5' Untranslated Region Elements Show High Abundance and Great
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genotyping of Breech Flystrike Resource – Update
Project No: ON-00515 Contract No: PO4500010753 AWI Project Manager: Bridget Peachey Contractor Name: CSIRO Agriculture and Food Prepared by: Dr Sonja Dominik Publication Date: July 2019 Genotyping of breech flystrike resource – update Published by Australian Wool Innovation Limited, Level 6, 68 Harrington Street, THE ROCKS, NSW, 2000 This publication should only be used as a general aid and is not a substitute for specific advice. To the extent permitted by law, we exclude all liability for loss or damage arising from the use of the information in this publication. AWI invests in research, development, innovation and marketing activities along the global supply chain for Australian wool. AWI is grateful for its funding, which is primarily provided by Australian woolgrowers through a wool levy and by the Australian Government which provides a matching contribution for eligible R&D activities © 2019 Australian Wool Innovation Ltd. All rights reserved. Contents Executive Summary .................................................................................................................... 3 1 Introduction/Hypothesis .................................................................................................... 5 2 Literature Review ............................................................................................................... 6 3 Project Objectives .............................................................................................................. 8 4 Success in Achieving Objectives ........................................................................................ -
Genome-Wide Analysis of ATP-Binding
Tian et al. BMC Genomics (2017) 18:330 DOI 10.1186/s12864-017-3706-6 RESEARCH ARTICLE Open Access Genome-wide analysis of ATP-binding cassette (ABC) transporters in the sweetpotato whitefly, Bemisia tabaci Lixia Tian1, Tianxue Song2, Rongjun He1, Yang Zeng1, Wen Xie1, Qingjun Wu1, Shaoli Wang1, Xuguo Zhou3* and Youjun Zhang1* Abstract Background: ABC transporter superfamily is one of the largest and ubiquitous groups of proteins. Because of their role in detoxification, insect ABC transporters have gained more attention in recent years. In this study, we annotated ABC transporters from a newly sequenced sweetpotato whitefly genome. Bemisia tabaci Q biotype is an emerging global invasive species that has caused extensive damages to field crops as well as ornamental plants. Results: A total of 55 ABC transporters containing all eight described subfamilies (A to H) were identified in the B. tabaci Q genome, including 8 ABCAs, 3 ABCBs, 6 ABCCs, 2 ABCDs, 1 ABCE, 3 ABCFs, 23 ABCGs and 9 ABCHs. In comparison to other species, subfamilies G and H in both phloem- and blood-sucking arthropods are expanded. The temporal expression profiles of these 55 ABC transporters throughout B. tabaci developmental stages and their responses to imidacloprid, a neonicotinoid insecticide, were investigated using RNA-seq analysis. Furthermore, the mRNA expression of 24 ABC transporters (44% of the total) representing all eight subfamilies was confirmed by the quantitative real-time PCR (RT-qPCR). Furthermore, mRNA expression levels estimated by RT-qPCR and RNA-seq analyses were significantly correlated (r =0.684,p <0.01). Conclusions: It is the first genome-wide analysis of the entire repertoire of ABC transporters in B. -
A Single-Cell Transcriptomic Landscape of Primate Arterial Aging
ARTICLE https://doi.org/10.1038/s41467-020-15997-0 OPEN A single-cell transcriptomic landscape of primate arterial aging Weiqi Zhang 1,2,3,4,5,13, Shu Zhang6,7,13, Pengze Yan3,8,13, Jie Ren7,9,13, Moshi Song3,5,8, Jingyi Li2,3,8, Jinghui Lei4, Huize Pan2,3, Si Wang3,5,8, Xibo Ma3,10, Shuai Ma2,3,8, Hongyu Li2,3, Fei Sun2,3, Haifeng Wan3,5,11, ✉ ✉ ✉ Wei Li 3,5,11, Piu Chan4, Qi Zhou3,5,11, Guang-Hui Liu 2,3,4,5,8 , Fuchou Tang 6,7,9,12 & Jing Qu 3,5,11 Our understanding of how aging affects the cellular and molecular components of the vas- 1234567890():,; culature and contributes to cardiovascular diseases is still limited. Here we report a single-cell transcriptomic survey of aortas and coronary arteries in young and old cynomolgus monkeys. Our data define the molecular signatures of specialized arteries and identify eight markers discriminating aortic and coronary vasculatures. Gene network analyses characterize tran- scriptional landmarks that regulate vascular senility and position FOXO3A, a longevity- associated transcription factor, as a master regulator gene that is downregulated in six subtypes of monkey vascular cells during aging. Targeted inactivation of FOXO3A in human vascular endothelial cells recapitulates the major phenotypic defects observed in aged monkey arteries, verifying FOXO3A loss as a key driver for arterial endothelial aging. Our study provides a critical resource for understanding the principles underlying primate arterial aging and contributes important clues to future treatment of age-associated vascular disorders. 1 CAS Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China. -
Molecular Structure of a Novel Cholesterol-Responsive a Subclass ABC Transporter, ABCA9
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Regensburg Publication Server BBRC Biochemical and Biophysical Research Communications 295 (2002) 408–416 www.academicpress.com Molecular structure of a novel cholesterol-responsive A subclass ABC transporter, ABCA9 Armin Piehler,1 Wolfgang E. Kaminski,1 Juurgen€ J. Wenzel, Thomas Langmann, and Gerd Schmitz* Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, Franz-Josef-Strauß-Allee 11, D-93042, Regensburg, Germany Received 25 May 2002 Abstract We recently identified a novel ABC A subclass transporter, ABCA6, in human macrophages. Here, we report the molecular cloning of an additional ABC A subfamily transporter from macrophages denoted ABCA9. The identified coding sequence is 4.9 kb in size and codes for a 1624 amino acid protein product. In accordance with the proposed nomenclature, the novel transporter was designated ABCA9. The putative full-length ABC transporter polypeptide consists of two transmembrane domains and two nu- cleotide binding folds and thus conforms to the group of full-size ABC transporters. We identified alternative ABCA9 mRNA variants in human macrophages that predict the existence of three truncated forms of the novel transporter. Among the human ABC A subfamily transporters, ABCA9 exhibits the highest amino acid sequence homology with ABCA8 (72%) and ABCA6 (60%), respectively. The striking amino acid sequence similarity between these transporter molecules supports the notion that they represent an evolutionary more recently emerged subgroup within the family of ABC A transporters, which we refer to as ‘‘ABCA6-like transporters.’’ ABCA9 mRNA is ubiquitously expressed with the highest mRNA levels in heart, brain, and fetal tissues. -
Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice. -
Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing -
ABCA5 (NM 018672) Human Tagged ORF Clone – RC213865 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213865 ABCA5 (NM_018672) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ABCA5 (NM_018672) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ABCA5 Synonyms: ABC13; EST90625; HTC3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC213865 representing NM_018672 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCACTGCAATTAGGGAGGTAGGAGTTTGGAGACAGACCAGAACACTTCTACTGAAGAATTACTTAA TTAAATGCAGAACCAAAAAGAGTAGTGTTCAGGAAATTCTTTTTCCACTATTTTTTTTATTTTGGTTAAT ATTAATTAGCATGATGCATCCAAATAAGAAATATGAAGAAGTGCCTAATATAGAACTCAATCCTATGGAC AAGTTTACTCTTTCTAATCTAATTCTTGGATATACTCCAGTGACTAATATTACAAGCAGCATCATGCAGA AAGTGTCTACTGATCATCTACCTGATGTCATAATTACTGAAGAATATACAAATGAAAAAGAAATGTTAAC ATCCAGTCTCTCTAAGCCGAGCAACTTTGTAGGTGTGGTTTTCAAAGACTCCATGTCCTATGAACTTCGT TTTTTTCCTGATATGATTCCAGTATCTTCTATTTATATGGATTCAAGAGCTGGCTGTTCAAAATCATGTG AGGCTGCTCAGTACTGGTCCTCAGGTTTCACAGTTTTACAAGCATCCATAGATGCTGCCATTATACAGTT GAAGACCAATGTTTCTCTTTGGAAGGAGCTGGAGTCAACTAAAGCTGTTATTATGGGAGAAACTGCTGTT GTAGAAATAGATACCTTTCCCCGAGGAGTAATTTTAATATACCTAGTTATAGCATTTTCACCTTTTGGAT ACTTTTTGGCAATTCATATCGTAGCAGAAAAAGAAAAAAAAATAAAAGAATTTTTAAAGATAATGGGACT TCATGATACTGCCTTTTGGCTTTCCTGGGTTCTTCTATATACAAGTTTAATTTTTCTTATGTCCCTTCTT ATGGCAGTCATTGCGACAGCTTCTTTGTTATTTCCTCAAAGTAGCAGCATTGTGATATTTCTGCTTTTTT -
ABC Transporter Activity Linked to Radiation Resistance And
Ingram et al. Experimental Hematology & Oncology 2013, 2:26 http://www.ehoonline.org/content/2/1/26 Experimental Hematology & Oncology RESEARCH Open Access ABC transporter activity linked to radiation resistance and molecular subtype in pediatric medulloblastoma Wendy J Ingram1,2,4*,LisaMCrowther1, Erica B Little1,RuthFreeman1, Ivon Harliwong1, Desi Veleva1, Timothy E Hassall2, Marc Remke3, Michael D Taylor3 and Andrew R Hallahan1,2 Abstract Background: Resistance to radiation treatment remains a major clinical problem for patients with brain cancer. Medulloblastoma is the most common malignant brain tumor of childhood, and occurs in the cerebellum. Though radiation treatment has been critical in increasing survival rates in recent decades, the presence of resistant cells in a substantial number of medulloblastoma patients leads to relapse and death. Methods: Using the established medulloblastoma cell lines UW228 and Daoy, we developed a novel model system to enrich for and study radiation tolerant cells early after radiation exposure. Using fluorescence-activated cell sorting, dead cells and cells that had initiated apoptosis were removed, allowing surviving cells to be investigated before extensive proliferation took place. Results: Isolated surviving cells were tumorigenic in vivo and displayed elevated levels of ABCG2, an ABC transporter linked to stem cell behavior and drug resistance. Further investigation showed another family member, ABCA1, was also elevated in surviving cells in these lines, as well as in early passage cultures from pediatric medulloblastoma patients. We discovered that the multi-ABC transporter inhibitors verapamil and reserpine sensitized cells from particular patients to radiation, suggesting that ABC transporters have a functional role in cellular radiation protection. -
Interindividual Differences in the Expression of ATP-Binding
Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/02/02/dmd.117.079061.DC1 1521-009X/46/5/628–635$35.00 https://doi.org/10.1124/dmd.117.079061 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:628–635, May 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Special Section on Transporters in Drug Disposition and Pharmacokinetic Prediction Interindividual Differences in the Expression of ATP-Binding Cassette and Solute Carrier Family Transporters in Human Skin: DNA Methylation Regulates Transcriptional Activity of the Human ABCC3 Gene s Tomoki Takechi, Takeshi Hirota, Tatsuya Sakai, Natsumi Maeda, Daisuke Kobayashi, and Ichiro Ieiri Downloaded from Department of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan (T.T., T.H., T.S., N.M., I.I.); Drug Development Research Laboratories, Kyoto R&D Center, Maruho Co., Ltd., Kyoto, Japan (T.T.); and Department of Clinical Pharmacy and Pharmaceutical Care, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan (D.K.) Received October 19, 2017; accepted January 30, 2018 dmd.aspetjournals.org ABSTRACT The identification of drug transporters expressed in human skin and levels. ABCC3 expression levels negatively correlated with the methylation interindividual differences in gene expression is important for understanding status of the CpG island (CGI) located approximately 10 kilobase pairs the role of drug transporters in human skin. In the present study, we upstream of ABCC3 (Rs: 20.323, P < 0.05). The reporter gene assay revealed evaluated the expression of ATP-binding cassette (ABC) and solute carrier a significant increase in transcriptional activity in the presence of CGI. -
Whole-Exome Sequencing Identifies Novel Mutations in ABC Transporter
Liu et al. BMC Pregnancy and Childbirth (2021) 21:110 https://doi.org/10.1186/s12884-021-03595-x RESEARCH ARTICLE Open Access Whole-exome sequencing identifies novel mutations in ABC transporter genes associated with intrahepatic cholestasis of pregnancy disease: a case-control study Xianxian Liu1,2†, Hua Lai1,3†, Siming Xin1,3, Zengming Li1, Xiaoming Zeng1,3, Liju Nie1,3, Zhengyi Liang1,3, Meiling Wu1,3, Jiusheng Zheng1,3* and Yang Zou1,2* Abstract Background: Intrahepatic cholestasis of pregnancy (ICP) can cause premature delivery and stillbirth. Previous studies have reported that mutations in ABC transporter genes strongly influence the transport of bile salts. However, to date, their effects are still largely elusive. Methods: A whole-exome sequencing (WES) approach was used to detect novel variants. Rare novel exonic variants (minor allele frequencies: MAF < 1%) were analyzed. Three web-available tools, namely, SIFT, Mutation Taster and FATHMM, were used to predict protein damage. Protein structure modeling and comparisons between reference and modified protein structures were performed by SWISS-MODEL and Chimera 1.14rc, respectively. Results: We detected a total of 2953 mutations in 44 ABC family transporter genes. When the MAF of loci was controlled in all databases at less than 0.01, 320 mutations were reserved for further analysis. Among these mutations, 42 were novel. We classified these loci into four groups (the damaging, probably damaging, possibly damaging, and neutral groups) according to the prediction results, of which 7 novel possible pathogenic mutations were identified that were located in known functional genes, including ABCB4 (Trp708Ter, Gly527Glu and Lys386Glu), ABCB11 (Gln1194Ter, Gln605Pro and Leu589Met) and ABCC2 (Ser1342Tyr), in the damaging group. -
1 Fibrillar Αβ Triggers Microglial Proteome Alterations and Dysfunction in Alzheimer Mouse 1 Models 2 3 4 Laura Sebastian
bioRxiv preprint doi: https://doi.org/10.1101/861146; this version posted December 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Fibrillar triggers microglial proteome alterations and dysfunction in Alzheimer mouse 2 models 3 4 5 Laura Sebastian Monasor1,10*, Stephan A. Müller1*, Alessio Colombo1, Jasmin König1,2, Stefan 6 Roth3, Arthur Liesz3,4, Anna Berghofer5, Takashi Saito6,7, Takaomi C. Saido6, Jochen Herms1,4,8, 7 Michael Willem9, Christian Haass1,4,9, Stefan F. Lichtenthaler 1,4,5# & Sabina Tahirovic1# 8 9 1 German Center for Neurodegenerative Diseases (DZNE) Munich, 81377 Munich, Germany 10 2 Faculty of Chemistry, Technical University of Munich, Garching, Germany 11 3 Institute for Stroke and Dementia Research (ISD), Ludwig-Maximilians Universität München, 12 81377 Munich, Germany 13 4 Munich Cluster for Systems Neurology (SyNergy), Munich, Germany 14 5 Neuroproteomics, School of Medicine, Klinikum Rechts der Isar, Technical University of Munich, 15 Munich, Germany 16 6 Laboratory for Proteolytic Neuroscience, RIKEN Center for Brain Science Institute, Wako, 17 Saitama 351-0198, Japan 18 7 Department of Neurocognitive Science, Nagoya City University Graduate School of Medical 19 Science, Nagoya, Aichi 467-8601, Japan 20 8 Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, 81377 21 Munich, Germany 22 9 Biomedical Center (BMC), Ludwig-Maximilians Universität München, 81377 Munich, Germany 23 10 Graduate School of Systemic Neuroscience, Ludwig-Maximilians-University Munich, Munich, 24 Germany. 25 *Contributed equally 26 #Correspondence: [email protected] and [email protected] 27 28 Running title: 29 Microglial proteomic signatures of AD 30 Keywords: Alzheimer’s disease / microglia / proteomic signatures / neuroinflammation / 31 phagocytosis 32 1 bioRxiv preprint doi: https://doi.org/10.1101/861146; this version posted December 2, 2019. -
ATP-Binding Cassette (ABC) Transporter Recessive Mutations in Biliary Atresia Cases
PgmNr 1953: ATP-binding cassette (ABC) transporter recessive mutations in biliary atresia cases. Authors: W.Y. Lam 1,2; J.S. Hsu 3; C.S. Tang 1,2; M.T. So 1; P.H.Y. Chung 1; P.K.H. Tam 1,2; M.M. Garcia-Barcelo 1,2 View Session Add to Schedule Affiliations: 1) Department of Surgery, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong; 2) Dr Li Dak-Sum Research Centre, The University of Hong Kong – Karolinska Institutet Collaboration in Regenerative Medicine, The University of Hong Kong, Hong Kong; 3) Department of Psychiatry, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong Biliary atresia (BA) is an aggressive neonatal disorder characterized by progressive fibrosclerosing obliteration of the extrahepatic biliary tract in a few weeks after birth. Early surgical intervention by Kasai portoenterostomy to establish bile flow is critical to survival, yet disease progression to liver cirrhosis occurs in many patients, leaving liver transplantation the only option. BA has the highest prevalence of 1/5000 live births in the Southeast Asian population, 3 to 4 times higher than the US and European populations. Pathogenesis of BA remains uncertain. Consistent and robust evidence supporting theories of viral infection, immune dysregulation, environmental and multifactorial causes are yet to be established. Multiple genetic studies in different ethnic groups have identified ADD3 as a susceptibility gene of BA, yet disease-causal genetic risk factor is still in search. We conducted a whole exome sequencing study on 83 trios from the Southeast Asian population, and identified 148 rare non-synonymous de novo and inherited recessive mutations in 135 genes that were predicted to be damaging, and expressed in liver or bile duct tissues according to public databases and in-house BA liver organoid gene expression dataset.