lnvitrogen)). RNA was denatured for 10 min at 65°C, and then cooled on ice for 2 minutes before addition of RT mix and enzyme. The reverse transcriptase reaction was carried out at 42°C for l h and 95°C for 5 minutes. The reverse transcribed RNA were stored at -20°C until further analysis.

3.3 Quantitative Real Time PCR (qRT-PCR)

qRT-PCR was performed as described previously using gene specificprimers

(Table 2) on RNA purified from cell lines.226 39

Table 2. qRT-PCR and ChIP Primers Used in the Study

PCR primers Forward (5' ) Reverse (5') ld4 CCCTCCCTCTCTAGTGCTCC GrGAACAAGCAGGGCGCA

GAP DH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATHC

AR GAAGCCATTGAGCCAGGTOT TCGTCCACGTGTAAGTl'GCG

p21 GCCAlTAGCGCATCACAG TGCG'ITCACAGG'l'GTITCrG

T FKBP51 TfCCCTCGAATGCAACTCTC TCTACTGlTGCTCCTCGTTTG

CHiP Primers

FKBP51 GGAGCCTCllTCTC AGTTrrG CAATCGGAGTGTAACCAC ATC

BAX GGAOCCI ClTTCTCAGTrr,·o CAATCGGAGTG'l'AACCACATC PUMA CATGlTCACATTAGTACACCTTGCC TCTCAGATCCAGGCTTGCITACTGTC

3.4 Protein Extraction

Total cellular proteins were prepared from cultured PCa cell lines using M-PER

(Thermo Scientific).19 Protein samples were quantitated using the BCA protein assay protocol fromBio-Rad. A standard curve was determinedusing BSA and sample absorbance read at 750 nm. Samples were concentrated in 30 µg/µL volume and then

mixed 1: 1 with 2X laemmli sample Buffer.

3.5 Western Blot Analysis

30 µg of total protein was size fractionated on 4-20% SDS-polyacrylamide gel and subsequently blotted onto a nitrocellulose membrane (Whatman). The blotted

nitrocellulose membrane was subjected to western blot analysis using respective protein specificantibodies (Table 3 ). 40

Table 3. Antibodies for Western Blotting, Co-IP, IHC, ICC, and ChiP Analysis

Protein Company Antibodies Dilutions WB/ICC !04 Aviva I:1200, I :200 !04 BioCheck 1:1000 GAPDH Cell Signaling 1:1000, 1:200 PUMA Rockland lmmunochemical 1:1000 BAX Cell Signaling 1:1000 PTEN Abeam 1:1000, 1:150 p21 Cell Signaling 1:1000 p53 Cell Signaling I: 1000, I :200 E-Cad Novus Biologicals 1:1000 AR Santa Cruz 1:500, 1:150 EGFI Cell Signaling 1:1000 Kl67 Abeam 1:1000 RNA Pol II Millipore Global Acetylated lysine Cell Signaling 1:1000 K320 Millipore 1:1000 K373 Abeam 1:1000 Goat anti-rabbit 1:10000 Secondary Antibody Millipore PDH Cell Signaling 1:250 ICC secondary antibodies Cell Signaling DyLight 594 goat anti- 1:200 mouse (red) Thermoscientific DyLight 488 goat anti- 1:200 rabbit (green) Thermoscientific DyLight 594 goat anti- 1:200 rabit (red) Thermoscientific Dy Light 488 goat anti- 1:200 mouse (green) Thermoscientific

After washing with Ix PBS, 0.5% Tween 20, the membranes were incubated with horseradish peroxidase (HRP) coupled secondary antibody against rabbit JgG and visualized using the Super Signal West Dura Extended Duration Substrate (Thermo

Scientific) on Fuji Film LAS-3000 Imager. 41

3.6 Cell Proliferation Assay

PC3-CMV and PC3+1D4 cells were plated in a U shaped 96 well plate at a density of 5x 103 cells/well. Afterthe cells attached, they we Cell proliferation analyses were performed using 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

(MTT) assay. PC3-CMV and PC3+ID4 cells were seeded in 96-multi well plates at a density of 5 x 105 cells/ well without serum overnight. Cells were then cultured for 72 hrs. MTT assay was performed using CellTiter 96 Non-Radioactive Cell Proliferation

Assay kit (Promega) following manufacturer's instructions.

3. 7 Statistical Analysis (Proliferation)

Data was analyzed by SPSS 13.0 statistics software. Experimental data is presented as means ± SEM. A p-value of <0.05 was considered statistically significant.

3.8 Apoptosis Assay

Apoptosis was quantitated using Propidium Iodide and Alexa Fluor 488 conjugated Annexin V (Molecular Probes) and dual-sensor MitoCasp (Cell Technology) as described previously.227

3.9 Statistical Analysis {Apoptosis)

Quantitative real time data was analyzed using the delta delta Ct method. The

ChIP data was analyzed using% chromatin (1%) asinput (Life Technologies). Within group Student's t-test was used for evaluating the statistical differences between groups. 42

3.10 AKT Kinase Assay

Akt kinase assay was performed using a nonradioactive IP-kinase assay kit (Cell

Signaling, Beverly, USA) as directed by the manufacturer. Briefly, immunoprecipitated

Akt was incubated with cold ATP and GSK-3 fusionprotein, an AKT substrate, followed by detection ofphosphorylated GSK-3 by immunoblottingwith a specific antiphospho­

GSK-3<>1/3 (Ser2l/9) antibody,228 in DU145 and DU145 + Id4 cells.

3.11 Migration Assay

In vitro cell migration assay was conducted using 24-well transwell inserts (8mm,

BD Biosciences, Palo Alto, California). Cells were harvested and centrifuged at 1500 rpm for5 minutes at room temperature. The pellets were suspended into Fl2 supplemented with 0.2% BSA. Aliquots of lOOµL cell suspension (3xl04 cells/insert) were added to each insert. Chemo attractant solutions were made by diluting EGF (I 0 ng/mL) into Fl2 supplemented with 0.2% BSA and then cells were allowed to migrate through a porous membrane coated with rat tail collagen (50 mg/mL) at 37°C for 5 hours.

F-12 containing 0.2% BSA served as the control medium. Cells inside the transwell inserts were removed by cotton swabs. The cleaned inserts were fixed in 4% paraformaldehyde(pH 7.5). Cells on the outside of the transwell insert membranes were stained using DAPI (3 µg/mL). The images were captured in fiverandom areas using

Axiovert 200M, Carl Zeiss (Gottingen, Germany) microscope. Stained nuclei were counted using image analysis software (ZEN 2012; Carl Zeiss). Results were expressed as migration index definedas: the average number of cells per field fortest substance/the average number of cells per field forthe medium control. 43

3.12 Tunel Assay

The terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate

(dUTP) nick end labeling (TUNEL) assay was used to detect fragmentedDNA as marker forapoptosis in FFPE tissue sections using TACS 2 TdT-DAB apoptosis detection kit

(Trevigen). The slides were counterstained in hematoxylin and mounted with lmmuno­ mount (Thermo Scientific).

3.13 Luciferase Reporter Gene Assay

PC3-CMV and PC3+1D4 cells were plated in a 96-well plate at a density of

2.5x l 04 cells/well. After the cells attached, they were transiently transfected by mixing either mutated androgen response element (ARR3-luciferase) or AR response element driven luciferase reporter plasmid (PSA-luciferase) with pGL4.74 plasmid (hR/uc/TK:

Renilla luciferase, Promega) DNA in a 9:1 ratio with FuGENE HD transfection reagent

(Promega) in a finalvolume of l 00 µL of RPM! 1640 medium and incubated for 15 minutes at room temperature. The transfection mix was then added to the cells followed by addition of R 1881 (IO nM) or vehicle after 4 hours. Aftera total of 24 hours, the cells were assayed for fireflyand renilla luciferase activities usingthe Dual-Glo Luciferase reporterassay system (Promega) in LUM!star OPTIMA (MHG Labtech). The results were normalized for the internalrenilla luciferase control. Both of the luciferase plasmids were provided as a generous gift fromDr Amina Zoubeidi (University of British

Columbia, Canada). 44

3.14 lmmunohistochemistry (IHC)

Slides were processed through standard protocols. Following antigen retrieval

(autoclave in 0.01 M sodium citrate bufferpH 6.0 at 121C/20 psi for 30 min), the peroxidase activity was blocked in 3% H2O2 and nonspecificbinding sites blocked in

I 0% Goat serum. The blocked sections were incubated overnight at 4°C with respective protein specificprimary antibodies followedby incubation with secondary antibody for I hour. The slides were stained with DAB for2 min, counterstained with haematoxylin and mounted with lmmuno-mount (Thermo Scientific), examined and photo-micrographs taken using the Zeiss microscope with an AxioVision version 4.8 imaging system. All the antibodies were mono-reactive, that is a single reactive band was observed in western blot using total cell lysate from PCa cell lines LNCaP, DUI 545 and PC3.

3.15 DNA Methylation Analysis

PTEN promoter methylation was analyzed using methylation-specific PCR (MSP) as described previously.229 The MSP region amplifiedin context of the PTEN genome in this study has been previously investigated and well characterized in hepatocarcinoma.229

Briefly, Genomic DNA fromcell lines was isolated using DNeasy kit (Qiagen) and from laser captured sections using ZR Genomic DNA tissue MicroPrep Kit (Zymo Research).

Approximately I µg of DNA was sodium bi sulfite-modified using EZ DNA methylation

Kit (Zymo Research) and subjected to MSP as described previously.229 Polymerase chain reactions were performedin a 25µL reaction using GoTaq Green master mix (12.Sul,

Promega) with 500pm each of the 5' and 3' primers (Table 2). Temperature conditions for PCR were as follows: 40 cycles of 94°C for30 sec, 58°C for 45 sec and 72°C for 30 45 sec, followedby I cycle at 72°C for IO min. PCR products were separated on 1.5 % agarose gels and visualized using GelDoc XR+ (BioRad).

3.16 Bisulfite Sequencing

Direct bisulfite sequencing of the PCR product was performed as reported earlier using ID4 specific primers as listed in Table 2 and analyzed using ABI sequencer.

3.17 siRNATransient Transfections

Cells were seeded in 6 well plates at l .25x 105 cells/well in 5% bovine calf serum

(VWR) and allowed to attach overnight. The following day, cells were rinsed with serum free media immediately prior to transfection. Transient transfection reagent was used to transfect pl 4ARF siRNA and p 14ARF siRNA (Catlog # AM51331) control in DU 145 cells according to manufacturer's protocol fromAmbion Life Technologies and the cells were then cultured for additional 48-72 hr. Subsequently, the transiently transfected cells were harvested forRNA/protein or cross linked with formaldehyde for Chromatin immuno-precipitation.

3.18 Chromatin Immunoprecipitation (ChIP) Assay

Formalin-fixed paraffin-embedded (FFPE) samples were used forCh!P based analysis for enrichment ofp53, Acetyl p53, H3K27Me3 and H3Ac on PTEN promoter.

For this analysis, the regions showing >75% cancerous regions or more than >80% normal/ benignregions were dissected using Leica LMD6500 and captured in micro centrifugetubes. Genomic DNA was isolated fromthese sections by the method of

Fanelli et al., except that tissue samples were de-paraffinizedwith xylene instead of 46 histolemon. The chromatin extracted fromtissue samples was sheared (Covaris S220), subjected to immuno-precipitation with either p53, Acetyl p53, RNA POL 11,

H3Acetylation or IgG antibodies (see Table 3), reverse cross linked and subjected to quantitative Ch!P- PCR (qChlP).

Chromatin immuno-precipitation in cell lines was performed using the ChJP assay kit (Millipore, Billerica, MD) as per manufacturer's instructions. The chromatin (total

DNA) extracted from cells was sheared (Covaris S220), subjected to immuno­ precipitation with respective antibodies (see above), reverse cross linked and subjected to quantitative ChIP- PCR in Bio-Rad CFX.

3.19 Statistical Analysis (ChlP)

Quantitative real time data was analyzed using the ti.ti.Ct method. TheChlP data was analyzed against non-immune IgG used as a negative control. Within group

Student's t-test was used for evaluating the statistical differences between groups.

3.20 lmmuno-Cytochemistry

Cells were grown on glass chamber slides up to 75% confluency. The slides were then washed with PBS (3x) and fixed in ice cold methanol for 10 min at room temperature and stored at -20°C until further use. Beforeuse, the slides were equilibrated at room temperature, washed with PBS (5 min x 3), blocked with I %BSA in PBST for 30 min at room temp and incubated overnight ( 4°C) with primary antibody (I% BSA in

PBST). The slides were then washed in PBS and incubated with secondary antibody with fluorochromeconjugated to Dy Light in I% BSA for I hr at room temp in dark. The 47 slides were subsequently washed again and stained in DAPI for I min and mounted with glycerol. Images were acquired by Zeiss fluorescence microscope through Axiovision software.

3.21 Site-Directed Mutagenesis

In-vitro site-directed mutagenesis was performedby using cloned Pfu DNA polymerase (Agilent technologies) on bacterial expression plasmids. The PCR product was first digested overnight with Dpn-1 (Promega) and then used to transformJMlOI super-competent cells (Agilent). All the mutants were verifiedby DNA sequencing

(Applied Biosciences). Mutations in the SPVR region at serine 5 of!D4 were introduced by PCR using complementary primers incorporatingspecific site mutations. The mutation of the serine with alanine serves as a phospho- deficientand mutation of serine with glutamic acid serve as a phosphor- mimic. Followed by transfectionof the plasmid into cell lines to further determine the effect of mutagenesis at serine 5 of ld4 that explains whether Id4 is phosphorylated or not. CHAPTER IV

RESULTS

4.1. ld4 Regulates PTEN Expression/Function

Previous studies from both our lab and from other labs showed that ld4 acts as a tumor suppressor in PCa by promoting apoptosis through caspase 3/7, cytochrome c and p53 dependent pathways. 19 But the underlying mechanism of how Id4 regulates p53 dependent pathways is not known. Studies showing the positive feedback loop between

PTEN and p53 lead us to investigate one of the mechanisms of how p53 pathway can be regulated by PTEN in the presence ofld4. PTEN presence blocks the PI3-AKT pathway which controls fundamental cellular processes such as cell survival and cell cycle. In my preliminary data I have shown that ld4 increases the expression levels of PTEN and also I have shown that decreases pAKT expression levels with no change in total AKT levels. I have seen both at gene, protein and also with IHC data. These lead us to investigate the mechanism by which ld4 regulates PTEN expression/function and whether transcriptional regulation of PTEN is (acetyl) p53 dependent. ld4 acts as a tumor promoter in glioblastoma,230 but tumor suppressor in prostate, gastric, colon and leukemia. Functional difference of Id4 in different cancers might be because of phosphorylated or unphosphorylated forms as seen in the case of Id2. Recent evidences based on the Bioinformatics data on Id4 suggested possible phosphorylation sites that might get phosphorylated. PTEN by converting PIP3 to PIP2, (dephosphorylates)

48 49 pAKT to AKT), might functionin dephosphorylating Jd4 which leads to tumor suppression that we see in PCa and increase in dephosphorylated ld4 increases PTEN levels which serves as a feedback loop. Overall these observations lead us to investigate phosphorylation of serines at position 5 on ld4 protein.

Based on preliminary results demonstrating that ld4 dependent regulation of (JHC data PTEN mRNA and protein levels) of PTEN, pAKT and AKT made us to investigate our first aim to determine the mechanism by which Id4 regulates PTEN expression/ function.

4.1.1 Methylation and Acetylation of PTEN Promoter

At the epigenetic level, methylation and acetylation of PTEN were studied in the presence or absence of Jd4. We observed that there was partial methylation of PTEN promoter in DU145+1d4 cell line to no methylation in DU145. These results prompted us to check histone acetylation status of PTEN promoter in the presence ofld4. We were able to identify H3K.27 acetylation marks near the PTEN promoter region using bioinformatics approaches. Experimentally we did not see significant difference in acetylation of PTEN in DU145 and DUI45+1D4 cell lines (Figure 20).

Methylation Acetylation

l.=:::J DU145 - DU145+1D4

MUMMUMM UM M UM M lJM

00�--�­ HlA�M),

Figure 20. PTEN promoter methylation and acetylation: a. Showing Partial methylation of the PTEN Promoter in DU 145. b. Showing no significant difference comparatively in Acetylation status in DU 145.

49 50

4.1.2 ld4 and p53 Acetylation

PTEN regulation occurs at the transcriptional level also. Many proteins regulate

PTEN transcription negatively (sal-like protein 4 (SALL4), SNAIL, inhibitor of DNA binding I (!DI), BMII, c-JUN, ecotropic virus integration site I protein (EVIi) and

MYC) and positively (peroxisome proliferator-activated receptor-y (PPARy), early growth-response protein I (EGRI), p53 and C-repeat binding factor (CBFl). 148 Human genomic PTEN locus contains a p53 binding element directly upstream of the PTEN gene, which is necessary for inducible transactivation of PTEN by p53.231 These studies along with data from our lab demonstrating that Id4 promotes p53 transcriptional activity through CBP/p300 dependent acetylation, 15 led us to investigate on whether transcriptional regulation of PTEN by ld4 is p53 dependent. IHC data on ld4 -/- also confirms that acetylated p53 expression is decreased in ld4-/- mice as compared to wild type and the expression of p21 a known p53 target is also decreased in Id4-/- mice prostates as shown in Figure 21. 51

104/KO WT

,. . 40X Pll

..

40x Acetyl pS3

' 2Chl lOX .r \' / \ l

40• 40• TotalpSJ

� ..

Figure 21. IHC on ld4-/- with p53, Acetyl p53 and p2 l. The results suggested that acetylated p53 expression is decreased in ld4-/- mice as compared to wild type along with p2 I a known p53 target, with no change in total p53. Acetyl p53 is the active form ofp53 that is involved in tumor suppressor role ofp53.

4.1.3. Binding of Acetyl p53 on PTEN Promoter

These results prompted us to investigate whether PTEN expression is also

regulated by acetylated p53 in the prostate. Chf P analysis on the PTEN promoter showed

significantincrease in binding of acetylated p53 on PTEN promoter in DU 145 + ld4 cell

line compared to DU 145 cell line as shown in Figure 22. Overall these results suggested

ld4 dependent increase in binding of acetylated p53 on PTEN promoter and Id4 regulates

PTEN expression/ function at the transcriptional level via p53 pathway. 52

2.5 D DU145 2.0 • DU145+I04

� 1.5

0:R. 1.0

0.5

00 RNA Pol p53 Ac-p53

Figure 22. ChlP Assay: Increase in the binding of Acetylated p53 to PTEN Promoter. Enrichment of RNA Pol 11, p53, and Ac-p53 on PTEN promoter in prostate cancer cell lines DU 145 and DU45 + ld4 cells. The data is expressed (mean+SEM, n�3 in triplicate) as% of input. The statistical significance between enrichment (indicated by letters"** *" correspondingto Pol II and Ac-p53 respectively) is based on comparison with DUl45 cells(*: P<0.001).

4.2. Role of PTEN-pAKT Axis in Regulating ld4 Phosphorylation

ld2 acts as a tumor suppressor in dephosphorylated form and tumor promoter in phosphorylated form in different cancers where serine 5 of SPVR region gets phosphorylated.26 With this observation along with using one of the Bioinformatic tool,

NetPhosK 1.0 Server (see Figure 15), we were able to focuson possible serines in ld4 that might get phosphorylated based on this score. Serines 5 and IO possessed highest score but we initially focused on serine 5 based on the previous study.26 This observation along with the observation that Id2 study as previously discussed, made us to study aim

2, that is whether PTEN-pAKT axis regulates ld4 activity by phosphorylation and vice­ versa Id4 regulate AKT pathway by dephosphorylating pAKT to AKT via regulating

PTEN. 53

4.2.1 Kinase Assay: ld4 Regulates PTEN/Akt Axis

Phosphorylation of proteins is a posttranslational modification that affects intracellular signaling. Functional regulation by phosphorylation has been well documented for many transcription factors.232 For example tumor suppressor Rb gene that is composed of two sets -pl I0Rb, an un- or under-phosphorylated species, and pp 112-l l 4Rb, a group of overtly phosphorylated proteins is wholly unphosphorylated in

GI, and gets phosphorylated at the beginning of S phase and remained phosphorylated

233 234 through S phase and 02 phase of the cell cycle. - 2% of eukaryotic genes code for protein kinases that are involved in catalyzing phosphorylation events.235 Conserved amino acid sequence SPVR, in Id proteins is a phosphorylation target by cyclin E-cdk2 and cyclin A cdk2 kinases.26 Kinase Assay was performedto study the role ofld4 in phosphorylation of AKT as initial studies, show Id4 regulates pAKT. Kinase assay determines AKT kinase activity in the cell that is measured in terms of Glycogen synthase kinase 3 (OSK- 3) phosphorylation. Results fromFigure 23 indicated that kinase levels in terms of GSK phosphorylation decreased in the presence of ld4 in DU 145 suggesting the antitumor role ofld4. Kinase assay not only determines Id4 role in

PTEN/AKT pathway but also can solve whether in this process ld4 gets phosphorylated or unphosphorylated as seen in Jd2.

DU145+1d4 DU145

Figure 23. Kinase Assay. Showing pAKT activity (in terms ofpGSK levels) is decreased in the presence ofld4. thus indicating the role ofld4 in phosphorylationthat can be antitumoric. GAPDH is used as loading control. 54

4.2.2 Treatment with PBK Inhibitor Lead to ld4 Expression in DU145 Cells

In the initial studies we observed Id4 upregulates and vice-versa downregulates pAKT, speculating the role of ld4 in PTEN/AKT pathway in DU 145 cells. Id4 also reduced the levels ofphospho-GSK as seen above. To further confirmthe role ofld4 in

PTEN/AKT axis we treated DU145 cells with PI3K inhibitor (L Y294002) that inhibits

PIP2 phosphorylation to PIP3 which further blocks AKT phosphorylation. Treatment with PI3K inhibitor increased PTEN expression in DU145 cells as noticed in initial studies). Thus this study furtherconfirms that Id4 induces PTEN in DUl45 cells that, in tum, dephosphorylates AKT. Expression of ld4 after treatment with L Y294002, as seen in Figure 24, indicates that ld4 may be is subjected to phosphorylation even though there is no change in kinase levels before and aftertreatment with L Y294002. Further, Kinase levels are determined in terms of phospho-GSK as seen in Figure 25 aftertreatment with

L Y294002. Id4 by regulating PTEN, can maintain AKT phosphorylation status and by doing so may acquire one of the phosphorylation forms.To clarifythis, we performedIP with ld4, followed by western blot with global phosphoscrine antibody. Possible phosphorylation of ld4 was seen in DU 145+1d4, PC3 and MDA-MB-231, breast cancer cell line used as loading control for Id4 (Figure 26). To further confirm the phosphorylation, future experiments are discussed in next section. 55

OU145 OU145

104

PTEN

GAPDH

LV294002TIIMT

Figure 24. Treatment with LY294002. WesternBlot showing the expression levels of ld4 after treatment with LY294002 in DU 145 cell line, with a comparative increase in PTEN after treatment with L Y294002. GAPDH is used as a loading control

Phospho-GSK

GAPOH .....LY:294002 LY294002 CTRL TRMT

Figure 25. Kinase Assay showing pAKT activity. In terms of Pgsk, levels remained almost same in DUI45 after treatment with PI3K inhibitor. GAPDH is used as a loading control.

1B ld4

PSerine

Figure 26. ld4 Phosphorylation -IP with ID4 & Western blot with phospho serine. Phosphorylation was observed in DU 145+Id4, PC3 and MDA-MB-23 l(Breast cancer cell linethat expresses Id4 used as a control). CHAPTER V

DISCUSSION AND CONCLUSION

Phosphoinositide 3-kinase (PBK)-AKT pathway modulates cell growth, metabolism, differentiation, migration, survival, and proliferation of a wide variety of cell types.236 Misregulation of this signaling pathway can cause several disorders, including leukemia and/or autoimmunity or alternativelyimmune deficiencies.237 Since the discovery of PTEN and its role as a phosphatase, the PIP3-Akt pathway assumes significanceas a major cancer pathway.238 PTEN remains one of the main factors in

90 239 modulating proteins such as AKT and p53 that are altered in cancer. · PTEN, the main negative regulator of PBK-Akt pathway functions as regulator of cell polarity and also as a switch between cell proliferation and migration, various types of cancer.238

Unlike p53, a tumor suppressor which is acutely and rapidly upregulated in response to oncogenic stress, PTEN expression is constitutive and essential at all times.240

PTEN is shown to be regulated by transforminggrowth factor� (TGF�).241 PTEN is upregulated transcriptionallyby factors such as peroxisome proliferation-activated receptor A (PPARA), 141 and the early growth regulated transcription factor-l(EGRl). 142

There is a P53 putative binding element in the promoter sequence of PTEN, 231 that suggests a p53 mediated cellular survival mechanism that functions through the activation of PTEN transcription.

56 57

In Id4 -/- studies, we observed focal hyperplastic regions resembling PIN like lesions. Many of the genes associated with PCa and their respective knockout/transgenic phenotypes are also recapitulated in the Id4-/- model that support the role of Id4 in PCa.

Apart from loss ofNkx3.I as discussed in our recent study, 18 a decrease in PTEN specifically in the prostate, sustained androgen receptor expression, increased Myc and

Sox9 also promote early stages prostatic intraepithelial neoplasia. 223 Our results suggest that the above noted genes and their regulated pathways are downstream of Id4.

However, in spite of these complex alterations, we did not observe a significantly greater number of pre-neoplastic lesions in Id4-/- prostate suggesting the possibility of mechanisms/pathways that restrains the formation of significant pre-cancerous lesions and PCa. One of these pathways could involve AKT, a kinase on which many of these pathways converge. AKT I and AKT 2 deficiency is sufficient to reduce the incidence of tumors in Pten (+/-) mice,242 and Myc also cooperates with Aktl in promoting prostate tumorigenesis.243 Thus loss of AKT could be a key mechanism that negatively regulates the formation of PIN like lesions given the remarkable pro-neoplastic gene signature in ld4-/- mice. Loss ofAKT I also leads to increased apoptosis and general growth retardation that affectthe size of organs.244 We speculate that the smaller genital tract and prostate in Id4-/- could be in part due to decreased AKT expression.

In this study, we provide significant evidence demonstrating the role of Id4 in

PI3K -AKT pathway. At the core of the pathway is the expression of PTEN, which is positively regulated by Id4. Upregulation of PTEN in the presence of Id4 led to a decrease in levels of pAKT. p53 acetylation by Id4 and its subsequent binding to the 58

PTEN promoter appears to the underlying regulatory mechanism. We predict ld4 plays an important role in modulation of PTEN activity in PCa cells. If this theory with evidence works, it would suggest that ld4 might be used for the firsttime as physiological agent to upregulate PTEN which will intum regulate AKT pathway, thus regulating cell proliferation and cell division in cancerous cells. Additionally ld4 by modulating PTEN and regulating AKT pathway may intum get phosphorylated or dephosphorylated that can address one of the mechanismby which ld4 acts as a tumor suppressor in PCa.

Although it has been reportedthat ld4 exerts tumor suppressive activities in several cancer models as presented in literature herein, it is possible that ld4 may act as tumor suppressor in a PTEN- p53-independent mannerby regulating AKT pathway. However in tumors with PTEN loss, both mTORCl and other molecules upstream in the pathway including Pl3K and AKT PI3/AKT should be inhibited. lfwe find that ld4 act as tumor suppressor in the absence of PTEN, we will continue to investigate the functional role of ld4 and its effects on the apoptotic and/or senescence pathway in the cellular environment. PART II

1D4 PROMOTES AR EXPRESSION AND BLOCKS TUMORIGENICITY

OF PC3 PROSTATE CANCER CELLS CHAPTER VJ

INTRODUCTION

Deregulation of tumor suppressor genes is associated with tumorigenesis and the

development of cancer. In PCa, ID4 is epigenetically silenced and acts as a tumor

suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor

15 17· 20 (AR) and p53 to exert its tumor suppressor activity. · Previous studies have shown

that ID4 promotes tumor suppressive function of AR whereas loss of 1D4 results in tumor

17 19 promoter activity of AR. · Ectopic ID4 expression in DUl45 cells attenuates

proliferation and promotes AR expression suggesting that ID4 promotes AR expression.

In this study, we examined the effectof ectopic expression of ID4 on highly malignant

PCa cell PC3. Stable overexpression of ID4 in PC3 cells leads to increased apoptosis and

decreased cell proliferation and migration. In addition, in vivo studies showed a decrease

in tumor size and volume of!D4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR),

p2 I, and AR dependent FKBP5 I expression. At the mechanistic level, 1D4 may regulate the expression or functionof AR through specific but yet unknown AR co-regulators that may determine the finalout come of AR function.

59 CHAPTER VII

LITERATURE REVIEW

7.1 AR in Prostate

The prenatal development of the prostate is dependent on androgen, particularly

DHT. The fetal testis produces testosterone, which is reduced by Su-rcductase enzyme that is present in the urogenital sinus before and during prostate development. Afterthe development of the prostate, androgens continue to function in promoting the survival of the secretory epithelia, the primary cell type thought to be transformed in prostate adenocarcinoma. In the normal prostate, the rate of cell death is 1-2% per day, which is balanced by a 1-2% rate of proliferation. The reduction of serum and prostatic DHT levels by castration results in a loss of 70% of the prostate secretory epithelial cells due to apoptosis in adult male rats, but the basal epithelia and stromal cell populations are relatively unaffected. AR is also expressed in the prostatic stroma, although castration results in the loss of stromal AR expression. The prostatic stroma thereforehas the capacity to respond to androgen, but androgen is not required for its survival.

In humans, the proliferation occurs predominantly in the transitional zone of the prostate, the region that is primarily affectedin benign prostatic hypertrophy but is seldom the initial site of prostate carcinoma formation. Although individual cases of PCa have been reportedin anabolic steroid users, epidemiological studies have failedto establish a link between elevated serum testosterone, DHT, or adrenal androgens and PCa

60 61 risk, suggesting that elevated testicular and adrenal androgens alone do not significantly promote prostate carcinogenesis. Although serum androgens alone may not promote prostate carcinogenesis, androgen action and the functionalstatus of AR are important mediators of PCa progression. Low serum testosterone levels in men with newly diagnosed and untreated PCa have been foundto correlate with higher AR expression, increased capillary vessel density within the tumor, and higher Gleason score. AR expression is observed in primary PCa and can be detected throughout progression in both hormone sensitive and hormone refractory cancers. Epigenetic silencing of AR expression by methylation may occur and has been observed in 8% of primary PC as.

Another possibility forthe loss of AR expression in some tumor cells is a decrease in AR protein stability that reduces the AR protein level to one difficult to detect immunohistologically.245 AR is also degraded by ubiquitin targeting to the proteasome.

Ubiquitination of AR is promoted by AKT kinase-mediated phosphorylation of the receptor, suggesting that cells with increased AKT activation may have a reduced AR protein level.

7.2 AR as Tumor Suppressor and Tumor Promoter

246 247 AR may act both as a tumor suppressor and a proliferator in the prostatc. -

Over-expression of AR in PC3 cells results in decreased invasion in, in vivo mouse models whereas mice lacking the prostate epithelial AR (PEARKO) have increased apoptosis in epithelial luminal cells and increased proliferationin epithelial basal cells resulting in the expansion of CK5/CK8-positive intermediate cells. The PERKO mice 62 developed larger and more invasive metastatic tumors in lymph nodes and died earlier

than wild-type littermates.246

AR activity and functionis regulated by many co-factors and chaperones.248 In

this context, ID4 appears to be one of the key regulators of AR function. Results suggest that in the presence of ID4, AR functions as a tumor suppressor whereas loss of ID4

17 19·20 promotes AR to act as a tumor promoter. · Identifying new or complex interactions

between AR co-/regulators could provide some insight into possible mechanisms by which AR undergoes transition between a tumor suppressor vs. tumor promoter. Herc, we report that ID4 acts as a regulator of AR by not only inducing AR expression but promoting its tumor suppressor activity, leading to induction ofap optosis and inhibition of cell migration and growth, in more metastatic PC3 cells.

7.3 AR Regulated Transcriptional Factor: FKBPSI

FKBPs which belong to the familyofimmunophilins, exert important nuclear functions, mediated by histone chaperone activity, interaction with transcription factors, and modifications of chromatin structure and also play a role in cancer pathogenesis.249

FKBPs, such as FKBPSI, FKBP25, FKBP38, FKBP12, and FKBP52 indirectly associate with DNA and affect gene expression through interaction with transcription factors or by histone modification.250 In PCa, FKBPS 1 is part of a super chaperone complex that includes androgen receptor (AR) and androgen and plays an active role in cell proliferation in both the physiologic conditions of cell growth and differentiation, and in pre-neoplastic and neoplastic diseases and its deregulation leads to resistance to cell death.249· 251 Studies show that deregulated FKBPS 1 as a prime factor in the etiology of 63

androgen-dependent PCa.252 In androgen-dependent tumor cell lines, FKBP5 l

hyperexpression increased androgen receptor transcriptional activity in the presence and

absence of androgens; whereas, knockdown of FKBP5 l dramatically decreased androgen

dependent gene transcription and proliferation.253 On the other hand, it has been shown

that FKBP5 l is a more reliable marker than PSA because it is induced by AR more

rapidly and more strongly than does PSA.254 On the basis of these studies, FKBP5 l

serves not only as a usefultarget for innovative therapies that block the androgen­

receptor signaling axis in PCa but also as a AR regulated transcriptional factor.

7.4 1D4 and AR

In PCa cell lines it shows that Id4 protein has a different effect on the cell cycle to

the other Id proteins. Id4, when ectopically over-expressed in PCa cell lines, induced S

phase arrest and apoptosis and this was attributed to ld4 up-regulating the expression of

E2A which in tum increased the levels ofp21 and p27 expression. Id4 has also been

demonstrated to increase cycline levels in cdkn2a -/- astrocytes, which drives their

proliferation. 199 And in neural precursors, Id4 protein is required for the G 1 to S phase

transition in the cell cycle.200 All knockout ld4 mice studies revealed that ld4 plays an

essential role in neural stem cell proliferation and differentiation,200 and normal brain

development.211 ID4 acts as a tumor suppressor in PCa, and its loss, frequentlyobserved

in PCa, promotes CRPC through constitutive AR activation. 17 Id4 is regulated by

androgens in cells that respond to androgen stimulation such as testicular sertoli cells and prostate epithelial cells.225 ld4 also restores androgen receptor expression and activity in the androgen receptor negative PCa cell line DU145. 19 64

ID4, a dominant negative helix-loop-helix transcriptional regulator is highly

expressed in normal epithelial cells of the prostate. 161· 255 In PCa, ID4 expression is

progressively lost with increasing stage of the disease, 161 due to promoter hyper­

methylation. 19· 161· 256 We have previously reported that knockdown of Inhibitor of

differentiation-4(ID4) in PCa LNCaP cells, promoted tumorigenicity with a gene

expression signature that resembles that of constitutively activated AR in castrated

mice. 17 Conversely, ectopic ID4 expression induced re-expression of AR that led to

decreased proliferation and increased apoptosis in otherwise androgen receptor negative

PCa cell line DU145. 19 Previous study fromour lab shown in Figures 27 and 28,

determined that in DU 145 cells, ID4 functions as a tumor suppressor and when

overexpressed in DU 145 cells, it led to expression of AR and other genes such as p2 l,

p27 that are needed forAR to functionas a tumor suppressor protein. 19 To further

elucidate the role of ID4 in PCa, we utilized more metastatic and tumorigenic PC3 cells,

which do not express AR and have very low levels of ID4, due to promoter

methylation.220

c 50 .2 T :: 40. T

� 30 � 20

1: 10 -" "' 0 DU145 LNCaP DU145·1d4

Figure 27. Androgen receptor expression analysis. A (Upper Panel) Expression of androgen receptor (AR)and E2A (El2/E47) bllLH transcription factor by RT-PCR. The gain of androgen receptor expression in DU 145-Id4 cells as comparedto DU 145 cells al the transcript and protein level is evident. As controls, the parental, mock transfected DU145 cells (AR -ve) and LNCaP (AR +ve) cell lines were used. The expression ofbeta-actin was used as loading and RT-PCR control. B. Real time PCR analysis, performed on the same batch of reverse transcribed RNA used in panel A confinns the RT-PCR data. The fold change in AR expression is nonnali1.,ed to bcta-actin. 65

'> .,l ,t> ,:-.- (, Q\) ef

Figure 28. Gene expression changes in DU145+ld4 cell lines. (A): RT-PCR and semi-quantitative expression levels of cyclin dependent kinase inhibitors p27 and p21 in DU 145, DUl45-Id4 and PrEC (normal prostate epithelial) cells. (8) Semi-quantitative analysis ofRT-PCR results shown in (A). (C): Real time analysis of ld4, p53 and E-cadherin gene expression in DU 145, DU 145-CMV and DU 145-ld4 cell lines. The real time data is normalizedto the constitutively expressed gene beta-actin. CHAPTER VIII

RESULTS

8.1 Generation of 1D4 Expressing PCa Cell Line

Stably transfectedPC3 with pCMV+l04 vector expressed nearly 2.5 fold higher

1D4 expression (PC3+1D4) cells as compared to the control vector (PC3+CMV) transfected cells. The 1D4 expression in control vector transfected cells was negligible and was comparable to that in parental PC3 cells. Expression of 1D4 was measured by quantitative PCR (Figure 29A) and western blotting (Figure 298).

8.2 Effect of1D4 on Morphology, Cell Proliferation and Migration

A change in morphology in PC3+1D4 cells was observed (Figure 29C, Left panel). PC3+1D4 cells had an "epithelial like" morphology that was associated with increased cell-cell adhesion as compared to a mesenchymal morphology of the PC3-

CMV cells (Figure 29C, Right panel). At the molecular level, the transition towards

"epithelial" morphology and increased cell adhesion of PC3+1D4 cells could be due an increase in E-cadherin expression (Figure 29D and 29E). Overexpression of 1D4 also attenuated proliferation of the PC3 cells. The PC3+1D4 cells had a 2 fold decrease in proliferation(Figure 29F), as compared to control cells. KI-67, a cellular marker for proliferation present during all active phasesof cell cycle, was alsoreduced in PC3+1D4 cells compared to control cells (Figure 29G). Next, we investigated the effect on

66 67 apoptosis in these cells by flow cytometry. The rate of apoptosis in PC3+ID4 cells was significantly higher as compared to PC3-CMV control cells (Figure 29H). Western blot analysis showed an increase in BAX expression, a marker associated with apoptosis in

PC3+1D4 cells, compared to PC3-CMV cells (Figure 291). The Cyclin dependent kinase inhibitor p21, a well-known inhibitor of cyclin-dependent kinases acts as a key factor for the regulation of cell growth is upregulated by AR in PCa cell lines.257 Consistent with this observation, Western blot analysis showed stable 1D4 expression in PC3 cells resulted in upregulation of p2 l levels (Figure 291), compared to PC3 control cells.

f tq,.-u.- 1 C A II

, , ...... I ---- O ....)CMV

,;: I .... ,·bQ• _...,_ """"'°'6 -

= ...... ·­ - C.-•d- ...... --

Figure 29. Stable overexpression of ID4 with pCMV-1D4 in PC3 cells. Expression of ID4 was evaluated with real time PCR (A) and Western Blot (B). C: Morphology of the PC3-CMV and PC3+1D4 cells in culture. D and E: Analysis of E-cadherin by Western blot and lmmuno-cytochemistry. F: Proliferationrate of PC3-CMV and PC3+1D4 cells expressed as absorption at 570 nm (means± SEM, n = 3: ***, P <.00 I). G: Ki-67 expression by Western Blot. H: Percent of cells undergoing apoptosis by flowcytometry (***: P < 0.00 I). I: Western blot analysis of BAX, and p2 I. GAPDH was used as loading control. 68 PC3+1D4 cells showed significantly decreased migration compared to the PC3-

CMV control cells (Figure 30A and 30B) in a transwell migration assay. Collectively, these results demonstrate that 1D4 expression decreases proliferation and increases apoptosis via BAX upregulation.

A

C PC3-EGF CJ PC3-CMJ - PC3 ... 1D4

B

Figure 30. ID4 regulates migration. A. ID4 significantly inhibited migration in PC3+1D4 cells compared to PC3---CMV and PC3+EGF cells (positive control). Each bar represents Mean± SEM (n � 3). (*** p < 0.001 compared to PC3-CMV). B: Representative images of PC3+EGF, PC3 CMV and PC3+1D4 cells after migration of cells through Trans well ( x I0).

8.3 1D4 Promotes AR Expression

Real time PCR demonstrated that PC3+1D4 cells have 4 fold greater AR expression compared to PC3-CMV cells (Figure 3 lA). Western blot analysis further demonstrated greater AR protein expression in PC3+1D4 cells compared to PC3-CMV cells (Figure 31 C). Immuno-cytochemistry furtherconfirmed increased expression of 69 androgen receptor in PC3+1O4 cells (Figure 31D). The AR expression in PC3+1D4 cells was localized primarily to the nucleus (Figure 3102) with an increase in expression and nuclear localization after treatment with l0nM R1881 (Figure 31D4). In contrast, AR was not expressed in PC3-CMV cells treated with vehicle alone but was expressed only after

R188 l treatment (31D3).

C

·· -1 --- ,._..._-

0 ... ..:J�· -,.' , . .. 20 ••• • C' C" ... .. 1, ' ..

t 0 ""

Figure 31. ID4 regulates expression of AR. A and B. Quantitative real time RT-PCR of AR and FKBP5 I respectively (mean± SEM, n=3 in triplicate, normalized to GAPDH followedby fold change over PC3- CMY cells***: P < 0.00 I). C: Western blot analysis of AR and FKBP5 I in PC3- CMV and PC3+1D4 cells (±RI 881). GAPDH was used as loading control. D: AR immuno-cytochemistry (red). The cells were counterstained with DAPI (blue) to reveal the nucleus (x200). E: Enrichment of Pol II and AR, on FKBPS I promoter in PC3-CMV, PC3+1D4 cells. The data is expressed (mean±SEM, n=3 in triplicate) as% of input ("a", and "b" corresponding to Pol JI, and AR respectively, p<0.001 compared with PC3 - CMV cells. F: The AR transcriptional activity as determined by PSA AR response element driven luciferase reported plasmid. The data is normalized to Renilla luciferase. The mutant ARR3 luciferase reporter plasmid was used as a negative control (mean ± SEM *** : P < 0.001 as compared to respective ARR3 luciferase, a: p<0.001 as compared to PSA luciferase activity in PC3-CMV, c: p

FKBP5 l, a well-established AR regulated gene was used to assess the transcriptional activity of AR. 1D4 induced FKBP5 l expression at both mRNA and protein levels in PC3+1D4 cells (Figure 31 B and 31 C). Androgen-dependent transcription 70 of the FKBP5 I is conferred through a non-canonical androgen response element (ARE) element within an intron.254 Chromatin immuno-precipitation analysis using androgen receptor antibody revealed that binding to FKBP5 I promoter is significantlyincreased

(P < 0.00 I) in PC3+1D4 cells compared to PC3 control cells (Figure 31 E). These results suggest that ID4 promotes binding of AR to FKBPS I promoter.

In order to further assess the transcriptional activity of AR, the activity of luciferase driven by the PSA promoter was performed. The relative PSA luciferase activity increased significantlyin PC3+ID4 cells as compared to PC3-CMV cells

(Figure 31 F), which is consistent with the increased expression of AR in these cell lines. The mutant ARR3 luciferase plasmid (mt-ARR3 RE) used as a negative control, did not result in significant luciferase activity. (FireflyPSA is nomialized to Renilla empty vector).

8.4 1D4 Results in Decreased Tumor Growth in Vivo

The influenceof 1D4 on tumor formation by PC3 was examined by measuring the size and weight of the tumors. PC3-CMV control cell tumors in nude mice were observed within I week of injection (Figure 32A and 328). In contrast, PC3+1D4 cells formed tumors aftera latency period of approximately 3 weeks, which led to a significantdecrease in tumor growth. At the end of the experiments (6 weeks), the tumors were excised and volume and weights were measured (Figure 32C and 32D).

The PC3+1D4 cells formedsmaller tumors compared to PC3 control cells.

Collectively, these results indicate that overexpression of ID4 decreases tumor growth of PC3 in nude mice. 71

A e ,CJ LW I- /lllf")-«M ·-i ,_ ..i - .! 1 .I I w.....

C D

E

Figure 32. Stable overexpression of 104 in PC3 cells suppresses tumor growth in vivo. Male and nude mice were injected with PC3-CMV and PC3+1D4 cells and evaluated for tumor volumes and tumor weights. A: Representative xenograft images with numbers of mice with similar tumor (n) are shown. B: 3 Volumes of the tumors were measured weekly (expressed as mm , means±SEM, n = 3/group, ***, p < .001, and *p<0.01 between PC3-CMV and PC3+1D4). The mice were sacrificed at 6 weeks. C, D: Relative volumes and weights(means±SEM, n = 3) of the tumors after excision(•••, P < .00 I, between PC3- CMV and PC3+1D4 tumors). E: TUN EL assay demonstrated increased apoptosis in in PC3+1D4 mice xenograft (Brown staining) as compared to the PC3-CMV cells. The TUN EL positive cells were counted in five fields(at 400x) on three different tissue samples.

Xenografts derived from PC3+ID4 cells showed significantly more apoptotic

cells compared to xenografts from PC3-CMV cells, confirming a role for 1D4 in

promoting apoptosis. 15 The average number of TUN EL positive cells in PC3+ID4

xenograft tissue is significantly higher compared to PC3 control xenograft tissue

(Figure 32E). CHAPTER IX

DISCUSSION AND CONCLUSION

The role of!D4 in cancer has not been clarified; however, studies support both a pro-tumor and anti-tumor activity of ID4. ID4 promoter methylation demonstrates its role as a potential tumor suppressor and oncogene in a context dependent manner. We have shown that ID4 expression is decreased due to promoter methylation in PCa.220

Epigenetic silencing of ID4 promoter tend to support its tumor suppressor role in PCa.

In PCa cell lines, ID4 promotes cell cycle arrest and apoptosis, by up-regulating the expression of p21 and p27. 19 In the present study also, ID4 decreases migration and cell proliferation of PC3 cells, which is associated with an increase in p2 l, a regulator of cell cycle progression at GI and S phase and with a significant decrease in Ki 67, a marker of proliferation.258 PC3+ID4 cells showed increased apoptosis and decreased cell migration compared to control cells. Most importantly we show an up-regulation of a E-cadherin a well-established tumor suppressor and inhibitor of epithelial to mesenchymal transition, 259 by ID4. ID4 may directly regulate E-cadherin expression by neutralizing basic helix loop helix E2A proteins that negatively regulate E-cadherin gene expression through E-Box response elements.260 Alternatively, increased AR expression in PC3+ID4 cells may itself promote e-cadherin expression.261

Collectively, these results demonstrated that ID4 expression induces a change in cell morphology AR plays a tumor suppressor role in normal cells and functionsas tumor 72 73

248 262 2 promoter in PCa cells. - - 64 Various studies have shown that AR mRNA and protein

265 26 expression are low but detectable in PC-3 cells. - 6 Studies with treatment of PC3,

DU145, and LAPC4 cells with RI881 and DHT showed increased AR levels only in PC3 cells, with no effectin DU 145 and a negative effect in LAPC4 cells suggesting that PC3 retained the necessary cofactorsto engage AR as a tumor suppressor.267 Addition of functionalAR in PC3 cells resulted in decreased invasion in bone lesion assay and in mouse models.246 Induction of AR expression and activity in PC3 cells indeed results in growth suppression, 248· 257· 261· 268 which is probably mediated by co-regulators that enable

AR' s normal tumor suppressor function.

Our results demonstrate that ID4 may activate the tumor suppressor activity of

AR by inducing expression of target genes P2 I and FKBPS 1, and by decreasing expression ofKI67, in PC3 cells. At the mechanistic level, ID4 may regulate the expression or functionof specificbut yet unknown AR co-regulators that may determine the finaloutcome of AR function.

In conclusion, ID4 may restore AR expression and activity in PC3 cells, which may contribute to the tumor suppressor functionof 1D4. Therefore,AR-dependent and - independent pathways may contribute to the tumor suppressor function of ID4.

Identificationof the factors that mediate these effects in these PCa cells will improve our understanding of mechanisms that contribute to tumor invasion and therapeutic resistance associated with androgen deprivation therapy. REFERENCES

I. Littlewood, T. D.; Evan, G. I. Transcription Factors 2: Helix-loop-helix. Protein Profile1995, 2 (6), 621-702.

2. Massari, M. E.; Murre, C. Helix-loop-helix Proteins: Regulators of Transcription in Eucaryotic Organisms. Mo/ Cell Biol 2000, 20 (2), 429-40.

3. Lasorella, A.; Uo, T.; Iavarone, A. Id Proteins at the Cross-Road of Development and Cancer. Oncogene 2001, 20 (58), 8326-33.

4. Zebedee, Z.; Hara, E. Id Proteins in Cell Cycle Control and Cellular Senescence. Oncogene 2001, 20 (58), 8317-25.

5. Gebauer, S.; Yu, A. L.; Omura-Minamisawa, M.; Batova, A.; Diccianni, M. B. Expression Profilesand Clinical Relationships oflD2, CDKNIB, and CDKN2A in Primary Neuroblastoma. Genes Chromosomes Cancer 2004, 41 (4), 297-308.

6. Chaudhary, J.; Sadler-Riggleman, I.; Ague, J.M.; Skinner, M. K. The Helix-loop­ helix Inhibitor of Differentiation (ID) Proteins Induce Post-Mitotic Terminally DifferentiatedSertoli Cells to Re-enter the Cell Cycle and Proliferate. Biology of Reproduction 2005, 72 (5), 1205-17.

7. Chaudhary, J.; Cupp, A. S.; Skinner, M. K. Role of Basic-helix-loop-helix Transcription Factors in Sertoli Cell Differentiation: Identificationof an E-box Response Element in the Transferrin Promoter. Endocrinology 1997, 138 (2), 667-75.

8. Benezra, R.; Davis, R. L.; Lockshon, D.; Turner, D. L.; Weintraub, H. The Protein Id: A Negative Regulator of Helix-loop-helix DNA Binding Proteins. Ce// 1990, 6/ (I), 49-59.

9. Garrell, J.; Modolell, J. The Drosophila Extramacrochaetae Locus, An Antagonist of Proneural Genes That, Like These Genes, Encodes a Helix-loop-helix Protein. Cell 1990, 6/ (I), 39-48.

I 0. Norton, J. D.; Deed, R. W.; Craggs, G.; Sablitzky, F. Id Helix-loop-helix Proteins in Cell Growthand Differentiation. Trends in Cell Biology1998, 8 (2), 58-65.

74 75

11. Norton, J. D. ID Helix-loop-helix Proteins in Cell Growth, Differentiation and Tumorigenesis. Journalof Cell Science 2000, 113 ( Pt 22), 3897-905.

12. Pagliuca, A.; Bartoli, P. C.; Saccone, S.; Della Valle, G.; Lania, L. Molecular Cloning of ID4, A Novel Dominant Negative Helix-loop-helix Human Gene on Chromosome 6p21.3-p22. Genomics 1995, 27 (!), 200-3.

13. Ruzinova, M. B.; Benezra, R. Id Proteins in Development, Cell Cycle and Cancer. Trends in Cell Biology2003, 13 (8), 410-8.

14. Kiewitz, S. D.; Cabrele, C. Synthesis and Conformational Properties ofProtein Fragments Based on the Id Family of DNA-Binding and Cell-Differentiation Inhibitors. Biopolymers 2005, 80 (6), 762-74.

15. Knowell, A. E.; Patel, D.; Morton, D. J.; Sharma,P.; Glymph, S.; Chaudhary, J. ld4 Dependent Acetylation Restores Mutant-p53 Transcriptional Activity. Mo/ Cancer 2013, 12, 161.

16. Carey, J.P.; Knowell, A. E.; Chinaranagari, S.; Chaudhary, J. Id4 Promotes Senescence and Sensitivity to Doxorubicin-Induced Apoptosis in DU145 Prostate Cancer Cells. Anticancer Res 2013, 33 ( I 0), 4271-8.

17. Patel, D.; Knowell, A. E.; Korang-Yeboah, M.; Sharma, P.; Joshi, J.; Glymph, S.; Chinaranagari, S.; Nagappan, P.; Palaniappan, R.; Bowen, N. J.; Chaudhary, J. Inhibitor of Differentiation 4 (1D4) InactivationPromotes De Novo Steroidogenesis and Castration-Resistant Prostate Cancer. Mo!Endocrinol 2014, 28 (8), 1239-53.

18. Sharma,P.; Knowell, A. E.; Chinaranagari, S.; Komaragiri, S.; Nagappan, P.; Patel, D.; Havrda, M. C.; Chaudhary, J. Id4 DeficiencyAttenuates Prostate Development and Promotes PIN-Like Lesions by Regulating Androgen Receptor Activity and Expression ofNKX3. l and PTEN. Mo/ Cancer 2013, 12, 67.

19. Carey, J. P.; Asirvatham, A. J.; Galm, O.; Ghogomu, T. A.; Chaudhary, J. Inhibitor of Differentiation 4 (Id4) is a Potential Tumor Suppressor in Prostate Cancer. BMC Cancer 2009, 9, 173.

20. Komaragiri, S. K.; Bostanthirige, D. H.; Morton, D. J.; Patel, D.; Joshi, J.; Upadhyay, S.; Chaudhary, J. ID4 Promotes AR Expression and Blocks Tumorigenicity ofPC3 Prostate Cancer Cells. Biochem Biophys Res Commun 2016, -178 (1), 60-6. 76

21. Freeman, D. J.; Li, A.G.; Wei, G.; Li, H. H.; Kertesz, N.; Lesche, R.; Whale, A. D.; Martinez-Diaz, H.; Rozengurt, N.; Cardiff,R. D.; Liu, X.; Wu, H. PTEN Tumor Suppressor Regulates p53 Protein Levels and Activity Through Phosphatase­ Dependent and Independent Mechanisms. Cancer Cell 2003, 3 (2), 117-30.

22. Zhou, M.; Gu, L.; Findley, H. W.; Jiang, R.; Woods, W. G. PTEN Reverses MDM2-Mediated Chemotherapy Resistance by Interacting with p53 in Acute Lymphoblastic Leukemia Cells. Cancer Res 2003, 63 ( 19), 6357-62.

23. Mayo, L. D.; Dixon, J. E.; Durden, D. L.; Tonks, N. K.; Donner, D. B. PTEN Protects p53 From Mdm2 and Sensitizes Cancer Cells to Chemotherapy. J Biol Chem 2002, 277 (7), 5484-9.

24. Martelli, A. M.; Evangelisti, C.; Folio, M. Y.; Ramazzotti, G.; Fini, M.; Giardino, R.; Manzoli, L.; Mccubrey, J. A.; Cocco, L. Targeting the Phosphatidylinositol 3-kinase/Akt/mammalian Target ofRapamycin Signaling Network in Cancer Stem Cells. Current Medicinal Chemistry 2011, 18 (18), 2715-26.

25. Sharma, P.; Chinaranagari, S.; Chaudhary, J. Inhibitor of Differentiation4 (ID4) Acts as an Inhibitor of ID-I, -2 and -3 and Promotes Basic Helix Loop Helix (bHLH) E47 DNA Binding and Transcriptional Activity. Biochimie 2015, 112, 139-50.

26. Butler, D. C.; Haramizu, S.; Williamson, D. L.; Alway, S. E. Phospho-ablated ld2 is Growth Suppressive and Pro-apoptotic in ProliferatingMyo blasts. PLoS One 2009, 4 (7), e6302.

27. Hanahan, D.; Weinberg, R. A. The Hallmarks of Cancer. Cell 2000, JOO (I), 57-70.

28. Mitelman, F.; Johansson, B.; Mertens, F. The Impact ofTranslocations and Gene Fusions on Cancer Causation. Nat Rev Cancer 2007, 7 (4), 233-45.

29. Stratton, M. R.; Campbell, P. J.; Futreal, P. A. The Cancer Genome. Nature 2009, -158 (7239), 719-24.

30. Suva, M. L.; Riggi, N .; Bernstein, B. E. Epigenetic Reprogramming in Cancer. Science 2013, 339 (6127), 1567-70.

31. Jeronimo, C.; Bastian, P. J.; Bjartell, A.; Carbone, G. M.; Catto, J. W.; Clark, S. J.; Henrique, R.; Nelson, W. G.; Shariat, S. F. Epigenetics in Prostate Cancer: Biologic and Clinical Relevance. Eur Urol 2011, 60 (4), 753-66.

32. Cooper, C. S.; Foster, C. S. Concepts of Epigenetics in Prostate Cancer Development. Br J Cancer 2009, JOO (2), 240-5. 77

33. Martin, F. L. Epigenetic Influencesin the Aetiology of Cancers Arising from Breast and Prostate: A Hypothesised Transgenerational Evolution in Chromatin Accessibility. JSRN Oncology2013, 20/3, 624794.

34. Andersson, S. O.; Wolk, A.; Bergstrom, R.; Adami, H. O.; Engholm, G.; Englund, A.; Nyren, 0. Body Size and Prostate Cancer: A 20-Year Follow-up Study among 135,006 Swedish Construction Workers. J Natl Cancer Inst 1997, 89 (5), 385-9.

35. Meikle, A. W.; Stephenson, R. A.; Lewis, C. M.; Middleton, R. G. Effects of Age and Sex Hormones on Transition and Peripheral Zone Volumes of Prostate and Benign Prostatic Hyperplasia in Twins. J Clin EndocrinolMetab 1997, 82 (2), 571-5.

36. Abate-Shen, C.; Shen, M. M. Molecular Genetics of Prostate Cancer. Genes & Development2000, 14 (19), 2410-34.

37. DeMarzo, A. M.; Nelson, W. G.; Isaacs, W. B.; Epstein, J. I. Pathological and Molecular Aspects of Prostate Cancer. Lancet 2003, 361 (9361), 955-64.

38. Thomson, A. A.; Cunha, G. R. Prostatic Growth and Development are Regulated by FGFI0. Development 1999, / 26 (16), 3693-701.

39. Marker, P. C.; Donjacour, A. A.; Dahiya, R.; Cunha, G. R. Hormonal, Cellular, and Molecular Control of Prostatic Development. Dev Biol 2003, 253 (2), 165-74.

40. Siegel, R.; Ma, J.; Zou, Z; Jcmal, A. Cancer Treatment and Survivorship Statistics, and Prostate Cancer Treatment (PDQ). J Clin. [Online] 2014, 64. 9-29. http://onlinelibrary.wiley.com/doi/10.3322/caac.2 l 235/full (accessed Aug 24, 2014).

41. World Health Organization; World Cancer Report 2014; Chapter 5, p 11; ISBN 9283204298.

42. Malvezzi, M.; Bertuccio, P.; Levi, F.; La Vecchia, C.; Negri, E. European Cancer Mortality Predictions for the Year 2014. Annals ofOncology: OfficialJournal of the European Societyfor Medical Oncology/ESMO2014, 24 (3), 792-800.

43. McGuire, S. World Cancer Report 2014. Geneva, Switzerland: World Health Organization, International Agency for Research on Cancer, WHO Press, 2015. Advances in Nutrition 2016, 7 (2), 418-9.

44. McIntosh, H. Why Do African-American Men Suffer More Prostate Cancer? Journal of the National Cancer Institute 1997, 89 (3), 188-9. 78

45. Hudak, S. J.; Hernandez, J.; Thompson, I. M. Role of 5 Alpha-Reductase Inhibitors in the Management of Prostate Cancer. Clinical lnlerventions in Aging 2006, I (4), 425-3 I.

46. Bostwick, D. G.; Burke, H.B.; Djakiew, D.; Euling, S.; Ho, S. M.; Landolph, J.; Morrison, H.; Sonawane, B.; Shifflett,T.; Waters, D. J.; Timms, 8. Human Prostate Cancer Risk Factors. Cancer 2004, JOI (10 Suppl), 2371-490.

47. Hughes, C.; Murphy, A.; Martin, C.; Sheils, O.; O'Leary, J. Molecular Pathology of Prostate Cancer. Journal of clinical palhology2005, 58 (7), 673-84.

48. Freedland, S.J.; Isaacs, W. B.; Platz, E. A.; Terris, M. K.; Aronson, W.J.; Amling, C. L.; Presti, J.C., Jr.; Kane, C. J. Prostate Size and Risk of High-Grade, Advanced Prostate Cancer and Biochemical Progression Aller Radical Prostatectomy: A Search Database Study. Journal (){ClinicalOncology: OfficialJournal of/he American Society a/Clinical Oncolo[zy2005, 23 (30), 7546-54.

49. Matsuyama, H.; Pan, Y.; Skoog, L.; Tribukait, B.; Naito, K.; Ekman, P.; Lichter, P.; Bergerheim, U. S. Deletion Mapping of Chromosome 8p in Prostate Cancer by Fluorescence in Situ Hybridization. Oncogene 1994, 9 (10), 3071-6.

50. Whang, Y. E.; Wu, X.; Suzuki, H.; Reiter, R. E.; Tran, C.; Vessella, R.L.; Said, J. W.; Isaacs, W. B.; Sawyers, C. L. Inactivation of the Tumor Suppressor PTEN/MMACI in Advanced Human Prostate Cancer Through Loss of Expression. Proc Natl Acad Sci US A 1998, 95 (9), 5246-50.

51. Cooney, K.A.; Wetzel, J.C.; Merajver, S. D.; Macoska, J.A.; Singleton, T.P.; Wojno, K. J. Distinct Regions of Allelic Loss on 13q in Prostate Cancer. Cancer Res 1996, 56 (5), 1142-5.

52. Huggins, C.; Hodges, C. V. Studies on Prostatic Cancer. The Effectof Castration, of Estrogen and Androgen Injection on Serum Phosphatases in Metastatic Carcinoma of the Prostate. CA Cancer J Clin 1972, 22 (4), 232-40.

53. Morales A. Testosterone and prostate safety. Europ Urology2002, 7. 1-6.

54. Karantanos, T.; Corn, P. G.; Thompson, T. C.Prostate Cancer Progression Aller Androgen Deprivation Therapy: Mechanisms of Castrate Resistance and Novel Therapeutic Approaches. Oncogene 2013, 32 (49), 5501-11.

55. Chang, K. H.; Ercole, C.E.; Sharifi, N. Androgen Metabolism in Prostate Cancer: From Molecular Mechanisms to Clinical Consequences. Br J Cancer 2014, I I I (7), 1249-54. 79

56. Hill, B.; Kyprianou, N. Sequencing Hormonal Ablation and Radiotherapy in Prostate Cancer: A Molecular and Therapeutic Prespective (Review). Oncology reports2002, 9 (6), 1151-6.

57. Lynch, H. T.; Lynch, J. F. The Lynch Syndrome: Melding Natural History and Molecular Genetics to Genetic Counseling and Cancer Control. Cancer Control: .Journal of the Moffitt Cancer Center 1996, 3 (1), 13-19.

58. Jin, J. K.; Dayyani, F.; Gallick, G. E. Steps in Prostate Cancer Progression that Lead to Bone Metastasis. International .Journal of Cancer . .Journal International du Cancer 2011, / 28 (11), 2545-61.

59. Maluf, F. C.; Smaletz, O.; Herchenhom, D. Castration-Resistant Prostate Cancer: Systemic Therapy in 2012. Clinics 2012, 67 (4), 389-94.

60. Lonergan, P. E.; Tindall, D. J. Androgen Receptor Signaling in Prostate Cancer Development and Progression . .Journal of Carcinogenesis 2011, JO, 20.

61. Boorjian, S. A.; Eastham, J. A.; Graefen, M.; Guillonneau, B.; Karnes, R. J.; Moul, J. W.; Schaeffer, E. M.; Stief, C.; Zorn, K. C. A Critical Analysis of the Long­ Term Impact of Radical Prostatectomy on Cancer Control and Function Outcomes. European Urology2012, 6/ (4), 664-75.

62. Culig, Z.; Hobisch, A.; Cronauer, M. V.; Radmayr, C.; Trapman, J.; Hittmair, A.; Bartsch, G.; Kloeker, H. Androgen Receptor Activation in Prostatic Tumor Cell Lines by Insulin-Like Growth Factor-I, Keratinocyte Growth Factor, and Epidermal Growth Factor. Cancer Research 1994, 54 (20), 5474-8.

63. Wolk, A.; Mantzoros, C. S.; Andersson, S. O.; Bergstrom, R.; Signorello, L. B.; Lagiou, P.; Adami, H. 0.; Trichopoulos, D. Insulin-Like Growth Factor I and Prostate Cancer Risk: A Population-Based, Case-Control Study. .Journal of the National Cancer Institute 1998, 90 ( 12), 911-5.

64. Karayi, M. K.; Markham, A. F. Molecular Biology of Prostate Cancer. Prostate Cancer Prostatic Dis 2004, 7 (I), 6-20.

65. Peehl, D. M. Oncogenes in Prostate Cancer. An Update. Cancer 1993, 71 (3 Suppl), 1159-64.

66. Wolf, D. A.; Kohlhuber, F.; Schulz, P.; Fittler, F.; Eick, D. Transcriptional Down­ Regulation of C-myc in Human Prostate Carcinoma Cells by the Synthetic Androgen Mibolerone. Br .J Cancer 1992, 65 (3), 376-82. 80

67. Laible, G.; Wolf, A.; Dom, R.; Reuter, G.; Nislow, C.; Lebersorger, A.; Popkin, D.; Pillus, L.; Jenuwein, T. Mammalian Homologues of the Polycomb-Group Gene Enhancer of Zeste Mediate Gene Silencing in Drosophila Heterochromatin and at S. Cerevisiae Telomeres. EMBO J 1997, 16 (I l ), 3219-32.

68. Hsu, V.; Zobel, C. L.; Lambie, E. J.; Schedl, T.; Kornfeld, K. Caenorhabditis Elegans Lin-45 Raf is Essential for Larval Viability, Fertility and the Induction ofVulval Cell Fates. Genetics 2002, 160 (2), 481-92.

69. Lee, J. Y.; Kang, M. B.; Jang, S. H.; Qian, T.; Kim, H.J.; Kim, C.H.; Kim, Y.; Kong, G. Id-I Activates Aki-mediated Wnt Signaling and p27(Kipl) Phosphorylation Through PTEN Inhibition. Oncogene 2009, 28 (6), 824-31.

70. Chen, Z.; Carracedo, A.; Lin, H. K.; Koutcher, J. A.; Behrendt, N.; Egia, A.; Alimonti, A.; Carver, B. S.; Gerald, W.; Teruya-Feldstein, J.; Loda, M.; Pandolfi, P. P. Differentialp53-Independent Outcomes of pl 9(Arl) Loss in Oncogenesis. Science Signaling 2009, 2 (84), ra44.

71. Cairns, P.; Okami, K.; Halachmi, S.; Halachmi, N.; Esteller, M.; Herman, J. G.; Jen, J.; Isaacs, W. B.; Bova, G. S.; Sidransky, D. Frequent Inactivation of PTEN/MMACI in Primary Prostate Cancer. Cancer Res 1997, 57 (22), 4997- 5000.

72. Osman, I.; Drobnjak, M.; Fazzari, M.; Ferrara, J.; Scher, H. I.; Cordon-Cardo, C., Inactivation of the p53 Pathway in Prostate Cancer: Impact on Tumor Progression. C/in Cancer Res 1999, 5 (8), 2082-8.

73. Bookstein, R.; Rio, P.; Madreperla, S. A.; Hong, F.; Allred, C.; Grizzle, W. E.; Lee, W. H. Promoter Deletion and Loss ofRetinoblastoma Gene Expression in Human Prostate Carcinoma. Proc Natl A cad Sci US A 1990, 87 ( 19), 7762-6.

74. Korabiowska, M.; Ruschenburg, I.; Belke, H.; Stachura, J.; Schlott, T.; Cardo, C. C.; Brinck, U. Downregulation of the Retinoblastoma Gene Expression in the Progression of Malignant Melanoma. Palhobiology: Journal of 1mmunopathology, Molecular and Cellular Biology2001, 69 (5), 274-80.

75. Vogelstein, B.; Kinzler, K. W. p53 Function and Dysfunction. Ce/11992, 70 (4), 523-6.

76. Isaacs, W. B.; Carter, B. S.; Ewing, C. M. Wild-type p53 Suppresses Growth of Human Prostate Cancer Cells Containing Mutant p53 Alleles. Cancer Res 1991, 51 (17), 4716-20. 81

77. Rubin, M.A.; Gerstein, A; Reid, K.; Bostwick, D. G.; Cheng, L.; Parsons, R.; Papadopoulos, N. 10q23.3 Loss ofHeterozygosity is Higher in Lymph Node­ Positive (pT2-3,N+) Versus Lymph Node-Negative (pT2-3,N0) Prostate Cancer. Hum Pathol 2000, 31 (4), 504-8.

78. Walsh, C. A.; Morrow, E. M.; Rubenstein, J. L. Autism and Brain Development. Cell 2008, 135 (3), 396-400.

79. Eng, C.; Peacocke, M. PTEN and Inherited Hamartoma-Cancer Syndromes. Nat Genet 1998, 19 (3), 223.

80. Liaw, D.; Marsh, D. J.; Li, J.; Dahia, P. L.; Wang, S. I.; Zheng, Z.; Bose, S.; Call, K. M.; Tsou, H. C.; Peacocke, M.; Eng, C.; Parsons, R. Germline Mutations of the PTEN Gene in Cowden Disease, An Inherited Breast and Thyroid Cancer Syndrome. Nat Genet 1997, 16 (I), 64-7.

81. Marsh, D. J.; Dahia, P. L.; Zheng, Z.; Liaw, D.; Parsons, R.; Gorlin, R. J.; Eng, C. Germline Mutations in PTEN are Present in Bannayan-Zonana Syndrome. Nat Genet 1997, 16 (4), 333-4.

82. Cooney, K. A.; Tsou, H. C.; Petty, E. M.; Miesfeldt, S.; Ping, X. L.; Gruener, A C.; Peacocke, M. Absence of PTEN Germ-Line Mutations in Men with a Potential Inherited Predisposition to Prostate Cancer. Clin Cancer Res 1999, 5 (6), 1387- 91.

83. Li, J.; Yen, C.; Liaw, D.; Podsypanina, K.; Bose, S.; Wang, S. I.; Puc, J.; Miliaresis, C.; Rodgers, L.; McCombie, R.; Bigner, S. H.; Giovanella, B. C.; Ittmann, M.; Tycko, B.; Hibshoosh, H.; Wigler, M. H.; Parsons, R. PTEN, A Putative Protein Tyrosine Phosphatase Gene Mutated in Human Brain, Breast, and Prostate Cancer. Science 1997, 275 (5308), 1943-7.

84. Steck, P.A.; Pershouse, M.A.; Jasser, S. A.; Yung, W. K.; Lin, H.; Ligon, A.H.; Langford, L. A.; Baumgard, M. L.; Hattier, T.; Davis, T.; Frye, C.; Hu, R.; Swedlund, B.; Teng, D. H.; Tavtigian, S. V. Identification of a Candidate Tumour Suppressor Gene, MMACl, at Chromosome 10q23.3 that is Mutated in Multiple Advanced Cancers. Nat Genet 1997, 15 (4), 356-62.

85. Nwosu, V.; Carpten, J.; Trent, J. M.; Sheridan, R. Heterogeneity of Genetic Alterations in Prostate Cancer: Evidence of the Complex Nature of the Disease. Human Molecular Genetics 2001, JO (20), 2313-8.

86. Simpson, L.; Parsons, R. PTEN: Life as a Tumor Suppressor. Exp Cell Res 2001, (I), 29-41. 82

87. Sircar, K.; Yoshimoto, M.; Monzon, F. A.; Koumakpayi, I. H.; Katz, R. L.; Khanna, A.; Alvarez, K.; Chen, G.; Darnel, A.D.; Aprikian, A.G.; Saad, F.; Bismar, T. A.; Squire, J. A. PTEN Genomic Deletion is Associated with p-Akt andAR Signalling in Poorer Outcome, Hormone Refractory Prostate Cancer. J Pathol 2009, 218 (4), 505-13.

88. Kou, X. X.; Hao, T.; Meng, Z.; Zhou, Y. H.; Gan, Y. H. Acetylated Sp! Inhibits PTEN Expression Through Binding to PTEN Core Promoter and Recruitment of HDAC I and Promotes Cancer Cell Migration and Invasion. Carcinogenesis 2013, 3-1(1), 58-67.

89. Zhou, X. P.; Waite, K. A.; Pilarski, R.; Hampel, H.; Fernandez, M. J.; Bos, C.; Dasouki, M.; Feldman, G.L.; Greenberg, L.A.; Jvanovich, J.; Matloff, E.; Patterson, A.; Pierpont, M. E.; Russo, D.; Nassif, N. T.; Eng, C. Germline PTEN Promoter Mutations and Deletions in Cowden/Bannayan-Riley­ Ruvalcaba Syndrome Result in Aberrant PTEN Protein and Dysregulation of the Phosphoinositol-3-kinase/Akt Pathway. Am J Hum Genet 2003, 73 (2), 404- 11.

90. Lee, J. O.; Yang, H.; Georgescu, M. M.; Di Cristofano, A.; Maehama. T.; Shi, Y.; Dixon, J.E.; Pandolfi, P.; Pavletich, N. P. Crystal Structure of the PTEN Tumor Suppressor: Implications For Its Phosphoinositide Phosphatase Activity and Membrane Association. Cell 1999, 99 (3), 323-34.

91. Fixsen, J. A. Orthopaedic Management of Infantile Hemiplegia. Physiotherapy 1976, 62 (9), 294-6.

92. Waite, K. A.; Eng, C. Protean PTEN: Form and Function. Am .I Hum Genet 2002, 70 ( 4), 829-44.

93. Taylor, B. S.; Schultz, N.; Hieronymus, H.; Gopalan, A.; Xiao, Y.; Carver, B. S.; Arora, V. K.; Kaushik, P.; Cerami, E.; Reva, B.; Antipin, Y.; Mitsiades, N.; Landers, T.; Dolgalev, I.; Major, J. E.; Wilson, M.; Socci, N. D.; Lash, A. E.; Heguy, A.; Eastham, J. A.; Scher, H. I.; Reuter, V. E.; Scardino, P. T.; Sander, C.; Sawyers, C. L.; Gerald, W. L. Integrative Genomic Profilingof Human Prostate Cancer. Cancer Cell 2010, 18 (1), 11-22.

94. McCall, P.; Witton, C. J.; Grimsley, S.; Nielsen, K. V.; Edwards, J. Is PTEN Loss Associated with Clinical Outcome Measures in Human Prostate Cancer? Br J Cancer 2008, 99 (8), 1296-301.

95. Chung, J. H.; Ginn-Pease, M.E.; Eng, C.Phosphatase and Tensin Homologue Deleted on Chromosome 10 (PTEN) Has Nuclear Localization Signal-Like Sequences for Nuclear Import Mediated by Major Vault Protein. Cancer Res 2005, 65 (I 0), 4108-16. 83

96. Weng, L. P.; Brown, J. L.; Eng, C.PTEN Coordinates G(l) Arrest by Down­ Regulating Cyclin DI Via Its Protein Phosphatase Activity and Up-Regulating p27 Via Its Lipid Phosphatase Activity in a Breast Cancer Model. Human Molecular Genetics 2001, JO (6), 599-604.

97. Chung, J. H.; Ostrowski, M. C.; Romigh, T.; Minaguchi, T.; Waite, K.A.; Eng, C. The ERKl/2 Pathway Modulates Nuclear PTEN-Mediated Cell Cycle Arrest by Cyclin DI Transcriptional Regulation.Human Molecular Gene/ics 2006, 15 (17), 2553-9.

98. Gimm, O.; Perren, A.; Weng, L. P.; Marsh, D. J.; Yeh, J. J.; Ziebold, U.; Gil, E.; Hinze, R.; Delbridge, L.; Lees, J.A.; Mutter, G. L.; Robinson, B.G.; Komminoth, P.; Dralle, H.; Eng, C. Differential Nuclear and Cytoplasmic Expression of PTEN in Normal Thyroid Tissue, and Benign and Malignant Epithelial ThyroidTumors. Am J Pa/ho/ 2000, 156 (5), 1693-700.

99. Chang, C.J.; Mulholland, D.J.; Valamehr, B.; Mosessian, S.; Sellers, W.R.; Wu, H. PTEN Nuclear Localization is Regulated by Oxidative Stress and Mediates p53-Dependent Tumor Suppression. Mo/ Cell Biol 2008, 28 (10), 3281-9.

I 00. Li, Y.; Guessous, F.; Kwon, S.; Kumar, M.; lbidapo, O.; Fuller, L.; Johnson, E.; Lal, B.; Hussaini, I.; Bao, Y.; Laterra, J.; Schiff, D.; Abounader, R. PTEN Has Tumor-Promoting Properties in the Setting of Gain-of-Function p53 Mutations. Cancer Res 2008, 68 (6), 1723-31.

101. Trotman, L.C.; Wang, X.; Alimonti, A.; Chen, Z.; Teruya-Feldstein, J.; Yang, H.; Pavletich, N. P.; Carver, B.S.; Cordon-Cardo, C.; Erdjument-Bromage, H.; Temps!, P.; Chi, S. G.; Kim, H.J.; Misteli, T.; Jiang, X.; Pandolfi, P. P. Ubiquitination Regulates PTEN Nuclear Importand Tumor Suppression.Cell 2007, 128 (I), 141-56.

102. Shen, W. H.; Balajee, A. S.; Wang, J.; Wu, H.; Eng, C.; Pandolfi,P. P.; Yin, Y. Essential Role for Nuclear PTEN in Maintaining Chromosomal Integrity. Cell 2007, /28(1), 157-70.

103. Hu, Z.; Gu, Y.; Han, B.; Zhang, J.; Li, Z.; Tian, K.; Young, C. Y.; Yuan, H. Knockdown of AGR2 Induces Cellular Senescence in Prostate Cancer Cells. Carcinogenesis 2012, 33 (6), 1178-86.

104. Song, M.S.; Carracedo, A.; Salmena, L.; Song, S. J.; Egia, A.; Malumbres, M.; Pandolfi, P.P. Nuclear PTEN Regulates the APC-CDHI Tumor-Suppressive Complex in a Phosphatase-Independent Manner. Cell 2011, 1 ././ (2), 187-99. 84

105. Liu, X. S.; Song, B.; Elzey, B. D.; Ratliff, T. L.; Konieczny, S. F.; Cheng, L.; Ahmad, N .; Liu, X. Polo-like Kinase 1 Facilitates Loss of Pten Tumor Suppressor-Induced Prostate Cancer Formation.J Biol Chem 2011, 286 (41), 35795-800.

I 06. Vivanco, I.; Sawyers, C. L. The Phosphatidylinositol 3-Kinase AKT Pathway in Human Cancer. Nat Rev Cancer 2002, 2 (7), 489-501.

107. Maehama, T.; Dixon, J.E. The Tumor Suppressor, PTEN/MMACI, Dephosphorylates the Lipid Second Messenger, Phosphatidylinositol 3,4,5- Tisphosphate. J Biol Chem 1998, 273 (22), 13375-8.

108. Sun, H.; Lesche, R.; Li, D. M.; Liliental, J.; Zhang, H.; Gao, J.; Gavrilova, N.; Mueller, B.; Liu, X.; Wu, H. PTEN Modulates Cell Cycle Progression and Cell Survival by Regulating Phosphatidylinositol 3,4,5,-Trisphosphate and Akt/Protein Kinase B Signaling Pathway. Proc Nall Acad Sci US A 1999, 96 (11), 6199-204.

109. Manning, B. D.; Cantley, L. C. AKT/PKB Signaling: Navigating Downstream. Cell 2007, 129 (7), 1261-74.

110. Zoncu, R.; Efeyan, A.; Sabatini, D. M. mTOR: From Growth Signal Integration to Cancer, Diabetes andAgeing. Nature Reviews. Molecular Cell Biology2011, 12 (!), 21-35.

111. de la Taille, A.; Rubin, M.A.; Chen, M. W.; Vacherot, F.; de Medina, S. G.; Burchardt, M.; Buttyan, R.; Chopin, D. Beta-Catenin-RelatedAnomalies in Apoptosis-Resistant and Hormone-Refractory Prostate Cancer Cells. Clin Cancer Res 2003, 9 (5), 1801-7.

112. Lee, H.K.; Kwak, H. Y.; Hur, J.; Kim, I. A.; Yang, J. S.; Park, M. W.; Yu, J.; Jeong, S. Beta-Catenin Regulates Multiple Steps of RNA Metabolism as Revealed by the RNA Aptamer in Colon Cancer Cells. Cancer Res 2007, 67 (19), 9315-21.

113. Grunwald, V.; DeGraffenried, L.; Russel, D.; Friedrichs, W. E.; Ray, R. B.; Hidalgo, M. Inhibitors of mTOR Reverse Doxorubicin Resistance Conferred by PTEN Status in Prostate Cancer Cells. Cancer Res 2002, 62 (21), 6141-5.

114. Um, S. H.; Frigerio, F.; Watanabe, M.; Picard, F.; Joaquin, M.; Sticker, M.; Fumagalli, S.; Allegrini, P. R.; Kozma, S. C.; Auwerx, J.; Thomas, G. Absence ofS6Kl Protects Against Age- and Diet-Induced Obesity While Enhancing Insulin Sensitivity. Nalure 2004, 431 (7005), 200-5. 85

115. Hsu, P. P.; Kang, S. A.; Rameseder, J.; Zhang, Y.; Ottina, K. A.; Lim, D.; Peterson, T. R.; Choi, Y.; Gray, N. S.; Yaffe, M. B.; Marto, J. A.; Sabatini, D. M. The mTOR-Regulated Phosphoproteome Reveals a Mechanism of mTORCI­ Mediated Inhibition of Growth Factor Signaling. Science 2011, 332 (6035), 1317-22.

116. Stambolic, V.; Suzuki, A.; de la Pompa, J. L.; Brothers, G. M.; Mirtsos, C.; Sasaki, T.; Ruland, J.; Penninger, J.M.; Siderovski, D. P.; Mak, T. W. Negative Regulation of PKB/Akt-Dependent Cell Survival by the Tumor Suppressor PTEN. Cell 1998, 95 (I), 29-39.

117. Wen, Y.; Hu, M. C.; Makino, K.; Spohn, B.; Bartholomeusz, G.; Yan, D. H.; Hung, M. C. HER-2/neu Promotes Androgen-Independent Survival and Growth of Prostate Cancer Cells Through the Akt Pathway. Cancer Res 2000, 60 (24), 6841-5.

118. Lin, H.K.; Hu, Y. C.; Lee, D. K.; Chang, C. Regulation of Androgen Receptor Signaling by PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome I 0) Tumor Suppressor Through Distinct Mechanisms in Prostate Cancer Cells. Mo/ Endocrinol2004, 18 (10), 2409-23.

119. Raftopoulou,M.; Etienne-Manneville, S.; Self, A.; Nicholls, S.; Hall, A. Regulation of Cell Migration by the C2 Domain of the Tumor Suppressor PTEN. Science 2004, 303 (5661), 1179-81.

120. Nardella, C.; Carracedo, A.; Alimonti, A.; Hobbs, R. M.; Clohessy, J. G.; Chen, Z.; Egia, A.; Fomari, A.; Fiorentino, M.; Loda, M.; Kozma, S. C.; Thomas, G.; Cordon-Cardo, C.; Pandolfi,P. P. DifferentialRequirement ofmTOR in Postmitotic Tissues and Tumorigenesis. Science Signaling 2009, 2 (55), ra2.

121. Cully, M.; You, H.; Levine, A. J.; Mak, T. W. Beyond PTEN Mutations: The PI3K Pathway as an Integrator ofMultiple Inputs During Tumorigenesis.Nat Rev Cancer 2006, 6 (3), 184-92.

122. Chen, Z.; Trotman, L. C.; Shaffer, D.; Lin, H.K.; Dolan, Z. A.; Niki, M.; Koutcher, J. A.; Scher, H. I.; Ludwig, T.; Gerald, W.; Cordon-Cardo, C.; Pandolfi,P. P. Crucial Role of p53-Dependent Cellular Senescence in Suppression of Pten­ Deficient Tumorigenesis. Nature 2005, 436 (7051), 725-30.

123. Lei, Q.; Jiao, J.; Xin, L.; Chang, C. J.; Wang, S.; Gao, J.; Gleave, M. E.; Witte, 0. N.; Liu, X.; Wu, H. NKX3.I Stabilizes p53, Inhibits AKT Activation, and Blocks Prostate Cancer Initiation Caused by PTEN Loss. Cancer Cell 2006, 9 (5), 367-78. 86

124. Nakamura, N.; Ramaswamy, S.; Vazquez, F.; Signoretti, S.; Loda, M.; Sellers, W. R. Forkhead Transcription Factors are Critical Effectorsof Cell Death and Cell Cycle ArrestDownstream of PTEN. Mal Cell Biol 2000, 20 (23), 8969-82.

125. Davies, M.A.; Lu, Y.; Sano, T.; Fang, X.; Tang, P.; LaPushin, R.; Koul, D.; Bookstein, R.; Stokoe, D.; Yung, W. K.; Mills, G. B.; Steck, P.A. Adenoviral Transgene Expression of MMAC/PTEN in Human Glioma Cells Inhibits Akt Activation and Induces Anoikis. Cancer Res 1998, 58 (23), 5285-90.

126. Kim, Y.C.; Kitaura, H.; Taira, T.; Iguchi-Ariga, S. M.; Ariga, H. Oxidation ofDJ- 1-Dependent Cell Transformation Through Direct Binding of DJ- I to PTEN. Int J Oncol 2009, 35 (6), 1331-41.

127. Myers, M.P.; Stolarov, J.P.; Eng, C.; Li, J.; Wang, S. I.; Wigler, M. H.; Parsons, R.; Tonks, N. K. P-TEN, the Tumor Suppressor From Human Chromosome I 0q23, is a Dual-Specificity Phosphatase. Proc Natl Acad Sci US A 1997, 9-1 (17), 9052-7.

128. Tamura, M.; Gu, J.; Matsumoto, K.; Aota, S.; Parsons, R.; Yamada, K. M. Inhibition of Cell Migration, Spreading, and Focal Adhesions by Tumor Suppressor PTEN. Science 1998, 280 (5369), 1614-7.

129. Gu, T.; Zhang, Z.; Wang, J.; Guo, J.; Shen, W. H.; Yin, Y. CREB is a Novel Nuclear Target of PTEN Phosphatase. Cancer Res 2011, 71 (8), 2821-5.

130. Mounir, Z.; Krishnamoorthy, J. L.; Robertson, G. P.; Scheuner, D.; Kaufman, R. J.; Georgescu, M. M.; Koromilas, A. E. Tumor Suppression by PTEN Requires the Activation of the PKR-e1F2alpha Phosphorylation Pathway. Science Signaling 2009, 2 (I 02), ra85.

131. Zhang, S.; Huang, W. C.; Li, P.; Guo, H.; Poh, S. B.; Brady, S. W.; Xiong, Y.; Tseng, L. M.; Li, S. H.; Ding, Z.; Sahin, A.A.; Esteva, F. J.; Hortobagyi, G. N.; Yu, D. Combating Trastuzumab Resistanceby Targeting SRC, A Common Node Downstream of Multiple Resistance Pathways. Nature medicine 2011, 17 (4), 461-9.

132. Dahia, P. L. PTEN, A Unique Tumor Suppressor Gene. Endocrine-RelatedCancer 2000, 7 (2), 115-29.

133. Salvesen, H.B.; MacDonald, N.; Ryan, A.; Jacobs, I. J.; Lynch, E. D.; Akslen, L. A.; Das, S. PTEN Methylation is Associated with Advanced Stage and Microsatellite Instability in Endometrial Carcinoma. Int J Cancer 2001, 91 (I), 22-6. 87

134. Yin, Y.; Shen, W. H.PTEN: A New Guardian of the Genome. Oncogene 2008, 27 (41), 5443-53.

135. Mukhopadhyay, N. K.; Cinar, B.; Mukhopadhyay, L.; Lutchman, M.; Ferdinand, A. S.; Kim, J.; Chung, L. W.; Adam, R. M.; Ray, S.K.; Leiter, A. B.; Richie, J.P.; Liu, B. C.; Freeman, M. R. The Zinc Finger Protein Ras-Responsive Element Binding Protein-I is a Coregulator of the Androgen Receptor: Implications for the Role of the Ras Pathway in Enhancing Androgenic Signaling in Prostate Cancer. Mal Endocrinol2007, 21 (9), 2056-70.

136. Hettinger, K.; Vikhanskaya, F.; Poh, M. K.; Lee, M. K.; de Belle, I.; Zhang, J.T.; Reddy, S. A.; Sabapathy, K. c-Jun Promotes Cellular Survival by Suppression of PTEN. Cell Death Differ 2007, 14 (2), 218-29.

137. Chow, J. Y.; Quach, K.T.; Cabrera, B. L.; Cabral, J. A.; Beck, S. E.; Carethers, J. M. RAS/ERK Modulates TGFbeta-Regulated PTEN Expression in Human Pancreatic Adenocarcinoma Cells. Carcinogenesis 2007, 28 (11), 2321-7.

138. Xia, D.; Srinivas, H.; Ahn, Y. H.; Sethi, G.; Sheng, X.; Yung, W. K.; Xia, Q.; Chiao, P. J.; Kim, H.; Brown, P.H.; Wistuba, II; Aggarwal, B. B.; Kurie, J.M. Mitogen-Activated Protein Kinase Kinase-4 Promotes Cell Survival by Decreasing PTEN Expression Through an NF Kappa B-Dependent Pathway.J Biol Chem 2007, 282 (6), 3507-19.

139. Escriva, M.; Peiro, S.; Herranz,N.; Villagrasa, P.; Dave, N.; Montserrat-Sentis, B.; Murray, S. A.; Franci, C.; Gridley, T.; Virtanen, I.; Garcia de Herreras, A. Repression of PTEN Phosphatase by Snaill Transcriptional Factor During Gamma Radiation-Induced Apoptosis.Mal Cell Biol 2008, 28 (5), 1528-40.

140. Thiery, J.P.; Acloque, H.; Huang, R. Y.; Nieto, M.A. Epithelial-Mesenchymal Transitions in Development and Disease. Cell 2009, 139 (5), 871-90.

141. Patel, L.; Pass, I.; Coxon, P.; Downes, C. P.; Smith, S.A.; Macphee, C.H. Tumor Suppressor and Anti-inflammatory Actions of PPARgamma Agonists are Mediated Via Upregulation of PTEN. Current biology : CB 2001, 11 (I 0), 764-8.

142. Virolle, T.; Adamson, E. D.; Baron, V.; Birle, D.; Mercola, D.; Mustelin, T.; de Belle, I. The Egr-1 Transcription Factor Directly Activates PTEN During Irradiation-Induced Signalling. Nat Cell Biol 2001, 3 (12), 1124-8.

143. Song, L.B.; Li, J.; Liao, W. T.; Feng, Y.; Yu, C. P.; Hu, L. J.; Kong, Q. L.; Xu, L. H.; Zhang, X.; Liu, W. L.; Li, M. Z.; Zhang, L.; Kang, T. B.; Fu, L. W.; Huang, W. L.; Xia, Y. F.; Tsao, S. W.; Li, M.; Band, V.; Band, H.; Shi, Q. H.; Zeng, Y. X.; Zeng, M. S. The Polycomb Group Protein Bmi-1 Represses the Tumor 88

Suppressor PTEN and Induces Epithelial-Mesenchymal Transition in Human Nasopharyngeal Epithelial Cells. The Journal of Clinical Investigation 2009, I I 9(12), 3626-36.

144. Palmero, I.; Pantoja, C.; Serrano, M. pl9ARF Links the Tumour Suppressor p53 to Ras. Nature 1998, 395 (6698), 125-6.

145. Whelan, J. T.; Forbes, S. L.; Bertrand, F. E. CBF-1 (RBP-J kappa) Binds to the PTEN Promoter and Regulates PTEN Gene Expression. Cell Cycle 2007, 6 (1), 80-4.

146. Poliseno, L.; Salmena, L.; Riccardi, L.; Fomari, A.; Song, M. S.; Hobbs, R. M.; Sportoletti, P.; Varmeh, S.; Egia, A.; Fedele, G.; Rameh, L.; Loda, M.; Pandolfi, P. P. Identificationof the miR-106b-25 microRNA Cluster as a Proto­ oncogenic PTEN-targeting Intron that Cooperates with Its Host Gene MCM7 in Transformation.Science Signaling 2010, 3 (l 17), ra29.

147. Poliseno, L.; Salmena, L.; Zhang, J.; Carver, B.; Haveman, W. J.; Pandolfi, P. P. A Coding-independent Function of Gene and Pseudogene mRNAs Regulates Tumour Biology. Nature 2010, 465 (7301), 1033-8.

148. Song, M.S.; Salmena, L.; Pandolfi, P. P. The Functions and Regulation of the PTEN Tumour Suppressor. Nature Reviews. Molecular Cell Biology2012, 13 (5), 283-96.

149. Georgescu, M. M.; Kirsch, K. H.; Akagi, T.; Shishido, T.; Hanafusa, H. The Tumor-Suppressor Activity of PTEN is Regulated by Its Carboxyl-Terrninal Region. Proc Natl Acad Sci US A 1999, 96 (18), 10182-7.

150. Das, S.; Dixon, J.E.; Cho, W. Membrane-binding and Activation Mechanism of PTEN. Proc Natl Acad Sci US A 2003, JOO (13), 7491-6.

151. Vazquez, F.; Grossman, S. R.; Takahashi, Y.; Rokas, M. V.; Nakamura, N.; Sellers, W.R. Phosphorylation of the PTEN Tail Acts as an Inhibitory Switch by Preventing Its Recruitment into a Protein Complex. J Biol Chem 2001, 276 (52), 48627-30.

152. Miller, S. J.; Lou, D. Y.; Seldin, D. C.; Lane, W. S.; Neel, B. G. Direct Identificationof PTEN Phosphorylation Sites. FEBS Lei/ 2002, 528 (1-3), 145- 53.

153. Leslie, N. R.; Downes, C. P. PTEN Function: How Normal Cells Control It and Tumour Cells Lose It. BiochemJ2004, 382 (Pt 1), 1-11. 89

154. Wang, X.; Trotman, L.C.; Koppie, T.; Alimonti, A.; Chen, Z.; Gao, Z.; Wang, J.; Erdjument-Bromage, H.; Tempst, P.; Cordon-Cardo, C.; Pandolfi, P. P.; Jiang, X. NEDD4-l is a Proto-Oncogenic Ubiquitin Ligase for PTEN. Cell 2007, 128 (1), 129-39.

155. Liang, K.; Esteva, F. J.; Albarracin, C.; Stemke-Hale, K.; Lu, Y.; Bianchini, G.; Yang, C. Y.; Li, Y.; Li, X.; Chen, C. T.; Mills, G. B.; Hortobagyi, G. N.; Mendelsohn, J.; Hung, M. C.; Fan, Z. Recombinant Human Erythropoietin Antagonizes Trastuzumab Treatment of Breast Cancer Cells Via Jak2-Mediated Src Activation and PTEN Inactivation. Cancer Cell 2010, 18 (5), 423-35.

156. Maccario, H.; Perera, N. M.; Davidson, L.; Downes,C. P.; Leslie, N. R. PTEN is Destabilized by Phosphorylation on Thr366. Biochem J2007, ./05 (3), 439-44.

157. Li, Z.; Dong, X.; Wang, Z.; Liu, W.; Deng, N.; Ding, Y.; Tang, L.; Hla, T.; Zeng, R.; Li, L.; Wu, D. Regulation of PTEN by Rho Small GTPases. Nat Cell Biol 2005, 7 (4), 399-404.

158. Sanchez, T.; Thangada, S.; Wu, M. T.; Kontos, C. D.; Wu, D.; Wu, H.; Hla, T. PTEN as an Effector in the Signaling of Antimigratory G Protein-Coupled Receptor. Proc Natl Acad Sci US A 2005, 102 (12), 4312-7.

159. Papakonstanti, E.A.; Ridley, A. J.; Vanhaesebroeck, B. The pl !Odetta Isoformof PI 3-kinase Negatively Controls RhoA and PTEN. EMBO J 2007, 26 (13), 3050-61.

160. Yim, E. K.; Peng, G.; Dai, H.; Hu, R.; Li, K.; Lu, Y.; Mills, G. B.; Meric-Bemstam, F.; Hennessy, B. T.; Craven, R. J.; Lin, S. Y. Rak Functions as a Tumor Suppressor by Regulating PTEN Protein Stability and Function. Cancer Cell 2009, 15 (4), 304-14.

161. Sharma, P.; Chinaranagari, S.; Patel, D.; Carey, J.; Chaudhary, J.Epigenetic Inactivation of Inhibitor of Differentiation4 (Id4) Correlates with Prostate Cancer. Cancer Medicine 2012, n/a-n/a.

162. Mathew, S.; Chen, W.; Murty, V. V.; Benezra, R.; Chaganti, R. S. Chromosomal Assignment of Human IOI and 102 Genes. Genomics 1995, 30 (2), 385-7.

163. Biggs, J.; Murphy, E. V.; Israel, M.A.A Human Id-like Helix-loop-helix Protein Expressed During Early Development. Proc Nall Acad Sci US A 1992, 89 (4), 1512-6.

164. Israel, M.A.; Hernandez, M. C.; Florio, M.; Andres-Barquin, P. J.; Mantani, A.; Carter, J. H.; .Julin, C.M. Id Gene Expression as a Key Mediator of Tumor Cell Biology. Cancer Res l 999, 59 (7 Suppl), I 726s-1730s. 90

165. Yokota, Y.; Mansouri, A.; Mori, S.; Sugawara, S.; Adachi, S.; Nishikawa, S.; Gruss, P. Development of Peripheral Lymphoid Organs and Natural Killer Cells Depends on the Helix-loop-helix Inhibitor Id2. Nature 1999, 397 ( 6721 ), 702-6.

166. Sikder, H. A.; Devlin, M. K.; Dunlap, S.; Ryu, B.; Alani, R. M. Id Proteins in Cell Growth and Tumorigenesis. Cancer Cell 2003, 3 (6), 525-30.

167. Hacker, C.; Kirsch, R. D.; Ju, X. S.; Hieronymus, T.; Gust, T. C.; Kuhl, C.; Jorgas, T.; Kurz, S. M.; Rose-John, S.; Yokota, Y.; Zenke, M. Transcriptional Profiling Identifies Id2 Function in Dendritic Cell Development. Nature Immunology 2003, 4 (4), 380-6.

168. Yokota, Y. Id and Development. Oncogene 2001, 20 (58), 8290-8.

169. Lyden, D.; Young, A. Z.; Zagzag, D.; Yan, W.; Gerald, W.; O'Reilly, R.; Bader, B. L.; Hynes, R. O.; Zhuang, Y.; Manova, K.; Benezra, R. !di and Id3 are Required forNeurogenesis, Angiogenesis and Vascularization of Tumour Xenografts.Nature 1999, 40/ (6754), 670-7.

170. Alani, R.M.; Young, A. Z.; Shifflett, C. B. !di Regulation of Cellular Senescence Through Transcriptional Repression of p I6/Ink4a. Proc Natl A cad Sci US A 2001, 98 (14), 7812-6.

171. Deed, R. W.; Hara, E.; Atherton, G. T.; Peters, G.; Norton, J. D. Regulation ofld3 Cell Cycle Function by Cdk-2-Dependent Phosphorylation. Mo/ Cell Biol 1997, 17(12), 6815-21.

172. Hara, E.; Hall, M.; Peters, G. Cdk2-Dependent Phosphorylation of Id2 Modulates Activity of E2A-Related Transcription Factors. EMBO J 1997, 16 (2), 332-42.

173. Parrinello, S.; Lin, C. Q.; Murata, K.; Itahana, Y.; Singh, J.; Krtolica, A.; Campisi, J.; Desprez, P. Y. Id-I, ITF-2, and ld-2 Comprise a Network of Helix-loop-helix Proteins that Regulate Mammary Epithelial Cell Proliferation, Differentiation, and Apoptosis. J Biol Chem 2001, 276 (42), 39213-9.

174. Kee, B. L.; Rivera, R. R.; Murre, C. ld3 Inhibits B Lymphocyte Progenitor Growth and Survival in Response to TGF-beta. Nature Immunology2001, 2 (3), 242-7.

175. Andres-Barquin, P. J.; Hernandez, M. C.; Israel, M.A. ld4 Expression Induces Apoptosis in Astrocytic Cultures and ls Down-Regulated by Activation of the cAMP-Dependent Signal Transduction Pathway. Exp Cell Res 1999, 247 (2), 347-55. 91

176. Barone, M. V.; Pepperkok, R.; Peverali, F. A.; Philipson, L. Id Proteins Control Growth Induction in Mammalian Cells. Proc Natl Acad Sci US A 1994, 91 (11 ), 4985-8.

177. Coppe, J.P.; Smith, A. P.; Desprez, P. Y. Id Proteins in Epithelial Cells. Exp Cell Res 2003, 285 (I), 131-45.

178. Maruyama, H.; Kleeff, J.; Wildi, S.; Friess, H.; Buchler, M. W.; Israel, M.A.; Kore, M. Id-I and Id-2 are Overexpressed in Pancreatic Cancer and in Dysplastic Lesions in Chronic Pancreatitis. Am J Pathol 1999, 155 (3), 815-22.

179. Wilson, J. W.; Deed, R. W.; Inoue, T.; Balzi, M.; Becciolini, A.; Faraoni, P.; Potten, C. S.; Norton, J. D. Expression ofld Helix-loop-helix Proteins in Colorectal Adenocarcinoma Correlates with p53 Expression and Mitotic Index. Cancer Res 2001, 61 (24), 8803-10.

180. Vandeputte, D. A.; Troost, D.; Leenstra, S.; ljlst-Keizers, H.; Ramkema, M.; Bosch, D. A.; Baas, F.; Das, N. K.; Aronica, E. Expression and Distribution ofld Helix-loop-helix Proteins in Human Astrocytic Tumors. Glia 2002, 38 (4), 329- 38.

18 I. Langlands, K.; Down, G. A.; Kealey, T. IdProteins are Dynamically Expressed in Normal Epidermis and Dysregulated in Squamous Cell Carcinoma. Cancer Res 2000, 60 (21), 5929-33.

182. Sharma, P.; Patel, D.; Chaudhary, J. Id! and Id3 Expression is Associated with Increasing Grade of Prostate Cancer: Id3 Preferentially Regulates CDKNI B. Cancer Med 2012, 1 (2), 187-97.

183. Sharma, P.; Chinaranagari, S.;Patel, D.; Carey, J.; Chaudhary, J. Epigenetic Inactivation of Inhibitor of Differentiation4 (Id4) Correlates withProstate Cancer. Cancer Med 2012, 1 (2), 176-86.

184. Sablitzky, F.; Moore, A.; Bromley, M.; Deed, R. W.; Newton, J. S.; Norton, J. D. Stage- and Subcellular-Specific Expression of Id Proteins in Male Germ and Sertoli Cells Implicates Distinctive Regulatory Roles for Id Proteins During Meiosis, Spermatogenesis, and Sertoli Cell Function. Cell Growth Differ1998, 9(12), 1015-24.

185. Asirvatham, A. J.; Carey, J.P.; Chaudhary, J. IOI-, 1D2-, and 1D3-Regulated Gene Expression in E2A Positive or Negative Prostate Cancer Cells. Prostate 2007, 67(13), 1411-20. 92

186. Matsumura, M. E.; Lobe, D.R.; McNamara, C. A. Contribution of the Helix-loop­ helix Factor Id2 to Regulation of Vascular Smooth Muscle Cell Proliferation.J Biol Chem 2002, 277 (9), 7293-7.

187. Lasorella, A.; Stegmuller, J.; Guardavaccaro, D.; Liu, G.; Carro, M. S.; Rothschild, G.; de la Torre-Ubieta, L.; Pagano, M.; Bonni, A.; Javarone, A. Degradation of ld2 by the Anaphase-Promoting Complex Couples Cell Cycle Exit and Axonal Growth. Nature 2006, 442 (7101), 471-4.

188. Bounpheng, M.A.; Dimas, J. J.; Dodds, S. G.; Christy,B. A. Degradation ofld Proteins by the Ubiquitin-Protcasome Pathway. Faseb J1999, 13 (15), 2257-64.

189. Jen, Y.; Manova, K.; Benezra, R. Expression patterns ofld I, ld2, and ld3 are Highly Related But Distinct From That of Jd4 During Mouse Embryo genesis. DevelopmentalDynamics: An Official Publication of the American Association ofAnatomists 1996, 207 (3), 235-52.

190. Temple, S.; Raff,M. C. Clonal Analysis of Oligodendrocyte Development in Culture: Evidence fora Developmental Clock that Counts Cell Divisions. Cell 1986, 44 (5), 773-9.

191. Nogueira, M. M.; Mitjavila-Garcia, M. T.; Le Pesteur, F.; Filippi, M. D.; Vainchenker, W.; Duhart Kupperschmitt, A.; Sainteny, F.Regulation of Id Gene Expression During Embryonic Stem Cell-Derived Hematopoietic Differentiation.Biochem Biophys Res Commun 2000, 276 (2), 803-12.

192. Yuen, H.F.; Chua, C. W.; Chan, Y. P.; Wong, Y.C.; Wang, X.; Chan, K. W. Id Proteins Expression in Prostate Cancer: High-Level Expression of ld-4 in Primary Prostate Cancer is Associated with Development of Metastases. Mod Pathol 2006, 19 (7), 931-41.

193. Gomez Del Pulgar, T.; Valdes-Mora, F.; Bandres, E.; Perez-Palacios, R.; Espina, C.; Cejas, P.; Garcia-Cabezas, M.A.; Nistal, M.; Casado, E.; Gonzalez-Baron, M.; Garcia-Foncillas, J.; Lacal, J.C. Cdc42 is Highly Expressed in Colorectal Adenocarcinoma and Dowmegulates ID4 Through an Epigenetic Mechanism. lntJOncol2008,33 (1), 185-93.

194. Beger, C.; Pierce, L. N.; Kruger, M.; Marcusson, E.G.; Robbins, J.M.; Welcsh, P.; Welch, P. J.; Welte, K.; King, M.C.; Barber, J.R.; Wong-Staal, F. Identification ofld4 as a Regulator ofBRCAI Expression by Using a Ribozyme-Library-Based Inverse Genomics Approach. Proc Natl Acad Sci US A 2001, 98 (I), 130-5. 93

195. de Candia, P.; Akram, M.; Benezra, R.; Brogi, E. Id4 Messenger RNA and Estrogen Receptor Expression: Inverse Correlationin Human Normal Breast Epithelium and Carcinoma. Hum Pathol 2006, 37 (8), 1032-41.

196. Umetani, N.; Mori, T.; Koyanagi, K.; Shinozaki, M.; Kim, J.;Giuliano, A. E.; Hoon, D. S. Aberrant Hyperrnethylation of ID4 Gene Promoter Region Increases Risk of Lymph Node Metastasis in Tl Breast Cancer. Oncogene 2005, 24 (29), 4721-7.

197. Trausch-Azar, J. S.; Lingbeck, J.; Ciechanover, A.; Schwartz, A. L. Ubiquitin­ Proteasome-Mediated Degradation of Id I is Modulated by MyoD . ./ Biol Chem 2004, 279 (31), 32614-9.

198. Shan, L.; Yu, M.; Qiu, C.; Snyderwine, E.G. Id4 Regulates Mammary Epithelial Cell Growth and Differentiation and ls Overexpressed in Rat Mammary Gland Carcinomas. Am .IPathol 2003, 163 (6), 2495-502.

199. Jeon, H. M.; Jin, X.; Lee, J. S.; Oh, S. Y.; Sohn, Y. W.; Park, H.J.; Joo, K. M.; Park, W. Y.; Nam, D. H.; DePinho, R. A.; Chin, L.; Kim, H. Inhibitor of Differentiation4 Drives Brain Tumor-Initiating Cell Genesis Through Cyclin E and Notch Signaling. Genes & Development 2008, 22 (15), 2028-33.

200. Yun, K.; Mantani, A.;Gare!, S.; Rubenstein, J.; Israel, M.A. ld4 Regulates Neural Progenitor Proliferation and Differentiation in Vivo. Development 2004, I 3 I (21), 5441-8.

201. Guo, S. J.; Hu, J.G.; Zhao, B. M.; Shen, L.; Wang, R.; Zhou, J. S.; Lu, H. Z. Oligl and ID4 Interactions in Living Cells Visualized by Bimolecular Fluorescence Complementation Technique. Molecular Biology Reports 2011, 38 (7), 4637- 42.

202. Cheng, X.; Wang, Y.; He, Q.; Qiu, M.; Whittemore, S. R.; Cao, Q. Bone Morphogenetic Protein Signaling and Oligl/2 Interact to Regulate the Differentiation and Maturation of Adult Oligodendrocyte Precursor Cells. Stem Cells 2007, 25 (12), 3204-14.

203. Noetzel, E.; Veeck, J.; Niederacher, D.; Galm, O.; Horn, F.; Hartmann, A.; Knuchel, R.; Dahl, E. Promoter Methylation-Associated Loss of ID4 Expression is a Marker of Tumour Recurrence in Human Breast Cancer. BMCCancer 2008, 8, 154.

204. Yu, L.; Liu, C.; Vandeusen, J.; Becknell, B.; Dai, Z.; Wu, Y. Z.; Raval, A.; Liu, T. H.; Ding, W.; Mao, C.; Liu, S.; Smith, L. T.; Lee, S.; Rassenti, L.; Marcucci, G.; Byrd, J.; Caligiuri, M.A.; Plass, C. Global Assessment of Promoter Methylation 94

in a Mouse Model of Cancer Identifies 104 as a Putative Tumor-Suppressor Gene in Human Leukemia. Nat Genet 2005, 37 (3), 265-274.

205. Noetzel, E.; Veeck, J.; Horn, F.; Hartmann, A.; Knuchel, R.; Dahl, E. [Promoter Methylation of 104. A Marker for Recurrence-Free Survival in Human Breast Cancer]. Der Pathologe 2008, 29 Suppl 2, 319-27.

206. Umetani, N.; Takeuchi, H.; Fujimoto, A.; Shinozaki, M.; Bilchik, A. J.; Hoon, D. S. Epigenetic Inactivation oflO4 in Colorectal Carcinomas Correlates with Poor Differentiation and Unfavorable Prognosis. Clin Cancer Res 2004, 10 (22), 7475-83.

207. Chen, S. S.; Claus, R.; Lucas, D. M.; Yu, L.; Qian, J.; Ruppert, A. S.; West, D. A.; Williams, K. E.; Johnson, A. J.; Sablitzky, F.; Plass, C.; Byrd, J. C. Silencing of the Inhibitor of DNA Binding Protein 4 (104) Contributes to the Pathogenesis of Mouse and Human CLL. Blood 2011, /17 (3), 862-71.

208. Chan, A. S.; Tsui, W. Y.; Chen, X.; Chu, K. M.; Chan, T. L.; Li, R.; So, S.; Yuen, S. T.; Leung, S. Y. Downregulation of 104 by Promoter Hypermethylation in Gastric Adenocarcinoma. Oncogene 2003, 22 (44), 6946-53.

209. Boyer, L. A.; Plath, K.; Zeitlinger, J.; Brambrink, T.; Medeiros, L. A.; Lee, T. I.; Levine, S. S.; Wernig, M.; Tajonar, A.; Ray, M. K.; Bell, G. W.; Otte, A. P.; Vidal, M.; Gifford, D. K.; Young, R. A.; Jaenisch, R. Polycomb Complexes Repress Developmental Regulators in Murine Embryonic Stem Cells. Nature 2006, 441 (7091), 349-53.

210. Russell, L. J.; Akasaka, T.; Majid, A.; Sugimoto, K. J.; Loraine Karran, E.; Nagel, I.; Harder, L.; Claviez, A.; Gesk, S.; Moorman, A. V.; Ross, F.; Mazzullo, H.; Strefford, J. C.; Siebert, R.; Dyer, M. J.; Harrison, C. J. t(6; 14)(p22;q32): A New Recurrent IGH@ Translocation Involving 104 in B-Cell Precursor Acute Lymphoblastic Leukemia (BCP-ALL). Blood 2008, 111 (I), 387-91.

21 I. Dell'Orso, S.; Ganci, F.; Strano, S.; Blandino, G.; Fontemaggi, G. 104: A New Player in the Cancer Arena. Oncotarget 2010, I (I), 48-58.

212. Bellido, M.; Aventin, A.; Lasa, A.; Estivill, C.; Carnicer, M. J.; Pons, C.; Matias­ Guiu, X.; Bordes, R.; Baiget, M.; Sierra, .J.; Nomdedeu, J. F. ld4 is Deregulated by a t(6;14)(p22;q32) Chromosomal Translocation in a B-Cell Lineage Acute Lymphoblastic Leukemia. Haematologica 2003, 88 (9), 994-1001.

213. Tsang, D. P.; Cheng, A. S. Epigenetic Regulation of Signaling Pathways in Cancer: Role of the Histone Methyltransferase EZH2. Journal ofGastroenterology and Hepatology 2011, 26 (I), 19-27. 95

214. Chen, H.; Tu, S. W.; Hsieh, J. T. Down-Regulation of Human DAB21P Gene Expression Mediated by Polycomb Ezh2 Complex and Histone Deacetylase in Prostate Cancer.J Biol Chem 2005, 280 (23), 22437-44.

215. Yu, J.; Cao, Q.; Mehra, R.; Laxman, B.; Yu, J.; Tomlins, S. A.; Creighton, C. J.; Dhanasekaran, S. M.; Shen, R.; Chen, G.; Morris, D.S.; Marquez, V. E.; Shah, R. B.; Ghosh, D.; Varambally, S.; Chinnaiyan, A. M. Integrative Genomics Analysis Reveals Silencing of Beta-Adrenergic Signaling by Polycomb in Prostate Cancer. Cancer Cell 2007, 12 ( 5), 419-31 .

216. Cao, Q.; Yu, J.; Dhanasekaran, S. M.; Kim, J. H.; Mani, R. S.; Tomlins, S. A.; Mehra, R.; Laxman,B.; Cao, X.; Yu, J.; Kleer, C. G.; Varambally, S.; Chinnaiyan, A. M. Repression of E-Cadherin by the Polycomb Group Protein EZH2 in Cancer. Oncogene 2008, 27 (58), 7274-84.

217. Taniguchi, H.; Jacinto, F. V.; Villanueva, A.; Fernandez,A. F.; Yamamoto, H.; Carmona, F. J.; Puertas, S.; Marquez, V. E.; Shinomura, Y.; Imai, K.; Estellcr, M. Silencing ofKruppel-Like Factor 2 by the Histone Methyltransferase EZH2 in Human Cancer. Oncogene 2012, 31 (I 5), 1988-94.

218. Beke, L.; Nuytten, M.; Van Eynde, A.; Beullens, M.; Bollen, M. The Gene Encoding the Prostatic Tumor Suppressor PSP94 is a Target for Repression by the Polycomb Group Protein EZH2. Oncogene 2007, 26 (31), 4590-5.

219. Shin, Y. J.; Kim, J. H. The role of EZH2 in the Regulation of the Activity of Matrix Metalloproteinases in Prostate Cancer Cells. PLoS One 2012, 7 (I), e30393.

220. Chinaranagari, S.; Sharma, P.; Chaudhary, J. EZH2 Dependent H3K27me3 is Involved in Epigenetic Silencing of ID4 in Prostate Cancer. Onco/arget 2014.

221. Rahme, G. J.; Israel, M.A. ld4 Suppresses MMP2-Mediated Invasion of Glioblastoma-Derived Cells by Direct Inactivation of Twist! Function. Oncogene 2015, 34 (I), 53-62.

222. Abdulkadir, S. A. Mechanisms of Prostate Tumorigenesis: Roles for Transcription Factors Nkx3.l and Egrl. Annals of the New York Academy o_(Sciences2005, 1059, 33-40.

223. Thomsen, M. K.; Ambroisine, L.; Wynn, S.; Cheah, K. S.; Foster, C. S.; Fisher, G.; Berney, D. M.; Moller, H.; Reuter, V. E.; Scardino, P.; Cuzick, J.; Ragavan, N.; Singh, P. B.; Martin, F. L.; Butler, C. M.; Cooper, C. S.; Swain, A. SOX9 Elevation in the Prostate Promotes Proliferation and Cooperates with PTEN Loss to Drive Tumor Formation. Cancer Res 2010, 70 (3), 979-87. 96

224. Wang, H.; Leav, I.; lbaragi, S.; Wegner, M.; Hu, G. F.; Lu, M. L.; Balk, S. P.; Yuan, X. SOX9 is Expressed in Human Fetal Prostate Epithelium and Enhances Prostate Cancer Invasion. Cancer Res 2008, 68 (6), 1625-30.

225. Asirvatham, A. J.; Schmidt, M.A.; Chaudhary, J. Non-Redundant Inhibitor of Differentiation(Id) Gene Expression and Function in Human Prostate Epithelial Cells. Prostate 2006, 66 (9), 921-35.

226. Sharma, P.; Patel, D.; Chaudhary, J. Id I and Id3 Expression is Associated with Increasing Grade of Prostate Cancer: Id3 Preferentially Regulates CDKN I B. Cancer Medicine 2012, 1 (2), 187-197.

227. Patel, D.; Chaudhary, J. Increased Expression ofbHLH Transcription Factor E2A (TCF3) in Prostate Cancer Promotes Proliferation and Confers Resistance to Doxorubicin Induced Apoptosis. Biochem Biophys Res Commun 2012, 422 (I), 146-51.

228. Liu, W.; Akhand, A. A.; Takeda, K.; Kawamoto, Y.; ltoigawa, M.; Kato, M.; Suzuki, H.; Ishikawa, N.; Nakashima, I. Protein Phosphatase 2A-Linked and Unlinked Caspase-Dependent Pathways for Downregulation of Akt Kinase Triggered by 4-hydroxynonenal. Cell Death Differ 2003, JO (7), 772-81.

229. Wang, L.; Wang, W. L.; Zhang, Y.; Guo, S. P.; Zhang, J.; Li, Q. L. Epigenetic and Genetic Alterations of PTEN in Hepatocellular Carcinoma. Hepatology Research: The Official.Journal

230. Kuzontkoski, P. M.; Mulligan-Kehoe, M. J.; Harris, B. T.; Israel, M. A. Inhibitor of DNA Binding-4 Promotes Angiogenesis andGrowth ofGlioblastoma Multiformeby Elevating Matrix GLA Levels. Oncogene 2010, 29 (26), 3793- 802.

231. Stambolic, V.; MacPherson, D.; Sas, D.; Lin, Y.; Snow, B.; Jang, Y.; Bcnchimol, S.; Mak, T. W. Regulation of PTEN Transcription by p53. Molecular Cell 2001, 8 (2), 317-25.

232. Hunter, T.; Karin, M. The Regulation of Transcription by Phosphorylation. Cell 1992, 70 (3), 375-87.

233. Ludlow, J. W.; DeCaprio, J. A.; Huang, C. M.; Lee, W. H.; Paucha, E.; Livingston, D. M. SV40 Large T Antigen Binds Preferentially to an Underphosphorylated Member of the Retinoblastoma Susceptibility Gene Product Family. Ce// 1989, 56 (I), 57-65. 97

234. Ludlow, J. W.; Shon, J.; Pipas, J.M.; Livingston, D. M.; DeCaprio, J. A. The Retinoblastoma Susceptibility Gene Product Undergoes Cell Cycle-Dependent Dephosphorylation and Binding to and Release From SV40 Large T. Cell 1990, 60 (3), 387-96.

235. Koch, A.; Hauf, S. Strategies for theIdentification of Kinase Substrates Using Analog-Sensitive Kinases. European Journal of Cell Biology2010, 89 (2-3), 184-93.

236. Engelman, J. A.; Luo, J.; Cantley, L. C. The Evolution of Phosphatidylinositol 3- Kinases as Regulators of Growth and Metabolism. Nature Reviews. Genetics 2006, 7 (8), 606-19.

237. Di Cristofano, A.; Kotsi, P.; Peng, Y. F.; Cordon-Cardo, C.; Elkon, K. B.; Pandolfi, P. P. Impaired Fas Response and Autoimmunity in Pten+/- Mice. Science 1999, 285 (5436), 2122-5.

238. Georgescu, M. M. PTEN Tumor Suppressor Network in PI3K-Akt Pathway Control. Genes& Cancer 2010, I (12), 1170-7.

239. Kim, G.; Ouzounova, M.; Quraishi, A. A.; Davis, A.; Tawakkol, N.; Clouthier, S. G.; Malik, F.; Paulson, A. K.; D'Angelo, R. C.; Korkaya, S.; Baker, T. L.; Esen, E.S.; Prat, A.; Liu, S.; Kleer, C. G.; Thomas, D. G.; Wicha, M. S.; Korkaya, H. SOCS3-Mediated Regulation of InflammatoryCytokines in PTEN and p53 Inactivated Triple Negative Breast Cancer Model. Oncogene 2015, 3./ (6), 671- 80.

240. Salmena, L.; Carracedo, A.; Pandolfi, P. P. Tenets of PTEN Tumor Suppression. Cell 2008, 133 (3), 403-14.

241. Li, D. M.; Sun, H. TEP!, Encoded by a Candidate Tumor Suppressor Locus, is a Novel Protein Tyrosine Phosphatase Regulated by Transforming Growth Factor Beta. Cancer Res 1997, 5 7 (11 ), 2124-9.

242. Chen, M. L.; Xu, P. Z.; Peng, X. D.; Chen, W. S.; Guzman, G.; Yang, X.; Di Cristofano, A.; Pandolfi, P. P.; Hay, N. The Deficiency of Aktl is Sufficient to Suppress Tumor Development in Pten+/- Mice. Genes & Development 2006, 20 (12), 1569-74.

243. Clegg, N. J.; Couto, S.S.; Wongvipat, J.; Hieronymus, H.; Carver, B. S.; Taylor, B. S.; Ellwood-Yen, K.; Gerald, W. L.; Sander, C.; Sawyers, C. L. MYC Cooperates with AKT in Prostate Tumorigenesis and Alters Sensitivity to mTOR Inhibitors. PLoS One 2011, 6 (3), el 7449. 98

244. Chen, W. S.; Xu, P. Z.; Gottlob, K.; Chen, M. L.; Sokol, K.; Shiyanova, T.; Roninson, I.; Weng, W.; Suzuki, R.; Tobe, K.; Kadowaki, T.; Hay, N. Growth Retardation and Increased Apoptosis in Mice with Homozygous Disruption of the Aktl Gene. Genes & Development 2001, 15 (17), 2203-8.

245. Heinlein, C. A.; Chang, C. Androgen Receptor in Prostate Cancer. Endocrine Reviews 2004, 25 (2), 276-308.

246. Niu, Y.; Altuwaijri, S.; Lai, K. P.; Wu, C. T.; Ricke, W. A.; Messing, E. M.; Yao, J.; Yeh, S.; Chang, C. Androgen Receptor is a Tumor Suppressor and Proliferatorin Prostate Cancer. Proc Natl Acad Sci US A 2008, 105 (34), 12182-7.

247. Wen, S.; Niu, Y.; Lee, S. O.; Chang, C. Androgen Receptor (AR) Positive vs Negative Roles in Prostate Cancer Cell Deaths Including Apoptosis, Anoikis, Entosis, Necrosis and Autophagic Cell Death. Cancer Treatment Reviews 2014, 40 (I), 31-40.

248. Litvinov, I. V.; Antony, L.; Dalrymple, S. L.; Becker, R.; Cheng, L.; Isaacs, J. T. PC3, But Not DUl45, Human Prostate Cancer Cells Retain the Coregulators Required for Tumor Suppressor Ability of Androgen Receptor. Prostate 2006, 66 (12), 1329-38.

249. Romano, S.; Sorrentino, A.; Di Pace, A. L.; Nappo, G.; Mercogliano, C.; Romano, M. F. The Emerging Role of Large lmmunophilin FK506 Binding Protein 51 in Cancer. Current Medicinal Dhemistry 2011, 18 (35), 5424-9.

250. Yao, Y. L.; Liang, Y. C.; Huang, H. H.; Yang, W. M. FKBPs in Chromatin Modification and Cancer. Current Opinion in Pharmacology2011, 11 (4), 301- 7.

251. Ni, L.; Yang, C. S.; Gioeli, D.; Frierson, H.; Toft,D. O.; Paschal, B. M. FKBP51 Promotes Assembly of the Hsp90 Chaperone Complex and Regulates Androgen Receptor Signaling in Prostate Cancer Cells. Mo/ Cell Biol 2010, 30 (5), I 243- 53.

252. Stechschulte, L. A.; Sanchez, E. R. FKBP5 I-A Selective Modulator of Glucocorticoid and Androgen Sensitivity. Current Opinionin Pharmacology 2011, 11 (4), 332-7.

253. Periyasamy, S.; Hinds, T., Jr.; Shemshedini, L.; Shou, W.; Sanchez, E. R. FKBP51 and Cyp40 are Positive Regulators of Androgen-Dependent Prostate Cancer Cell Growth and the Targets of FK506 and Cyclosporin A. Oncogene 2010, 29 (11), 1691-701. 99

254. Makkonen, H.; Kauhanen, M.; Paakinaho, V.; Jaaskelainen, T.; Palvimo, J. J. Long-Range Activation ofFKBP51 Transcription by the Androgen Receptor via Distal lntronic Enhancers. Nucleic Acid� Res 2009, 37 (12), 4135-48.

255. Sharma, P.; Knowell, A. E.; Chinaranagari, S.; Komaragiri, S.; Nagappan, P.; Patel, D.; Havrda, M. C.; Chaudhary, J. Id4 Deficiency Attenuates Prostate Development and Promotes PIN-Like Lesions by Regulating Androgen Receptor Activity and Expression ofNKX3.I and PTEN. Molecular Cancer 2013, 12(1), 67.

256. Vinarskaja, A.; Goering, W.; Ingenwcrth, M.; Schulz, W. A. ID4 is Frequently Downregulated and Partially Hypermethylated in Prostate Cancer. World Journal of Urology2012, 30 (3), 319-25.

257. Heisler, L. E.; Evangelou, A.; Lew, A. M.; Trachtenberg, J.; Elsholtz, H.P.; Brown, T. J. Androgen-Dependent Cell Cycle Arrest and Apoptotic Death in PC-3 Prostatic Cell Cultures Expressing a Full-Length Human Androgen Receptor. Mo/ Cell Endocrinol 1997, 126 (I), 59-73.

258. Fisher, G.; Yang, Z. H.; Kudahetti, S.; Moller, H.; Scardino, P.; Cuzick, J.; Berney, D. M. Prognostic Value of Ki-67 for Prostate Cancer Death in a Conservatively Managed Cohort. Br J Cancer 2013, 108 (2), 271-7.

259. Christofori, G.; Semb, H. The Role of the Cell-Adhesion Molecule E-cadherin as a Tumour-Suppressor Gene. Trends in Biochemical Sciences 1999, 2-1 (2), 73-6.

260. Perez-Moreno, M. A.; Locascio, A.; Rodrigo, I.; Dhondt, G.; Portillo, F.; Nieto, M. A.; Cano, A. A New Role for E 12/E4 7 in the Repression of E-cadhcrin Expression and Epithelial-Mesenchymal Transitions. J Biol Chem 2001, 276 (29), 27424-31.

261. Huo, C.; Kao, Y. H.; Chuu, C. P. Androgen Receptor Inhibits Epithelial­ Mesenchymal Transition, Migration, and Invasion of PC-3 Prostate Cancer Cells. Cancer Lett 201S, 369 (I), 103-11.

262. Culig, Z.; Bartsch, G. Androgen Axis in Prostate Cancer. J Cell Biochem [Online] 2006, 99, 3 73-81. http://onlinelibrary.wiley.com/doi/10.1002/jcb.20898/full (accessed Apr 5, 2006)

263. Alimirah, F.; Chen, J.; Basrawala, Z.; Xin, H.; Choubey, D. DU-145 and PC-3 Human Prostate Cancer Cell Lines Express Androgen Receptor: Implications for the Androgen Receptor Functions and Regulation. FEES Lett 2006, 580 (9), 2294-300. JOO

264. Litvinov, I. V.; De Marzo, A. M.; Isaacs, J. T. ls the Achilles' Heel for Prostate Cancer Therapy a Gain of Function in Androgen Receptor Signaling? J Clin Endocrinol Metab 2003, 88 (7), 2972-82.

265. Edelstein, R. A.; Carr, M. C.; Caesar, R.; Young, M.; Atala, A.; Freeman, M. R. Detection of Human Androgen Receptor mRNA Expression Abnormalities by Competitive PCR. DNA and Cell Biology 1994, 13 (3), 265-73.

266. Jarrard, D. F.; Kinoshita, H.; Shi, Y.; Sandefur, C.; Haft: D.; Meisner, L. F.; Chang, C.; Herman, J. G.; Isaacs, W. B.; Nassif, N. Methylation of the Androgen Receptor Promoter CpG Island is Associated with Loss of Androgen Receptor Expression in Prostate Cancer Cells. Cancer Res 1998, 58 (23), 5310-4.

267. Fujimoto, N.; Mizokami, A.; Harada, S.; Matsumoto, T. DifferentExpression of Androgen Receptor Coactivators in Human Prostate. Urology2001, 58 (2), 289- 94.

268. Yuan, S.; Trachtenberg, J.; Mills, G. B.; Brown, T. J.; Xu, F.; Keating, A. Androgen-Induced Inhibition of Cell Proliferationin an Androgen-Insensitive Prostate Cancer Cell Line (PC-3) Transfectedwith a Human Androgen Receptor Complementary DNA. Cancer Res 1993, 53 (6), 1304-11.