The Yeast Heterochromatin Protein Sir3 Experienced Functional Changes in the AAA+ Domain After Gene Duplication and Subfunctionalization

| INVESTIGATION

Ashleigh S. Hanner and Laura N. Rusche1 Department of Biological Sciences, State University of New York at Buffalo, New York 14260

ABSTRACT A key unresolved issue in molecular evolution is how paralogs diverge after gene duplication. For multifunctional genes, duplication is often followed by subfunctionalization. Subsequently, new or optimized molecular properties may evolve once the protein is no longer constrained to achieve multiple functions. A potential example of this process is the evolution of the yeast heterochromatin protein Sir3, which arose by duplication from the conserved DNA replication protein Orc1. We previously found that Sir3 subfunctionalized after duplication. In this study, we investigated whether Sir3 evolved new or optimized properties after subfunctionalization . This possibility is supported by our observation that nonduplicated Orc1/Sir3 proteins from three species were unable to complement a sir3D mutation in Saccharomyces cerevisiae. To identify regions of Sir3 that may have evolved new properties, we created chimeric proteins of ScSir3 and nonduplicated Orc1 from Kluyveromyces lactis. We identified the AAA+ base subdomain of KlOrc1 as insufficient for heterochromatin formation in S. cerevisiae.InOrc1, this subdomain is intimately associated with other ORC subunits, enabling ATP hydrolysis. In Sir3, this subdomain binds Sir4 and perhaps nucleosomes. Our data are inconsistent with the insufficiency of KlOrc1 resulting from its ATPase activity or an inability to bind ScSir4. Thus, once Sir3 was no longer constrained to assemble into the ORC complex, its heterochromatin-forming potential evolved through changes in the AAA+ base subdomain.

KEYWORDS gene silencing; Escape from Adaptive Conﬂict (EAC); gene sharing

ENE duplication is a fundamental mechanism through tions without disrupting the others. However, after duplication Gwhich genetic diversity increases. A common outcome of and subfunctionalization, the duplicate genes escape this con- gene duplication is subfunctionalization, in which the func- flict and can acquire optimizing mutations. To gain insight into tions of an ancestral gene are partitioned between the dupli- gene fate after subfunctionalization, we have examined the cates. Several theoretical models describe subfunctionalization, yeast genes ORC1 and SIR3, a duplicate pair that arose during and differ with respect to whether new or specialized functions a whole-genome duplication, and for which there is extensive emerge after subfunctionalization. Models including Duplica- functional and structural information. tion-Degeneration-Complementation (Force et al. 1999) and Orc1 is a conserved eukaryotic protein required for DNA Constructive Neutral Evolution (Stoltzfus 1999) describe a sit- replication. It is the largest subunit of the Origin Recognition uation in which no new function arises. In this scenario, the Complex (ORC), which binds to, and identifies, origins of duplicate genes acquire complementary inactivating mutations, replication throughout the genome (Li and Stillman 2012). such that they each perform a subset of the ancestral functions. In Saccharomyces cerevisiae, ORC also serves as a silencer- fl Other models, such as Escape from Adaptive Con ict (Hittinger binding protein, which recruits the SIR complex (Silent In- and Carroll 2007) and Gene Sharing (Hughes 1994) describe a formation Regulator) to the silenced cryptic mating-type loci, situation in which new or enhanced function does arise. In this HMRa and HMLa. In particular, the Orc1 subunit binds to Sir1 scenario, the ancestral gene cannot optimize any one of its func- (Triolo and Sternglanz 1996), which, in turn, recruits other Sir proteins to establish a domain of repressive or “silenced” Copyright © 2017 by the Genetics Society of America doi: https://doi.org/10.1534/genetics.117.300180 chromatin. The paralog of Orc1, Sir3, is also involved in si- Manuscript received January 23, 2017; accepted for publication August 9, 2017; lenced chromatin formation, but has a different role. Sir3 binds published Early Online August 21, 2017. 1Corresponding author: Department of Biological Sciences, State University of New to deacetylated nucleosomes (Hecht et al. 1995; Onishi et al. York at Buffalo, 109 Cooke Hall, Buffalo, NY 14260. E-mail: [email protected] 2007), enabling the spreading of the SIR complex along a

Genetics, Vol. 207, 517–528 October 2017 517 chromosome (Hoppe et al. 2002; Luo et al. 2002; Rusche et al. 2002). SIR-mediated silencing occurs at the cryptic mating-type loci, whose repression maintains haploid cell identity, and at telomeres, where this chromatin is thought to stabilize the ends of chromosomes. Orc1 and Sir3 retain homology along their entire lengths and have three major structural domains (Figure 1). The AAA+ domain is a hallmark of the AAA+ superfamily, whose mem- bers couple ATP hydrolysis to structural rearrangements of proteins. In this family, ATP binding and hydrolysis requires Figure 1 Structural organization of Orc1/Sir3 proteins. Major structural amino acids from two interacting AAA+ domains. Although domains are represented in white for ScSir3 or black for KlOrc1. Each both Orc1 and Sir3 contain an AAA+ domain, Sir3 lacks key domain is labeled with its molecular function. Amino acid sequence iden- amino acids required to bind ATP and has no detectable tity (similarity) between ScSir3 and KlOrc1 was calculated for each domain ATPase activity (Bell et al. 1995). Instead, the AAA+-like using EMBL-EBI LALIGN Pairwise Sequence alignment (Huang and Miller 1991). domain in Sir3 interacts with Sir4 (Chang et al. 2003; King et al. 2006; Ehrentraut et al. 2011), and is also proposed to AAA+ base subdomain. This portion of Sir3 interacts with Sir4. bind histones (Hecht et al. 1995; Altaf et al. 2007; Ehrentraut However, our data are inconsistent with the insufficiency of the et al. 2011). A second domain is a winged helix domain, KlOrc1 base subdomain resulting from a failure to interact with whose ancestral function is to bind DNA (Gaudier et al. ScSir4. Moreover, our data do not support the possibility that 2007). However, the winged helix domains of both Sir3 the presumed ability of KlOrc1 to bind ATP interferes with het- and Orc1 in S. cerevisiae lack this activity and instead are erochromatin formation in S. cerevisiae. Therefore, the AAA+ involved in homo-dimerization (Oppikofer et al. 2013). The base subdomain may have acquired new or optimized molecu- third domain is the N-terminal bromo-adjacent homology lar properties after duplication. (BAH) domain. The BAH domains of both Orc1 and Sir3 bind to nucleosomes (Onishi et al. 2007; Armache et al. 2011; Zhang et al. 2015). The BAH domain of ScOrc1 also binds Materials and Methods to Sir1 (Triolo and Sternglanz 1996; Hou et al. 2005). In Yeast strain construction and growth addition to these three structural domains, there is a rapidly evolving linker that separates the BAH domain from the AAA+ The yeast strains used in this study (Table 1) were derived domain. from W303-1a. Yeast were grown in YM (0.67% yeast nitro- Prior work indicates that Orc1 and Sir3 subfunctionalized gen base without amino acids, 2% glucose) or CSM-Trp [YM after duplication (van Hoof 2005; Hickman and Rusche supplemented with a mixture of amino acids and other nu- 2010). In particular, the nonduplicated Orc1 from Kluyvero- trients but lacking tryptophan (MPBio 4512-522)]. Yeast myces lactis, which serves as a proxy for the ancestral non- transformation was performed using lithium acetate and duplicated protein, has both replication and silencing PEG (Schiestl and Gietz 1989). Cells were harvested at an functions. KlOrc1 is required for transcriptional repression OD600 1, washed twice with TEL (10 mM Tris, pH 7.5; at heterochromatic loci, and its nucleosome-binding BAH do- 1 mM EDTA; 100 mM LiOAc), and resuspended in 10 ml main is required for spreading across these loci (Hickman and TEL/ OD cells. For transformation, 100 ml of cells was added Rusche 2010), as seen for ScSir3. Another indication that the to 0.1 mg plasmid DNA or 0.1 mg of linear DNA plus 30 mg ancestral protein had a silencing function is that the nondu- sheared salmon sperm DNA. plicated ORC1 gene from Lachancea kluyverii weakly comple- To express KlSir4-HA or ScSir4-HA in S. cerevisiae,wefirst ments a sir3D mutation in S. cerevisiae (van Hoof 2005). generated tagging cassettes on plasmids, and then used these These results imply that Orc1 was involved in heterochroma- cassettes to transform strain LRY1098. Plasmid pLR588 con- tin formation before the gene duplication, and, therefore, tains the ScSIR4 gene with a C-terminal HA tag and down- that subfunctionalization occurred after duplication. stream HIS3 marker. The original source for the 3xHA tag was Despite the role of KlOrc1 in forming heterochromatin in its pMPY-3XHA (Schneider et al. 1995). This plasmid was al- native context, we found that when KlOrc1 is expressed in a tered by site-directed mutagenesis to add a stop codon S. cerevisiae sir3D strain, heterochromatin formation does not immediately after the HA tag (...DVPDYAA stop), yielding occur. This inability of KlOrc1 to complement a sir3D muta- pLR522. Next, HIS3 from pRS403 (Sikorski and Hieter tion suggests that Sir3 acquired new or optimized molecular 1989) was ligated into the SphI and XmaI sites of pLR522 properties after duplication. If so, Sir3 could be an example of in place of URA3, generating pLR541. The original source for the type of evolutionary change described by the EAC and the ScSIR4 gene was pJR2027 (gift from Jasper Rine), based gene sharing models. To examine this possibility, we identified on vector pRS315. The 3x-HA tag plus HIS3 marker from the sections of KlOrc1 that are insufficient for heterochromatin pLR541 was inserted at the 39 end of the ScSIR4 gene formation by creating chimeric proteins composed of ScSir3 and through homologous recombination in yeast, generating KlOrc1. We discovered that the primary insufficiency lies in the pLR588. Finally, plasmid pLR588 was modified by replacing

518 A. S. Hanner and L. N. Rusche Table 1 Yeast strains used in this study

Strains Genotype Source JRY4013 W303-1a MATa ADE2 lys2D can1-100 his3-11 leu2-3,112 trp1-1 ura3-1 J. Rine LRY1098/JRY4608 JRY4013 sir3D::LEU2 J. Rine LRY3080 JRY4013 sir3D::LEU2 sir4D::KlSIR4-HA-HIS3 This study LRY3081 JRY4013 sir3D::LEU2 ScSIR4::HA-HIS3 This study LRY1021 MATa his4D P. Schatz

the open reading frame of ScSIR4 with that of KlSIR4 Mating assay (KLLA0F13420g) to generate pLR1122. The tagging cas- Semiquantitative mating assays were performed as previ- settes were isolated from both plasmids and used to trans- ously described (Lynch and Rusche 2010) using MATa cells form S. cerevisiae. (LRY1098) containing a plasmid expressing the chimeric Plasmid construction SIR3/ORC1 genes and a selectable marker TRP1.These cells were grown to midlog phase, resuspended in CSM- Plasmids used in this study (Table 2) were derived from Trp at a density of 10 OD/ml, and diluted in a 10-fold pLR911, a yeast CEN/TRP1 plasmid expressing Sir3-V5 from series in CSM-Trp. For the plating control, 3 mlofeach the ScSIR3 promoter. This plasmid was created by replacing dilution was spotted on CSM-Trp. For mating, an equal the HA tag in pJR2299 (ScSIR3-HA plasmid from Jasper volume of MATa mating partner (LRY1021) was added to Rine) with a V5 tag amplified from pFA6a–63GLY–V5– each dilution at a constant concentration of 10 OD/ml in hphMX4 (Funakoshi and Hochstrasser 2009) using homol- YPD (1% yeast extract, 2% Peptone, 2% glucose); 3 mlof ogous recombination. To express Orc1 proteins from that mixture was spotted on YM to select for prototrophic nonduplicated species in S. cerevisiae, plasmids were con- diploids. structed in which the open reading frame of ScSIR3 in pLR911wasreplacedwiththeORC1 open reading frame Immunoblotting from another species. ORC1 from Kluyveromyces lactis was Immunoblots were performed as previously described isolated from plasmid pLR824 (Hickman and Rusche (Hickman and Rusche 2010). Cells were grown to an 2010), ORC1 from Zygosaccharomyces rouxii was isolated OD600 of 1.0, and fixed with a final concentration of 10% from yeast strain CBS732 (Pribylova and Sychrova 2003) TCA prior to cell lysis; 45 OD equivalents of fixed cells were and ORC1 from Lachancea kluyveri was derived from plasmid lysed by vortexing 5 min in the presence of silica beads pLR0649 (van Hoof 2005). To generate chimeric ScSIR3 and (0.5 mm dia. #11079105z, BioSpec Products) in 40 ml lysis fi KlORC1 genes, portions of KlORC1 were ampli ed from buffer [10 mM HEPES pH 7.9, 150 mM KCl, 1.5 mM pLR824 and used to replace the homologous regions of MgCl2, 0.5 mM DTT, 10% glycerol, 5 mg/ml chymostatin, ScSIR3 in plasmid pLR911. 2 mg/ml pepstatin A, 156 mg/ml benzamidine, 35.2 mg/ml Plasmids were generated either by homologous recombi- TPCK, 174 mg/ml PMSF, and 13 Complete Protease Inhibi- nation in yeast or by PCR stitching. For homologous recom- tor (Roche)]. Proteins were denatured by the addition of 1/3 bination, the parent plasmid, pLR911, was cut with a volume sample buffer (30% glycerol, 15% b-mercaptoethanol, restriction enzyme within the region to be replaced, and a 6% SDS, 200 mM Tris pH 6.8, 0.08 mg/ml bromophenol PCR product was generated containing the desired region of blue) and incubation at 95° for 5 min. Finally, samples were fl D KlORC1 anked by 40 bp of ScSIR3 sequence. A sir3 clarified by centrifugation. Aliquots (10 ml) of protein extract strain (LRY1098) was transformed with both DNA fragments were resolved on a 7.5% acrylamide gel, transferred to mem- (150 ng of cut plasmid and 300 ng of PCR product), and brane (Amersham 45004008), and probed to detect Sir3/Orc1 cells containing recombined plasmids were selected on chimeric proteins (anti-V5, ab3792; Millipore) or Pgk1 (ab113687; CSM-Trp medium. Candidate plasmids were recovered from Abcam) as a loading control. yeast and amplified in Escherichia coli. For PCR stitching, which is a variant of site-directed mutagenesis, a PCR product RNA isolation and cDNA synthesis was created in which the desired region of KlORC1 was RNA was extracted in hot phenol (Schmitt et al. 1990) from fl anked by 25 bp of ScSIR3 sequence. This PCR product cells grown to an OD600 of 1.0 in CSM-Trp. For cDNA synthe- was then used as a primer to amplify and modify pLR911. sis, genomic DNA was removed from RNA samples in a total The cycling parameters were 3 min at 95°, 18 cycles of 40 sec volume of 30 ml containing 3 mg of RNA, DNAse buffer, and at 95°,50secat62°, and 27 min at 68°, followed by 20 min 3 units Ambion Turbo DNase (AM2238) at 37° for 30 min. at 68°. The newly synthesized plasmid was recovered through The samples were then extracted with phenol/chloroform E. coli after the template DNA had been digested with DpnI, and precipitated with ethanol. cDNA was generated using which cleaves only methylated DNA. All plasmids were con- the iScript Advanced cDNA Synthesis Kit (170-8843; Bio- firmed by sequencing. Rad). A 20 ml reaction containing 10 ml of DNase treated

Specialization of Sir3 AAA+ Domain 519 Table 2 Plasmids used in this study

pRS314 (Sikorski and Hieter 1989), pJR2299 (Rine lab), and pLR824 (Hickman and Rusche 2010) were previously described. All other plasmids were generated for this study.

RNA, 13 iScript Advanced Mix, and 1 ml iScript reverse tran- by real-time PCR to quantify the recovery of silenced loci scriptase was incubated for 30 min at 42° and then inacti- (HMR-E and TelVI-R) and a control locus (ATS1) relative to vated for 5 min at 85°. a standard curve prepared from input DNA. The ratio of the cDNA was quantified using a Bio-Rad CFX384 real-time experimental locus to the control locus is represented as rel- PCR machine. The silenced genes (HMRa1 or YFR057W) and ative enrichment. Primers are listed in Table 3. a control gene (NTG1) were quantified relative to a standard Yeast immunofluorescence curve prepared from genomic DNA (LRY1098 containing pLR0911). Primers are listed in Table 3. The ratio of the Immunofluorescence was performed as previously described silenced gene to the control gene was determined for each (Keeling and Miller 2011). The yeast cell wall was digested sample. Two technical replicates (independent RNA isola- with Zymolyase (10 mg/ml in 1 M sorbitol/PBS) for 45 min tions) were prepared from each of two biological replicates at room temperature. Cells were then blocked with 5 mg/ml (independent transformants). The ratios for all four replicate BSA in PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, samples were averaged, and this value was normalized to the 1.8 mM KH2PO4, pH 7.4) for 1 hr, incubated overnight in average ratio in cells expressing ScSir3-V5. primary antibody (anti-V5, ab3792; Millipore) diluted 1:100 in PBS, and then incubated 2 hr at room temperature in Chromatin immunoprecipitation secondary antibody (111-165-144, Cy3-conjugated Affini- Chromatin immunoprecipitation was performed as previously Pure Goat Anti-Rabbit IgG; Jackson ImmunoResearch). Fi- described (Rusche and Rine 2001). Cells were grown in CSM- nally, the cells were stained with DAPI (1 mg/ml in PBS)

Trp, harvested at an OD600 of 1, and crosslinked for 30 min for 15 min and visualized as previously described (Chavel in 1% formaldehyde. For immunoprecipitation, 2 ml of anti et al. 2014) on a Zeiss PLAN-APOCHROMAT 1003 objective V5 antibody (Millipore ab3792) was used. Two technical using the DIC, rhodamine and DAPI channels. Images were replicates (independent immunoprecipitations) were pre- captured for multiple ﬁelds of view, and the subcellular lo- pared from each of two biological replicates (independent calization of the Cy3 signal was scored for 150 cells of each transformants). The immunoprecipitated DNA was analyzed genotype.

520 A. S. Hanner and L. N. Rusche Table 3 Oligonucleotides used for quantitative PCR MATa cells will only mate if HMRa is silenced. The haploid a a Description Oligo Sequence MAT cells were plated with a MAT tester strain, and prototrophic diploids were selected on minimal medium (Figure ChIP primers ATS1 ggtaacgcagccgtttgagc 2A). Controls indicated that yeast cells lacking Sir3 did not ATS1 cctcatcgtgccccagtcc mate (row 1), whereas cells expressing ScSir3 did mate HMR-E gtaccctttttattgcatatag (rows 2 and 3). In contrast, cells expressing nonduplicated HMR-E gtttgcaaatgtggacgaaaag Orc1 proteins from Zygosaccharomyces rouxii, K. lactis,orL. 0.3 kb from Tel VI-R ctgagttcggatcactacacac kluyveri did not mate (rows 4–6). The nonduplicated Orc1 0.3 kb from Tel VI-R gatcattgaggatctataatcaac 1.3 kb from Tel VI-R gtaggaatgcgaaaggatctgtc proteins were expressed at levels comparable to ScSir3 (Fig- 1.3 kb from Tel VI-R gtgctaaaggaatccccagagac ure 2B), indicating that the failure to complement was not 1.7 kb from Tel VI-R caaattgcaggcaaataaacac due to lack of expression. This inability of the nonduplicated 1.7 kb from Tel VI-R gcatgatgatccccaataac Orc1 proteins to restore silenced chromatin formation in the 2.3 kb from Tel VI-R gacggaaagagggcagaaag absence of ScSir3 is consistent with the hypothesis that Sir3 2.3 kb from Tel VI-R cagcgcacgtttgtttgatg 3.3 kb from Tel VI-R gagttttgtagtagcgatccgac evolved a new property after duplication. 3.3 kb from Tel VI-R gtagtgtaaccataagaaatccag These results differ from a previous report that ORC1 from cDNA primers L. kluyveri does complement a sir3D mutation in S. cerevisiae NTG1 caaggttcctcgatttagtg (van Hoof 2005). However, the reported complementation is NTG1 gactccagatcagacaagaac extremely weak, and we have been unable to reproduce this YFR057W caatagcctttcaaagcatac YFR057W gctttgttacgcttgcacttg result using the original strains and plasmids (data not shown). HMR- 1 a atggaaagtaatttgactaaagtag The KlOrc1 AAA+ domain was insufficient for silencing HMR- 1 a ccaaactcttacttgaagtggag in S. cerevisiae To delineate the region of KlOrc1 that is insufficient in S. cerevisiae, and thus may have evolved new molecular prop- Data availability erties, we created chimeric proteins of ScSir3 and KlOrc1. These chimeric proteins were expressed from a ScSIR3 pro- All strains and plasmids are available upon request. All data moter and had a C-terminal V5 tag. As a starting point, we necessary for evaluating our conclusions are represented focused on the four structural divisions of the protein (Figure within this paper. 1A and Figure 3A) and replaced the BAH, linker, AAA+, and winged helix domains of ScSir3 with the homologous por- Results tions of KlOrc1. All these chimeric proteins were expressed at levels comparable to ScSir3 (Figure 3B). Nonduplicated Orc1 proteins did not complement a We first tested whether these chimeric proteins were able sir3D mutation in S. cerevisiae to silence HMRa using the mating assay (Figure 3C). Cells Given that Orc1 and Sir3 subfunctionalized (Hickman and expressing chimeric proteins containing the BAH, linker, or Rusche 2010), nonduplicated Orc1 proteins might be winged helix domains of KlOrc1 were able to mate as effi- expected to complement a sir3D mutation in S. cerevisiae. ciently as full-length ScSir3 (Figure 3C, constructs 5, 6, 8). In To test this hypothesis, we expressed three nonduplicated contrast, cells expressing a chimeric protein containing the Orc1 proteins from the ScSIR3 promoter in an S. cerevisiae KlOrc1 AAA+ domain did not mate (Figure 3C, construct 7). sir3D strain. To assess silenced chromatin formation, we ex- To directly assess the ability of these chimeric proteins to amined whether the cryptic mating-type locus HMRa was repress transcription, we measured the levels of a1 mRNA repressed using a semi quantitative mating assay. These from HMRa as well as YFR057W at telomere VI-R, which is

Figure 2 Nonduplicated Orc1 proteins did not complement a sir3D mutation in S. cerevisiae. (A) Mating was assessed for sir3D MATa cells (LRY1098) carrying plasmids encoding ScSir3 (pJR2299, pLR911), Z. rouxii Orc1 (pLR1058), K. lactis Orc1 (pLR915), L. kluyverii Orc1 (pLR1056) or an empty vector (pRS314). Cells were diluted 10-fold and spotted on CSM lacking tryptophan (CSM- Trp) as a plating control (right). The same diluted cells were combined with a constant amount of MATa tester cells (LRY1021) and spotted on minimal medium (YM) to detect the prototrophic diploids. The evolutionary relationship of the species (Byrne and Wolfe 2005) is indicated by a cladogram on the left. (B) Expression of Orc1/Sir3 proteins in the cells used in (A) was examined by immunoblotting. Orc1/Sir3 proteins were detected with antibodies against V5. Pgk1 (3-phosphoglycerate kinase) served as a loading control.

Specialization of Sir3 AAA+ Domain 521 Figure 3 The KlOrc1 AAA+ domain was insufficient for silencing in S. cerevisiae. (A) The chimeric proteins studied are represented by graphics, in which white indicates ScSir3 sequences and black indicates KlOrc1 sequences. (B) Expression of the chimeric proteins described in (A) was assessed by immunoblotting, as for Figure 2. (C) Mating assays were conducted as for Figure 2. S. cerevisiae cells expressed the indicated ScSir3-KlOrc1 chimeric proteins. (D) Levels of a1 mRNA were measured by quantitative RT-PCR for cells expressing the indicated chimeric proteins. For each strain, a1 mRNA was quantified relative to a control locus, NTG1, and then mRNA levels were normalized to cells expressing ScSir3-V5. (E) Levels of YFR057W mRNA were measured as for (D). (F) The association of chimeric proteins with the HMR-E silencer was determined by ChIP. The x-axis represents the relative enrichment of the chimeric protein at the silencer compared to a control locus, ATS1. (G) The association of chimeric proteins with telomere VI-R was determined by ChIP as for (F). a read-out for telomeric silencing (Figure 3, D and E). In keep- To determine whether these chimeric proteins were de- ing with the mating assay, a1andYFR057W were no longer ficient in recruitment to silenced regions, we preformed repressed in the presence of KlOrc1 or the chimeric protein chromatin immunoprecipitation (ChIP) (Figure 3, F and G). containing the KlOrc1 AAA+ domain. These results indicate For this assay, we used an antibody against the V5 tag and that the primary insufficiency of KlOrc1 is in the AAA+ domain. examined relative enrichment compared to a control locus,

522 A. S. Hanner and L. N. Rusche Figure 4 ScSir3, KlOrc1, and chimeric proteins were predominantly nuclear. (A) The proteins examined are represented by graphics, in which white indicates ScSir3 sequences and black indicates KlOrc1 sequences. (B) Represen- tative images of Cy3-labeled V5-tagged proteins. The first column shows the DIC images merged with both fluorescence channels. The next two columns show Cy3 and DAPI stain- ing, and the last column shows the merged Cy3 and DAPI channels. (C) The subcellular localization of the Cy3 signal was scored for 150 cells. Localization was nuclear (purple), nuclear and cytoplasmic (gray), or cytoplasmic (green). In addition, some cells had no fluorescence (yellow).

ATS1, which is not associated with Sir proteins. We found tivity interferes with the assembly of silenced chromatin. If that the chimeric proteins containing the KlOrc1 BAH or this were the case, disrupting this activity might enable the winged helix domains had a modest decrease in association protein to generate heterochromatin in S. cerevisiae. Therefore, with HMR-E and telomere VI-R. In contrast, full-length KlOrc1 we mutated the Walker A box, which is a canonical motif re- and the chimeric protein containing the K. lactis AAA+ domain quired for ATP binding. In particular, we placed the nonfunctional did not localize to HMR-E or telomere VI-R. Thus, the insuffi- Walker A box of ScSir3 into full-length KlOrc1 or the chimeric ciency in the AAA+ domain is due to a deficiency in recruitment protein containing the KlOrc1 AAA+ domain (Figure 5A). How- rather than a later step in chromatin assembly or transcriptional ever, this substitution did not rescue the ability of KlOrc1 to repression. achieve mating in S. cerevisiae (Figure 5). Therefore, there are One potential explanation for the lack of function of KlOrc1 likely other regions of the KlOrc1 AAA+ domain that are insuf- and the chimeric protein containing the KlOrc1 AAA+ domain ficient for silencing, and it is not simply the presumed ATPase is that they were not properly localized to the nucleus. There- activity of this domain that hinders function in S. cerevisiae. fore, we examined the subcellular localization of these pro- The base subdomain of the KlOrc1 AAA+ domain was fl teins using an immuno uorescence assay (Figure 4). From a insufficient for silencing in S. cerevisiae population of 150 cells, we determined the numbers of cells with nuclear, cytoplasmic, or nuclear and cytoplasmic local- To narrow down the region of the AAA+ domain of KlOrc1 ization of the V5 tag. In addition, some cells lacked any sig- that was insufficient in S. cerevisiae, we created additional nal, presumably because the antibodies failed to enter the chimeric proteins. First, the major structural units of the cells. All the V5-tagged proteins were primarily nuclear and AAA+ domain were replaced with the homologous portions had similar fractions of cells with each localization pattern. of KlOrc1, namely the pre-AAA+, base, and lid subdomains This included the functional ScSir3-V5 and chimeric protein (Figure 6A). These chimeric proteins were all expressed (Fig- containing KlOrc1 BAH and the nonfunctional KlOrc1-V5 and ure 6B). Cells expressing a chimeric protein containing the chimeric protein containing the KlOrc1 AAA+ domain. Thus, KlOrc1 AAA+ base subdomain were unable to mate (Figure improper localization did not account for the lack of function 6C, construct 12) or repress transcription (Figure 6, D and E). of KlOrc1 or the chimeric protein containing KlOrc1 AAA+. In contrast, the chimeric proteins containing KlOrc1 pre-AAA+ or lid subdomains promoted mating and transcriptional si- Disruption of Walker A box in KlOrc1 did not lencing (constructs 11, 13). Moreover, the chimeric protein restore silencing containing the KlOrc1 AAA+ base subdomain was not asso- The AAA+ domain of KlOrc1 is presumed to have ATPase ciated with silenced loci (Figure 6, F and G). Nevertheless, activity, based on the presence of key conserved amino acids although it did not function, the chimeric protein containing and the critical role for this activity in DNA replication. the KlOrc1 AAA+ base subdomain was properly localized to However, the Sir3 AAA+ domain has no detectable ATPase the nucleus (Figure 4). activity. Therefore, one potential explanation for the inability We noted that the KlOrc1 pre-AAA+ subdomain also dis- of the KlOrc1 AAA+ domain to function in silenced chroma- rupted function at Telomere VI-R but not HMR (construct tin formation in S. cerevisiae is that its presumed ATPase ac- 11, compare Figure 6, E and G with Figure 6, D and F). The

Specialization of Sir3 AAA+ Domain 523 Figure 5 Disruption of Walker A box in KlOrc1 did not restore silencing. (A) An alignment of Walker A boxes from K. lactis Orc1 and S. cerevisiae Sir3 and Orc1. The bar indicates the amino acids that were replaced in KlOrc1 (pLR1103) or a chimeric protein with the KlOrc1 AAA+ domain (pLR1119). (B) Ex- pression of the proteins with mutated Walker A domains was assessed by immunoblotting. (C) Mating assays were conducted for S. cerevisiae cells expressing the indicated chimeric proteins.

pre-AAA+ subdomain of ScSir3 interacts with Rap1 (Moretti domain (rows 5–7). Furthermore, these chimeric proteins were and Shore 2001), and this interaction is especially critical for not recruited to HMRa or to telomere VI-R (Figure 7, D and E). recruitment to telomeres. Perhaps the pre-AAA+ subdomain Therefore, the insufficiency of the KlOrc1 AAA+ base subdomain of KlOrc1 has lower affinity for ScRap1. Nevertheless, the is most likely not due to an inability to bind Sir4. subdomain does function at HMR-E. The KlOrc1 bridging helix destabilized ScSir3 To further delineate the critical region within the base subdomain, we made additional chimeric proteins. The small- In addition to the AAA+ domain, a second region of KlOrc1 est portion of KlOrc1 that was nonfunctional in S. cerevisiae that disrupted function in ScSir3 was the bridging helix be- was the base subdomain without its first two a-helices (con- tween the AAA+ and winged helix domains. We originally struct 14). This chimeric protein was unable to silence at HMRa found that a chimeric protein containing the KlOrc1 winged or telomere VI-R and did not associate with these loci (Figure 6). helix domain plus the bridging helix was not functional (Fig- Substitutions of individual helices within the base subdomain ure 8, construct 17). To localize the portion of this domain did not perturb function (data not shown). Thus, the critical that interfered with silencing, we created chimeric proteins deficiency in KlOrc1 lies within the AAA+ base subdomain. containing just the winged helix domain or the bridging helix. A chimeric protein containing the KlOrc1 winged helix Providing KlSir4, the natural binding partner of KlOrc1, domain was expressed and restored mating similarly to ScSir3 did not restore silencing (Figure 8, construct 8). In contrast, the chimeric protein con- One known property of the AAA+ base domain in ScSir3 is to taining just the KlOrc1 bridging helix was unable to restore bind ScSir4 (Ehrentraut et al. 2011). If this interaction sur- silencing (Figure 8, construct 18). Moreover, this chimeric pro- face has evolved over time, species–specific contacts between tein was not expressed (Figure 8B). This lack of expression was Sir3/Orc1 and Sir4 might prevent KlOrc1 from associating not due to a sequence error in the plasmid, and occurred for with ScSir4.Asafirst test of this possibility, we generated a three independent transformants. In fact, the mRNA for this chimeric protein in which the Sir4-interacting loop of ScSir3 chimeric protein was present in these transformants (data not (Ehrentraut et al. 2011) was replaced with the homologous shown). Therefore, we considered the possibility that the loop from KlOrc1. If this loop from KlOrc1 does not interact KlOrc1 bridging helix destabilizes the ScSir3 protein. with ScSir4, this chimeric protein should be nonfunctional. This potential instability of the chimeric protein could However, it functioned equivalently to full-length ScSir3 occur because the KlOrc1 bridging helix does not pack well (Figure 6, construct 15). against the ScSir3 protein. If so, stability might be maintained As a further test of the possibility that KlOrc1 cannot if the KlOrc1 bridging helix were placed into ScSir3 in a interact with ScSir4, we determined whether the ability of manner that retains appropriate packing interactions. To test KlOrc1 to form heterochromatin could be restored by expressing this idea, we created two additional chimeric proteins. One its natural partner, Sir4 from K. lactis.Todoso,wereplacedthe chimeric protein contains the last quarter of the KlOrc1 bridg- genomic copy of ScSIR4 with KlSIR4.Importantly,cellsexpressing ing helix and the KlOrc1 winged helix domain against which ScSir3 and KlSir4 were able to mate at a low level [Figure 7B, it packs (Oppikofer et al. 2013), and the second chimeric row 3; see also Astrom and Rine (1998)], indicating that KlSir4 protein contains the other three-quarters of the bridging helix does function as part of the S. cerevisiae SIR complex. Neverthe- and the AAA+ lid domain against which it packs (Ehrentraut less, KlOrc1 remained unable to restore mating in cells expressing et al. 2011). These two chimeric proteins were expressed KlSir4 (Figure 7B, row 4). This lack of function was also observed (Figure 8B, constructs 19 and 20), indicating that protein for chimeric proteins containing portions of the KlOrc1 AAA+ stability was restored. Moreover, these chimeric proteins

524 A. S. Hanner and L. N. Rusche Figure 6 The base subdomain of the KlOrc1 AAA+ domain was insufﬁ- cient for silencing in S. cerevisiae. (A) The structure of the AAA+ domain (PDB-3te6) is colored to show the three subdomains, with a portion of the pre-AAA+ subdomain in green, the base subdomain in red, and the lid subdomain in blue. Only a small frag- ment of the pre-AAA+ domain was modeled in the crystal structure. The Sir4-interaction loop is colored violet. The graphical representation of chimeric proteins is indicated. (B) Expression of chimeric proteins was assessed by immunoblotting. (C) Mating assays were conducted using cells expressing the indicated chimeric proteins. mRNA levels were measured for a1 (D) or YFR057W (E) using quantitative RT-PCR for cells expressing the indicated proteins. The association of chimeric proteins with the HMR-E silencer (F) or telomere VI-R (G) was determined by ChIP.

functioned similarly to ScSir3 (Figure 8, C–G). Given that minus its first two alpha helices. We hypothesize that this portion neither portion of the bridging helix interferes with function of Sir3 acquired new molecular properties after duplication. when it occurs in the presence of its proper packing partner, The AAA+ base subdomains of duplicated Orc1 and Sir3 we conclude that the lack of function of the chimeric protein have distinct functions, consistent with this region evolving containing the full KlOrc1 bridging helix results from poor after duplication. The AAA+ base subdomain of Orc1 interlocks packing against ScSir3. Thus, the KlOrc1 bridging helix does with other AAA+ domains in ORC (Chen et al. 2008; Bleichert not lack a property present in ScSir3, and there is no evidence et al. 2015), and these interactions promote ATP binding and that a new molecular property evolved in either the bridging hydrolysis. In contrast, the AAA+ subdomain of Sir3 contacts helix or the winged helix domain. the heterochromatin protein Sir4 and is also proposed to bind nucleosomes (Ehrentraut et al. 2011). We considered whether the inability of KlOrc1 to function in the Sir complex is due to its Discussion potential ATPase activity. However, disrupting the Walker A In this study, we identified a discrete portion of the non- ATP-binding domain of KlOrc1 did not recover the ability to duplicated KlOrc1 protein as being insufficient for hetero- function in the silencing complex (Figure 5). Therefore, the chromatin formation in the duplicated species S. cerevisiae. potentialATPaseactivityinitselfisnotthereasonthatKlOrc1 Specifically, the insufficiency lies in the AAA+ base subdomain fails to generate heterochromatin in S. cerevisiae.

Specialization of Sir3 AAA+ Domain 525 Figure 7 Coexpression of KlSir4 and KlOrc1 did not restore silencing in S. cerevisiae. (A) The graphical representation of chimeric proteins. (B) Mating assays were conducted using cells expressing the indicated chimeric proteins, as well as KlSir4-HA or ScSir4-HA. (C) Expression of chimeric proteins was assessed by immunoblotting. The association of chimeric proteins with the HMR-E silencer (D) or telomere VI-R (E) was determined by ChIP.

In ScSir3, the AAA+ base subdomain does not bind or the best characterized nucleosome-binding domain of hydrolyze ATP, but instead binds ScSir4. A similar interaction Sir3 is the BAH domain (Onishi et al. 2007; Armache is thought to occur in K. lactis, with KlOrc1 binding KlSir4. et al. 2011), the existence of a lower affinity nucleo- It was therefore possible that KlOrc1 fails to function in some-binding region in the AAA+ domain is supported S. cerevisiae because it cannot bind ScSir4. Indeed, Sir4 is one by biochemical studies (Hecht et al. 1995; Altaf et al. of the most rapidly evolving proteins within the Saccharomyces 2007; Ehrentraut et al. 2011). It is possible that this second- clade (Zill et al. 2010), and thus could theoretically form species- ary nucleosome-binding region does not exist in nondupli- specific interactions with Sir3/Orc1. However, given that KlSir4 cated Orc1 proteins, such as KlOrc1, and only evolved after complements a Scsir4D mutation (Astrom and Rine 1998), it the AAA+ base domain was no longer constrained to assem- must interact with S. cerevisiae Sirproteins,andinmuchthesame ble into ORC. Further studies will be required to test this way that ScSir4 does. Moreover, expression of KlSir4 in S. cere- possibility. visiae did not restore silencing in the presence of KlOrc1 (Figure This study suggests that Sir3 and Orc1 followed the EAC or 7). Therefore, the insufficiency within the AAA+ base subdomain Gene Sharing model of evolution after duplication (Hughes is most likely not due to its inability to bind ScSir4. 1994; Hittinger and Carroll 2007). Even though the nondu- The other proposed function for the AAA+ base subdomain plicated KlOrc1 contributes to heterochromatin formation in and surrounding regions is to bind nucleosomes. Although its native context (Hickman and Rusche 2010), it was unable

526 A. S. Hanner and L. N. Rusche Figure 8 The K. lactis bridging helix destabilized ScSir3. (A) The AAA+ (PDB-3te6) and Winged Helix (PDB-3zco) domains are colored to show the bridging helix (black), AAA+ lid subdomain (blue), and winged helix domain (gray). Portions of the bridging helix are modeled in each of the two struc- tures, although some amino acids are not in either structure. The graphical representation of each chimeric protein is indicated to the right. (B) Expression of chimeric proteins was assessed by immunoblotting. (C) Mating assays were conducted using S. cerevisiae cells expressing the indicated ScSir3-KlOrc1 chimeric proteins. mRNA levels were measured for a1 (D) or YFR057W (E) using quantitative RT-PCR. The association of chimeric proteins with the HMR-E silencer (F) or telomere VI-R (G) was determined by ChIP.

to complement a sir3D mutation in S. cerevisiae (Figure 2). We conclude that Sir3 specialized within the AAA+ base Moreover, nonduplicated Orc1 proteins from two other spe- subdomain after subfunctionalization. Our data are not con- cies also failed to function in S. cerevisiae, suggesting that sistent with the scenarios that the ATPase of Orc1 interferes Sir3 gained new molecular properties after subfunction- with silencing, or that KlOrc1 fails to bind ScSir4. Therefore, alization. A potential “conflict” experienced by the non- we favor the possibility that this region gained the ability to duplicated Orc1 might be that because the AAA+ domain bind nucleosomes. must pack into the ORC it cannot evolve surfaces that pack optimally with the Sir chromatin. Perhaps due to this Acknowledgments conflict, heterochromatin formation in K. lactis requires additional factors not needed in S. cerevisiae.Inparticu- We thank Ambro van Hoof and Hana Sychrová for strains lar, the Sum1 DNA-binding protein is required for silenc- and plasmids. We also thank Gerald Koudelka for help an- ing at cryptic mating-type loci in K. lactis (Hickman and alyzing the structural modules of ScSir3, and Jacky Chow Rusche 2009), but is not needed in S. cerevisiae. The further for help with the fluorescence microscopy. This research was evolution of Sir3 after duplication may have eliminated the need supported by startup funds provided to L.N.R. by the College for Sum1. Thus, functional differences in the proteomes of S. of Arts and Sciences at the State University of New York at cerevisiae and K. lactis may offset functional differences in ScSir3 Buffalo and National Science Foundation (NSF) grant MCB- and KlOrc1. 1615367.

Specialization of Sir3 AAA+ Domain 527 Literature Cited Hughes, A. L., 1994 The evolution of functionally novel proteins after gene duplication. Proc. Biol. Sci. 256: 119–124. Altaf, M., R. T. Utley, N. Lacoste, S. Tan, S. D. Briggs et al., Keeling, J. W., and R. K. Miller, 2011 Indirect immunofluores- 2007 Interplay of chromatin modifiers on a short basic patch cence for monitoring spindle assembly and disassembly in yeast. of histone H4 tail defines the boundary of telomeric heterochro- Methods Mol. Biol. 782: 231–244. matin. Mol. Cell 28: 1002–1014. King, D. A., B. E. Hall, M. A. Iwamoto, K. Z. Win, J. F. Chang et al., Armache, K. J., J. D. Garlick, D. Canzio, G. J. Narlikar, and R. E. 2006 Domain structure and protein interactions of the silent Kingston, 2011 Structural basis of silencing: Sir3 BAH domain in information regulator Sir3 revealed by screening a nested de- complex with a nucleosome at 3.0 A resolution. Science 334: 977– letion library of protein fragments. J. Biol. Chem. 281: 20107– 982. 20119. Astrom, S. U., and J. Rine, 1998 Theme and variation among Li, H., and B. Stillman, 2012 The origin recognition complex: a silencing proteins in Saccharomyces cerevisiae and Kluyveromy- biochemical and structural view. Subcell. Biochem. 62: 37–58. ces lactis. Genetics 148: 1021–1029. Luo, K., M. A. Vega-Palas, and M. Grunstein, 2002 Rap1-Sir4 Bell, S. P., J. Mitchell, J. Leber, R. Kobayashi, and B. Stillman, binding independent of other Sir, yKu, or histone interactions 1995 The multidomain structure of Orc1p reveals similarity initiates the assembly of telomeric heterochromatin in yeast. to regulators of DNA replication and transcriptional silencing. Genes Dev. 16: 1528–1539. Cell 83: 563–568. Lynch, P. J., and L. N. Rusche, 2010 An auxiliary silencer and a Bleichert, F., M. R. Botchan, and J. M. Berger, 2015 Crystal structure boundary element maintain high levels of silencing proteins at of the eukaryotic origin recognition complex. Nature 519: 321–326. HMR in Saccharomyces cerevisiae. Genetics 185: 113–127. Byrne, K. P., and K. H. Wolfe, 2005 The yeast gene order browser: Moretti, P., and D. Shore, 2001 Multiple interactions in Sir pro- combining curated homology and syntenic context reveals gene tein recruitment by Rap1p at silencers and telomeres in yeast. fate in polyploid species. Genome Res. 15: 1456–1461. Mol. Cell. Biol. 21: 8082–8094. Chang, J. F., B. E. Hall, J. C. Tanny, D. Moazed, D. Filman et al., Onishi, M., G. G. Liou, J. R. Buchberger, T. Walz, and D. Moazed, 2003 Structure of the coiled-coil dimerization motif of Sir4 2007 Role of the conserved Sir3-BAH domain in nucleosome and its interaction with Sir3. Structure 11: 637–649. binding and silent chromatin assembly. Mol. Cell 28: 1015– Chavel, C. A., L. M. Caccamise, B. Li, and P. J. Cullen, 2014 Global 1028. regulation of a differentiation MAPK pathway in yeast. Genetics Oppikofer, M., S. Kueng, J. J. Keusch, M. Hassler, A. G. Ladurner 198: 1309–1328. et al., 2013 Dimerization of Sir3 via its C-terminal winged Chen, Z., C. Speck, P. Wendel, C. Tang, B. Stillman et al., helix domain is essential for yeast heterochromatin formation. 2008 The architecture of the DNA replication origin recogni- EMBO J. 32: 437–449. tion complex in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. Pribylova, L., and H. Sychrova, 2003 Efficient transformation of USA 105: 10326–10331. the osmotolerant yeast Zygosaccharomyces rouxii by electropo- Ehrentraut, S., M. Hassler, M. Oppikofer, S. Kueng, J. M. Weber ration. J. Microbiol. Methods 55: 481–484. et al., 2011 Structural basis for the role of the Sir3 AAA+ Rusche, L. N., and J. Rine, 2001 Conversion of a gene-specific domain in silencing: interaction with Sir4 and unmethylated repressor to a regional silencer. Genes Dev. 15: 955–967. histone H3K79. Genes Dev. 25: 1835–1846. Rusche, L. N., A. L. Kirchmaier, and J. Rine, 2002 Ordered nucle- Force, A., M. Lynch, F. B. Pickett, A. Amores, Y. L. Yan et al., ation and spreading of silenced chromatin in Saccharomyces 1999 Preservation of duplicate genes by complementary, de- cerevisiae. Mol. Biol. Cell 13: 2207–2222. generative mutations. Genetics 151: 1531–1545. Schiestl, R. H., and R. D. Gietz, 1989 High efficiency transforma- Funakoshi, M., and M. Hochstrasser, 2009 Small epitope-linker tion of intact yeast cells using single stranded nucleic acids as a modules for PCR-based C-terminal tagging in Saccharomyces carrier. Curr. Genet. 16: 339–346. cerevisiae. Yeast 26: 185–192. Schmitt, M. E., T. A. Brown, and B. L. Trumpower, 1990 A rapid Gaudier, M., B. S. Schuwirth, S. L. Westcott, and D. B. Wigley, and simple method for preparation of RNA from Saccharomyces 2007 Structural basis of DNA replication origin recognition cerevisiae. Nucleic Acids Res. 18: 3091–3092. by an ORC protein. Science 317: 1213–1216. Schneider, B. L., W. Seufert, B. Steiner, Q. H. Yang, and A. B. Hecht, A., T. Laroche, S. Strahl-Bolsinger, S. M. Gasser, and M. Futcher, 1995 Use of polymerase chain reaction epitope tag- Grunstein, 1995 Histone H3 and H4 N-termini interact with ging for protein tagging in Saccharomyces cerevisiae. Yeast 11: SIR3 and SIR4 proteins: a molecular model for the formation of 1265–1274. heterochromatin in yeast. Cell 80: 583–592. Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors and Hickman, M. A., and L. N. Rusche, 2009 The Sir2-Sum1 complex yeast host strains designed for efficient manipulation of DNA in represses transcription using both promoter-specific and long- Saccharomyces cerevisiae. Genetics 122: 19–27. range mechanisms to regulate cell identity and sexual cycle in Stoltzfus, A., 1999 On the possibility of constructive neutral evo- the yeast Kluyveromyces lactis. PLoS Genet. 5: e1000710. lution. J. Mol. Evol. 49: 169–181. Hickman, M. A., and L. N. Rusche, 2010 Transcriptional silencing Triolo, T., and R. Sternglanz, 1996 Role of interactions between functions of the yeast protein Orc1/Sir3 subfunctionalized after the origin recognition complex and SIR1 in transcriptional si- gene duplication. Proc. Natl. Acad. Sci. USA 107: 19384–19389. lencing. Nature 381: 251–253. Hittinger, C. T., and S. B. Carroll, 2007 Gene duplication and the van Hoof, A., 2005 Conserved functions of yeast genes support adaptive evolution of a classic genetic switch. Nature 449: 677–681. the duplication, degeneration and complementation model for Hoppe, G. J., J. C. Tanny, A. D. Rudner, S. A. Gerber, S. Danaie et al., gene duplication. Genetics 171: 1455–1461. 2002 Steps in assembly of silent chromatin in yeast: Sir3- Zhang, W., S. Sankaran, O. Gozani, and J. Song, 2015 A Meier- independent binding of a Sir2/Sir4 complex to silencers and role Gorlin syndrome mutation impairs the ORC1-nucleosome asso- for Sir2-dependent deacetylation. Mol. Cell. Biol. 22: 4167–4180. ciation. ACS Chem. Biol. 10: 1176–1180. Hou, Z., D. A. Bernstein, C. A. Fox, and J. L. Keck, 2005 Structural Zill,O.A.,D.Scannell,L.Teytelman,andJ.Rine,2010 Co-evolution basis of the Sir1-origin recognition complex interaction in transcrip- of transcriptional silencing proteins and the DNA elements specify- tional silencing. Proc. Natl. Acad. Sci. USA 102: 8489–8494. ing their assembly. PLoS Biol. 8: e1000550. Huang, X., and W. Miller, 1991 A time-efficient, linear-space local similarity algorithm. Adv. Appl. Math. 12: 337–357. Communicating editor: O. Rando

528 A. S. Hanner and L. N. Rusche