DOCSLIB.ORG

Supplemental File 1, DG2 Sirna Results.Xlsx

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental File 1, DG2 Sirna Results.Xlsx Supplemental Table 1: Results of primary druggable genome v2 (DG2) Achilles heel siRNA screen in KMS11 multiple myeloma cells. Results are provided per siRNA as a B-score centered on the median and normalized to the standard deviation. All statistically validated vulnerable genes are listed in Table 1 in the paper; siRNA against other genes are unverified for sensitivity/specificity (individual siRNA results may be inaccurate and should be examined within a robust statistical framework). Entrez siRNA Gene SYMBOL Description B_Score Target Sequence Vendor target annotation Top refseq hit 1 A1BG alpha-1-B glycoprotein 0.02 CAGAAGATGCGTATCAGTATT NM_130786: NM_130786: 1 A1BG alpha-1-B glycoprotein -1.38 CTGCGTCTACGTGGACCTGAA NM_130786: NM_130786: 2 A2M alpha-2-macroglobulin -4.22 ACGGATGAGCATGGCCTTGTA NM_000014: NM_000014: 2 A2M alpha-2-macroglobulin 0.20 CACCAACTCAAAGATTCGTAA NM_000014: NM_000014: 53947 A4GALT alpha 1,4-galactosyltransferase (globotriaosylceramide synthase) 0.85 AGGAGAATAATCAATAGAATA NM_017436: NM_017436: 53947 A4GALT alpha 1,4-galactosyltransferase (globotriaosylceramide synthase) 1.32 CACGTGCTGGTCCTGATGAAA NM_017436: NM_017436: 13 AADAC arylacetamide deacetylase (esterase) 0.67 TTGGCTGATGACAACAAATTA NM_001086: NM_001086: 13 AADAC arylacetamide deacetylase (esterase) 1.06 CAGCCTCTTGATGTAGATTTA NM_001086: NM_001086: 22848 AAK1 AP2 associated kinase 1 -1.50 AACGTGAGTAGCGGTGATGTA NM_014911: NM_014911: 22848 AAK1 AP2 associated kinase 1 0.53 CCAGGTGGTAAACCTGATGAA NM_014911: NM_014911: 10157 AASS aminoadipate-semialdehyde synthase 0.51 AACGATTGATCTTGTGGCTTA NM_005763: NM_005763: 10157 AASS aminoadipate-semialdehyde synthase 0.50 AACGGTACATTACCTGATAAA NM_005763: NM_005763: 26574 AATF apoptosis antagonizing transcription factor 0.07 TCGAGAACTCATAGAACGGAA NM_012138: NM_012138: 26574 AATF apoptosis antagonizing transcription factor -0.58 TTGGAAGGAAGGATCAAACTA NM_012138: NM_012138: AB095936 1.11 TCCGGGTGATTCACTATAGAA AB095936 No hits found till 3 mismatches 18 ABAT 4-aminobutyrate aminotransferase 0.59 TCCCGATGATTCCATACGGAA NM_000663: NM_020686:NM_000663: 18 ABAT 4-aminobutyrate aminotransferase -1.10 CACGCACTCTAAAGCCATTCA NM_000663: NM_020686:NM_000663: 19 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 -2.65 CCGGAACATGCTACAATACCA NM_005502: NM_005502: 19 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 0.29 CACCGACAATAAGCTGAATAA NM_005502: NM_005502: 10349 ABCA10 ATP-binding cassette, sub-family A (ABC1), member 10 0.63 AAAGAGATAAGCGTGCGTCAA NM_080282: NM_080282: 10349 ABCA10 ATP-binding cassette, sub-family A (ABC1), member 10 0.61 CAGCCTGTTAATCGTTAATAA NM_080282: NM_080282: 26154 ABCA12 ATP-binding cassette, sub-family A (ABC1), member 12 -2.28 CAGGTGACTCCGATAATATAA NM_015657: NM_015657: 26154 ABCA12 ATP-binding cassette, sub-family A (ABC1), member 12 -0.97 AAGCCTAATGATCCGACTTTA NM_015657: NM_015657:NM_173076: 20 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 -3.23 CTGGAAGAACGTGACGCTCAA NM_001606: NM_001606: 20 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 1.06 CTGGGTCAGTCCCGTATTTAT NM_001606: NM_001606:NM_212533: 21 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 0.09 CCGCTTGAAGATTCAGTCGGA NM_001089: NM_001089: 21 ABCA3 ATP-binding cassette, sub-family A (ABC1), member 3 2.25 CCAAGTTTATCTCATCCTTTA NM_001089: NM_001089: 24 ABCA4 ATP-binding cassette, sub-family A (ABC1), member 4 -1.42 AAGGAGCCCATTGTTGATGAA NM_000350: NM_000350: 24 ABCA4 ATP-binding cassette, sub-family A (ABC1), member 4 -0.71 CCGTCTGAACATCACCTTCTA NM_000350: NM_000350: 23461 ABCA5 ATP-binding cassette, sub-family A (ABC1), member 5 1.71 GTACGTAATGTTCCAATCTAA NM_018672: NM_018672:NM_172232: 23461 ABCA5 ATP-binding cassette, sub-family A (ABC1), member 5 0.61 TGGCGAGCAATTCGAACTGCA NM_018672: NM_018672:NM_172232: 23460 ABCA6 ATP-binding cassette, sub-family A (ABC1), member 6 1.68 ACGCGAGGCTCGCCATCGCAA NM_080284: NM_080284:NM_172346: 23460 ABCA6 ATP-binding cassette, sub-family A (ABC1), member 6 1.80 AAGGATTACATTCTAGAGCTA NM_080284: NM_080284:NM_172346: 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 -0.59 CCCGGCCACGTGCGCATCAAA NM_019112: NM_019112:NM_033308: 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 0.80 GACGAGGATGTAGCCCGTGAA NM_019112: NM_019112:NM_033308: 10351 ABCA8 ATP-binding cassette, sub-family A (ABC1), member 8 -0.03 TTCGTTAGCATGCAATGCCAA NM_007168: NM_007168: 10351 ABCA8 ATP-binding cassette, sub-family A (ABC1), member 8 0.91 CTATCTGGCATTGGCGATTTA NM_007168: NM_007168: 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 -0.06 TCGATAGTTGCTACTGATCTA NM_080283: NM_080283:NM_172386: 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 -2.64 GAGGGCGATCATAGGGCATAA NM_080283: NM_080283:NM_172386: 5243 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 -0.60 ATCGAGTCACTGCCTAATAAA NM_000927: NM_000927: 5243 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 0.00 CACGGAAGGCCTAATGCCGAA NM_000927: NM_000927: 23456 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 -3.24 TAGACCCTAAGAAGTAATTAA NM_012089: NM_012089: 23456 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 -3.19 CTAGGTATTATTAAGAATGAA NM_012089: NM_012089: 8647 ABCB11 ATP-binding cassette, sub-family B (MDR/TAP), member 11 0.84 CGGGATGATAGTCAATTCCTT NM_003742: NM_003742: 8647 ABCB11 ATP-binding cassette, sub-family B (MDR/TAP), member 11 0.02 TCAGATCGGGATGATAGTCAA NM_003742: NM_003742: 5244 ABCB4 ATP-binding cassette, sub-family B (MDR/TAP), member 4 0.59 CCGACTGTCTACGGTCCGAAA NM_000443: NM_000443:NM_018849:NM_018850: 5244 ABCB4 ATP-binding cassette, sub-family B (MDR/TAP), member 4 -0.93 TCGGCATTTAGTGACAAAGAA NM_000443: NM_000443:NM_018849:NM_018850: 340273 ABCB5 ATPATP-binding-binding cassette,cassette, subsub-family-family B (MDR/TAP),(MDR/TAP), member 5 1.951.95 TTGGAGAATATACGTACTATA NM_ 178559: NM_ 178559: 340273 ABCB5 ATP-binding cassette, sub-family B (MDR/TAP), member 5 -0.58 TACGTACTATAGTGTCATTAA NM_178559: NM_178559: 10058 ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 0.06 CAGGCTCTCAACTGTGGTCAA NM_005689: NM_005689: 10058 ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 -2.04 CACCTACATTATCCAGCTGTA NM_005689: NM_005689: 22 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 -2.24 AACCCTCATAGTATCTATTCA NM_004299: NM_004299: 22 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 -0.48 AGCATTTATCTTGCTGGTCAA NM_004299: NM_004299: 11194 ABCB8 ATP-binding cassette, sub-family B (MDR/TAP), member 8 -3.83 AAGCTGGAAGCTTCCGATGAA NM_007188: NM_007188: 11194 ABCB8 ATP-binding cassette, sub-family B (MDR/TAP), member 8 0.90 AGGAATTTAAGTCATCCTTCA NM_007188: NM_007188: 23457 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 2.53 CCCGGTCAATAAAGTGTACTA NM_019624: NM_019624:NM_203445:NM_203444:NM_019625: 23457 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 4.45 CTGCGTGACCACGGCCATCTA NM_019624: NM_019624:NM_203445:NM_203444:NM_019625: NM_004996:NM_019902:NM_019901:NM_019900: 4363 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 -1.62 CCGAGTGGAATTCCGGAACTA NM_004996: NM_019899:NM_019862:NM_019898: NM_004996:NM_019902:NM_019901:NM_019900: 4363 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 -0.96 TCGGATGTCATCTGAAATGGA NM_004996: NM_019899:NM_019862:NM_019898: 89845 ABCC10 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 0.01 AGCCCAGATTGTGGTAGATTA NM_033450: NM_033450: 89845 ABCC10 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 0.29 CTGCTGGTACCCGTCAACAAA NM_033450: NM_033450: 85320 ABCC11 ATP-binding cassette, sub-family C (CFTR/MRP), member 11 0.35 AGGCTACTTGATGGCTCTCAA NM_032583: NM_145186:NM_033151:NM_032583: 85320 ABCC11 ATP-binding cassette, sub-family C (CFTR/MRP), member 11 -1.84 CTCCTCCAGTTGGATCATCAA NM_032583: NM_145186:NM_033151:NM_032583: NM_145188:NM_145190:NM_145189:NM_145187: 94160 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 -0.45 CGGTAGGAAATTACCCTGAAA NM_033226: NM_033226: NM_145188:NM_145190:NM_145189:NM_145187: 94160 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 0.39 CCGGAAAGTCATCGTTAGGAA NM_033226: NM_033226: 150000 ABCC13 ATP-binding cassette, sub-family C (CFTR/MRP), member 13 1.08 CTCGCTTGAATGTATGCGATA NM_138726: NM_138726: 150000 ABCC13 ATP-binding cassette, sub-family C (CFTR/MRP), member 13 -0.30 TAGGGTTATCTACAATATAAA NM_138726: NM_138726: 1244 ABCC2 ATP-binding cassette, sub-family C (CFTR/MRP), member 2 -2.38 CCGTATCAGGTTTGCCAGTTA NM_000392: NM_000392: 1244 ABCC2 ATP-binding cassette, sub-family C (CFTR/MRP), member 2 -1.35 CTGGAGTACCTACAAGCAATA NM_000392: NM_000392: 8714 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 -0.43 AAGGGTGAAATCCGCATTGAT NM_003786: NM_020037:NM_020038:NM_003786: 8714 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 0.01 CCGGAATTATTCTGTGCGCTA NM_003786: NM_020037:NM_020038:NM_003786: 10257 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 0.07 GAGGTTAAAGACAGTCATATA NM_005845: NM_005845: 10257 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 -3.17 CTCCTAGTACTTAGAAATACA NM_005845: NM_005845: 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 -1.52 ATAGCCTATATTTACAGTGAA NM_005688: NM_005688: 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1.00 ATCCTTCACGATCAAACCTAA NM_005688: NM_005688: 368 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 -1.28 CACGTGTGCTGTGCTGAGCAA NM_001171: NM_001171: 368 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP),
Load more

Recommended publications
  • Bacillus Anthracis Edema Factor Substrate Specificity: Evidence for New Modes of Action
    Toxins 2012, 4, 505-535; doi:10.3390/toxins4070505 OPEN ACCESS toxins ISSN 2072–6651 www.mdpi.com/journal/toxins Review Bacillus anthracis Edema Factor Substrate Specificity: Evidence for New Modes of Action Martin Göttle 1,*, Stefan Dove 2 and Roland Seifert 3 1 Department of Neurology, Emory University School of Medicine, 6302 Woodruff Memorial Research Building, 101 Woodruff Circle, Atlanta, GA 30322, USA 2 Department of Medicinal/Pharmaceutical Chemistry II, University of Regensburg, D-93040 Regensburg, Germany; E-Mail: [email protected] 3 Institute of Pharmacology, Medical School of Hannover, Carl-Neuberg-Str. 1, D-30625 Hannover, Germany; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-404-727-1678; Fax: +1-404-727-3157. Received: 23 April 2012; in revised form: 15 June 2012 / Accepted: 27 June 2012 / Published: 6 July 2012 Abstract: Since the isolation of Bacillus anthracis exotoxins in the 1960s, the detrimental activity of edema factor (EF) was considered as adenylyl cyclase activity only. Yet the catalytic site of EF was recently shown to accomplish cyclization of cytidine 5′-triphosphate, uridine 5′-triphosphate and inosine 5′-triphosphate, in addition to adenosine 5′-triphosphate. This review discusses the broad EF substrate specificity and possible implications of intracellular accumulation of cyclic cytidine 3′:5′-monophosphate, cyclic uridine 3′:5′-monophosphate and cyclic inosine 3′:5′-monophosphate on cellular functions vital for host defense. In particular, cAMP-independent mechanisms of action of EF on host cell signaling via protein kinase A, protein kinase G, phosphodiesterases and CNG channels are discussed.
    [Show full text]
  • RT² Profiler PCR Array (384-Well Format) Human Apoptosis 384HT
    RT² Profiler PCR Array (384-Well Format) Human Apoptosis 384HT Cat. no. 330231 PAHS-3012ZE For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Applied Biosystems® models 7900HT (384-well block), Format E ViiA™ 7 (384-well block); Bio-Rad CFX384™ RT² Profiler PCR Array, Roche® LightCycler® 480 (384-well block) Format G Description The Human Apoptosis RT² Profiler PCR Array profiles the expression of 370 key genes involved in apoptosis, or programmed cell death. The array includes the TNF ligands and their receptors; members of the bcl-2 family, BIR (baculoviral IAP repeat) domain proteins, CARD domain (caspase recruitment domain) proteins, death domain proteins, TRAF (TNF receptor-associated factor) domain proteins and caspases. These 370 genes are also grouped by their functional contribution to apoptosis, either anti-apoptosis or induction of apoptosis. Using real-time PCR, you can easily and reliably analyze expression of a focused panel of genes related to apoptosis with this array. For further details, consult the RT² Profiler PCR Array Handbook. Sample & Assay Technologies Shipping and storage RT² Profiler PCR Arrays in formats E and G are shipped at ambient temperature, on dry ice, or blue ice packs depending on destination and accompanying products. For long term storage, keep plates at –20°C. Note: Ensure that you have the correct RT² Profiler PCR Array format for your real-time cycler (see table above). Note: Open the package and store the products appropriately immediately
    [Show full text]
  • Peking University-Juntendo University Joint Symposium on Cancer Research and Treatment ADAM28 (A Disintegrin and Metalloproteinase 28) in Cancer Cell Proliferation and Progression
    Whatʼs New from Juntendo University, Tokyo Juntendo Medical Journal 2017. 63(5), 322-325 Peking University - Juntendo University Joint Symposium on Cancer Research and Treatment ADAM28 (a Disintegrin and Metalloproteinase 28) in Cancer Cell Proliferation and Progression YASUNORI OKADA＊ ＊Department of Pathophysiology for Locomotive and Neoplastic Diseases, Juntendo University Graduate School of Medicine, Tokyo, Japan A disintegrinandmetalloproteinase 28 (ADAM28) is overexpressedpredominantlyby carcinoma cells in more than 70% of the non-small cell lung carcinomas, showing positive correlations with carcinoma cell proliferation and metastasis. ADAM28 cleaves insulin-like growth factor binding protein-3 (IGFBP-3) in the IGF-I/IGFBP-3 complex, leading to stimulation of cell proliferation by intact IGF-I released from the complex. ADAM28 also degrades von Willebrand factor (VWF), which induces apoptosis in human carcinoma cell lines with negligible ADAM28 expression, andthe VWF digestionby ADAM28-expressing carcinoma cells facilitates them to escape from VWF-induced apoptosis, resulting in promotion of metastasis. We have developed human antibodies against ADAM28 andshown that one of them significantly inhibits tumor growth andmetastasis using lung adenocarcinoma cells. Our data suggest that ADAM28 may be a new molecular target for therapy of the patients with ADAM28-expressing non-small cell lung carcinoma. Key words: a disintegrin and metalloproteinase 28 (ADAM28), cell proliferation, invasion, metastasis, human antibody inhibitor Introduction human cancers 2). However, development of the synthetic inhibitors of MMPs andtheir application Cancer cell proliferation andprogression are for treatment of the cancer patients failed 3). modulated by proteolytic cleavage of tissue micro- On the other hand, members of the ADAM (a environmental factors such as extracellular matrix disintegrin and metalloproteinase) gene family, (ECM), growth factors andcytokines, receptors another family belonging to the metzincin gene andcell adhesionmolecules.
    [Show full text]
  • Cytokine Nomenclature
    RayBiotech, Inc. The protein array pioneer company Cytokine Nomenclature Cytokine Name Official Full Name Genbank Related Names Symbol 4-1BB TNFRSF Tumor necrosis factor NP_001552 CD137, ILA, 4-1BB ligand receptor 9 receptor superfamily .2. member 9 6Ckine CCL21 6-Cysteine Chemokine NM_002989 Small-inducible cytokine A21, Beta chemokine exodus-2, Secondary lymphoid-tissue chemokine, SLC, SCYA21 ACE ACE Angiotensin-converting NP_000780 CD143, DCP, DCP1 enzyme .1. NP_690043 .1. ACE-2 ACE2 Angiotensin-converting NP_068576 ACE-related carboxypeptidase, enzyme 2 .1 Angiotensin-converting enzyme homolog ACTH ACTH Adrenocorticotropic NP_000930 POMC, Pro-opiomelanocortin, hormone .1. Corticotropin-lipotropin, NPP, NP_001030 Melanotropin gamma, Gamma- 333.1 MSH, Potential peptide, Corticotropin, Melanotropin alpha, Alpha-MSH, Corticotropin-like intermediary peptide, CLIP, Lipotropin beta, Beta-LPH, Lipotropin gamma, Gamma-LPH, Melanotropin beta, Beta-MSH, Beta-endorphin, Met-enkephalin ACTHR ACTHR Adrenocorticotropic NP_000520 Melanocortin receptor 2, MC2-R hormone receptor .1 Activin A INHBA Activin A NM_002192 Activin beta-A chain, Erythroid differentiation protein, EDF, INHBA Activin B INHBB Activin B NM_002193 Inhibin beta B chain, Activin beta-B chain Activin C INHBC Activin C NM005538 Inhibin, beta C Activin RIA ACVR1 Activin receptor type-1 NM_001105 Activin receptor type I, ACTR-I, Serine/threonine-protein kinase receptor R1, SKR1, Activin receptor-like kinase 2, ALK-2, TGF-B superfamily receptor type I, TSR-I, ACVRLK2 Activin RIB ACVR1B
    [Show full text]
  • Common Gene Polymorphisms Associated with Thrombophilia
    Chapter 5 Common Gene Polymorphisms Associated with Thrombophilia Christos Yapijakis, Zoe Serefoglou and Constantinos Voumvourakis Additional information is available at the end of the chapter http://dx.doi.org/10.5772/61859 Abstract Genetic association studies have revealed a correlation between DNA variations in genes encoding factors of the hemostatic system and thrombosis-related disease. Certain var‐ iant alleles of these genes that affect either gene expression or function of encoded protein are known to be genetic risk factors for thrombophilia. The chapter presents the current genetics and molecular biology knowledge of the most important DNA polymorphisms in thrombosis-related genes encoding coagulation factor V (FV), coagulation factor II (FII), coagulation factor XII (FXII), coagulation factor XIII A1 subunit (FXIIIA1), 5,10- methylene tetrahydrofolate reductase (MTHFR), serpine1 (SERPINE1), angiotensin I-con‐ verting enzyme (ACE), angiotensinogen (AGT), integrin A2 (ITGA2), plasma carboxypeptidase B2 (CPB2), platelet glycoprotein Ib α polypeptide (GP1BA), thrombo‐ modulin (THBD) and protein Z (PROZ). The molecular detection methods of each DNA polymorphism is presented, in addition to the current knowledge regarding its influence on thrombophilia and related thrombotic events, including stroke, myocardial infarction, deep vein thrombosis, spontaneous abortion, etc. In addition, best thrombosis prevention strategies with a combination of genetic counseling and molecular testing are discussed. Keywords: Thrombophilia, coagulation
    [Show full text]
  • The Roles of Histone Deacetylase 5 and the Histone Methyltransferase Adaptor WDR5 in Myc Oncogenesis
    The Roles of Histone Deacetylase 5 and the Histone Methyltransferase Adaptor WDR5 in Myc oncogenesis By Yuting Sun This thesis is submitted in fulfilment of the requirements for the degree of Doctor of Philosophy at the University of New South Wales Children’s Cancer Institute Australia for Medical Research School of Women’s and Children’s Health, Faculty of Medicine University of New South Wales Australia August 2014 PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Sun First name: Yuting Other name/s: Abbreviation for degree as given in the University calendar: PhD School : School of·Women's and Children's Health Faculty: Faculty of Medicine Title: The Roles of Histone Deacetylase 5 and the Histone Methyltransferase Adaptor WDR5 in Myc oncogenesis. Abstract 350 words maximum: (PLEASE TYPE) N-Myc Induces neuroblastoma by regulating the expression of target genes and proteins, and N-Myc protein is degraded by Fbxw7 and NEDD4 and stabilized by Aurora A. The class lla histone deacetylase HDAC5 suppresses gene transcription, and blocks myoblast and leukaemia cell differentiation. While histone H3 lysine 4 (H3K4) trimethylation at target gene promoters is a pre-requisite for Myc· induced transcriptional activation, WDRS, as a histone H3K4 methyltransferase presenter, is required for H3K4 methylation and transcriptional activation mediated by a histone H3K4 methyltransferase complex. Here, I investigated the roles of HDAC5 and WDR5 in N-Myc overexpressing neuroblastoma. I have found that N-Myc upregulates HDAC5 protein expression, and that HDAC5 represses NEDD4 gene expression, increases Aurora A gene expression and consequently upregulates N-Myc protein expression in neuroblastoma cells.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Determining HDAC8 Substrate Specificity by Noah Ariel Wolfson A
    Determining HDAC8 substrate specificity by Noah Ariel Wolfson A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Biological Chemistry) in the University of Michigan 2014 Doctoral Committee: Professor Carol A. Fierke, Chair Professor Robert S. Fuller Professor Anna K. Mapp Associate Professor Patrick J. O’Brien Associate Professor Raymond C. Trievel Dedication My thesis is dedicated to all my family, mentors, and friends who made getting to this point possible. ii Table of Contents Dedication ....................................................................................................................................... ii List of Figures .............................................................................................................................. viii List of Tables .................................................................................................................................. x List of Appendices ......................................................................................................................... xi Abstract ......................................................................................................................................... xii Chapter 1 HDAC8 substrates: Histones and beyond ...................................................................... 1 Overview ..................................................................................................................................... 1 HDAC introduction
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • 5' Untranslated Region Elements Show High Abundance and Great
    International Journal of Molecular Sciences Article 0 5 Untranslated Region Elements Show High Abundance and Great Variability in Homologous ABCA Subfamily Genes Pavel Dvorak 1,2,* , Viktor Hlavac 2,3 and Pavel Soucek 2,3 1 Department of Biology, Faculty of Medicine in Pilsen, Charles University, 32300 Pilsen, Czech Republic 2 Biomedical Center, Faculty of Medicine in Pilsen, Charles University, 32300 Pilsen, Czech Republic; [email protected] (V.H.); [email protected] (P.S.) 3 Toxicogenomics Unit, National Institute of Public Health, 100 42 Prague, Czech Republic * Correspondence: [email protected]; Tel.: +420-377593263 Received: 7 October 2020; Accepted: 20 November 2020; Published: 23 November 2020 Abstract: The 12 members of the ABCA subfamily in humans are known for their ability to transport cholesterol and its derivatives, vitamins, and xenobiotics across biomembranes. Several ABCA genes are causatively linked to inborn diseases, and the role in cancer progression and metastasis is studied intensively. The regulation of translation initiation is implicated as the major mechanism in the processes of post-transcriptional modifications determining final protein levels. In the current bioinformatics study, we mapped the features of the 50 untranslated regions (50UTR) known to have the potential to regulate translation, such as the length of 50UTRs, upstream ATG codons, upstream open-reading frames, introns, RNA G-quadruplex-forming sequences, stem loops, and Kozak consensus motifs, in the DNA sequences of all members of the subfamily. Subsequently, the conservation of the features, correlations among them, ribosome profiling data as well as protein levels in normal human tissues were examined. The 50UTRs of ABCA genes contain above-average numbers of upstream ATGs, open-reading frames and introns, as well as conserved ones, and these elements probably play important biological roles in this subfamily, unlike RG4s.
    [Show full text]
  • Identification of New Substrates and Physiological Relevance
    Université de Montréal The Multifaceted Proprotein Convertases PC7 and Furin: Identification of New Substrates and Physiological Relevance Par Stéphanie Duval Biologie Moléculaire, Faculté de médecine Thèse présentée en vue de l’obtention du grade de Philosophiae doctor (Ph.D) en Biologie moléculaire, option médecine cellulaire et moléculaire Avril 2020 © Stéphanie Duval, 2020 Résumé Les proprotéines convertases (PCs) sont responsables de la maturation de plusieurs protéines précurseurs et sont impliquées dans divers processus biologiques importants. Durant les 30 dernières années, plusieurs études sur les PCs se sont traduites en succès cliniques, toutefois les fonctions spécifiques de PC7 demeurent obscures. Afin de comprendre PC7 et d’identifier de nouveaux substrats, nous avons généré une analyse protéomique des protéines sécrétées dans les cellules HuH7. Cette analyse nous a permis d’identifier deux protéines transmembranaires de fonctions inconnues: CASC4 et GPP130/GOLIM4. Au cours de cette thèse, nous nous sommes aussi intéressé au rôle de PC7 dans les troubles comportementaux, grâce à un substrat connu, BDNF. Dans le chapitre premier, je présenterai une revue de la littérature portant entre autres sur les PCs. Dans le chapitre II, l’étude de CASC4 nous a permis de démontrer que cette protéine est clivée au site KR66↓NS par PC7 et Furin dans des compartiments cellulaires acides. Comme CASC4 a été rapporté dans des études de cancer du sein, nous avons généré des cellules MDA- MB-231 exprimant CASC4 de type sauvage et avons démontré une diminution significative de la migration et de l’invasion cellulaire. Ce phénotype est causé notamment par une augmentation du nombre de complexes d’adhésion focale et peut être contrecarré par la surexpression d’une protéine CASC4 mutante ayant un site de clivage optimale par PC7/Furin ou encore en exprimant une protéine contenant uniquement le domaine clivé N-terminal.
    [Show full text]