sign in sign up
<<
Home , ARID1A, Arylsulfatase E, ATF3, ATP13A3, BCL6, C7orf26

Tablet S1. factors induced at least two fold by OHT with p<0.01

Probe.Set.ID Symbol Gene Title 207826_s_at ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix 218839_at HEY1 hairy/enhancer-of-split related with YRPW motif 1 203574_at NFIL3 nuclear factor, 3 regulated 209291_at ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 44783_s_at HEY1 hairy/enhancer-of-split related with YRPW motif 1 220225_at IRX4 iroquois protein 4 220493_at DMRT1 and mab-3 related 1 204194_at BACH1 BTB and CNC 1, basic zipper transcription factor 1 204622_x_at NR4A2 nuclear subfamily 4, group A, member 2 206140_at LHX2 LIM homeobox 2 212696_s_at RNF4 ring finger protein 4 207144_s_at CITED1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 41037_at TEAD4 TEA domain family member 4 36711_at MAFF v- musculoaponeurotic fibrosarcoma homolog F (avian) 216248_s_at NR4A2 subfamily 4, group A, member 2 204131_s_at FOXO3A forkhead box O3A 204132_s_at FOXO3A forkhead box O3A 50221_at TFEB transcription factor EB 204281_at TEAD4 TEA domain family member 4 31845_at ELF4 E74-like factor 4 (ets domain transcription factor) 221558_s_at LEF1 lymphoid enhancer-binding factor 1 208502_s_at PITX1 paired-like homeodomain transcription factor 1 204249_s_at LMO2 LIM domain only 2 (rhombotin-like 1) 204798_at MYB v- myeloblastosis viral oncogene homolog (avian) 210319_x_at MSX2 msh homeobox homolog 2 () 221950_at EMX2 empty spiracles homolog 2 (Drosophila) 203408_s_at SATB1 special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA's) 206915_at NKX2-2 NK2 transcription factor related, 2 (Drosophila) 216417_x_at HOXB9 homeobox B9 202692_s_at UBTF upstream binding transcription factor, RNA polymerase I 207978_s_at NR4A3 nuclear receptor subfamily 4, group A, member 3 213150_at HOXA10 209587_at PITX1 paired-like homeodomain transcription factor 1 210655_s_at FOXO3A forkhead box O3A 208157_at SIM2 single-minded homolog 2 (Drosophila) 204082_at PBX3 pre-B-cell leukemia transcription factor 3 214651_s_at HOXA9 homeobox A9 210649_s_at ARID1A AT rich interactive domain 1A (SWI- like) 213147_at HOXA10 homeobox A10 210016_at MYT1L myelin transcription factor 1-like 203973_s_at CEBPD CCAAT/enhancer binding protein (C/EBP), delta 220392_at EBF2 early B-cell factor 2 206289_at HOXA4 homeobox A4 210162_s_at NFATC1 nuclear factor of activated T-cells, cytoplasmic, -dependent 1 209905_at HOXA9 homeobox A9 205935_at FOXF1 forkhead box F1 203358_s_at EZH2 enhancer of zeste homolog 2 (Drosophila) 218284_at SMAD3 SMAD, mothers against DPP homolog 3 (Drosophila) 209292_at ID4 Inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 204621_s_at NR4A2 nuclear receptor subfamily 4, group A, member 2 204039_at CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 219884_at LHX6 LIM homeobox 6 218128_at NFYB nuclear transcription factor Y, beta 215152_at MYB v-myb myeloblastosis viral oncogene homolog (avian) 209454_s_at TEAD3 TEA domain family member 3 202724_s_at FOXO1A forkhead box O1A (rhabdomyosarcoma) 205193_at MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) 209205_s_at LMO4 LIM domain only 4 205906_at FOXJ1 forkhead box J1 213906_at MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 206283_s_at TAL1 T-cell acute lymphocytic leukemia 1 206510_at SIX2 sine oculis homeobox homolog 2 (Drosophila) 219990_at E2F8 transcription factor 8 202449_s_at RXRA X receptor, alpha 200878_at EPAS1 endothelial PAS domain protein 1 206657_s_at MYOD1 myogenic differentiation 1 206363_at MAF v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) 212689_s_at JMJD1A jumonji domain containing 1A 205932_s_at MSX1 msh homeobox homolog 1 (Drosophila) 208510_s_at PPARG peroxisome proliferative activated receptor, gamma 213920_at CUTL2 cut-like 2 (Drosophila) 202672_s_at ATF3 activating transcription factor 3 210239_at IRX5 iroquois homeobox protein 5 211219_s_at LHX2 LIM homeobox 2 205555_s_at MSX2 msh homeobox homolog 2 (Drosophila) 210170_at PDLIM3 PDZ and LIM domain 3 209959_at NR4A3 nuclear receptor subfamily 4, group A, member 3 209293_x_at ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 218917_s_at ARID1A AT rich interactive domain 1A (SWI- like) 207069_s_at SMAD6 SMAD, mothers against DPP homolog 6 (Drosophila) 206558_at SIM2 single-minded homolog 2 (Drosophila) 207060_at EN2 homolog 2 210555_s_at NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 206377_at FOXF2 forkhead box F2 212612_at RCOR1 REST 1 209239_at NFKB1 nuclear factor of kappa polypeptide gene enhancer in B-cells 1 (p105) 210948_s_at LEF1 lymphoid enhancer-binding factor 1 204668_at RNF24 ring finger protein 24 202340_x_at NR4A1 nuclear receptor subfamily 4, group A, member 1 218127_at NFYB nuclear transcription factor Y, beta 206511_s_at SIX2 sine oculis homeobox homolog 2 (Drosophila) 211467_s_at NFIB /B 209347_s_at MAF v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) 215264_at EMX1 empty spiracles homolog 1 (Drosophila) 206589_at GFI1 growth factor independent 1 221016_s_at TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) /// transcription factor 7-like 1 (T-cell specific, HMG-box) 205817_at SIX1 sine oculis homeobox homolog 1 (Drosophila) 205604_at HOXD9 homeobox D9 214881_s_at UBTF upstream binding transcription factor, RNA polymerase I 204529_s_at TOX high mobility group box protein TOX 213844_at HOXA5 homeobox A5 208216_at DLX4 distal-less homeobox 4 204188_s_at RARG receptor, gamma 206645_s_at NR0B1 nuclear receptor subfamily 0, group B, member 1 209262_s_at NR2F6 nuclear receptor subfamily 2, group F, member 6 218129_s_at NFYB nuclear transcription factor Y, beta 202531_at IRF1 interferon regulatory factor 1 40284_at FOXA2 forkhead box A2 202723_s_at FOXO1A forkhead box O1A (rhabdomyosarcoma) 211771_s_at POU2F2 POU domain, class 2, transcription factor 2 /// POU domain, class 2, transcription factor 2 210818_s_at BACH1 BTB and CNC homology 1, basic transcription factor 1 203490_at ELF4 E74-like factor 4 (ets domain transcription factor) 216925_s_at TAL1 T-cell acute lymphocytic leukemia 1 205259_at NR3C2 nuclear receptor subfamily 3, group C, member 2 209664_x_at NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 207725_at POU4F2 POU domain, class 4, transcription factor 2 208978_at CRIP2 cysteine-rich protein 2 218344_s_at RCOR3 REST corepressor 3 206387_at CDX2 caudal type homeobox transcription factor 2 206847_s_at HOXA7 homeobox A7 218850_s_at LIMD1 LIM domains containing 1 210271_at NEUROD2 neurogenic differentiation 2 209261_s_at NR2F6 nuclear receptor subfamily 2, group F, member 6 218881_s_at FOSL2 FOS-like antigen 2 218724_s_at TGIF2 TGFB-induced factor 2 (TALE family homeobox) 208492_at RFXAP regulatory -associated protein 214614_at HLXB9 homeobox HB9 214457_at HOXA2 homeobox A2 214401_at PAX1 paired box gene 1 215006_at EZH2 Enhancer of zeste homolog 2 (Drosophila) 204189_at RARG , gamma 206228_at PAX2 paired box gene 2 205225_at ESR1 receptor 1 210103_s_at FOXA2 forkhead box A2 209710_at GATA2 GATA binding protein 2 209189_at FOS v-fos FBJ murine osteosarcoma viral oncogene homolog 221866_at TFEB transcription factor EB 205286_at TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 207260_at FEV FEV (ETS oncogene family) 216161_at SBNO1 Sno, strawberry notch homolog 1 (Drosophila) 208487_at LMX1B LIM homeobox transcription factor 1, beta 217399_s_at FOXO3A forkhead box O3A 210745_at ONECUT1 one , family member 1 220804_s_at TP73 tumor protein 219568_x_at SOX18 SRY (sex determining region Y)-box 18 214326_x_at JUND jun D proto-oncogene 216928_at TAL1 T-cell acute lymphocytic leukemia 1 220480_at HAND2 and derivatives expressed 2 211466_at NFIB nuclear factor I/B 203393_at HES1 hairy and enhancer of split 1, (Drosophila) 204530_s_at TOX thymus high mobility group box protein TOX 210556_at NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 fold by OHT TTEST OHT 113 unique TFs 9.0 3.02267E-12 ARID1A 100.7 3.30322E-11 ATF3 2.7 3.41166E-11 BACH1 27.4 3.42266E-11 CDX2 66.9 1.96087E-10 CEBPA 12.1 2.33272E-10 CEBPD 11.2 4.1045E-10 CITED1 3.7 9.00757E-10 CRIP2 18.1 1.93485E-09 CUTL2 8.1 2.01815E-09 DLX4 2.8 2.20603E-09 DMRT1 23.3 3.27527E-09 E2F8 5.0 3.27765E-09 EBF2 2.3 3.41224E-09 ELF4 27.0 4.6143E-09 EMX1 4.0 5.09799E-09 EMX2 3.2 5.55042E-09 EN2 4.2 7.83035E-09 EPAS1 3.6 1.01405E-08 ESR1 3.3 1.16226E-08 EZH2 5.7 1.20024E-08 FEV 5.1 1.29333E-08 FOS 6.2 1.63506E-08 FOSL2 23.9 1.73649E-08 FOXA2 4.3 2.02575E-08 FOXF1 4.7 2.09327E-08 FOXF2 2.3 2.3856E-08 FOXJ1 2.9 2.47067E-08 FOXO1A 2.7 2.47876E-08 FOXO3A 2.8 2.51846E-08 GATA2 11.4 2.87736E-08 GFI1 4.5 2.95973E-08 HAND2 5.9 3.04831E-08 HES1 2.7 3.05259E-08 HEY1 14.4 3.47266E-08 HLXB9 2.6 3.70825E-08 HOXA10 6.2 4.21138E-08 HOXA2 2.8 4.43601E-08 HOXA4 5.8 4.81339E-08 HOXA5 3.7 4.94957E-08 HOXA7 5.5 5.08813E-08 HOXA9 15.2 5.86654E-08 HOXB9 7.1 5.94509E-08 HOXD9 11.3 7.26726E-08 ID3 6.5 7.80711E-08 ID4 9.4 1.0584E-07 IRF1 3.6 1.12827E-07 IRX4 2.9 1.1679E-07 IRX5 16.3 1.193E-07 JMJD1A 21.0 1.22548E-07 JUND 21.1 1.39176E-07 LEF1 3.2 1.44086E-07 LHX2 5.3 1.47996E-07 LHX6 5.8 1.61062E-07 LIMD1 2.0 1.72324E-07 LMO2 4.9 1.91278E-07 LMO4 2.1 1.98972E-07 LMX1B 2.1 2.22495E-07 MAF 10.6 2.23163E-07 MAFF 2.5 2.25119E-07 MSX1 17.7 2.25628E-07 MSX2 3.9 3.11613E-07 MYB 2.4 3.74084E-07 MYBL1 2.7 4.78446E-07 MYOD1 6.3 5.19069E-07 MYT1L 10.1 6.12122E-07 NEUROD2 2.6 7.01536E-07 NFATC1 2.7 7.18849E-07 NFATC3 2.7 8.0219E-07 NFIB 2.3 8.58654E-07 NFIL3 4.6 9.12736E-07 NFKB1 2.1 9.18213E-07 NFYB 3.8 9.22443E-07 NKX2-2 3.8 1.13555E-06 NR0B1 3.3 1.20901E-06 NR2F6 4.7 1.29049E-06 NR3C2 8.0 1.46545E-06 NR4A1 3.9 1.47219E-06 NR4A2 2.2 1.47669E-06 NR4A3 5.3 1.68427E-06 ONECUT1 4.5 1.69196E-06 PAX1 2.7 1.72545E-06 PAX2 2.7 1.78073E-06 PBX3 5.7 1.89295E-06 PDLIM3 3.1 1.94115E-06 PITX1 2.0 1.95954E-06 POU2F2 4.5 2.0557E-06 POU4F2 2.1 2.08016E-06 PPARG 4.3 2.16967E-06 RARG 3.9 2.18284E-06 RCOR1 3.7 2.58863E-06 RCOR3 2.1 2.66689E-06 RFXAP 2.2 2.72942E-06 RNF24 10.4 3.01816E-06 RNF4 2.6 3.03702E-06 RXRA 2.0 3.26501E-06 SATB1 2.7 3.47676E-06 SBNO1 4.2 3.56449E-06 SIM2 2.3 4.0078E-06 SIX1 8.8 4.18044E-06 SIX2 3.1 4.71076E-06 SMAD3 4.1 8.43542E-06 SMAD6 2.1 8.47217E-06 SOX18 2.6 9.06033E-06 TAL1 5.8 1.05985E-05 TCF7L1 2.7 1.43115E-05 TEAD3 3.3 1.52719E-05 TEAD4 3.5 1.59947E-05 TFAP2C 6.9 1.65484E-05 TFEB 2.4 1.89552E-05 TGIF2 3.2 2.03704E-05 TOX 2.1 2.08368E-05 TP73 8.1 2.61167E-05 UBTF 2.4 2.82521E-05 22.3 3.32727E-05 4.6 3.35754E-05 3.5 3.55712E-05 2.1 3.7258E-05 7.0 4.58479E-05 2.4 4.73825E-05 2.0 4.86545E-05 3.0 6.50578E-05 5.3 7.52578E-05 2.2 7.62837E-05 2.1 8.91404E-05 3.5 0.000151357 3.0 0.000175085 2.4 0.00017674 4.9 0.000372712 2.3 0.000383143 2.7 0.000442301 2.8 0.000511167 2.4 0.000591757 2.2 0.000633585 2.0 0.000675196 2.1 0.000693553 2.2 0.000855841 3.7 0.000954279 3.2 0.001082461 2.3 0.00108632 2.5 0.001104357 5.5 0.001929992 3.2 0.002433634 6.0 0.002477565 4.5 0.002504588 2.2 0.002890164 3.7 0.003709809 4.2 0.003897438 2.2 0.005207132 2.6 0.005227975 2.4 0.005707886 2.3 0.007439502 Table S2 Probes induced more than 2 fold by OHT with induced levels significantly lower in sh-FOXO samples than in sh-scr samples (T test palue<0.01)

351 probes (278 ) Probe.Set.IDGene SymbolGene Title fold by OHTscr-OHT/shFOXO in scr pvalue OHT (scr OHT vs FOXO278 OHT) unique genes

212796_s_atTBC1D2B TBC1 domain family,3.36 member1.54 2B 2.51E-08 AAK1 36711_at MAFF v-maf musculoaponeurotic2.26 1.75 fibrosarcoma3.07E-07 oncogene homologACSL1 F (avian) 209803_s_atPHLDA2 pleckstrin homology-like4.09 domain,1.21 family3.52E-07 A, member 2 ADAMTS8 213508_at C14ORF147chromosome 142.52 open reading2.06 frame5.96E-07 147 ADCY2 218898_at FAM57A family with sequence6.01 similarity1.48 57, member1.04E-06 A ADCY3 205193_at MAFF v-maf musculoaponeurotic2.10 1.68 fibrosarcoma2.68E-06 oncogene homologADCY9 F (avian) 204668_at RNF24 ring finger protein2.11 24 1.25 3.95E-06 AGMAT 207767_s_atEGR4 early growth response4.84 4 1.99 4.34E-06 AGPAT7 210480_s_atMYO6 VI 3.99 1.78 8.79E-06 AK3L1 214157_at GNAS GNAS complex 5.78locus 1.22 9.02E-06 AMD1 212942_s_atKIAA1199 KIAA1199 29.88 2.92 9.54E-06 ANKHD1 217280_x_atGABRA5 ///gamma-aminobutyric LOC653222 8.73 acid 1.56(GABA) A9.82E-06 receptor, alpha 5 /// APAF1similar to Gamma-aminobutyric-acid receptor alpha-5 subunit precursor (GABA(A) receptor) 207011_s_atPTK7 PTK7 protein tyrosine2.44 kinase1.14 7 1.05E-05 ARF6 216894_x_atCDKN1C -dependent3.39 kinase inhibitor1.45 1C1.20E-05 (p57, Kip2) ATF3 219892_at TM6SF1 transmembrane26.72 6 superfamily1.22 member1.26E-05 1 ATP2A2 207978_s_atNR4A3 nuclear receptor11.42 subfamily1.60 4, group1.57E-05 A, member 3 ATP6V0B 203057_s_atPRDM2 PR domain containing3.85 2, with1.26 ZNF domain1.63E-05 AVPI1 216347_s_atPPP1R13B protein phosphatase3.62 1, regulatory1.26 (inhibitor)1.73E-05 subunit 13B AZIN1 206363_at MAF v-maf musculoaponeurotic2.61 1.71 fibrosarcoma1.98E-05 oncogene homologB3GNT1 (avian) 204404_at SLC12A2 solute carrier family2.98 12 (sodium/potassium/chloride1.40 2.03E-05 transporters),B4GALT1 member 2 210655_s_atFOXO3A forkhead box O3A2.65 3.55 2.30E-05 B4GALT6 209347_s_atMAF v-maf musculoaponeurotic2.19 1.46 fibrosarcoma2.33E-05 oncogene homologBAHCC1 (avian) 202724_s_atFOXO1A forkhead box O1A4.86 (rhabdomyosarcoma)2.52 2.41E-05 BAZ1A 204132_s_atFOXO3A forkhead box O3A3.24 3.24 2.81E-05 BCL2 207345_at FST 7.91 1.38 2.89E-05 BCOR 209591_s_atBMP7 bone morphogenetic2.34 protein1.38 7 (osteogenic2.96E-05 protein 1) BMP2 205289_at BMP2 bone morphogenetic8.01 protein1.30 2 3.07E-05 BMP2K 59697_at RAB15 RAB15, member2.52 RAS onocogene1.21 family3.08E-05 BMP7 219132_at PELI2 pellino homolog3.56 2 (Drosophila)1.92 3.10E-05 C14ORF109 219255_x_atIL17RB receptor8.95 B 1.66 3.23E-05 C14ORF147 215918_s_atSPTBN1 spectrin, beta, 2.16non-erythrocytic1.78 1 3.66E-05 C14ORF169 204379_s_atFGFR3 fibroblast growth16.14 factor receptor1.43 3 (achondroplasia,3.82E-05 thanatophoricC14ORF45 dwarfism) 209292_at ID4 Inhibitor of DNA16.30 binding 4,1.70 dominant4.03E-05 negative helix-loop-helixC14ORF65 protein 208114_s_atISG20L2 interferon stimulated3.28 exonuclease1.19 gene4.27E-05 20kDa-like 2 /// interferonC18ORF8 stimulated gene 20kDa-like 2 206232_s_atB4GALT6 UDP-Gal:betaGlcNAc15.76 beta 2.081,4- galactosyltransferase,4.30E-05 polypeptideC1QDC1 6 217687_at ADCY2 adenylate cyclase4.38 2 (brain)1.70 4.49E-05 C2ORF17 209209_s_atPLEKHC1 pleckstrin homology2.12 domain1.46 containing,5.40E-05 family C (with FERMC6ORF145 domain) member 1 212521_s_atPDE8A phosphodiesterase2.71 8A 1.60 5.60E-05 CA2 203215_s_atMYO6 myosin VI 3.49 1.20 5.62E-05 CBLN1 206404_at FGF9 fibroblast growth7.20 factor 9 (glia-activating1.38 5.84E-05 factor) CC2D1A 205852_at CDK5R2 cyclin-dependent2.36 kinase 5,1.72 regulatory6.06E-05 subunit 2 (p39) CCDC109B 221983_at C2ORF17 22.00 open reading1.73 frame 6.09E-0517 CCDC48 209569_x_atD4S234E DNA segment on4.31 chromosome1.55 4 (unique)6.57E-05 234 expressed sequenceCD1D 211421_s_atRET Ret proto-oncogene2.31 (multiple1.74 endocrine6.90E-05 neoplasia and medullaryCDK5R2 1, Hirschsprung disease) 215794_x_atGLUD2 glutamate dehydrogenase6.65 1.302 7.11E-05 CDKN1C 207275_s_atACSL1 acyl-CoA synthetase5.13 long-chain1.44 family7.21E-05 member 1 CDKN2B 213348_at CDKN1C Cyclin-dependent4.59 kinase inhibitor1.40 1C7.33E-05 (p57, Kip2) CDKN2C 219889_at FRAT1 frequently rearranged2.93 in advanced2.14 T-cell7.61E-05 CEBPA 204131_s_atFOXO3A forkhead box O3A3.99 3.21 8.06E-05 CEBPD 220254_at LRP12 low density lipoprotein-related3.07 1.55 protein8.21E-05 12 CENTA2 213425_at WNT5A wingless-type MMTV3.13 integration2.57 site8.48E-05 family, member 5A ///CHPT1 wingless-type MMTV integration site family, member 5A 204948_s_atFST follistatin 3.67 1.26 8.73E-05 CHRD 219534_x_atCDKN1C cyclin-dependent3.47 kinase inhibitor1.36 1C8.80E-05 (p57, Kip2) CHRNA3 211248_s_atCHRD chordin 3.48 1.40 9.08E-05 CHST2 205777_at DUSP9 dual specificity4.18 phosphatase1.22 9 9.16E-05 CITED1 213246_at C14ORF109chromosome 143.03 open reading1.48 frame9.60E-05 109 COMMD3 221190_s_atC18ORF8 chromosome 182.66 open reading1.24 frame9.82E-05 8 CPM 211259_s_atBMP7 bone morphogenetic2.17 protein1.30 7 (osteogenic9.99E-05 protein 1) CRLF1 205850_s_atGABRB3 gamma-aminobutyric2.82 acid 1.89(GABA) A1.07E-04 receptor, beta 3 CSPG5 209818_s_atHABP4 hyaluronan binding4.04 protein1.62 4 1.11E-04 CTA-126B4.3 212923_s_atC6ORF145 chromosome 63.75 open reading1.35 frame 1.14E-04145 CTA-126B4.3 /// DJ222E13.2 221957_at PDK3 Pyruvate dehydrogenase2.19 kinase,1.38 isozyme1.16E-04 3 CTSB 214838_at SFT2D2 SFT2 domain containing2.69 2 1.42 1.17E-04 CTSL2 207069_s_atSMAD6 SMAD, mothers5.30 against DPP1.70 homolog1.23E-04 6 (Drosophila) CYP46A1 205555_s_atMSX2 msh homeobox3.26 homolog 21.52 (Drosophila)1.25E-04 D4S234E 212522_at PDE8A phosphodiesterase3.53 8A 1.27 1.30E-04 DACT1 207764_s_atHIPK3 homeodomain 2.65interacting 1.67protein kinase1.31E-04 3 DEPDC2 206924_at IL11 interleukin 11 2.31 1.40 1.45E-04 DIXDC1 205290_s_atBMP2 bone morphogenetic8.92 protein1.46 2 1.48E-04 DOCK9 200753_x_atSFRS2 splicing factor, 2.00arginine/serine-rich1.26 21.50E-04 DOT1L 51158_at LOC400451hypothetical gene3.27 supported1.58 by AK075564;1.51E-04 BC060873 DPP4 39966_at CSPG5 chondroitin sulfate2.93 proteoglycan1.22 5 (neuroglycan1.62E-04 C) DUSP9 210148_at HIPK3 homeodomain 3.65interacting 1.50protein kinase1.67E-04 3 EBF2 201772_at AZIN1 antizyme inhibitor2.25 1 1.49 1.68E-04 EDG2 40472_at AGPAT7 1-acylglycerol-3-phosphate2.27 1.27 O-acyltransferase1.74E-04 7 (lysophosphatidicEEF1A2 acid acyltransferase, eta) 211057_at ROR1 receptor tyrosine2.86 kinase-like1.79 orphan1.77E-04 receptor 1 /// receptorEGR1 kinase-like 1 201963_at ACSL1 acyl-CoA synthetase5.86 long-chain1.46 family1.79E-04 member 1 EGR2 202723_s_atFOXO1A forkhead box O1A6.89 (rhabdomyosarcoma)3.29 1.80E-04 EGR4 209301_at CA2 carbonic anhydrase9.19 II 1.31 1.83E-04 EML1 202626_s_atLYN v-yes-1 Yamaguchi2.78 sarcoma1.30 viral related1.91E-04 oncogene homologEMX2 /// v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 214786_at MAP3K1 mitogen-activated2.38 protein2.17 kinase kinase1.91E-04 kinase 1 ENO3 206300_s_atPTHLH parathyroid -like6.68 1.47hormone1.92E-04 EPHA7 210676_x_atRGPD5 /// LOC653086RANBP2-like /// and 3.12LOC653596 GRIP domain1.44 containing1.94E-04 5 /// similar to -bindingF12 protein 2-like 1 isoform 2 /// similar to RAN-binding protein 2-like 1 isoform 2 206100_at CPM carboxypeptidase20.61 M 1.34 2.05E-04 FAM46A 32062_at N4BP1 Nedd4 binding 4.71protein 1 1.43 2.05E-04 FAM57A 203495_at LRRC14 leucine rich repeat4.80 containing1.32 14 2.05E-04 FAM8A1 204391_x_atTRIM24 tripartite motif-containing2.26 1.6524 2.12E-04 FBLN5 202241_at TRIB1 tribbles homolog3.80 1 (Drosophila)1.12 2.23E-04 FGF4 210221_at CHRNA3 cholinergic receptor,6.14 nicotinic,1.56 alpha2.35E-04 3 FGF9 205241_at SCO2 SCO cytochrome3.60 oxidase deficient1.33 homolog2.38E-04 2 (yeast) FGFR1 206965_at KLF12 Kruppel-like factor2.62 12 1.51 2.41E-04 FGFR2 213275_x_atCTSB cathepsin B 2.14 1.83 2.70E-04 FGFR3 221611_s_atPHF7 PHD finger protein2.56 7 2.98 2.93E-04 FKBP5 218855_at GPR175 -coupled2.40 receptor1.28 175 3.02E-04 FOSL2 203015_s_atSSX2IP synovial sarcoma,3.04 X breakpoint1.38 2 interacting3.35E-04 protein FOXC1 211792_s_atCDKN2C cyclin-dependent8.98 kinase inhibitor1.26 2C3.41E-04 (p18, inhibits CDK4) FOXO1A 215113_s_atSENP3 SUMO1/sentrin/SMT33.17 specific1.20 peptidase3.46E-04 3 FOXO3A 205249_at EGR2 early growth response2.42 2 (Krox-203.22 homolog,3.51E-04 Drosophila) FRAT1 214047_s_atMBD4 methyl-CpG binding4.11 domain1.24 protein3.57E-04 4 FST 220327_at VGLL3 vestigial like 3 (Drosophila)2.29 1.66 3.59E-04 FVT1 210319_x_atMSX2 msh homeobox4.31 homolog 21.49 (Drosophila)3.67E-04 FZD1 206356_s_atGNAL guanine nucleotide7.16 binding1.19 protein 3.74E-04(G protein), alpha activatingFZD10 activity polypeptide, olfactory type 206238_s_atYAF2 YY1 associated2.48 factor 2 1.69 3.87E-04 FZD7 210021_s_atUNG2 uracil-DNA glycosylase6.36 2 1.20 4.08E-04 GABRA5 /// LOC653222 219081_at ANKHD1 ankyrin repeat 2.37and KH domain1.31 containing4.09E-04 1 GABRB3 206348_s_atPDK3 pyruvate dehydrogenase2.28 kinase,1.48 isozyme4.17E-04 3 GAS7 212665_at TIPARP TCDD-inducible3.32 poly(ADP-ribose)1.12 polymerase4.26E-04 GCH1 212766_s_atISG20L2 interferon stimulated3.19 exonuclease1.17 gene4.38E-04 20kDa-like 2 GENX-3414 215961_at F12 coagulation factor3.74 XII (Hageman2.31 factor)4.48E-04 GLUD1 210999_s_atGRB10 growth factor receptor-bound2.91 1.44 protein4.61E-04 10 GLUD2 202419_at FVT1 follicular lymphoma2.19 variant1.16 translocation4.81E-04 1 GNAI1 209107_x_atNCOA1 nuclear receptor2.47 coactivator1.63 1 4.86E-04 GNAL 203311_s_atARF6 ADP-ribosylation4.37 factor 6 1.16 4.86E-04 GNAS 210074_at CTSL2 cathepsin L2 3.66 1.21 4.91E-04 GPR135 212508_at MOAP1 modulator of apoptosis3.79 1 1.82 4.97E-04 GPR175 213174_at TTC9 tetratricopeptide3.13 repeat domain1.33 9 4.97E-04 GPRC5B 207144_s_atCITED1 Cbp/p300-interacting23.25 transactivator,1.51 5.16E-04 with Glu/Asp-rich carboxy-terminalGRB10 domain, 1 202236_s_atSLC16A1 solute carrier family5.34 16 (monocarboxylic1.15 5.33E-04 acid transporters),HABP4 member 1 204621_s_atNR4A2 nuclear receptor20.97 subfamily1.39 4, group5.35E-04 A, member 2 HBA1 202340_x_atNR4A1 nuclear receptor4.32 subfamily1.58 4, group5.65E-04 A, member 1 HBA1 /// HBA2 204796_at EML1 echinoderm microtubule2.25 associated1.51 5.68E-04 protein like 1 HBA2 219998_at HSPC159 HSPC159 protein2.28 1.30 5.75E-04 HBEGF 219526_at C14ORF169chromosome 142.69 open reading1.34 frame5.95E-04 169 HCN2 210573_s_atPOLR3C polymerase (RNA)2.12 III (DNA1.15 directed)5.96E-04 polypeptide C (62kD)HIPK3 213906_at MYBL1 v-myb myeloblastosis2.54 viral1.19 oncogene6.10E-04 homolog (avian)-likeHK2 1 219764_at FZD10 homolog8.52 10 (Drosophila)1.29 6.10E-04 HNRPH1 205591_at OLFM1 olfactomedin 17.74 1.81 6.20E-04 HOMER2 203921_at CHST2 carbohydrate (N-acetylglucosamine-6-O)11.08 2.06 6.33E-04 sulfotransferase HOXA22 206472_s_atTLE3 -like2.82 enhancer of1.33 split 3 (E(sp1)6.34E-04 homolog, Drosophila)HPCAL1 204039_at CEBPA CCAAT/enhancer21.06 binding protein1.63 (C/EBP),6.56E-04 alpha HRH3 203717_at DPP4 dipeptidyl-peptidase4.32 4 (CD26,1.37 adenosine6.63E-04 deaminase complexingHSPC159 protein 2) 203648_at TATDN2 TatD DNase domain2.70 containing1.42 2 6.67E-04 HTATSF1 207725_at POU4F2 POU domain, class4.61 4, transcription2.14 factor6.76E-04 2 ID4 209611_s_atSLC1A4 solute carrier family5.02 1 (glutamate/neutral1.38 6.79E-04 transporter),IGF1R member 4 201349_at SLC9A3R1 solute carrier family6.46 9 (sodium/hydrogen1.30 6.88E-04 exchanger), memberIL11 3 regulator 1 209485_s_atOSBPL1A oxysterol binding3.56 protein-like1.32 1A 7.45E-04 IL17RB 218456_at C1QDC1 C1q domain containing2.65 1 1.29 7.47E-04 ISG20L2 208157_at SIM2 single-minded14.36 homolog 2 (Drosophila)1.56 7.48E-04 ISOC1 213280_at LOC653127similar to GTPase5.03 activating1.26 Rap/RanGAP7.49E-04 domain-like 4 JAG1 217080_s_atHOMER2 homer homolog2.90 2 (Drosophila)1.24 7.60E-04 JOSD1 213301_x_atTRIM24 tripartite motif-containing2.06 1.4824 7.60E-04 JPH3 204622_x_atNR4A2 nuclear receptor18.08 subfamily1.39 4, group7.97E-04 A, member 2 KCNA1 207150_at SLC18A3 solute carrier family3.57 18 (vesicular1.63 acetylcholine),8.14E-04 member KCNQ23 217399_s_atFOXO3A forkhead box O3A5.50 10.75 8.15E-04 KCNV1 205789_at CD1D CD1d molecule2.83 /// CD1d molecule1.87 8.19E-04 KIAA0895 50965_at RAB26 RAB26, member5.22 RAS oncogene1.27 family8.46E-04 KIAA1199 220447_at HRH3 histamine receptor56.89 H3 2.01 8.69E-04 KIAA1212 213096_at TMCC2 transmembrane2.04 and coiled-coil1.49 domain8.70E-04 family 2 KIAA1446 221766_s_atFAM46A family with sequence2.71 similarity1.71 46, member8.74E-04 A KITLG 220732_at DEPDC2 DEP domain containing20.25 2 1.64 8.90E-04 KLF12 41577_at PPP1R16B protein phosphatase7.82 1, regulatory1.58 (inhibitor)8.92E-04 subunit 16B LETM1 200946_x_atGLUD1 glutamate dehydrogenase5.88 1.181 8.94E-04 LMO2 209580_s_atMBD4 methyl-CpG binding3.99 domain1.23 protein9.34E-04 4 LOC400451 202583_s_atRANBP9 RAN binding protein6.82 9 1.09 9.59E-04 LOC643287 209815_at PTCH1 patched homolog3.12 1 (Drosophila)1.29 9.71E-04 LOC653127 219433_at BCOR BCL6 co-repressor7.40 1.24 9.85E-04 LOC653483 210249_s_atNCOA1 nuclear receptor2.58 coactivator1.70 1 9.98E-04 LRP12 218631_at AVPI1 arginine vasopressin-induced6.97 1.22 1 1.02E-03 LRRC14 203420_at FAM8A1 family with sequence2.85 similarity1.43 8, member1.07E-03 A1 LYN 209098_s_atJAG1 jagged 1 (Alagille4.19 syndrome)1.16 1.09E-03 MAF 214414_x_atHBA2 , alpha8.48 2 /// hemoglobin,1.85 1.09E-03 alpha 2 MAFF 206233_at B4GALT6 UDP-Gal:betaGlcNAc11.49 beta 1.941,4- galactosyltransferase,1.09E-03 polypeptideMAN1C1 6 204540_at EEF1A2 eukaryotic translation2.54 elongation1.25 factor1.11E-03 1 alpha 2 MAP3K1 206574_s_atPTP4A3 protein tyrosine3.63 phosphatase1.50 type IVA,1.11E-03 member 3 MAP6D1 212435_at TRIM33 tripartite motif-containing5.79 1.2833 1.13E-03 MAPK12 203973_s_atCEBPD CCAAT/enhancer5.49 binding protein1.24 (C/EBP),1.13E-03 delta MAPK8IP2 204159_at CDKN2C cyclin-dependent5.69 kinase inhibitor1.06 2C1.17E-03 (p18, inhibits CDK4) MARCH3 218918_at MAN1C1 mannosidase, 16.25alpha, class 1.181C, member1.22E-03 1 MBD4 213131_at OLFM1 olfactomedin 16.11 1.67 1.22E-03 METRN 203685_at BCL2 B-cell CLL/lymphoma5.11 2 1.41 1.24E-03 MMP15 220795_s_atKIAA1446 likely ortholog 2.88of rat brain-enriched1.59 1.26E-03 guanylate kinase-associatedMOAP1 protein 220253_s_atLRP12 low density lipoprotein-related3.46 1.38 protein1.27E-03 12 MPP6 204547_at RAB40B RAB40B, member2.30 RAS oncogene2.14 family1.30E-03 MPPED2 221810_at RAB15 RAB15, member2.61 RAS onocogene1.21 family1.30E-03 MSL2L1 218901_at PLSCR4 phospholipid scramblase2.28 41.41 1.32E-03 MSX2 202672_s_atATF3 activating transcription2.06 factor1.30 3 1.34E-03 MTCP1 219792_at AGMAT agmatine ureohydrolase4.47 ()1.26 1.34E-03 MVK 216248_s_atNR4A2 nuclear receptor27.00 subfamily1.32 4, group1.37E-03 A, member 2 MYBL1 211535_s_atFGFR1 fibroblast growth2.36 factor receptor1.25 1 (fms-related1.39E-03 tyrosine kinaseMYO6 2, Pfeiffer syndrome) 201694_s_atEGR1 early growth response2.14 1 1.43 1.40E-03 N4BP1 219862_s_atNARF nuclear prelamin2.03 A recognition1.14 factor1.42E-03 NAB1 200632_s_atNDRG1 N- downstream2.63 regulated1.36 gene 1.43E-031 NARF 219631_at LRP12 low density lipoprotein-related2.56 1.35 protein1.49E-03 12 NCOA1 213256_at MARCH3 membrane-associated2.18 .25 finger (C3HC4)1.50E-03 3 NDRG1 209959_at NR4A3 nuclear receptor8.01 subfamily1.47 4, group1.53E-03 A, member 3 NLRP3 204021_s_atPURA purine-rich element3.16 binding1.32 protein1.54E-03 A NMB 203216_s_atMYO6 myosin VI 3.97 1.18 1.54E-03 NR3C2 204506_at PPP3R1 protein phosphatase2.12 3 (formerly1.52 2B),1.56E-03 regulatory subunit B,NR4A1 19kDa, alpha isoform (calcineurin B, type I) 209695_at PTP4A3 protein tyrosine2.99 phosphatase1.51 type IVA,1.56E-03 member 3 NR4A2 204249_s_atLMO2 LIM domain only6.22 2 (rhombotin-like1.44 1)1.56E-03 NR4A3 221950_at EMX2 empty spiracles4.65 homolog 21.17 (Drosophila)1.59E-03 NRCAM 202035_s_atSFRP1 secreted frizzled-related2.11 protein1.88 1 1.59E-03 NRTN 219358_s_atCENTA2 centaurin, alpha2.33 2 1.41 1.60E-03 NUDT4 /// NUDT4P1 221888_at CC2D1A coiled-coil and 2.60C2 domain 1.17containing1.61E-03 1A OLFM1 209579_s_atMBD4 methyl-CpG binding3.49 domain1.16 protein1.65E-03 4 OSBPL1A 212870_at SOS2 son of sevenless2.24 homolog 1.222 (Drosophila)1.75E-03 PAQR3 212552_at HPCAL1 hippocalcin-like2.52 1 1.19 1.76E-03 PDE10A 218881_s_atFOSL2 FOS-like antigen2.21 2 1.66 1.82E-03 PDE8A 220173_at C14ORF45 chromosome 143.76 open reading1.08 frame1.82E-03 45 PDK3 221792_at RAB6B RAB6B, member3.36 RAS oncogene1.13 family1.86E-03 PEG10 214212_x_atPLEKHC1 pleckstrin homology2.15 domain1.16 containing,1.86E-03 family C (with FERMPELI2 domain) member 1 208206_s_atRASGRP2 RAS guanyl releasing3.76 protein2.78 2 (calcium1.89E-03 and DAG-regulated)PHF7 219211_at USP18 ubiquitin specific9.80 peptidase1.23 18 1.94E-03 PHLDA2 204560_at FKBP5 FK506 binding protein6.51 5 1.70 1.95E-03 PHTF2 201713_s_atRANBP2 RAN binding protein2.29 2 1.19 1.97E-03 PIP5K2A 211171_s_atPDE10A phosphodiesterase3.29 10A 1.13 2.00E-03 PITPNC1 204105_s_atNRCAM neuronal cell adhesion2.13 molecule1.41 2.00E-03 PLEKHC1 59644_at BMP2K BMP2 inducible4.78 kinase 1.29 2.02E-03 PLSCR4 218733_at MSL2L1 male-specific lethal4.58 2-like 11.19 (Drosophila)2.04E-03 POLR3C 211139_s_atNAB1 NGFI-A binding2.21 protein 1 (EGR11.41 binding2.08E-03 protein 1) POU4F2 214487_s_atRAP2A /// RAP2BRAP2A, member3.27 of RAS oncogene1.34 family2.09E-03 /// RAP2B, memberPPP1R13B of RAS oncogene family 209576_at GNAI1 guanine nucleotide2.73 binding1.30 protein 2.14E-03(G protein), alpha inhibitingPPP1R16B activity polypeptide 1 201498_at USP7 ubiquitin specific2.63 peptidase1.07 7 (herpes2.15E-03 virus-associated) PPP3CC 205015_s_atTGFA transforming growth4.58 factor,1.58 alpha 2.17E-03 PPP3R1 202601_s_atHTATSF1 HIV-1 Tat specific4.96 factor 1 1.26 2.20E-03 PRDM2 201751_at JOSD1 Josephin domain3.72 containing1.19 1 2.23E-03 PTCH1 206302_s_atNUDT4 /// NUDT4P1nudix (nucleoside2.57 diphosphate1.29 linked2.29E-03 moiety X)-type motifPTGER2 4 /// nudix (nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 1 204483_at ENO3 enolase 3 (beta,3.88 muscle) 1.53 2.34E-03 PTHLH 211756_at PTHLH parathyroid hormone-like5.27 1.23hormone2.35E-03 /// parathyroid hormone-likePTK7 hormone 220188_at JPH3 junctophilin 3 2.66 1.49 2.35E-03 PTP4A3 210266_s_atTRIM33 tripartite motif-containing3.74 1.2233 2.36E-03 PURA 207768_at EGR4 early growth response12.69 4 2.35 2.45E-03 RAB15 210409_at LOC653483similar to myeloid/lymphoid6.24 1.60 or mixed-lineage2.47E-03 leukemia (trithoraxRAB26 homolog, Drosophila); translocated to, 4 212436_at TRIM33 tripartite motif-containing6.26 1.2433 2.48E-03 RAB40B 218170_at ISOC1 isochorismatase6.36 domain containing1.25 2.57E-031 RAB6B 212986_s_atTLK2 tousled-like kinase2.85 2 1.33 2.59E-03 RANBP2 217097_s_atPHTF2 putative homeodomain2.26 transcription1.24 2.59E-03 factor 2 RANBP9 205570_at PIP5K2A phosphatidylinositol-4-phosphate3.11 1.31 5-kinase,2.63E-03 type II, alpha RAP2A /// RAP2B 209291_at ID4 inhibitor of DNA27.38 binding 4,1.26 dominant2.63E-03 negative helix-loop-helixRASGRP2 protein 203632_s_atGPRC5B G protein-coupled14.33 receptor,1.28 family C,2.64E-03 group 5, member B RCOR1 204348_s_atAK3L1 adenylate kinase3.73 3-like 1 1.21 2.64E-03 RET 203843_at RPS6KA3 ribosomal protein2.39 S6 kinase,1.15 90kDa,2.65E-03 polypeptide 3 RGPD5 /// LOC653086 /// LOC653596 215237_at DOCK9 dedicator of cytokinesis2.85 9 1.48 2.66E-03 RMND5A 214457_at HOXA2 homeobox A2 2.38 1.72 2.68E-03 RNF24 203188_at B3GNT1 UDP-GlcNAc:betaGal9.81 beta-1,3-N-acetylglucosaminyltransferase1.21 2.70E-03 ROR1 1 202037_s_atSFRP1 secreted frizzled-related2.37 protein1.91 1 2.76E-03 RPS6KA3 202036_s_atSFRP1 secreted frizzled-related2.29 protein1.56 1 2.78E-03 RYBP 219051_x_atMETRN meteorin, glial 2.08cell differentiation1.39 regulator2.82E-03 RYR1 211554_s_atAPAF1 apoptotic peptidase2.70 activating1.44 factor2.85E-03 SATB1 204452_s_atFZD1 frizzled homolog4.40 1 (Drosophila)1.35 2.94E-03 SCO2 201711_x_atRANBP2 RAN binding protein2.64 2 1.27 2.96E-03 SCRIB 221713_s_atMAP6D1 MAP6 domain 5.40containing 11.22 /// MAP63.00E-03 domain containing 1SENP3 202602_s_atHTATSF1 HIV-1 Tat specific3.98 factor 1 1.18 3.09E-03 SFRP1 210942_s_atST3GAL6 ST3 beta-galactoside3.09 alpha-2,3-sialyltransferase1.20 3.09E-03 6 SFRS2 203627_at IGF1R Insulin-like growth2.06 factor 11.68 receptor3.11E-03 SFT2D2 206542_s_atSMARCA2 SWI/SNF related,2.06 matrix associated,1.46 3.17E-03 dependent regulatorSGK of , subfamily a, member 2 206783_at FGF4 fibroblast growth13.44 factor 4 (heparin1.36 secretory3.19E-03 transformingSIM2 protein 1, Kaposi sarcoma oncogene) 200078_s_atATP6V0B ATPase, H+ transporting,2.55 lysosomal1.11 3.20E-0321kDa, V0 subunit b ///SLC12A2 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b 206852_at EPHA7 EPH receptor A72.05 5.64 3.22E-03 SLC16A1 207592_s_atHCN2 hyperpolarization5.74 activated1.43 cyclic nucleotide-gated3.29E-03 potassiumSLC18A3 channel 2 212556_at SCRIB scribbled homolog2.89 (Drosophila)1.28 3.41E-03 SLC1A4 219218_at BAHCC1 BAH domain and6.19 coiled-coil1.29 containing3.41E-03 1 SLC25A10 38037_at HBEGF heparin-binding3.16 EGF-like growth1.43 factor3.43E-03 SLC30A4 203408_s_atSATB1 special AT-rich 2.26sequence binding1.62 protein3.45E-03 1 (binds to nuclearSLC37A1 matrix/scaffold-associating DNA's) 202625_at LYN v-yes-1 Yamaguchi3.36 sarcoma1.23 viral related3.47E-03 oncogene homologSLC9A3R1 /// v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 204036_at EDG2 endothelial differentiation,17.25 1.94 lysophosphatidic3.49E-03 acid G-protein-coupledSLK receptor, 2 210954_s_atTSC22D2 TSC22 domain 2.76family, member1.48 2 3.54E-03 SMAD6 204757_s_atTMEM24 transmembrane2.14 protein 241.44 3.57E-03 SMARCA2 219179_at DACT1 dapper, antagonist2.08 of beta-catenin,1.58 3.60E-03homolog 1 (Xenopus laevis)SMO 216016_at NLRP3 NLR family, pyrin2.02 domain containing2.31 3.63E-03 3 SOCS3 218928_s_atSLC37A1 solute carrier family4.39 37 (glycerol-3-phosphate1.36 3.67E-03 transporter),SOS2 member 1 215736_at KCNV1 potassium channel,2.15 subfamily1.44 V, member3.70E-03 1 SPINT1 218802_at CCDC109B coiled-coil domain3.31 containing1.14 109B 3.92E-03 SPTBN1 206631_at PTGER2 E7.02 receptor 21.71 (subtype3.92E-03 EP2), 53kDa SS18L1 203705_s_atFZD7 frizzled homolog2.84 7 (Drosophila)1.40 3.93E-03 SSX2IP 210508_s_atKCNQ2 potassium voltage-gated12.25 channel,1.57 KQT-like3.94E-03 subfamily, memberST3GAL6 2 204224_s_atGCH1 GTP cyclohydrolase5.00 1 (dopa-responsive1.21 3.96E-03 dystonia) TATDN2 211631_x_atB4GALT1 UDP-Gal:betaGlcNAc2.86 beta 1.251,4- galactosyltransferase,3.98E-03 polypeptideTBC1D2B 1 /// UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 205429_s_atMPP6 ,7.58 palmitoylated1.50 63.99E-03 (MAGUK p55 subfamilyTGFA member 6) 216862_s_atMTCP1 mature T-cell proliferation4.07 1.25 1 4.01E-03 TIPARP 205747_at CBLN1 cerebellin 1 precursor5.59 1.42 4.03E-03 TLE3 206875_s_atSLK STE20-like kinase3.89 (yeast) 1.33 4.05E-03 TLK2 220331_at CYP46A1 ,3.03 family 46,1.81 subfamily4.15E-03 A, polypeptide 1 TM6SF1 208158_s_atOSBPL1A oxysterol binding3.74 protein-like1.24 1A ///4.16E-03 oxysterol binding protein-likeTMCC2 1A 213140_s_atSS18L1 synovial sarcoma7.96 translocation1.20 gene4.18E-03 on -likeTMEFF1 1 213470_s_atHNRPH1 heterogeneous2.67 nuclear ribonucleoprotein1.30 4.21E-03 H1 (H) TMEM24 201844_s_atRYBP RING1 and YY12.33 binding protein1.11 4.21E-03 TRIB1 207362_at SLC30A4 solute carrier family11.19 30 (zinc1.41 transporter),4.25E-03 member 4 TRIM24 205485_at RYR1 ryanodine receptor2.10 1 (skeletal)1.23 4.44E-03 TRIM33 210212_x_atMTCP1 mature T-cell proliferation4.23 1.15 1 4.47E-03 TSC22D2 204018_x_atHBA1 /// HBA2hemoglobin, alpha2.06 1 /// hemoglobin,2.92 4.49E-03 alpha 1 /// hemoglobin,TTC9 alpha 2 /// hemoglobin, alpha 2 205016_at TGFA transforming growth6.66 factor,1.80 alpha 4.51E-03 UGT8 211186_s_atAAK1 AP2 associated9.84 kinase 1 5.05 4.65E-03 UNG2 206315_at CRLF1 -like3.40 factor1.25 1 4.78E-03 USP18 209320_at ADCY3 adenylate cyclase2.92 3 1.40 4.85E-03 USP7 201739_at SGK /glucocorticoid2.96 regulated1.21 kinase4.90E-03 VGLL3 209410_s_atGRB10 growth factor receptor-bound2.21 1.22 protein4.92E-03 10 WNT5A 213372_at PAQR3 progestin and adipoQ5.78 receptor1.44 family5.05E-03 member III YAF2 206558_at SIM2 single-minded homolog4.54 2 (Drosophila)1.24 5.08E-03 201197_at AMD1 adenosylmethionine2.50 decarboxylase1.57 5.14E-031 208522_s_atPTCH1 patched homolog5.19 1 (Drosophila)3.96 5.20E-03 216627_s_atB4GALT1 UDP-Gal:betaGlcNAc4.61 beta 1.461,4- galactosyltransferase,5.31E-03 polypeptide 1 205123_s_atTMEFF1 transmembrane2.89 protein with1.30 EGF-like5.54E-03 and two follistatin-like domains 1 212361_s_atATP2A2 ATPase, Ca++ transporting,2.96 1.10 ,5.65E-03 slow twitch 2 217986_s_atBAZ1A 3.89adjacent to 1.36zinc finger5.69E-03 domain, 1A 209382_at POLR3C polymerase (RNA)2.03 III (DNA1.18 directed)5.73E-03 polypeptide C (62kD) 214724_at DIXDC1 DIX domain containing3.18 1 1.99 5.74E-03 214854_at DOT1L DOT1-like, histone2.22 H3 methyltransferase2.70 5.77E-03 (S. cerevisiae) 218275_at SLC25A10 solute carrier family2.13 25 (mitochondrial1.19 5.85E-03 carrier; dicarboxylate transporter), member 10 205050_s_atMAPK8IP2 mitogen-activated3.79 protein1.73 kinase 8 5.98E-03interacting protein 2 219018_s_atC14ORF65 chromosome 142.17 open reading1.16 frame5.98E-03 65 212612_at RCOR1 REST corepressor3.14 1 1.24 6.16E-03 218939_at LETM1 leucine zipper-EF-hand3.22 containing1.32 transmembrane6.19E-03 protein 1 219155_at PITPNC1 phosphatidylinositol3.25 transfer1.22 protein,6.20E-03 cytoplasmic 1 205259_at NR3C2 nuclear receptor2.38 subfamily1.42 3, group6.37E-03 C, member 2 220677_s_atADAMTS8 ADAM metallopeptidase2.04 with1.70 thrombospondin6.39E-03 type 1 motif, 8 219546_at BMP2K BMP2 inducible4.74 kinase 1.24 6.44E-03 208358_s_atUGT8 UDP glycosyltransferase7.04 8 1.10(UDP-galactose6.47E-03 ceramide galactosyltransferase) 213424_at KIAA0895 KIAA0895 protein3.93 1.63 6.56E-03 211659_at GPR135 G protein-coupled8.35 receptor2.27 135 /// 6.57E-03G protein-coupled receptor 135 221078_s_atKIAA1212 KIAA1212 2.67 1.23 6.59E-03 202938_x_atCTA-126B4.3CGI-96 /// DJ222E13.2 protein 2.82/// similar to1.13 CGI-966.68E-03 213260_at FOXC1 forkhead box C13.90 1.48 6.80E-03 216932_at MVK mevalonate kinase2.15 1.81 6.84E-03 200947_s_atGLUD1 glutamate dehydrogenase5.27 1.161 6.87E-03 210683_at NRTN neurturin 2.66 1.30 6.90E-03 202934_at HK2 hexokinase 2 2.54 1.49 6.92E-03 215692_s_atMPPED2 metallophosphoesterase2.06 domain1.41 containing6.95E-03 2 220392_at EBF2 early B-cell factor15.24 2 1.25 7.05E-03 209321_s_atADCY3 adenylate cyclase3.37 3 1.16 7.10E-03 202825_at SPINT1 serine peptidase2.75 inhibitor, 1.17Kunitz type7.11E-03 1 220006_at CCDC48 coiled-coil domain2.02 containing2.27 48 7.44E-03 203716_s_atDPP4 dipeptidyl-peptidase5.77 4 (CD26,1.45 adenosine7.51E-03 deaminase complexing protein 2) 32541_at PPP3CC protein phosphatase2.02 3 (formerly1.28 2B),7.58E-03 catalytic subunit, gamma isoform (calcineurin A gamma) 215531_s_atGABRA5 ///gamma-aminobutyric LOC653222 10.72 acid 1.53(GABA) A7.70E-03 receptor, alpha 5 /// similar to Gamma-aminobutyric-acid receptor alpha-5 subunit precursor (GABA(A) receptor) 212478_at RMND5A required for meiotic2.67 nuclear1.60 division7.76E-03 5 homolog A (S. cerevisiae) 206106_at MAPK12 mitogen-activated2.22 protein1.32 kinase 127.77E-03 206359_at SOCS3 suppressor of cytokine4.97 signaling1.31 3 7.86E-03 215456_at --- Clone 24734 mRNA2.05 sequence1.76 7.96E-03 212092_at PEG10 paternally expressed2.43 10 1.29 8.17E-03 211745_x_atHBA1 hemoglobin, alpha2.78 1 /// hemoglobin,1.36 8.35E-03 alpha 1 217606_at --- MRNA; cDNA DKFZp686P241584.27 1.87 (from8.43E-03 clone DKFZp686P24158) 208479_at KCNA1 potassium voltage-gated4.69 channel,1.40 shaker-related8.46E-03 subfamily, member 1 (episodic ataxia with myokymia) 203088_at FBLN5 fibulin 5 4.87 1.24 8.60E-03 211067_s_atGAS7 growth arrest-specific2.26 7 ///1.19 growth arrest-specific8.64E-03 7 203986_at GENX-3414genethonin 1 2.94 1.47 8.68E-03 202937_x_atCTA-126B4.3CGI-96 protein2.70 1.50 8.70E-03 205204_at NMB neuromedin B 4.67 1.44 8.83E-03 213182_x_atCDKN1C cyclin-dependent3.23 kinase inhibitor1.38 1C8.84E-03 (p57, Kip2) 202235_at SLC16A1 solute carrier family9.86 16 (monocarboxylic1.24 8.85E-03 acid transporters), member 1 203365_s_atMMP15 matrix metallopeptidase11.35 151.29 (membrane-inserted)9.01E-03 216384_x_atLOC643287similar to prothymosin,2.53 alpha1.16 (gene9.02E-03 sequence 28) 203639_s_atFGFR2 fibroblast growth4.94 factor receptor1.46 2 (bacteria-expressed9.11E-03 kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) 221675_s_atCHPT1 choline phosphotransferase2.18 1.77 1 9.23E-03 218048_at COMMD3 COMM domain3.77 containing1.13 3 9.34E-03 201846_s_atRYBP RING1 and YY12.42 binding protein1.21 9.41E-03 204498_s_atADCY9 adenylate cyclase8.85 9 1.11 9.42E-03 207530_s_atCDKN2B cyclin-dependent2.67 kinase inhibitor2.54 2B9.55E-03 (p15, inhibits CDK4) 207029_at KITLG KIT 3.33 1.30 9.79E-03 218629_at SMO homolog2.39 (Drosophila)1.38 9.83E-03 203684_s_atBCL2 B-cell CLL/lymphoma4.89 2 1.37 9.84E-03

RGPD5 /// LOC653086 /// LOC653596 Table S3 FOXO-dependent targets. Induce by OHT at least 2 fold in sh-scr AND fold induction by OHT at least 1.5-fold lower in shFOXO samples than in sh-scambled.

PID Gene Symbol 201963_at ACSL1 202672_s_at ATF3 206232_s_at B4GALT6 206233_at B4GALT6 219218_at BAHCC1 205289_at BMP2 213508_at C14ORF147 213348_at CDKN1C 204039_at CEBPA 210221_at CHRNA3 203921_at CHST2 206100_at CPM 219179_at DACT1 220732_at DEPDC2 203717_at DPP4 204036_at EDG2 201694_s_at EGR1 205249_at EGR2 207767_s_at EGR4 206404_at FGF9 218881_s_at FOSL2 204132_s_at FOXO3A 219889_at FRAT1 217280_x_at GABRA5 /// LOC653222 209576_at GNAI1 209818_s_at HABP4 214414_x_at HBA2 220447_at HRH3 206924_at IL11 213280_at LOC653127 210409_at LOC653483 220254_at LRP12 210319_x_at MSX2 210249_s_at NCOA1 202340_x_at NR4A1 204621_s_at NR4A2 209959_at NR4A3 217097_s_at PHTF2 207725_at POU4F2 216347_s_at PPP1R13B 203057_s_at PRDM2 209815_at PTCH1 206574_s_at PTP4A3 211057_at ROR1 201975_at RSN 207150_at SLC18A3 207069_s_at SMAD6 215918_s_at SPTBN1 202241_at TRIB1 212436_at TRIM33 213425_at WNT5A 206238_s_at YAF2 FOXO-dependent E2F1 targets. Induce by OHT at least 2 fold in sh-scr AND fold induction by OHT at least 1.5-fold lower in shFOXO samples than in sh-scambled.

Description acyl-CoA synthetase long-chain family member 1 activating transcription factor 3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 BAH domain and coiled-coil containing 1 bone morphogenetic protein 2 147 Cyclin-dependent kinase inhibitor 1C (p57, Kip2) CCAAT/enhancer binding protein (C/EBP), alpha cholinergic receptor, nicotinic, alpha 3 carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2 carboxypeptidase M dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) DEP domain containing 2 dipeptidyl-peptidase 4 (CD26, complexing protein 2) endothelial differentiation, G-protein-coupled receptor, 2 early growth response 1 early growth response 2 (Krox-20 homolog, Drosophila) early growth response 4 9 (glia-activating factor) FOS-like antigen 2 forkhead box O3A frequently rearranged in advanced T-cell lymphomas gamma-aminobutyric acid (GABA) A receptor, alpha 5 /// similar to Gamma-aminobutyric-acid receptor alpha-5 subunit precursor (GABA(A) receptor) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 hyaluronan binding protein 4 hemoglobin, alpha 2 /// hemoglobin, alpha 2 H3 interleukin 11 similar to GTPase activating Rap/RanGAP domain-like 4 similar to myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 low density lipoprotein-related protein 12 msh homeobox homolog 2 (Drosophila) nuclear receptor 1 nuclear receptor subfamily 4, group A, member 1 nuclear receptor subfamily 4, group A, member 2 nuclear receptor subfamily 4, group A, member 3 putative homeodomain transcription factor 2 POU domain, class 4, transcription factor 2 protein 1, regulatory (inhibitor) subunit 13B PR domain containing 2, with ZNF domain patched homolog 1 (Drosophila) protein tyrosine phosphatase type IVA, member 3 -like orphan receptor 1 /// receptor tyrosine kinase-like orphan receptor 1 restin (Reed-Steinberg cell-expressed intermediate filament-associated protein) solute carrier family 18 (vesicular acetylcholine), member 3 SMAD, mothers against DPP homolog 6 (Drosophila) spectrin, beta, non-erythrocytic 1 tribbles homolog 1 (Drosophila) tripartite motif-containing 33 wingless-type MMTV integration site family, member 5A /// wingless-type MMTV integration site family, member 5A YY1 associated factor 2 FOXO-dependent E2F1 targets. Induce by OHT at least 2 fold in sh-scr AND fold induction by OHT at least 1.5-fold lower in shFOXO samples than in sh-scambled.

Unique genes ACSL1 ATF3 B4GALT6 BAHCC1 BMP2 C14ORF147 CDKN1C CEBPA CHRNA3 CHST2 CPM DACT1 DEPDC2 DPP4 EDG2 EGR1 EGR2 EGR4 FGF9 FOSL2 FOXO3A FRAT1 GABRA5 /// LOC653222 GNAI1 HABP4 HBA2 HRH3 IL11 LOC653127 LOC653483 LRP12 MSX2 NCOA1 NR4A1 NR4A2 NR4A3 PHTF2 POU4F2 PPP1R13B PRDM2 PTCH1 PTP4A3 ROR1 RSN SLC18A3 SMAD6 SPTBN1 TRIB1 TRIM33 WNT5A YAF2 Table S4. FOXO-independent E2F1 targets Induced by OHT at least 2 fold in sh-scr AND 0.90.05

Probe.Set.ID Gene Symbol 218839_at HEY1 44783_s_at HEY1 209735_at ABCG2 220680_at RAVER2 206159_at GDF10 206283_s_at TAL1 206017_at KIAA0319 215081_at KIAA1024 210404_x_at CAMK2B 206067_s_at WT1 214180_at MAN1C1 220225_at IRX4 212188_at KCTD12 219932_at SLC27A6 209946_at VEGFC 211778_s_at OVOL2 221796_at NTRK2 205906_at FOXJ1 218804_at TMEM16A 206946_at HCN4 204995_at CDK5R1 205935_at FOXF1 205841_at JAK2 205883_at ZBTB16 206565_x_at SMA3 203680_at PRKAR2B 215043_s_at SMA3 /// SMA5 212930_at ATP2B1 212915_at PDZRN3 221991_at NXPH3 220161_s_at EPB41L4B 206864_s_at HRK 216587_s_at FZD8 221523_s_at RRAGD 205034_at CCNE2 218829_s_at CHD7 207800_at AKAP5 204526_s_at TBC1D8 221086_s_at FEZF2 32137_at JAG2 213924_at MPPE1 219322_s_at WDR8 213245_at ADCY1 207291_at PRRG4 219699_at LGI2 213353_at ABCA5 213172_at TTC9 204347_at LOC645619 209570_s_at D4S234E 211814_s_at CCNE2 209441_at RHOBTB2 214071_at MPPE1 220076_at ANKH 213523_at CCNE1 222317_at PDE3B 205209_at ACVR1B 206355_at GNAL 208099_x_at TTLL5 220804_s_at TP73 216268_s_at JAG1 205501_at --- 209587_at PITX1 201902_s_at YY1 215152_at MYB 221558_s_at LEF1 221524_s_at RRAGD 209784_s_at JAG2 212810_s_at SLC1A4 219270_at CHAC1 205251_at PER2 203510_at MET 212636_at QKI 203302_at DCK 212811_x_at SLC1A4 220104_at ZC3HAV1 218128_at NFYB 210740_s_at ITPK1 209890_at TSPAN5 221935_s_at C3ORF64 210117_at SPAG1 218330_s_at NAV2 202582_s_at RANBP9 201996_s_at SPEN 208502_s_at PITX1 212538_at DOCK9 41037_at TEAD4 217481_x_at FLJ45455 221663_x_at HRH3 204178_s_at RBM14 210127_at RAB6B 221969_at --- 215517_at PYGO1 213912_at KIAA0984 221047_s_at MARK1 209099_x_at JAG1 206052_s_at SLBP 213228_at PDE8B 210829_s_at SSBP2 203641_s_at COBLL1 213920_at CUTL2 214790_at SENP6 218974_at FLJ10159 217956_s_at MASA 205874_at ITPKA 214998_at AAK1 207005_s_at BCL2 219615_s_at KCNK5 215518_at STXBP5L 210261_at KCNK2 204381_at LRP3 218236_s_at PRKD3 219400_at CNTNAP1 212297_at ATP13A3 217833_at SYNCRIP 203787_at SSBP2 216434_at FLJ20699 219463_at C20ORF103 215460_x_at BRD1 207735_at RNF125 203849_s_at KIF1A 214582_at PDE3B 202466_at POLS 50221_at TFEB 210233_at IL1RAP 211276_at TCEAL2 205604_at HOXD9 209982_s_at NRXN2 206179_s_at TPPP 216322_at CD58 212468_at SPAG9 206208_at CA4 211170_s_at PDE10A 219491_at LRFN4 205284_at KIAA0133 203274_at F8A1 202458_at PRSS23 206510_at SIX2 218127_at NFYB 220739_s_at CNNM3 218087_s_at SORBS1 220494_s_at --- 209293_x_at ID4 203908_at SLC4A4 202761_s_at SYNE2 210123_s_at CHRNA7 /// CHRFAM7A /// LOC652740 202179_at BLMH 209864_at FRAT2 219499_at SEC61A2 220364_at FLJ11235 204520_x_at BRD1 213933_at PTGER3 206511_s_at SIX2 213618_at CENTD1 214936_at LRCH1 213241_at PLXNC1 212062_at ATP9A 218929_at CARF 204457_s_at GAS1 205860_x_at FOLH1 221196_x_at BRCC3 218900_at CNNM4 219000_s_at DCC1 213355_at ST3GAL6 214723_x_at KIAA1641 204281_at TEAD4 208491_s_at PGM5 207661_s_at SH3PXD2A 202370_s_at CBFB 202410_x_at IGF2 217745_s_at NAT12 206618_at IL18R1 209834_at CHST3 209760_at KIAA0922 40284_at FOXA2 203853_s_at GAB2 219377_at FAM59A 213974_at ADAMTSL3 208978_at CRIP2 212160_at XPOT 213654_at TAF5L 203016_s_at SSX2IP 208518_s_at PER2 217426_at --- 208109_s_at C15ORF5 206615_s_at ADAM22 204184_s_at ADRBK2 218865_at MOSC1 44120_at ADCK2 201189_s_at ITPR3 213358_at KIAA0802 220940_at KIAA1641 220524_at LOC653326 219663_s_at TMEM121 203961_at NEBL 206901_at C19ORF57 31845_at ELF4 202531_at IRF1 205894_at ARSE 217437_s_at TACC1 204319_s_at RGS10 221830_at RAP2A 220702_at --- 212829_at --- 201401_s_at ADRBK1 210614_at TTPA /// LOC649495 218553_s_at KCTD15 202843_at RALBP1 202332_at CSNK1E 206048_at OVOL2 201689_s_at TPD52 203018_s_at SSX2IP 213155_at KIAA0523 214182_at ARF6 212094_at PEG10 204169_at IMPDH1 218871_x_at GALNACT-2 211483_x_at CAMK2B 214358_at ACACA 208545_x_at TAF4 221223_x_at CISH 214048_at MBD4 208226_x_at ADAM22 218899_s_at BAALC 222071_s_at SLCO4C1 213971_s_at SUZ12 /// SUZ12P 218626_at EIF4ENIF1 209767_s_at GP1BB /// SEPT5 213085_s_at WWC1 210355_at PTHLH 218878_s_at SIRT1 213092_x_at DNAJC9 204244_s_at DBF4 201242_s_at ATP1B1 209272_at NAB1 222168_at ALDH1A3 209068_at HNRPDL 217828_at SLTM 201188_s_at ITPR3 220302_at MAK 215245_x_at FMR1 213610_s_at KLHL23 203480_s_at OTUD4 214614_at HLXB9 209525_at HDGFRP3 205659_at HDAC9 220038_at SGK3 212287_at SUZ12 210567_s_at SKP2 219062_s_at ZCCHC2 201712_s_at RANBP2 205356_at USP13 214903_at --- 221976_s_at HDGFRP3 214076_at GFOD2 212690_at DDHD2 211679_x_at GABBR2 206915_at NKX2-2 219143_s_at RPP25 209517_s_at ASH2L 218284_at SMAD3 32094_at SAFB2 222235_s_at GALNACT-2 /// LOC644504 219673_at C6ORF61 203962_s_at NEBL 214989_x_at PLEKHA5 202895_s_at SIRPA 52285_f_at CEP76 213908_at WHDC1L1 /// WHDC1L2 /// LOC643458 /// LOC646456 212400_at FAM102A 217738_at PBEF1 /// LOC646309 /// RP11-92J19.4 204202_at IQCE 217826_s_at UBE2J1 222344_at C5ORF13 47083_at C7ORF26 214075_at NENF 203960_s_at C1ORF41 208591_s_at PDE3B 203884_s_at RAB11FIP2 205751_at SH3GL2 217300_at --- 205575_at C1QL1 217427_s_at HIRA 201688_s_at TPD52 203929_s_at MAPT 219387_at KIAA1212 58994_at CC2D1A 213520_at RECQL4 207073_at CDKL2 212975_at DENND3 212061_at SR140 206645_s_at NR0B1 221272_s_at C1ORF21 218404_at SNX10 215084_s_at LRRC42 201243_s_at ATP1B1 214793_at DUSP7 217823_s_at UBE2J1 220200_s_at SETD8 207332_s_at TFRC 214682_at LOC339047 206589_at GFI1 204082_at PBX3 211982_x_at XPO6 221898_at PDPN 203221_at TLE1 205414_s_at KIAA0672 205434_s_at AAK1 204512_at HIVEP1 205111_s_at PLCE1 217024_x_at SIRPA 204554_at PPP1R3D 213272_s_at LOC57146 201414_s_at NAP1L4 201310_s_at C5ORF13 201901_s_at YY1 200762_at DPYSL2 208237_x_at ADAM22 209067_s_at HNRPDL 212193_s_at LARP1 216870_x_at DLEU2 201845_s_at RYBP 213183_s_at CDKN1C 219573_at LRRC16 215947_s_at FLJ14668 209123_at QDPR 220842_at AHI1 202409_at IGF2 202080_s_at TRAK1 203940_s_at VASH1 218819_at INTS6 203230_at DVL1 202192_s_at GAS7 208673_s_at SFRS3 219582_at OGFRL1 201690_s_at TPD52 205449_at SAC3D1 219313_at GRAMD1C 202506_at SSFA2 207511_s_at C2ORF24 200911_s_at TACC1 201424_s_at CUL4A 205225_at ESR1 204106_at TESK1 213686_at VPS13A 213088_s_at DNAJC9 212138_at SCC-112 219731_at FLJ34077 214543_x_at QKI 202304_at FNDC3A 203344_s_at RBBP8 202842_s_at DNAJB9 213792_s_at --- 216026_s_at POLE 205100_at GFPT2 213017_at ABHD3 207984_s_at MPP2 204678_s_at KCNK1 206710_s_at EPB41L3 212910_at THAP11 212140_at SCC-112 34726_at CACNB3 220955_x_at RAB23 221561_at SOAT1 208251_at KCNC4 201678_s_at C3ORF37 201309_x_at C5ORF13 222212_s_at LASS2 203130_s_at KIF5C 47560_at LPHN1 203870_at USP46 221244_s_at --- 205880_at PRKD1 216161_at SBNO1 205809_s_at WASL 202890_at NIT1 214162_at LOC284244 219247_s_at ZDHHC14 203659_s_at TRIM13 208623_s_at VIL2 208315_x_at TRAF3 208190_s_at LSR 218068_s_at ZNF672 202968_s_at DYRK2 213983_s_at SCC-112 204679_at KCNK1 210036_s_at KCNH2 213135_at TIAM1 203955_at KIAA0649 219311_at CEP76 213582_at ATP11A 216999_at EPOR 218772_x_at TMEM38B 217253_at --- 212448_at NEDD4L 209711_at SLC35D1 211776_s_at EPB41L3 201135_at ECHS1 205112_at PLCE1 200593_s_at HNRPU 207693_at CACNB4 206470_at PLXNC1 221014_s_at RAB33B 222291_at --- 204762_s_at GNAO1 208691_at TFRC 206698_at XK 214036_at --- 206091_at MATN3 218126_at FAM82C 203129_s_at KIF5C 202880_s_at --- 204742_s_at APRIN 204481_at BRPF1 209409_at GRB10 217905_at C10ORF119 222015_at CSNK1E 212828_at SYNJ2 206204_at GRB14 210103_s_at FOXA2 208218_s_at ACVR1B 221646_s_at ZDHHC11 204763_s_at GNAO1 211467_s_at NFIB 217257_at --- 203490_at ELF4 200790_at ODC1 201129_at SFRS7 212339_at EPB41L1 201423_s_at CUL4A 203017_s_at SSX2IP 214766_s_at AHCTF1 217825_s_at UBE2J1 200874_s_at NOL5A 209205_s_at LMO4 212235_at PLXND1 211005_at LAT 218459_at TOR3A 214000_s_at RGS10 200875_s_at NOL5A 222239_s_at INTS6 209983_s_at NRXN2 203580_s_at SLC7A6 203806_s_at FANCA 200047_s_at YY1 219229_at SLCO3A1 212357_at KIAA0280 205227_at IL1RAP 217739_s_at PBEF1 /// LOC646309 /// RP11-92J19.4 202254_at SIPA1L1 203284_s_at HS2ST1 218683_at PTBP2 214125_s_at NENF 203626_s_at SKP2 213695_at PON3 203883_s_at RAB11FIP2 201993_x_at HNRPDL 204188_s_at RARG 222164_at FGFR1 212712_at CAMSAP1 200768_s_at MAT2A 220116_at KCNN2 215286_s_at PHTF2 218724_s_at TGIF2 201218_at CTBP2 /// LOC645291 /// LOC645508 /// LOC650999 208252_s_at CHST3 210447_at GLUD2 218627_at DRAM 210835_s_at CTBP2 208621_s_at VIL2 221455_s_at WNT3 217899_at FLJ20254 207004_at BCL2 203299_s_at AP1S2 /// LOC653653 /// LOC654127 217777_s_at PTPLAD1 208328_s_at MEF2A 212765_at CAMSAP1L1 212897_at CDC2L6 221579_s_at NUDT3 217812_at YTHDF2 40687_at GJA4 218429_s_at FLJ11286 217234_s_at VIL2 203120_at TP53BP2 200671_s_at SPTBN1 219864_s_at DSCR1L2 209454_s_at TEAD3 209677_at PRKCI 202191_s_at GAS7 202722_s_at GFPT1 219882_at TTLL7 203744_at HMGB3 205333_s_at RCE1 214772_at C11ORF41 217596_at UPF3A 202762_at ROCK2 219145_at LPHN1 Table S4. FOXO-independent E2F1 targets Induced by OHT at least 2 fold in sh-scr AND 0.90.05

Gene Title hairy/enhancer-of-split related with YRPW motif 1 hairy/enhancer-of-split related with YRPW motif 1 ATP-binding cassette, sub-family G (WHITE), member 2 ribonucleoprotein, PTB-binding 2 growth differentiation factor 10 T-cell acute lymphocytic leukemia 1 KIAA0319 KIAA1024 protein /calmodulin-dependent (CaM kinase) II beta Wilms tumor 1 mannosidase, alpha, class 1C, member 1 iroquois homeobox protein 4 potassium channel tetramerisation domain containing 12 /// potassium channel tetramerisation domain containing 12 solute carrier family 27 ( transporter), member 6 vascular endothelial growth factor C ovo-like 2 (Drosophila) /// ovo-like 2 (Drosophila) neurotrophic tyrosine kinase, receptor, type 2 forkhead box J1 transmembrane protein 16A hyperpolarization activated cyclic nucleotide-gated potassium channel 4 cyclin-dependent kinase 5, regulatory subunit 1 (p35) forkhead box F1 Janus kinase 2 (a protein tyrosine kinase) finger and BTB domain containing 16 SMA3 protein kinase, cAMP-dependent, regulatory, type II, beta SMA3 /// SMA5 ATPase, Ca++ transporting, plasma membrane 1 PDZ domain containing RING finger 3 neurexophilin 3 /// neurexophilin 3 erythrocyte membrane protein band 4.1 like 4B harakiri, BCL2 interacting protein (contains only BH3 domain) frizzled homolog 8 (Drosophila) Ras-related GTP binding D cyclin E2 chromodomain DNA binding protein 7 A kinase (PRKA) anchor protein 5 TBC1 domain family, member 8 (with GRAM domain) FEZ family 2 jagged 2 Metallophosphoesterase 1 WD repeat domain 8 adenylate cyclase 1 (brain) proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) leucine-rich repeat LGI family, member 2 ATP-binding cassette, sub-family A (ABC1), member 5 tetratricopeptide repeat domain 9 similar to Adenylate kinase isoenzyme 4, mitochondrial (ATP-AMP transphosphorylase) DNA segment on (unique) 234 expressed sequence cyclin E2 Rho-related BTB domain containing 2 Metallophosphoesterase 1 ankylosis, progressive homolog (mouse) cyclin E1 3B, cGMP-inhibited activin A receptor, type IB guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type tyrosine ligase-like family, member 5 /// tubulin tyrosine ligase-like family, member 5 tumor protein p73 jagged 1 (Alagille syndrome) CDNA FLJ25677 fis, clone TST04054 paired-like homeodomain transcription factor 1 YY1 transcription factor v-myb myeloblastosis viral oncogene homolog (avian) lymphoid enhancer-binding factor 1 Ras-related GTP binding D jagged 2 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 ChaC, cation transport regulator-like 1 (E. coli) period homolog 2 (Drosophila) met proto-oncogene (hepatocyte growth factor receptor) quaking homolog, KH domain RNA binding (mouse) deoxycytidine kinase solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 zinc finger CCCH-type, antiviral 1 nuclear transcription factor Y, beta inositol 1,3,4-triphosphate 5/6 kinase tetraspanin 5 /// tetraspanin 5 open reading frame 64 sperm associated antigen 1 navigator 2 RAN binding protein 9 spen homolog, transcriptional regulator (Drosophila) paired-like homeodomain transcription factor 1 dedicator of cytokinesis 9 TEA domain family member 4 FLJ45455 protein histamine receptor H3 RNA binding motif protein 14 RAB6B, member RAS oncogene family --- pygopus homolog 1 (Drosophila) KIAA0984 protein MAP/microtubule affinity-regulating kinase 1 jagged 1 (Alagille syndrome) stem-loop () binding protein phosphodiesterase 8B single-stranded DNA binding protein 2 COBL-like 1 cut-like 2 (Drosophila) SUMO1/sentrin specific peptidase 6 hypothetical protein FLJ10159 E-1 enzyme inositol 1,4,5-trisphosphate 3-kinase A AP2 associated kinase 1 B-cell CLL/ 2 potassium channel, subfamily K, member 5 syntaxin binding protein 5-like potassium channel, subfamily K, member 2 low density lipoprotein receptor-related protein 3 protein kinase D3 contactin associated protein 1 ATPase type 13A3 synaptotagmin binding, cytoplasmic RNA interacting protein single-stranded DNA binding protein 2 Hypothetical protein FLJ20699 open reading frame 103 bromodomain containing 1 ring finger protein 125 family member 1A phosphodiesterase 3B, cGMP-inhibited polymerase (DNA directed) sigma transcription factor EB interleukin 1 receptor accessory protein transcription A (SII)-like 2 homeobox D9 neurexin 2 brain-specific protein p25 alpha CD58 molecule sperm associated antigen 9 carbonic anhydrase IV phosphodiesterase 10A leucine rich repeat and fibronectin type III domain containing 4 KIAA0133 coagulation factor VIII-associated (intronic transcript) 1 protease, serine, 23 sine oculis homeobox homolog 2 (Drosophila) nuclear transcription factor Y, beta cyclin M3 sorbin and SH3 domain containing 1 --- inhibitor of DNA binding 4, dominant negative helix-loop-helix protein solute carrier family 4, sodium cotransporter, member 4 spectrin repeat containing, nuclear envelope 2 cholinergic receptor, nicotinic, alpha 7 /// CHRNA7 (cholinergic receptor, nicotinic, alpha 7, 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion /// similar to CHRNA7-FAM7A fusion isoform 1 frequently rearranged in advanced T-cell lymphomas 2 Sec61 alpha 2 subunit (S. cerevisiae) hypothetical protein FLJ11235 bromodomain containing 1 prostaglandin E receptor 3 (subtype EP3) sine oculis homeobox homolog 2 (Drosophila) centaurin, delta 1 Leucine-rich repeats and calponin homology (CH) domain containing 1 plexin C1 ATPase, Class II, type 9A collaborates/cooperates with ARF (alternate reading frame) protein growth arrest-specific 1 hydrolase (prostate-specific membrane antigen) 1 BRCA1/BRCA2-containing complex, subunit 3 cyclin M4 defective in sister chromatid cohesion homolog 1 (S. cerevisiae) ST3 beta-galactoside alpha-2,3-sialyltransferase 6 KIAA1641 TEA domain family member 4 phosphoglucomutase 5 SH3 and PX domains 2A core-binding factor, beta subunit insulin-like growth factor 2 (somatomedin A) N-acetyltransferase 12 interleukin 18 receptor 1 carbohydrate (chondroitin 6) sulfotransferase 3 KIAA0922 forkhead box A2 GRB2-associated binding protein 2 family with sequence similarity 59, member A ADAMTS-like 3 cysteine-rich protein 2 exportin, tRNA (nuclear export receptor for tRNAs) TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa synovial sarcoma, X breakpoint 2 interacting protein period homolog 2 (Drosophila) --- open reading frame 5 /// chromosome 15 open reading frame 5 ADAM metallopeptidase domain 22 adrenergic, beta, receptor kinase 2 MOCO sulphurase C-terminal domain containing 1 aarF domain containing kinase 2 inositol 1,4,5-triphosphate receptor, type 3 KIAA0802 KIAA1641 similar to erythrocyte membrane protein band 4.1 like 4B transmembrane protein 121 nebulette open reading frame 57 E74-like factor 4 (ets domain transcription factor) interferon regulatory factor 1 E (chondrodysplasia punctata 1) transforming, acidic coiled-coil containing protein 1 regulator of G-protein signalling 10 RAP2A, member of RAS oncogene family --- CDNA FLJ13267 fis, clone OVARC1000964 /// CDNA FLJ13267 fis, clone OVARC1000964 adrenergic, beta, receptor kinase 1 tocopherol (alpha) transfer protein (ataxia (Friedreich-like) with E deficiency) /// similar to Alpha-tocopherol transfer protein (Alpha-TTP) potassium channel tetramerisation domain containing 15 ralA binding protein 1 , epsilon ovo-like 2 (Drosophila) tumor protein D52 synovial sarcoma, X breakpoint 2 interacting protein KIAA0523 protein ADP-ribosylation factor 6 paternally expressed 10 IMP (inosine monophosphate) dehydrogenase 1 chondroitin sulfate GalNAcT-2 calcium/calmodulin-dependent protein kinase (CaM kinase) II beta acetyl-Coenzyme A carboxylase alpha TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa cytokine inducible SH2-containing protein methyl-CpG binding domain protein 4 ADAM metallopeptidase domain 22 brain and acute leukemia, cytoplasmic solute carrier organic anion transporter family, member 4C1 suppressor of zeste 12 homolog (Drosophila) /// suppressor of zeste 12 homolog pseudogene eukaryotic translation initiation factor 4E nuclear import factor 1 (platelet), beta polypeptide /// septin 5 WW, C2 and coiled-coil domain containing 1 parathyroid hormone-like hormone (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) DnaJ (Hsp40) homolog, subfamily C, member 9 DBF4 homolog (S. cerevisiae) ATPase, Na+/K+ transporting, beta 1 polypeptide NGFI-A binding protein 1 (EGR1 binding protein 1) Aldehyde dehydrogenase 1 family, member A3 heterogeneous nuclear ribonucleoprotein D-like SAFB-like, transcription modulator inositol 1,4,5-triphosphate receptor, type 3 male germ cell-associated kinase fragile X mental retardation 1 kelch-like 23 (Drosophila) OTU domain containing 4 homeobox HB9 Hepatoma-derived growth factor, related protein 3 /// Hepatoma-derived growth factor, related protein 3 9 serum/ regulated kinase family, member 3 suppressor of zeste 12 homolog (Drosophila) S-phase kinase-associated protein 2 (p45) zinc finger, CCHC domain containing 2 RAN binding protein 2 ubiquitin specific peptidase 13 (isopeptidase T-3) CDNA FLJ42519 fis, clone BRACE3000787 Hepatoma-derived growth factor, related protein 3 Glucose-fructose oxidoreductase domain containing 2 DDHD domain containing 2 gamma-aminobutyric acid (GABA) B receptor, 2 /// gamma-aminobutyric acid (GABA) B receptor, 2 NK2 transcription factor related, locus 2 (Drosophila) P 25kDa subunit ash2 (absent, small, or homeotic)-like (Drosophila) SMAD, mothers against DPP homolog 3 (Drosophila) scaffold attachment factor B2 chondroitin sulfate GalNAcT-2 /// similar to chondroitin beta1,4 N-acetylgalactosaminyltransferase 2 open reading frame 61 nebulette Pleckstrin homology domain containing, family A member 5 signal-regulatory protein alpha centrosomal protein 76kDa WAS protein homology region 2 domain containing 1-like 1 /// WAS protein homology region 2 domain containing 1-like 2 /// similar to junction-mediating and regulatory protein /// similar to junction-mediating and regulatory protein family with sequence similarity 102, member A pre-B-cell colony enhancing factor 1 /// similar to Nicotinamide phosphoribosyltransferase (NAmPRTase) (Nampt) (Pre- enhancing factor) (Pre-B-cell colony-enhancing factor 1) /// pre-B cell enhancing factor 1 pseudogene IQ motif containing E ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) open reading frame 13 open reading frame 26 neuron derived neurotrophic factor open reading frame 41 phosphodiesterase 3B, cGMP-inhibited RAB11 family interacting protein 2 (class I) SH3-domain GRB2-like 2 --- complement component 1, q subcomponent-like 1 HIR histone regulation defective homolog A (S. cerevisiae) tumor protein D52 microtubule-associated protein tau KIAA1212 coiled-coil and containing 1A RecQ protein-like 4 cyclin-dependent kinase-like 2 (CDC2-related kinase) DENN/MADD domain containing 3 U2-associated SR140 protein nuclear receptor subfamily 0, group B, member 1 chromosome 1 open reading frame 21 /// chromosome 1 open reading frame 21 sorting nexin 10 leucine rich repeat containing 42 ATPase, Na+/K+ transporting, beta 1 polypeptide dual specificity phosphatase 7 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) SET domain containing (lysine methyltransferase) 8 receptor (p90, CD71) hypothetical protein LOC339047 growth factor independent 1 pre-B-cell leukemia transcription factor 3 exportin 6 podoplanin transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) KIAA0672 gene product AP2 associated kinase 1 immunodeficiency virus type I enhancer binding protein 1 C, epsilon 1 signal-regulatory protein alpha 1, regulatory subunit 3D promethin assembly protein 1-like 4 chromosome 5 open reading frame 13 YY1 transcription factor -like 2 ADAM metallopeptidase domain 22 heterogeneous nuclear ribonucleoprotein D-like La ribonucleoprotein domain family, member 1 deleted in lymphocytic leukemia, 2 RING1 and YY1 binding protein Cyclin-dependent kinase inhibitor 1C (p57, Kip2) leucine rich repeat containing 16 hypothetical protein FLJ14668 quinoid dihydropteridine reductase Abelson helper integration site 1 insulin-like growth factor 2 (somatomedin A) trafficking protein, kinesin binding 1 vasohibin 1 integrator complex subunit 6 dishevelled, dsh homolog 1 (Drosophila) growth arrest-specific 7 splicing factor, arginine/serine-rich 3 opioid growth factor receptor-like 1 tumor protein D52 SAC3 domain containing 1 GRAM domain containing 1C sperm specific antigen 2 open reading frame 24 transforming, acidic coiled-coil containing protein 1 cullin 4A 1 testis-specific kinase 1 Vacuolar protein sorting 13 homolog A (S. cerevisiae) DnaJ (Hsp40) homolog, subfamily C, member 9 SCC-112 protein weakly similar to zinc finger protein 195 quaking homolog, KH domain RNA binding (mouse) fibronectin type III domain containing 3A retinoblastoma binding protein 8 DnaJ (Hsp40) homolog, subfamily B, member 9 --- polymerase (DNA directed), epsilon glutamine-fructose-6- transaminase 2 abhydrolase domain containing 3 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) potassium channel, subfamily K, member 1 erythrocyte membrane protein band 4.1-like 3 THAP domain containing 11 SCC-112 protein calcium channel, voltage-dependent, beta 3 subunit RAB23, member RAS oncogene family sterol O-acyltransferase (acyl-Coenzyme A: acyltransferase) 1 potassium voltage-gated channel, Shaw-related subfamily, member 4 chromosome 3 open reading frame 37 chromosome 5 open reading frame 13 LAG1 longevity assurance homolog 2 (S. cerevisiae) kinesin family member 5C 1 ubiquitin specific peptidase 46 --- protein kinase D1 Sno, strawberry notch homolog 1 (Drosophila) Wiskott-Aldrich syndrome-like 1 hypothetical protein LOC284244 zinc finger, DHHC-type containing 14 tripartite motif-containing 13 villin 2 (ezrin) TNF receptor-associated factor 3 lipolysis stimulated lipoprotein receptor zinc finger protein 672 dual-specificity tyrosine-(Y)- regulated kinase 2 SCC-112 protein potassium channel, subfamily K, member 1 potassium voltage-gated channel, subfamily H (eag-related), member 2 T-cell lymphoma invasion and 1 KIAA0649 centrosomal protein 76kDa ATPase, Class VI, type 11A receptor transmembrane protein 38B (clone B3B3E13) Huntington's disease candidate region mRNA fragment neural precursor cell expressed, developmentally down-regulated 4-like solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 erythrocyte membrane protein band 4.1-like 3 /// erythrocyte membrane protein band 4.1-like 3 enoyl Coenzyme A hydratase, short chain, 1, mitochondrial , epsilon 1 heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) calcium channel, voltage-dependent, beta 4 subunit plexin C1 RAB33B, member RAS oncogene family /// RAB33B, member RAS oncogene family --- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (p90, CD71) /// transferrin receptor (p90, CD71) X-linked Kx blood group (McLeod syndrome) --- matrilin 3 family with sequence similarity 82, member C kinesin family member 5C --- androgen-induced proliferation inhibitor bromodomain and PHD finger containing, 1 growth factor receptor-bound protein 10 open reading frame 119 Casein kinase 1, epsilon 2 growth factor receptor-bound protein 14 forkhead box A2 activin A receptor, type IB zinc finger, DHHC-type containing 11 guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O nuclear factor I/B (clone B3B3E13) Huntington's disease candidate region mRNA fragment E74-like factor 4 (ets domain transcription factor) ornithine decarboxylase 1 splicing factor, arginine/serine-rich 7, 35kDa erythrocyte membrane protein band 4.1-like 1 cullin 4A synovial sarcoma, X breakpoint 2 interacting protein AT hook containing transcription factor 1 ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) nucleolar protein 5A (56kDa with KKE/D repeat) LIM domain only 4 plexin D1 linker for activation of T cells torsin family 3, member A Regulator of G-protein signalling 10 nucleolar protein 5A (56kDa with KKE/D repeat) integrator complex subunit 6 neurexin 2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Fanconi anemia, complementation group A /// Fanconi anemia, complementation group A YY1 transcription factor /// YY1 transcription factor solute carrier organic anion transporter family, member 3A1 KIAA0280 interleukin 1 receptor accessory protein pre-B-cell colony enhancing factor 1 /// similar to Nicotinamide phosphoribosyltransferase (NAmPRTase) (Nampt) (Pre-B cell enhancing factor) (Pre-B-cell colony-enhancing factor 1) /// pre-B cell enhancing factor 1 pseudogene Signal-induced proliferation-associated 1 like 1 heparan sulfate 2-O-sulfotransferase 1 polypyrimidine tract binding protein 2 Neuron derived neurotrophic factor S-phase kinase-associated protein 2 (p45) 3 RAB11 family interacting protein 2 (class I) heterogeneous nuclear ribonucleoprotein D-like retinoic acid receptor, gamma fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) calmodulin regulated spectrin-associated protein 1 methionine adenosyltransferase II, alpha potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 putative homeodomain transcription factor 2 TGFB-induced factor 2 (TALE family homeobox) C-terminal binding protein 2 /// similar to C-terminal binding protein 2 /// similar to C-terminal binding protein 2 /// similar to C-terminal binding protein 2 carbohydrate (chondroitin 6) sulfotransferase 3 glutamate dehydrogenase 2 - C-terminal binding protein 2 villin 2 (ezrin) wingless-type MMTV integration site family, member 3 /// wingless-type MMTV integration site family, member 3 Hypothetical protein FLJ20254 B-cell CLL/lymphoma 2 adaptor-related protein complex 1, sigma 2 subunit /// similar to adaptor-related protein complex 1 sigma 2 subunit /// similar to adaptor-related protein complex 1 sigma 2 subunit protein tyrosine phosphatase-like A domain containing 1 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A) calmodulin regulated spectrin-associated protein 1-like 1 cell division cycle 2-like 6 (CDK8-like) nudix (nucleoside diphosphate linked moiety X)-type motif 3 YTH domain family, member 2 gap junction protein, alpha 4, 37kDa (connexin 37) hypothetical protein FLJ11286 villin 2 (ezrin) tumor protein binding protein, 2 spectrin, beta, non-erythrocytic 1 critical region gene 1-like 2 TEA domain family member 3 protein kinase C, iota growth arrest-specific 7 glutamine-fructose-6-phosphate transaminase 1 tubulin tyrosine ligase-like family, member 7 high-mobility group box 3 RCE1 homolog, prenyl protein peptidase (S. cerevisiae) open reading frame 41 UPF3 regulator of nonsense transcripts homolog A (yeast) Rho-associated, coiled-coil containing protein kinase 2 potassium channel tetramerisation domain containing 12 /// potassium channel tetramerisation domain containing 12

cholinergic receptor, nicotinic, alpha 7 /// CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion /// similar to CHRNA7-FAM7A fusion isoform 1 tocopherol (alpha) transfer protein (ataxia (Friedreich-like) with deficiency) /// similar to Alpha-tocopherol transfer protein (Alpha-TTP) WAS protein homology region 2 domain containing 1-like 1 /// WAS protein homology region 2 domain containing 1-like 2 /// similar to junction-mediating and regulatory protein /// similar to junction-mediating and regulatory protein pre-B-cell colony enhancing factor 1 /// similar to Nicotinamide phosphoribosyltransferase (NAmPRTase) (Nampt) (Pre-B cell enhancing factor) (Pre-B-cell colony-enhancing factor 1) /// pre-B cell enhancing factor 1 pseudogene

pre-B-cell colony enhancing factor 1 /// similar to Nicotinamide phosphoribosyltransferase (NAmPRTase) (Nampt) (Pre-B cell enhancing factor) (Pre-B-cell colony-enhancing factor 1) /// pre-B cell enhancing factor 1 pseudogene

C-terminal binding protein 2 /// similar to C-terminal binding protein 2 /// similar to C-terminal binding protein 2 /// similar to C-terminal binding protein 2 wingless-type MMTV integration site family, member 3 /// wingless-type MMTV integration site family, member 3 adaptor-related protein complex 1, sigma 2 subunit /// similar to adaptor-related protein complex 1 sigma 2 subunit /// similar to adaptor-related protein complex 1 sigma 2 subunit

WAS protein homology region 2 domain containing 1-like 1 /// WAS protein homology region 2 domain containing 1-like 2 /// similar to junction-mediating and regulatory protein /// similar to junction-mediating and regulatory protein Table S5. Summary of normal vs tumor analysis

Dataset Tissue N normal N tumor paired pvalue pvalue delta Meansdelta Means FOXO-E2F1FOXO indep. E2F1FOXO/E2F1FOXO-indep E2F1 GSE15852 breast 43 43 yes p<0.0001 p=0.1 0.2382 0.01878 GSE10780 breast 143 42 no p<0.0001 p<0.0001 0.5427 0.10101 GSE8671 colon 32 32 yes p<0.0001 p<0.0001 0.2422 0.176 GSE32323 colon 17 17 yes p=0.0009 p=0.29 0.4081 0.05746 GSE29721 liver 11 11 yes p=0.0045 p=0.52 0.3582 0.03621 GSE21122 sarcoma 9 149 no p<0.0001 p=0.65 0.042874 1.44E-03

Paired Wilcoxon test p=0.03 Tablet S6. Results of Connectivity Map query with FOXO-dependent E2F1 signature Only results with p<0.01 and positive enrichment score (signature inducers) are shown

cmap name and cell line mean n enrichment 1 trichostatin A - PC3 0.663 55 0.732 2 vorinostat - PC3 0.888 2 0.992 4 vorinostat - HL60 0.703 3 0.937 5 scriptaid - PC3 0.818 2 0.985 6 - MCF7 0.447 13 0.542 10 vorinostat - MCF7 0.482 7 0.666 13 sulconazole - MCF7 0.686 2 0.953 14 LY-294002 - PC3 0.365 12 0.48 16 sirolimus - HL60 0.362 10 0.512 21 miconazole - MCF7 0.674 2 0.932 23 prochlorperazine - HL60 0.606 4 0.738 rank rank determined by the permutaion p-value of the enrichment score cmap name and cell line drug and cell line names mean arithmetic mean of the connectivity scores for each drug-cell line pair instances n number of instances (treatment and control experimental pairs for the given drug-cell line combination) enrichment measure of the enrichment of instances (treatment and control experimental pairs for the given drug-cell line combination) in the ordered list of all instances p permutation p-value for the enrichment score specificity estimate of the uniqueness of the connectivity between a set of instances and a signature of interest based upon the behavior of that set of instances in a large number of results produced from a collection of diverse signatures. percent non-null percentage of experiments that showed signature upregulation for a given drug-cell line pair p specificitypercent non-null 0 0.1067 87 0.00004 0.009 100 0.00042 0.1397 100 0.00044 0 100 0.0005 0.1018 76 0.0013 0.4593 85 0.00392 0.051 100 0.00501 0.2308 66 0.00594 0.0486 70 0.00867 0.0255 100 0.00927 0.005 100

arithmetic mean of the connectivity scores for each drug-cell line pair instances number of instances (treatment and control experimental pairs for the given drug-cell line combination) measure of the enrichment of instances (treatment and control experimental pairs for the given drug-cell line combination) in the ordered list of all instances estimate of the uniqueness of the connectivity between a set of instances and a signature of interest based upon the behavior of that set of instances in a large number of results produced from a collection of diverse signatures. percentage of experiments that showed signature upregulation for a given drug-cell line pair estimate of the uniqueness of the connectivity between a set of instances and a signature of interest based upon the behavior of that set of instances in a large number of results produced from a collection of diverse signatures. Table S7 Oligonucleotides and shRNA used in this study

Real time RT-PCR primers APAF1-f AGCCCACTCAACAGCAAAGAGCA APAF1-r CCTTACACTGGAAGAAGAGACAACAGG CDKN1C-f CAGGAGCCTCTCGCTGAC CDKN1C-r TGGCGAAGAAATCGGAGAT DIXDC1-f CGTCTGGATCAGAGTATGGAGG DIXDC1-r GCTGAAGAACAGATGTGTCCTGC EGR1-f TTTGCCAGGAGCGATGAAC EGR1-r CCGAAGAGGCCACAACACTT EGR2-f TGGGATATGGGAGATCCAAC EGR2-r GGTGACCATCTTTCCCAATG EGR4-F CCAGCTCAAGAAGTCGCC EGR4-R GTCCACTGAAGGCTGTTGC FOXO1-f CTACGAGTGGATGGTCAAGAGC FOXO1-r CCAGTTCCTTCATTCTGCACACG FOXO3-f TCTACGAGTGGATGGTGCGTTG FOXO3-r CTCTTGCCAGTTCCCTCATTCTG FZD10-f CAACCAAGAAAAGCACCACA FZD10-r TATGAGATCCCTGCCCAGTC GAPDH-f ACCCACTCCTCCACCTTTGA GAPDH-r CTGTTGCTGTAGCCAAATTCGT MAP3K1-f CATCGATCCCTTCACATTTGTCT MAP3K1-r GGTCTGTCCTGAGGTTGAAGTTCT RRM2-f GATTACAGAAGCCCGCTGTTTC RRM2-r ATGTTTTCCATGGCAATTTGG SFRP1-f CAATGCCACCGAAGCCTCCAAG SFRP1-r CAAACTCGCTGGCACAGAGATG WNT4 r CTCGTCTTCGCCGTCTTCT WNT4-f AGTTTCTCGCACGTCTCCTC WNT5A-f TACGAGAGTGCTCGCATCCTCA WNT5A-r TGTCTTCAGGCTACATGAGCCG Real time ChIP primers Catalog number APAF1 mix Epitect (Qiagen) 334001 GPH1003351(-)01A EGR1 mix Epitect (Qiagen) 334001 GPH1010751(-)01A IGX1A mix Epitect (Qiagen) 334001 GPH100001C(-)01A pMCM4-f CCGAGCGAGGCCTACTTCT pMCM4-r GGACAGTGCCGCTTCTTCA

APAF1 FOXO site mutagenesis primers pAPAF1-mut-for GGGGCTTGGGGTGTGTGGAGTTGCATAAGCGGGCGC pAPAF1-mut-rev GCGCCCGCTTATGCAACTCCACACACCCCAAGCCCC pLKO shRNA Catalog number FOXO707 TRCN0000020707 (Open Biosystems) FOXO33 TRCN0000010333 (Open Biosystems) scrambled plasmid 1864 (Addgene) siRNA Sense sequence or catalog number APAF1-1 GAGCAGCUAUGCUGAUUAAdTdT APAF1-2 AAUUGGUGCACUUUUACGUGAdTdT FOXO1 SI02781415 Qiagen FOXO3 GAGCUCUUGGUGGAUCAUCdTdT control 1027281 Qiagen