Interaction of DUE-B and Treslin During the Initiation of DNA Replication

Home , DNA unwinding element, ORC1, ORC2, ORC4, TOPBP1

Wright State University CORE Scholar

Browse all Theses and Dissertations Theses and Dissertations

2016

Interaction of DUE-B and Treslin during the initiation of DNA replication

Sumeet Poudel Wright State University

Follow this and additional works at: https://corescholar.libraries.wright.edu/etd_all

Part of the Biomedical Engineering and Bioengineering Commons

Repository Citation Poudel, Sumeet, "Interaction of DUE-B and Treslin during the initiation of DNA replication" (2016). Browse all Theses and Dissertations. 2063. https://corescholar.libraries.wright.edu/etd_all/2063

This Dissertation is brought to you for free and open access by the Theses and Dissertations at CORE Scholar. It has been accepted for inclusion in Browse all Theses and Dissertations by an authorized administrator of CORE Scholar. For more information, please contact [email protected]. INTERACTION OF DUE-B AND TRESLIN DURING THE INITIATION OF DNA REPLICATION

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy

SUMEET POUDEL B.S., Saint Cloud State University, 2010

2016 Wright State University

SUMEET POUDEL

2016

WRIGHT STATE UNIVERSITY

GRADUATE SCHOOL

January 17, 2017

I HEREBY RECOMMEND THAT THE DISSERTATION PREPARED UNDER MY SUPERVISION BY Sumeet Poudel ENTITLED Interaction of DUE-B and Treslin during the Initiation of DNA Replication BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Doctor of Philosophy.

Michael Leffak, Ph.D. Dissertation Director

Mill W. Miller, Ph.D. Director, Biomedical Sciences Ph.D. Program

Robert E.W. Fyffe, Ph.D. Vice President for Research, Dean of the Graduate School Committee on final examination

J. Ashot Kozak, Ph.D.

Steven J. Berberich, Ph.D.

Yongjie Xu, Ph.D.

Scott E. Baird, Ph.D. ABSTRACT

Poudel Sumeet Ph.D., Biomedical Sciences Program, Wright State University, 2016. Interaction of DUE-B and Treslin during the initiation of DNA replication.

The initiation of DNA replication is a highly regulated and coordinated process.

To ensure that the entire genome is replicated only once per cell cycle, many replication proteins are assembled on the chromatin in a step-wise and cell cycle dependent manner.

This process is controlled by interaction of replication proteins, post-translational modifications of the replication factors, control of cellular localization of the proteins, or replication factor degradation after their function terminates. Two kinases, CDK (cyclin dependent kinase) and DDK (Dbf4/Drf1 dependent kinase), play important roles during the initiation stage of DNA replication.

The c-myc DNA unwinding element-binding protein (DUE-B) is an essential replication protein that interacts with both the replicative helicase (minichromosome maintenance (MCM)) and the helicase activator (Cdc45) at mammalian replication origins, and is required to load Cdc45 onto chromatin in Xenopus egg extracts. Here, using co-immunoprecipitation experiments, I show that DUE-B interacts with the protein

Treslin/TICRR (TopBP1- interacting, replication stimulating protein/TopBP1-interacting, checkpoint and replication regulator, simply refered to as Treslin) which has dual roles in replication and checkpoint in vivo. Treslin, an orthologue of yeast Sld3, is an essential

iv CDK substrate during replication initiation and DNA damage signaling. Treslin collaborates with TopBP1 in the Cdk2-mediated loading of Cdc45 onto replication origins. The interaction between DUE-B and Treslin does not require the presence of

DNA but requires TopBP1, another protein with dual functions in replication and checkpoint. TopBP1, a human homolog of budding yeast Dpb11, is a multi BRCT domain containing protein. It is a scaffolding protein that allows interaction between replication and checkpoint proteins. I show that the interaction between DUE-B and

Treslin is cell cycle and checkpoint regulated. Interaction between DUE-B and Treslin increases during mid/late G1 phase when the cells prepare for the initiation of DNA replication, and this interaction is significantly reduced in the presence of DNA damage.

The interaction of DUE-B with Treslin is mediated through the C-terminal region of

DUE-B, which contains multiple serine and threonine residues. Mutation of all serine and threonine residues to phosphomimic or phosphodeficient residues regulate DUE-B binding to the MCM helicase, but did not affect the interaction between DUE-B and

Treslin. I also show that knockdown of Treslin in HeLa cells inhibits chromatin binding of DUE-B, and in reverse experiments knockdown of DUE-B inhibits chromatin binding of Treslin. TopBP1 knockdown did not affect the chromatin binding of DUE-B and

Treslin but affected Cdc45 chromatin binding. Both DUE-B and Treslin knockdown reduces the levels of Cdc45 on the chromatin. In a time-course experiment, DUE-B,

Treslin and TopBP1 follow similar temporal chromatin binding profiles during mid/late

G1 phase and Cdc45 chromatin binding follows the binding of DUE-B, Treslin and

v TopBP1 to the chromatin. Replicative stress caused by aphidicolin and hydroxyurea also reduced the chromatin binding of DUE-B, Treslin and Cdc45 but not TopBP1.

The data presented here show that interaction between DUE-B and Treslin is regulated by signals from the cell cycle to control the initiation of DNA replication when

DNA replication occurs normally and in the presence of replicative stress, and that the interaction of DUE-B and Treslin is an important step for the loading of the helicase activator, Cdc45, to activate the replicative helicase.

vi Table of Contents

INTRODUCTION………………………………………………………………………...1

DNA replication origins…………………………………………………………...1

DNA replication initiation in eukaryotic organisms………………………………6

Treslin and TopBP1 in Higher Eukaryotes ……………………………………...11

Stress induced DNA replication checkpoint response…………………………...16

The DNA Unwinding Element Binding protein, DUE-B, and its role in DNA

replication……………………………………………………………………...... 20

MATERIALS AND METHODS………………………………………………………...23

Cell culture, Cell transfection and cells synchronization………………………...23

Subcellular Protein Fractionation………………………………………………..24

Western Blotting…………………………………………………………………24

Co-immunoprecipitation (co-IP)/ Immunoprecipitation (IP)…………………….25

Flow Cytometry………………………………………………………………….26

Preparation of ultra-competent cells……………………………………………..26

Construction of plasmids………………………………………………………...27

Site directed mutagenesis………………………………………………………...28

Gibson Assembly/siRNA #1 resistant plasmids…………………………………29

RESULTS………………………………………………………………………………..30

I. DUE-B, Treslin and TopBP1 show a similar chromatin binding kinetics in G1

phase before the initiation of DNA replication……………………………….30

vii Binding of replication factors to chromatin before helicase activation……….30

Summary…………………………………………………………………………35

II. Interdependence of replication factor chromatin binding before helicase

activation. …………………………………………………………………….36

DUE-B is necessary for binding of Treslin and Cdc45 on chromatin………...37

Treslin is necessary for binding of DUE-B, Cdc45 and TopBP1 onto the

chromatin……………………………………………………………………...42

TopBP1 is necessary for binding of Cdc45 on the chromatin but not for DUE-B

and Treslin…………………………………………………………………….46

Summary…………………………………………………………………………47

III. DUE-B interacts with Treslin and TopBP1 in vivo………………………….50

Endogenous Treslin and TopBP1 interact with recombinant DUE-B……….50

Chromatin binding is not necessary for the interaction of Treslin and DUE-

B.……………………………………………………………………………..63

TopBP1 is necessary for the interaction of DUE-B and Treslin……………..65

Summary…………………………………………………………………………66

IV. C- terminus region of DUE-B and its role interaction with Treslin……...... 70

C-Terminus tail of DUE-B is necessary for the interaction of DUE-B and

Treslin………………………………………………………………………..71

Phosphorylation status of DUE-B does not affect DUE-B and Treslin

interaction……………………………………………………………………74

viii C-terminal domain in DUE-B is also necessary for binding of Treslin to

chromatin…………………………………………………………………….83

Summary…………………………………………………………………………86

V. Interaction of DUE-B and Treslin is cell cycle regulated…………………….87

DUE-B and Treslin interaction is enhanced during G1 phase before replication

begins………………………………………………………………………...88

Summary…………………………………………………………………………93

VI. Activation of checkpoint decreases DUE-B, Treslin and TopBP1 interaction

and reduces DUE-B, Treslin and Cdc45 chromatin binding …………...... 93

Checkpoint activation with hydroxyurea and aphidicolin…………………..97

Chronic Treatment with HU and APH reduces the interaction between DUE-B

and Treslin………………………………………………………………….101

Checkpoint activation reduces DUE-B, Treslin and Cdc45 levels on the

chromatin but not TopBP1………………………………………………….104

Summary………………………………………………………………………..108

DISCUSSION…………………………………………………………………………..109

I. DUE-B is required for the chromatin binding of Treslin and vice versa…….109

II. DUE-B, Treslin and TopBP1 interact in vivo and C terminus is necessary for

the interaction of DUE-B and Treslin……………………………………….111

III. Cell cycle dependent analysis of DUE-B and Treslin shows that DUE-B and

Treslin interaction is enhanced just before replication begins………………113

ix IV. Activation of checkpoint pathway decreases DUE-B, Treslin and TopBP1

interaction and reduces DUE-B, Treslin and Cdc45 chromatin binding….....116

CONCLUSION…………………………………………………………...... 119

APPENDICES……………………………………………………………...... 120

REFERENCES…………………………………………………………...... 134

x LIST OF FIGURES

Figure 1: Simplified bacterial model postulated by Jacob et al. (1963) ………………….3

Figure 2: Unwinding of replication origin prior to DNA replication……………………10

Figure 3: Helicase activation by the action of DDK and CDK…………………………..13

Figure 4: The Human DNA Damage Response: A protein kinase cascade……………...19

Figure 5: Flow cytometry analysis shows that HeLa cells can be blocked at late G2/M phase boundary by nocodazole and released into normal cell cycle phases…………….33

Figure 6: Treslin, TopBP1 and DUE-B display similar chromatin binding profiles before replication initiation. Cdc45 chromatin binding follows the binding of DUE-B, TopBP1 and Treslin……………………………………………………………………………….34

Figure 7: Knockdown of DUE-B decreases binding of Treslin to the chromatin……….38

Figure 8: The effect of DUE-B knockdown on Treslin chromatin binding is specific...... 39

Figure 9: Wildtype DUE-B can rescue Treslin binding to the chromatin……………….41

Figure 10: Treslin knockdown reduces soluble nuclear and chromatin bound DUE-B…44

Figure 11: The effect of Treslin knockdown on DUE-B chromatin binding is specific…45

Figure 12: TopBP1 knockdown reduces Cdc45 chromatin binding without affecting

DUE-B and Treslin levels on chromatin…………………………………………………49

Figure 13: DUE-B interacts with TopBP1 in vivo……………………………………….52

Figure 14: DUE-B interacts with Treslin in vivo………………………………………...53

Figure 15: Cloning and Expression of FLAG-tagged wildtype (WT) DUE-B and FLAG- tagged ΔCT DUE-B into a pcDNA5/TO/FRT vector……………………………………55

xi Figure 16: Determination of concentration of doxycycline to induce FLAG-tagged DUE-

B in HeLa T-Rex inducible system………………………………………………………57

Figure 17: HeLa T-Rex FLAG-tagged WT DUE-B and FLAG-tagged ΔCT DUE-B clones induced with doxycycline………………………………………………………...58

Figure 18: Induction of FLAG-tagged DUE-B in HeLa T-Rex cells does not change the cell cycle profile………………………………………………………………………….59

Figure 19: DUE-B pulls down endogenous Treslin in tetracycline inducible system using

FLAG-tagged DUE-B……………………………………………………………………61

Figure 20: Transiently expressed FLAG-tagged Treslin can pull down endogenous DUE-

B. ………………………………………………………………………………………...62

Figure 21: Chromatin binding is not necessary for the interaction of DUE-B and

Treslin……………………………………………………………………………………64

Figure 22: TopBP1 is necessary for the interaction of DUE-B and Treslin……………..67

Figure 23: Crystal structure of N-terminus domain of DUE-B………………………….68

Figure 24: C-terminal domain of DUE-B is conserved in higher eukaryotes……………69

Figure 25: C-terminal tail of DUE-B is necessary for the interaction with Treslin……...73

Figure 26: Expression of C- terminal his6-tagged and N-terminal FLAG-tagged DUE-B,

ΔCT, serine/threonine mutated to aspartic acid (S/TD) and serine/threonine mutated to alanine (S/TA) mutants…………………………………………………………………..76

Figure 27: C-terminal serine/threonine phosphosites in DUE-B do not regulate the interaction between DUE-B and Treslin…………………………………………………77

xii Figure 28: HeLa T-Rex FLAG-tagged Treslin clones induced with doxycycline……….79

Figure 29: Induction of Treslin in HeLa T-Rex cells does not change the cell cycle progression profile……………………………………………………………………….80

Figure 30: Serine/threonine phosphosites do not regulate the interaction between DUE-B and Treslin……………………………………………………………………………….82

Figure 31: Analysis of siRNA resistant (siR) his6-tagged full length (fl) DUE-B and ΔCT

DUE-B…………………………………………………………………………………...84

Figure 32: C-terminus deletion mutant cannot facilitate the binding of Treslin to the chromatin………………………………………………………………………………...85

Figure 33: Flow profile for nocodazole blocked/ released HeLa T-Rex FLAG WT DUE-

B cells after induction with doxycycline……………………………………………...... 90

Figure 34: DUE-B and Treslin interaction is increased during G1 phase before DNA replication starts………………………………………………………………………….92

Figure 35: Direct role of Treslin in checkpoint pathway………………………………...95

Figure 36: DUE-B chromatin binding during normal DNA replication and in the presence of DNA damage. ………………………………………………………………………...96

Figure 37: Activation of checkpoint by hydroxyurea……………………………………99

Figure 38: Activation of checkpoint by aphidicolin……………………………………100

Figure 39: Activation of checkpoint pathway by hydroxyurea reduces the interaction between DUE-B, Treslin and TopBP1. ………………………………………………...102

xiii Figure 40: Activation of checkpoint pathway by aphidicolin reduces the interaction between DUE-B, Treslin and TopBP1. ………………………………………………...103

Figure 41: Checkpoint activation by hydroxyureas (HU) decreases the chromatin binding of DUE-B, Treslin, and Cdc45 but not TopBP1. ………………………………………106

Figure 42: Checkpoint activation by aphidicolin (APH) decreases the chromatin binding of DUE-B, Treslin, and Cdc45 but not TopBP1………………………………………..107

Figure 43: Model for DUE-B, Treslin and TopBP1 during DNA replication…...... 115

Figure 44: Model during DNA damage………………………………………………...118

Appendix 1: Plasmids used in this study……………………………………………….120

Appendix 2: Sequence Alignment of WT DUE-B, ΔCT DUE-B, ST/D DUE-B and ST/A

DUE-B………………………………………………………………………………….124

Appendix 3: Sequence alignment of WT DUE-B and siRNA resistant full length DUE-B and siRNA resistant ΔCT DUE-B……………………………………………………...125

Appendix 4: Site directed mutagenesis…………………………………………………126

Appendix 5: Colony PCR to test the integration of restriction digested fragments in a vector.…………………………………………………………………………………...127

Appendix 6: Gibson Assembly: General scheme of assembly or multiple overlapping oligos/PCR products (upto 6) into a vector. ……………………………………………128

Appendix 7: Oligos used for Gibson Assembly to make siRNA Resistant DUE-B plasmids...………………………………………………………………………………129

Appendix8: Creation of tetracycline inducible HeLa T-Rex cell lines. ………………..130

xiv

Table 1: Primers used in this study. ……………………………………………………131

Table 2: siRNAs used in this study……………………………………………………..132

Table 3: Summary of siRNA knockdown on chromatin binding profiles of replication factors…………………………………………………………………………………...133

xv ACKNOWLEDGEMENTS

I wish to thank my mentor Dr Michael Leffak for his guidance throughout the course of my doctoral training. I truly appreciate him for his invaluable input during my struggles, his guidance and for creating an excellent environment for my training. He has challenged my critical thinking abilities with unique questions and his patience. I will be forever thankful to him for his patience and guidance to develop me as a scientist. I would also like to thank past members of the laboratory Drs. Yanzhe Gao, Michael Kemp and Guoqi Liu for their assistance and for performing much of the background work which allowed me to propose and execute the experiments for my dissertation. Lastly, I would like to thank the past and present members of Leffak laboratory for their comments, criticisms, and ideas. They made the everyday journey to attain my doctoral degree pleasant and I will forever reminisce the memories that I created with all of them for the rest of my life.

xvi DEDICATION

To my family,

Whose constant love, support and belief made this dissertation possible.

xvii INTRODUCTION

DNA replication is a fundamental metabolic process that occurs in all eukaryotic organisms. When eukaryotic cells divide, their genome must be precisely duplicated. The process of DNA replication is limited to once and only once per cell cycle because over- replication leads to copy number heterogeneity, while under-replication of a segment of the genome causes loss of genome integrity and copy number heterogeneity (Tanaka and

Araki, 2011). Errors in DNA replication in unicellular organisms could lead to death, and in multicellular organisms can cause heritable diseases such as cancer, neurodegenerative disorders and developmental defects. Several replication factors play critical roles to carry out the process of DNA replication. When replication is not regulated properly, severe disorders, genome instability, and tumorigenesis can occur. Thus, the process of chromosomal DNA replication must be highly regulated and coordinated to allow survival.

DNA replication origins

Regulation of DNA replication involves at least two key elements: a target DNA sequence at which replication begins (known as an ‘origin of replication’) and specific proteins that promote replication initiation (initiators) (Jacob et al., 1963). The interaction of origin DNA and initiator proteins ultimately results in the assembly of replicative proteins; whose role is to load and activate the DNA helicase necessary to unwind DNA before replication (Figure 1)

1 DNA replication is initiated from preferred sites in eukaryotes, called origins of replication, in every cell cycle. In vivo, these replication origins contain information necessary for DNA replication to begin because DNA replication initiates reproducibly from localized regions of the genome in almost all eukaryotes (Yamada et al., 2004).

Replication origins are activated in S phase of the cell cycle, a process known as origin firing. The locations of replication origins are not random for most organisms. The process of DNA replication is best understood in budding yeast model (Saccharomyces cerevisiae). Analysis of the 12 million base pairs of the genome of budding yeast by different methods has identified about 700 replication origins. DNA replication starts at conserved specific sites known as Autonomously Replicating Sequences (ARS’s) in budding yeast (Wyrick et al., 2001; Xu et al., 2006; Nieduszynski et al., 2007). All replication origins analyzed in the budding yeast model contain ARS elements

(Marahrens and Stillman, 1992). The ARSs are less than 1 kilobase in length and consist of an 11-base pair ARS Consensus Sequence (ACS) and other ‘flanking’ B elements

(Dhar et al., 2012). The sites of ARS sequences dictate the loading of initiator proteins to begin DNA replication. The timing of ARS firing and the molecular steps of DNA replication are also best understood in budding yeast (reviewed in Masai et al., 2010).

Figure 1: Simplified bacterial model postulated by Jacob et al. (1963).

Regulation of DNA replication involves at least two elements: a target DNA sequence (presently known as an ‘origin of replication’) and a specific initiator protein.

The interaction of origin DNA and initiator proteins ultimately results in the assembly of replicative proteins.

3 In higher eukaryotes like humans, only a limited number of replication origins have been mapped due to the complexity of the genome (Karnani et al., 2010) in comparison to their budding yeast counterparts. Mammalian replication origins lack small sequence-specific sites like the ACSs in budding yeast, although in vitro analysis has shown nominal preference for initiator protein binding to negatively supercoiled

DNA and AT rich sequences (Remus et al., 2004). AT rich sequence and negatively supercoiled DNA may be differentially recognized by replication initiation factors.

Indeed, the Origin Recognition Complex (ORC) heterohexamer binds to the AT rich region through an “AT hook” in Orc4 in fission yeast and an AT rich ACS sequence is necessary for recognition by ORC to bind to the ARS (Chuang and Kelly, 1999; Bell and

Stillman, 1992; Kawakami et al., 2015). Negatively supercoiled DNA has been shown to play a common role in replication initiation for the recognition by replication factors and to assemble the replisome (reviewed in Bikard et al., 2010). Alternatively, since AT rich

DNA is energetically easier to denature than GC rich DNA, it might be favorable for the helicase to associate and unwind such regions of the genome. Consistent with this hypothesis, (ATTCT)n repeats can functionally replace the human DNA unwinding element (DUE) at the c-myc replication origin suggesting the importance of AT rich sequence at replication origins (Liu et al., 2007).

Due to the complexity of genome, of the estimated 30,000 to 50,000 origins in humans, only a small number of replication origins have been thoroughly characterized

(Leffak and James, 1989; Liu et al., 2003; Piaxao et al., 2004; Hamlin et al., 1992;

Abdurashidova et al., 2003; Debatisse et al., 2004, Mechali, 2010). These replication origins include dormant origins that are not normally activated unless the cells are under

4 replication stress like DNA damage or activation of checkpoint signaling (Blow et al.,

2011). Unlike their budding yeast counterparts, metazoans possess either large replication initiation zones (~54 kb) with multiple inefficient replication sites or short DNA fragments (~2-10 kb) with high initiation efficiency. The Chinese hamster dihydrofolate reductase (DHFR) replication origin (Burhans et al., 1991; Heintz et al., 1983; Altman and Fanning, 2002) is an example of an origin with large initiation zone while the c-myc

(Berberich et al., 1995; Trivedi et al., 1998; Malott and Leffak, 1999), lamin B2

(Biamonti et al., 1992) and β-globin (Aladjem et al., 1998) initiation zones are examples of short high efficiency origins. While some origins fire early (early firing), others fire late (late firing) (Raghuraman et al., 2001). Most of the origins of replication known so far in mammalian chromosomes are early firing (c-myc, DHFR, MCM4) (Gilbert, 2002)).

β-globin is a mid or late firing origin, although it can fire early when transcribed

(Aladjem, 2004). Although no sequence specific homology from yeast models to humans exists, the function of replication origins is to always act in cis for replication initiation and this feature is conserved between organisms. Lack of specific consensus sequences of replication origins in higher eukaryotes makes understanding the process of DNA replication a challenging task.

DNA replication begins with the assembly of pre-replication complexes (pre-

RCs) at thousands of DNA replication origins during the G1 phase of the cell cycle.

However, only a small subset of origin is activated during the S phase and is regulated in a specific temporal order (Fragkos et al., 2015). Not all replication origins are used during normal replication and the activation of replication origins are linked to chromosome organization and structure, cell growth and replicative stress (Jeon et al.,

5 2005; Blow et al., 2011, Chen et al., 2013). Importantly, when DNA replication is challenged by replicative stress, origin firing is prevented by the activation of an S-phase checkpoint (Santocanale and Diffley, 1998; Dimitrova and Gilbert, 2000). Once the replicative stress is cleared and the checkpoint signal is mitigated, dormant origins are activated to allow completion of DNA replication in a timely fashion (Blow et al., 2011;

Woodward et al., 2006). This is believed to be generally true, but in common fragile sites, where there are few origins, and incomplete replication leads to double strand break.

DNA replication initiation in eukaryotic organisms

Initiation of DNA replication is tightly regulated in a cell cycle dependent manner. Activation of replication origin occurs as a two-step reaction: licensing and firing (Figure 2). The licensing step begins in late mitosis (M) and early G1 phase of the cell cycle where initiator proteins bind origins of replication to form protein-DNA complexes called pre-replicative complexes (pre-RC’s). In this step, an inactive form of the MCM hexameric helicase is loaded onto the origin. The firing step occurs in S phase where the helicase is activated by the action of several other replication factors (discussed below), and bidirectional replication forks are established for DNA synthesis (Bell and

Dutta, 2002; Diffley, 2004; Douglas and Diffley, 2016).

The activation of the replicative helicase and initiation of DNA replication requires the formation of pre-replication complex (pre-RCs, licensing step) and pre- initiation complex (pre-IC, activation step/firing step). The first step of licensing is the binding of a six sub-unit protein Origin Recognition Complex 1-6 (ORC1-6) to the chromatin. ORC was first identified in yeast by DNA foot printing experiments (Bell and

6 Stillman, 1992) and recognizes replication origin sites in the chromosome (DePamphilis,

2005). ORC binding to the chromatin acts as the platform for the recruitment of other replication factors on to the replication origins. ORC is inactivated during the cell cycle progression by selective dissociation/reassociation of Orc1 sub-unit from chromatin bound ORCs and degradation. Orc1 is selectively released from chromatin as cells enter

S phase, converted to mono- or diubiquitinated form, and then deubiquitinated and rebound to chromatin during the M-to-G1 transition (Li and DePamphills, 2002). Two other replication factors, Cdc6 (cell division cycle protein 6) (Bueno and Russell, 1992) and Cdt1 (Cdc10 dependent transcript 1) (Hofmann and Beach, 1994), are the first proteins that are recruited to ORC and ORC/Cdc6/Cdt1 cooperate to load an inactive double hexamer helicase, MCM2-7 (mini-chromosome maintenance protein complex 2-

7), onto the chromatin. MCM2-7 is loaded by the physical interaction of ORC sub-units with CDC6 (Newport and Harvey, 2003). The C-terminus tail of Cdt1, which also physically interacts with MCM, is also required for the loading of the MCM2-7 complex on the chromatin (Takara and Bell, 2011). The levels and activities of Cdc6 and Cdt1 are strictly limited to the origin-licensing step just before replication initiation begins. Once the functions of Cdc6 are carried out, it is phosphorylated by CDK1 and targeted for proteosomal degradation (Drury et al., 1997). Cdt1 on the other hand is degraded or inhibited by the action of geminin after replication initiation commences (reviewed in

Kim and Kipreos, 2007). ORC, Cdc6 and Cdt1 cooperate to load MCM2-7 onto chromatin (Figure 2) as an inactive head-to-head double hexamer around double-stranded

DNA in the absence of CDK activity (Diffley et al., 1994; 1995; Aparicio et al., 1997;

7 Donovan et al., 1997; Liang and Stillman, 1997; Tanaka et al., 1997; Bell and Dutta,

2002).

In eukaryotes, loading and activation of MCM2-7 complex are two separate events during the initiation of DNA replication. The MCM complex on its own has limited helicase activity as purified MCM 4/6/7 shows limited activity in vitro (Ishimi,

1997). Activation of MCM2-7 requires post-translational modifications by kinases and recruitment of activation partners such as GINS (Go, Ichi, Nii, and San; five (Sld5), one

(Psf1), two (Psf2), and three (Psf3) in Japanese) (Takayama et al., 2003) and Cdc45 (cell division cycle 45) (Kneissl et al., 2003) to form the CMG complex (Cdc45, MCM2-7 and

GINS). This occurs when the CDK activity is high during the G1 to S phase transition

(Diffley et al., 1994; Bell and Dutta, 2002) and this requires the activity of several key replication factors. Binding of Cdc45 and GINS stimulates the helicase activity of the

MCM2-7 complex by several orders of magnitude (Bruck and Kaplan, 2011). Once activated, CMG unwinds the origin in the preparation for DNA replication.

Two kinases DDK (Dbf4/Drf1-dependent kinase) and CDK (cyclin dependent kinase) play important roles during DNA replication initiation (Figure 2). MCM chromatin binding can only occur during late M to G1 phase when CDK and DDK kinase activity is low (Bell and Dutta, 2002). During the G1-S phase transition, the kinase activities of DDK and CDK are elevated and phosphorylation of a series of substrates promotes the loading of the MCM activators (Figure 3). The ultimate goal of CDK and

DDK phosphorylation is to activate the helicase activity of the MCM complex. DDK phosphorylates chromatin bound MCM sub-units 2, 4 and 6 and relieves the inhibitory activity of MCM4 (Sheu and Stillman, 2010). Phosphorylated MCM can interact with

8 Cdc45 and GINS (Hardy et al., 1997; Zou and Stillman, 2000). In budding yeast, CDK phosphorylates two substrates, Sld2 (Synthetic lethality with Dpb11) and Sld3, which allows for loading Cdc45 (helicase activator) to activate MCM helicase (Zegerman and

Diffley, 2007). Phosphorylation of the budding yeast replication factors Sld2 and Sld3 promotes their binding to Dpb11 (DNA polymerase B sub-unit 11), a dual replication and checkpoint protein containing two BRCT (BRCA1 (breast cancer susceptibility gene 1) C terminus repeats) (Kamimura et al., 1998, 2001; Zegerman and Diffley, 2007; Ilves et al.,

2010) and interaction of phosphorylated Sld2 and Sld3 with Dpb11 is necessary for recruitment of Cdc45 to the MCM helicase. In higher eukaryotes like humans ReqQ4,

Treslin/ TICRR and TopBP1 recapitulate primary functions and show some limited structural homology with Sld2, Sld3 and Dpb11 respectively.

Interaction of Sld2 and Sld3 with Dpb11 promotes the recruitment of Cdc45 and

GINS to the MCM complex to form the CMG complex and the activation of replicative helicase. After the MCM2-7 helicase is activated, the origin is unwound and DNA synthesis begins. The conversion of an inactive MCM double hexamer into a functional helicase also involves several other replication factors, including Sld7, Mcm10, Ctf4,

RPA (replication protein A) and DNA polymerases ε (leading strand synthesis), δ

(lagging strand synthesis), α (lagging strand/primase) (Tanaka et al., 2011; Vo et al.,

2014; Im et al., 2009; Burgers, 2009).

Figure 2: Unwinding of replication origin prior to DNA replication.

A six sub-unit protein complex, ORC1-6, is loaded on the chromatin first which designates the replicative origin. Two replication factors, Cdc6 and Cdt1, facilitate the loading of a head-to-head double hexamer of inactive helicase MCM2-7 to form pre- replicative complex (pre-RC) in late M and early G1 phase of cell cycle when the CDK and DDK activity is low, a process known as origin licensing. During the G1 to S phase transition, when the CDK and DDK activity is high, many replication factors are phosphorylated to load Cdc45 and GINS on to the MCM2-7 complex to form a CMG complex and form pre-initiation complex (pre-IC). Activation of helicase allows for unwinding of DNA and initiation of DNA replication.

10 Treslin and TopBP1 in Higher Eukaryotes

In yeast, Sld2 and Sld3 are the minimal CDK substrates for replication initiation in budding yeast, but until recently their human homologs were not known (Zegerman and Diffley, 2007). Phosphorylated Sld2 interacts with Dpb11, which is required for

Cdc45 chromatin loading and DNA replication initiation. RecQ4 (RecQ protein-like 4) is a helicase essential for repairing damaged DNA (Fan and Luo, 2008) and appears to be a candidate for the human Sld2 ortholog, as it shares some sequence similarity at the N- terminus region with Sld2 and can bind TopBP1. RecQ4 is also phosphorylated by CDK, although oddly, phosphorylation of RecQ4 is not necessary to interact with TopBP1and it is not required for Cdc45 chromatin binding in Xenopus egg extract (Sangrithi et al.,

2005; Matsuno et al., 2006; Im et al., 2009, Gaggioli et al., 2014). Thus, the relationship between Sld2 and RecQ4 is unclear and requires further examination. Meanwhile,

Treslin/ TICRR was found to recapitulate the function of Sld3 (Kumagi et al., 2011;

Sansam et al., 2010; Muller et al., 2011).

Treslin is currently considered as the Sld3 ortholog in higher eukaryotes. It has dual replication and checkpoint function (Hassan et al., 2013, discussed below) just like its yeast ortholog Sld3. Treslin shares distant homology with yeast Sld3 (Sanchez-Pulido et al., 2010) and is required for recruitment of Cdc45 and for DNA replication in both human cell culture and Xenopus egg extract model (Kumagi et al., 2010; 2011). Treslin also interacts with TopBP1 (DNA topoisomerase II binding protein, the human homolog of Dpb11) in a CDK dependent manner (Figure 3, Kumagi et al. 2010; 2011; Sansam et al., 2010). CDK phosphorylation at the conserved serine (S) 1000 of Treslin is necessary for both interaction with TopBP1 and for DNA replication, while BRCT domains 1 and 2

11 in TopBP1 are required to interact with the C terminal domain of Treslin (Kumagi et al.,

2010; Boos et al., 2011). Treslin also binds to the Mcm3 and Mcm5 sub-units of Mcm2–7 and competes with GINS for interaction with Mcm3 and Mcm5, as in budding yeast.

Furthermore, Treslin binds to ssDNA, and ssDNA releases Treslin from Mcm3 and

Mcm5, analogous to the situation for yeast (Bruck and Kaplan, 2015). Treslin also stimulates human DDK phosphorylation of Mcm2 and DDK phosphorylation of human

Mcm2 decreases the affinity of Mcm5 for Mcm2 (Bruck ad Kaplan, 2015). Boos et al.

(2011) demonstrated that interaction of TopBP1 and Treslin is inhibited by Chk1 activation after S-phase interruption by hydroxyurea, just like Rad53 regulates Sld3 in budding yeast (Lopez et al., 2010; Zegerman and Diffley, 2010). Thus, Treslin seems to fit the role of Sld3 in higher eukaryotes by interaction with TopBP1 after phosphorylation by CDK to load Cdc45 to the helicase and with MCM helicase sub-units most likely before GINS binding to helicase because once GINS and Cdc45 is bound to the MCM helicase and activates the helicase presence of ssDNA allows for the release of Treslin from the replicative helicase.

Figure 3: Helicase activation by the action of DDK and CDK.

DDK and CDK phosphorylate multiple substrates for the activation of replicative helicase. During the G1 to S phase transition, when the DDK and CDK activity is high, several proteins are phosphorylated. DDK phosphorylates sub-units 2, 4 and 6 of the

MCM2-7 complex. CDK phosphorylates RecQ4 and Treslin, which allows for their interaction with TopBP1. Interaction of Treslin and RecQ4, and interaction of other replication factors like DUE-B and GEMC1 with TopBP1 allows for the loading of

Cdc45 (helicase activator) and GINS complex to activate the MCM helicase.

13 Treslin is a critical factor for negative regulatory mechanisms that suppress initiation of DNA replication (discussed below). The checkpoint-regulatory kinase Chk1 associates specifically with the C-terminal domain of Treslin (amino acids 1810- 1910, known as the TRCT domain) during normal DNA replication, in the absence of DNA damage. The most conserved stretch within the human TRCT domain of Treslin corresponds to the sequence LTQSPLL at amino acid positions 1,846–1,852. Mutation of

7 key residues on this C terminal end of Treslin abolishes the interaction between Treslin and Chk1 and induces increased loading of Cdc45 (Guo et al., 2015). Two residues,

S1893 and T1897, within the TRCT domain of Treslin are key Chk1 phosphorylation sites in vitro. Mutation of the LTQSPLL sequence in TRCT domain of Treslin to Treslin-

7A where all amino acids are mutated to alanine increases origin firing in human cells, and promotes initiation of replication (Guo et al., 2015). Significantly, abolition of the Treslin-Chk1 interaction results in elevated initiation of chromosomal DNA replication during an unperturbed cell cycle, which reveals a function for Chk1 during normal S phase. This increase is due to enhanced loading of Cdc45 onto potential replication origins.

Treslin also plays important function in the DNA damage checkpoint response.

Treslin stimulates ATR phosphorylation of Chk1 both in vitro and in vivo in a TopBP1- dependent manner after DNA damage, and phosphorylation of Treslin at Ser-1000 is important for its checkpoint function (Hassan et al., 2013). So, Treslin is a dual replication/checkpoint protein that directly participates in ATR-mediated checkpoint signaling.

14 In addition to Treslin two other replication factors, DUE-B (DNA unwinding element binding protein, discussed below) (Casper et al., 2005, Chowdhury et al, 2010), and GEMC1 (geminin coiled-coil containing protein 1) (Balestrini et al., 2010) have been shown to interact with TopBP1 and are necessary for DNA replication, suggesting a possibility that Sld3 function in higher organisms may require the collaboration of different proteins or a distribution of Sld3 function into different proteins in higher eukaryotes. GEMC1 is also highly conserved in vertebrates and is preferentially expressed in proliferating cells. Xenopus GEMC1 (xGEMC1) binds to TopBP1, which promotes binding of xGEMC1 to chromatin during pre-RC formation. GEMC1 interacts directly with replication factors like Cdc45 and the kinase Cdk2-CyclinE, through which it is heavily phosphorylated. Phosphorylated xGEMC1 stimulates initiation of DNA replication, whereas depletion of xGEMC1 prevents the onset of DNA replication owing to the impairment of Cdc45 loading onto chromatin by mediating TopBP1- and Cdk2- dependent recruitment of Cdc45 onto replication origins.

TopBP1, unlike its yeast homolog Dpb11, is an eight BRCT repeat containing protein. The main function of TopBP1 is to mediate protein-protein interaction via its

BRCT repeat, which are phospho-amino acid binding sites. It is required for initiation of

DNA replication (Labib, 2010; Garcia, 2005). It can directly bind Cdc45, and there is an interdependency of TopBP1, Cdc45 and GINS to be recruited to origins for the formation of the pre-initiation complexes (Van Hatten et al., 2002; Garcia et al., 2005; Schmidt et al., 2008). BRCT motif I and II in the N-terminal end are important and sufficient for the replication function of TopBP1 (Zegerman and Diffley, 2007; Yan and Michael, 2009;

Kumagi et al., 2010) while BRCT’s VII and VIII are important for ATR dependent Chk1

15 phosphorylation in response to replication stress (Yan et al., 2006; Yan and Michael,

2009). TopBP1 is also required for the activation of the G2/M checkpoint in response to

DNA damage (Garcia et al., 2005). Nevertheless, studies with conditional and separation of function mutants indicate that the checkpoint function of TopBP1 can be clearly separated from its DNA replication function (Yan et al., 2006).

Many replication proteins in humans display some level of sequence homology to their yeast counterparts (like the licensing factors ORC1-6 or MCM2-7 components). But replication factors necessary for origin firing and helicase activation (like Treslin (Sld3 ortholog in humans), TopBP1 (Dpb11 homolog in humans), or RecQ4 (Sld2 homolog in humans) show minimal sequence homology. Some factors required for helicase activation also have additional domains (4 BRCT domains in Dpb11 vs 8 BRCT domains in TopBP1) or display nominal functional conservation (Sld2 vs RecQ4). Since the process of DNA replication initiation is far more complex in humans than in yeasts, there are many additional replication factors like DUE-B, GEMC1, Mcm8 (Maiorano et al.

2005), Mcm10 (Douglas and Diffley, 2016), MTBP (Mdm2 binding protein) (Boos et al.

2011) whose functions remain to be characterized in detail.

Stress induced DNA replication checkpoint response

Events of replication stress constantly create obstacles during DNA replication.

Such events disturb the stability of the replication machinery (replication fork) and slow the progress of the replication fork by stalling the polymerase. These events can be physiological or environmental. Physiological stress can be induced by the generation of reactive oxygen species, the presence of non-B DNA secondary structures, the induction

16 of DNA breaks during processes such as homologous recombination or the action of enzymes like DNA topoisomerases (Symington and Gautier, 2011). Environmental stress can be caused by DNA-damaging agents like ultraviolet (UV) light or ionizing radiation

(IR), which modify DNA base pairing. To cope with such stresses and to maintain the integrity of DNA sequences, cells have evolved a complex system called a DNA damage checkpoint response.

The DNA damage checkpoint response is a collection of signal transduction pathways that are activated in response to DNA injuries. The proteins involved in these pathways are classified into three categories: sensors/mediators that recognize the damage and start the activation signal, transducers that carry and amplify the signals, and effectors that connect the activated signals with cell cycle machinery to generate a physiological outcome like cell cycle arrest, repair, senescence or apoptosis (Figure 4,

Ciccia and Elledge, 2010). Three kinases belonging to the phosphatidylinositol-3-OH kinase (PI3K or PIKK) family are at the apical end of DNA damage response and act as sensors in the checkpoint pathways: ATM (Ataxia Telangiectasia Mutated), ATR (ATM- and Rad3-related) and DNA-PK (DNA-dependent protein kinase) (Bartek and Lukas

2003; Lavin and Kozlov 2007). DNA double strand breaks activate ATM and DNA-PK, while ATR is mostly involved in monitoring replicative assaults, although there seem to be some forms of cross talk between these pathways (Falck et al., 2006). When double stranded DNA (dsDNA) breaks occur, MRN (Mre11-Rad50-Nbs1) recruits ATM to damaged sites, where it autophosphorylates and gets activated (Bakkenist and Kastan,

2003 ; Lee and Paul, 2007). Activated ATM phosphorylates the downstream effector

Chk2 with the help of other mediator proteins (Xu et al., 2002).

17 During replicative stress, ATR kinase is activated. The ATR dependent checkpoint constitutes a vital barrier to prevent replication of mutated DNA. ATR detects single strand DNA breaks and stalled replication forks (Figure 4). Upon induction of replication stress using hydroxyurea or aphidicolin, the ATR/Chk1 pathway is activated independently of ATM activity (Lee and Paul, 2007).

When cells are treated with replication stressors like hydroxyurea (HU), aphidicolin (APH) or DNA-damaging agent like UV irradiation (Lupardus et al., 2002;

Michael et al., 2000; Sogo et al., 2002), excessive single stranded DNA (ssDNA) accumulates at replication forks, and the single-strand binding (SSB) protein RPA immediately coats the ssDNA tracks. RPA protects ssDNA and contributes to checkpoint activation (Oakley and Patrick, 2010; Zou and Elledge SJ, 2003). ATR exists in a stable heterodimeric complex with ATR-interacting protein (ATRIP) (Cortez et al., 2001).

ATR-ATRIP activation relies on the action of TopBP1 to phosphorylate its downstream target Chk1 (Figure 4, Choi et al., 2010; Zhou et al., 2013; Kumagi et al., 2006; Dai and

Grant, 2010). Chk1 activation disrupts TopBP1/ Treslin interaction in HU treated cells

(which in turn impairs Cdc45 chromatin loading), stabilizes the replication fork function, blocks DDK kinase activity, blocks CDK activity via phosphorylation of Cdc25 and stops new origin firing (Furnari et al., 1997; Boos et al., 2011; Costanzo et al., 2003; Tsuji et al., 2008; Petermann et al., 2010). Treslin also plays important function in the checkpoint response. Treslin stimulates ATR phosphorylation of Chk1 both in vitro and in vivo in a

TopBP1-dependent manner after DNA damage. DUE-B binding to the chromatin is also inhibited during replicative stress (Gao, 2012).

18 Single Strand Double Break, Strand Break replication block

ssDNA, RPA Sensors ATM ATR-ATRIP TopBP 1 Mediators

Chk2, !H2AX Chk1 Transducers

Effectors p53, Cdc25, Nbs etc

Cdc45 loading, Cell cycle arrest Effect Repair, Apoptosis

Figure 4: The Human DNA Damage Response: A protein kinase cascade.

DNA damage response is a transduction pathway, which gets activated when

DNA injuries occur. This pathway is governed by three groups of proteins: sensors/ mediators that sense the damage and mediate the signaling; transducers that relay and amplify the signal, and effectors that convey the message to the cell cycle machinery for a physiological effect.

19 There are many outcomes of the DNA damage response, but the primary function of a checkpoint pathway is to slow down the cell cycle such that the cells get sufficient time to repair DNA damage if the assault can be repaired. If the damage is severe, checkpoint pathways convey signals for programmed cell death. Secondly, checkpoint also controls the replisome function but does not stabilizes replication machinery, prevents fork collapse during the damage and relays signals to restart replication when the damage is cleared (De Piccoli et al., 2012; Dungrawala et al., 2015).

The DNA Unwinding Element Binding protein, DUE-B, and its role in DNA replication

Using the c-myc DNA unwinding element as bait in a yeast one-hybrid screen,

DUE-B was identified as a novel replication protein that binds to the c-myc DNA replication origin. It is a small protein (209 amino acids) with a highly conserved N- terminal domain that shows strong homology to tRNA proofreading enzymes throughout prokaryotic and eukaryotic evolution. However, the C- terminal 60 amino acids are unique to higher organisms and show no significant homology to any other known proteins (Casper et al. 2005). The C-terminal tail of DUE-B is highly conserved in higher eukaryotes. DUE-B is an essential protein in the DNA replication pathway as immunodepletion of DUE-B from Xenopus egg extract inhibits DNA replication while siRNA knockdown in human cells delays the G1-S phase transition (Casper et al. 2005).

DUE-B binds to replication origins at the transition of G1-S phase and is released from origins shortly after DNA replication initiation. In Xenopus egg extract, immunodepletion of DUE-B inhibits DNA replication, and chromatin binding of DUE-B requires the pre-

20 existence of chromatin bound ORC, MCM and S phase CDK kinase activity (Gao, 2012).

DUE-B is necessary for chromatin loading of Cdc45 and RPA indicating a potential role in activating DNA unwinding and the MCM complex (Chowdhury et al., 2010). DUE-B purified from human cells forms a homodimer and supports DNA replication when added into DUE-B immunodepleted Xenopus egg extract. DUE-B interacts with TopBP1 and

Cdc45 via its C-terminal domain and this C-terminus is necessary for DNA replication

(Casper et al. 2005).

The C-terminal region of DUE-B also contains multiple serine/threonine sites necessary for its DNA replication activity. It is known that the state of DUE-B phosphorylation is maintained by the equilibrium between Cdc7-dependent phosphorylation and PP2A-dependent dephosphorylation (Gao et al., 2014). In egg extracts, alanine mutation of the DUE-B C-terminal phosphorylation blocks Cdc45 loading and inhibits DNA replication (Gao et al. 2014). Protein phosphatase 2A (PP2A) and DDK regulate the phosphorylation state of DUE-B as well as DUE-B’s ability to form high molecular weight complexes with MCM. Phosphorylation at the DUE-B C- terminus domain controls DUE-B activity in DNA replication, cell survival and DUE-B localization (Gao, 2012).

With all the background and since DUE-B and Treslin come into play at somewhat similar time points to carryout similar functions during the process of DNA replication initiation, this study was conducted to test the hypotheses that the interaction of DUE-B and Treslin is an important step for Cdc45 loading to the MCM helicase for its activation and DUE-B interaction with Treslin is regulated by the key Ser/Thr sites on the

21 C-terminal end of DUE-B which integrates signals from the cell cycle to control the initiation of DNA replication in human cells.

In this study, I show that DUE-B interacts with the essential replication and checkpoint protein Treslin. The interaction between DUE-B and Treslin is cell cycle dependent and requires the presence of TopBP1. Knockdown of DUE-B reduces the levels of Treslin in the soluble nuclear protein fraction and on chromatin. In reverse experiments, knockdown of Treslin decreases the levels of DUE-B in the soluble nuclear fraction and on chromatin. Cdc45 levels on chromatin are reduced when either Treslin or

DUE-B is knocked down. The interaction between Treslin and DUE-B requires the presence of the conserved C-terminal domain of DUE-B. N-terminus 150 amino acid of

DUE-B alone is not able to rescue Treslin chromatin binding, while the full length DUE-

B rescues Treslin chromatin loading, highlighting the importance of the C-terminal domain of DUE-B. DUE-B C-terminus phosphorylation does not seem to affect the interaction between DUE-B and Treslin, because mutants in which all C-terminal serine

(S) and threonine (T) are mutated to a phosphomimic (aspartic acid (D)) or phosphodeficient (alanine (A)) reside interact with Treslin like the wild-type DUE-B. The interaction between DUE-B and Treslin is significantly reduced when the checkpoint signaling pathways is activated. Activation of checkpoint response also reduces the levels of Treslin, DUE-B and Cdc45 on the chromatin, without affecting TopBP1 levels. The results of this study provide further details about the importance of DUE-B during the initiation of DNA replication and mechanism of how interaction of Treslin and DUE-B leads to the recruitment of Cdc45 to the MCM helicase for its activation. Details about these findings will be described in the subsequent chapters.

22 MATERIALS AND METHODS

Cell culture, transfection and synchronization HeLa cells and their derivatives were maintained as adherent cultures in DMEM containing 10% newborn calf serum with antibiotic antimycotic solution (Corning). A1

(stable his6-tagged wildtype DUE-B) and his6-tagged ΔCT DUE-B stable cells have been previously described (Chowdhury et al., 2010; Gao et al., 2014). HeLa T-Rex “Flp In” cells (Dr. Michael Kemp, Wright State University) were maintained in DMEM containing 10% newborn calf serum with blasticidin (5 ug/ml). A1 and stable his6-tagged

ΔCT-DUE-B cells were cultured in DMEM containing 10% NCS with G418.

293T T-Rex SRC2 cells were a kind gift from Dr. Weiwen Long (Wright State

University). To create tetracycline inducible stable cell lines expressing DUE-B or

Treslin, 80% confluent HeLa T-Rex “Flp In” cells were transfected by using

Lipofectamine 2000 (Invitrogen) with pcDNA5/TO/FRT plasmids carrying DUE-B or

Treslin along with pOG44 in 1:9 ratio in a 6 well plate. 24 hours after transfection, cells were transferred into a 15-cm plate and allowed to recover. The following day selection was started with hygromycin (100 ug/ml) for 15 days until distinct colonies appear.

Single colonies were picked and analyzed by western blotting after inducing the protein of interest with doxycycline (1000 ng/ml).

To synchronize cells at the late G2/mitotic (M) phase boundary, cells were incubated in complete medium supplemented with 50 ng/mL nocodazole (Sigma) for 18-

22 hours. Following treatment cells were “shaken off”, washed with phosphate-buffered

23 saline (PBS) and re-plated in DMEM with 10% fetal bovine serum. Induction of HeLa T-

Rex cells was done by treatment with doxycycline (1000ng/mL) for 24 hours along with treatment with nocodazole for synchronization.

Plasmid DNA and siRNA were transfected by using Lipofectamine 2000

(Invitrogen) by following the manufacturer’s protocol.

Subcellular Protein Fractionation

Subcellular protein fractionation kit from Thermo Scientific (Product #78840) was used for fractionation of soluble nuclear and chromatin bound proteins.

Western Blotting

Protein expression in cell lysates was determined by SDS-PAGE and Western blot analysis. Anti-human β-actin, and anti-FLAG antibodies were purchased from

Sigma. Rabbit anti-DUE-B antibodies (WRSU1) were raised in rabbits against a his6- tagged recombinant human DUE-B expressed in bacteria. WRSU4, rabbit anti-XOrc2 antibody was raised in rabbits against baculovirus-expressed recombinant Xenopus Orc2.

Both the WRSU1 and WRSU4 antibodies have been previously described (Casper et al.,

2005). WRSU5, rabbit anti-human TopBP1 antibody was raised in rabbits against E. coli expressed recombinant human TopBP1 (Chowdhury et al., 2010). WRSU1, 4, and 5 antibodies can recognize proteins from both human and Xenopus laevis. Anti-human

Cdc45 antibodies were purchased from Bethyl Laboratories. An anti-his6 antibody was purchased from Abcam. Anti-Chk1 phosphorylated Serine 345 antibody was purchased

24 from Cell Signaling. Anti-Treslin antibody was a kind gift from Dr. William G. Dunphy

(Caltech).

Co-immunoprecipitation (co-IP)/ Immunoprecipitation (IP)

All steps were carried out on ice or at 4 oC. Cells were lysed in high salt IP lysis buffer (20 mM Hepes-KOH, pH 7.4, 500 mM NaCl, 0.5% Triton X-100, 5 mM EDTA, 1 mM DTT, 10 mM β-glycerolphosphate, 1 mM NaF, 0.1 mM vanadate, 1 mM PMSF, 10 ug/mL chymostatin (Sigma), and 1X protease inhibitor cocktail (Sigma)). For his6-tagged pull-down, 10 mM imidazole was also included in the IP lysis buffer. Cells were sonicated for 5 seconds and supernatant was collected by centrifugation at 16,000 x g for

10 min. The supernatant was diluted with 20 mM Hepes-KOH (pH 7.4) to adjust NaCl concentration to 150 mM. The supernatant was again collected by centrifugation at

16,000 x g for 5 min. Lysates were pre-cleared with protein G agarose beads for 1 hour after equilibration of beads with diluted IP lysis buffer. 4 mg total protein was used for IP experiment (4% of total protein for input) and IP was carried out for 4 hours at 4 oC with appropriated beads (Ni-NTA (nickel charged nitrilotriacetic acid) beads for his6-tagged proteins) (Qaigen) and Red Anti-FLAG M2 beads (FLAG-tagged proteins) (Sigma)).

Proteins bound to the beads were washed with IP wash buffer (20 mM Hepes-

KOH, pH 7.5, 150 mM NaCl, 0.15% Triton X-100, 1.5 mM EDTA, 1 mM DTT, 10 mM

β-glycerolphosphate, 1 mM NaF, and 0.1 mM vanadate) 4 times. For his6-tagged proteins, 50 mM imidazole was also added to IP wash buffer. After wash steps, FLAG- tagged proteins were eluted with FLAG elution buffer (EB, 5 ug/ml FLAG peptide

(Sigma), Tris-buffered saline (TBS), 700 mM sodium chloride). His6-tagged proteins

25 were eluted by incubating beads with SDS sample buffer at 95 oC for 5 minutes. Samples were separated by SDS-PAGE and proteins were detected by western blotting.

Flow cytometry

To analyze cell cycle progression, DNA in cells was stained with propidium iodide and measured by flow cytometry. About 1 million cells were used for analysis by flow cytometry. Adherent HeLa cells were washed with PBS, trypsinized from their plate and pelleted by centrifugation at 500 x g at room temperature for 5 minutes. The cell pellet was washed once with PBS followed by another spin at 500 x g at room temperature for 5 minutes. The cell pellet was completely suspended in 1 mL ice- cold

70% ethanol and fixed at -20 °C for at least 20 minutes (ethanol fixed cells are stable for weeks). Fixed cells were pelleted by centrifugation at room temperature (500 x g for 5 minutes), washed once with PBS and suspended in 1 mL PBS. RNase A (25 ug/ml,

Sigma) was added and incubated at 37 °C for 20 minutes. Propidium iodide (50 ug/mL) was added to the PBS solution and incubated in the dark at 4 °C for 30 minutes. Stained cells were directly analyzed using the BD Accuri C6 flow cytometer under the FL2-A channel. Flow cytometry data was analyzed using the FCS Express 4 software.

Preparation of ultra-competent cells

DH5α cells were streaked out on LB plate without any selective marker. A single colony was picked and grown into a 10 mL starter culture in LB medium without antibiotic at 37°C overnight. The starter culture was inoculated into 250 mL antibiotic free LB medium and grown at 18 °C overnight. The following day, OD600 was measure

26 and when the OD600 was 0.55 cells were chilled on ice for 10 minutes to stop any growth.

Cells were spun down at 4000 x g at 4 °C for 10 minutes. LB supernatant was removed completely and the pellet was suspended in ice cold 75 mL sterile Inoue Transformation buffer (55 mM MnCl2, 15 mM CaCl2, 250 mM KCl, 10 mM PIPES/KOH, pH 6.7). Cells were spun down again at 4000 x g 4 °C for 10 minutes. Pellet was suspended gently in 20 mL ice-cold sterile Inoue Transformation buffer. Cell suspension was supplemented with

1.5 mL sterile DMSO and incubated on ice for 10 minutes. The cell suspension was aliquoted into 200 uL aliquots and stored in -80 °C until ready to use.

Construction of plasmids

Human DUE-B and its mutants with C-terminal his6-tag have been previously described (Gao et al., 2014) in pcDNA3.1 vector. N terminal FLAG-tagged DUE-B and its mutants were created by using site directed mutagenesis to insert Bam HI and Not I site by using the polymerase chain reaction (PCR) and cloned into pcDNA3.1 vectors for transient expression, or pcDNA5/TO/FRT vector (Dr. Michael Kemp, Wright State

University) to create tetracycline inducible cell lines. siRNA resistant plasmids were constructed using Gibson assembly (Gibson et al., 2008) and restriction digestion of Bam

HI site on the vector backbone in pcDNA3.1 and Bbv CI on the DUE-B sequence. pcDNA5/TO/Treslin-SF (S-protein and 3X FLAG tag) (Kumagi et al., 2014) was a generous gift from Dr William G. Dunphy (Caltech). Using sites Eco RV and Not I,

Treslin SF was cut out and cloned into pcDNA5/TO/FRT vector for use in HeLa T-Rex

“Flp-In” cells. pOG44 vector was from Dr. G. Wahl (Scripps Institute). TopBP1 and luciferase shRNAs were both in pKLO vector (Sigma).

27 Site directed mutagenesis

To add, remove or switch tags from the N- and C-terminus of DUE-B, site directed mutagenesis was utilized. Wild type DUE-B, ΔCT DUE-B, ST/D DUE-B and

ST/A DUE-B in pcDNA3.1 vector (Gao et al., 2014) were used as templates for PCR.

To add or remove tags and restriction digest sites, primers that sit partially on the template (15 to 25 base pairs) were designed (Appendix 4). Generally, the primers would contain some region of the target template to allow it for annealing and additional nucleotides to add/ remove a tag and restriction digest sites. To integrate a restriction digest sites, sequence of restriction digest site was integrated into the primer sequence in

5’-3’ depending on leading or lagging strand primes. Few (2-3) extra nucleotides were also added between the new integrated digest site followed by the primer sequence that anneal to the template. Site directed mutagenesis was carried out by using Phusion High-

Fidelity DNA Polymerase (NEB M0530S) for 25 rounds to minimize any errors. The

PCR product (500 ng) was digested by 10 units of Dpn I at 37 °C for 1 hour to remove template plasmid and passed through Zymo DNA Clean and Concentration column to remove excess enzymes, nucleotides and PCR buffer components. PCR fragments were digested and ligated into the vector of choice. 100-200 uL ultra-competent cells were transformed with 5 uL of ligation products by heat shock at 42 °C for 45 seconds. Heat shocked cells were supplemented with 1 mL drug free LB medium and recovered at 37

°C for 1 hour then plated onto LB plate with selectable antibiotics.

28 Gibson Assembly/ siRNA #1 resistant plasmids

Gibson assembly (New England Biolabs) was used to make siRNA resistant plasmid of WT DUE-B. The protocol was described by Gibson et al. (2009) to assemble multiple fragments of DNA with overlapping regions (15-80 bp) as shown in Appendix 6.

Gibson enzyme has an exonuclease which chews back the 5’ end of the fragment to create an overhang (so that the DNA fragments can anneal), a DNA polymerase activity which extends 3’ ends to fill in the gaps created by the exonuclease, and a DNA ligase activity which seals the nicks (Appendix 6). Using pcDNA3.1 his6-tagged WT DUE-B as a template, two oligonucleotides were designed for recloning (Appendix 7). The oligos overlap with each other and each oligo overlaps with part of the pcDNA 3.1 vector. Oligo one contains a siRNA (#1) resistant fragment where 9 nucleotide substitutions render the sequence resistance to siRNA #1 DUE-B. These substitutions do not change the codons without changing the amino acid sequence in DUE-B. Oligo 1 also overlaps with the vector pcDNA3.1 upstream of Bam HI digest site. Oligo 2 overlaps oligo 1 on the 5’ end and with the vector on the 3’ end (downstream of Bbv CI digest site). The fragments were assembled using Gibson assembly mastermix (New England Biolabs) at 50oC for 15 mins, transformed into NEB 5-alpha competent E. coli cells and grown on an agar plate.

Colonies were verified with colony PCR, restriction digest with Bam HI and Bbv CI and sequencing (Retrogen). Site directed mutagenesis was carried out to delete the 69 residue

C-terminus domain of WT DUE-B to create siRNA resistant ΔCT DUE-B by using pcDNA3.1siR (si resistant) WT DUE-B as a template.

29 RESULTS

I. DUE-B, Treslin and TopBP1 show a similar chromatin binding kinetics in G1 phase before the initiation of DNA replication.

Binding of replication factors to chromatin before helicase activation.

The process of DNA replication initiation requires binding and release of replication factors to and from the DNA at correct timing. The process is highly regulated to ensure faithful replication of the genome. DNA replication requires the sequential binding of replication proteins and is initiated by loading of ORC complex first, then an inactive helicase MCM2-7 and activation of MCM2-7 for the unwinding of DNA.

Previous data from our laboratory has shown that DUE-B is an essential component in the process of DNA replication initiation (Casper et al., 2005; Chowdhury et al., 2010).

Knocking down of DUE-B from HeLa cells using siRNA drastically decreased the amount of Cdc45 and RPA binding to the chromatin (Chowdhury et al., 2010). In

HCT116 cells that express a low level of a truncated form of Orc2, the amount of DUE-B chromatin binding was reduced (Chowdhury et al., 2010) and in Xenopus egg extracts

Orc2 depletion inhibits the binding of DUE-B, TopBP1 and Cdc45. Depletion of DUE-B from Xenopus extracts also delays Cdc45 and TopBP1 binding to chromatin (Gao, 2012).

These results indicate that DUE-B binds to the chromatin after pre-RC forms but before pre-IC formation. Treslin and TopBP1 are both replication and checkpoint proteins

30 necessary for helicase activation. Treslin collaborates with TopBP1 in a CDK dependent manner and this interaction is necessary for activation of helicase (Kumagi et al., 2010,

Sansam et al., 2010).

To understand the importance of order and timing of loading of replication factors during chromatin binding of DUE-B, Treslin and TopBP1 in human cells relative to other replication factors during the replication initiation process, block and release experiments in HeLa cells were done. In mammalian cells, many tissues show widely variety of overall cell cycle times but the duration of the S phase where DNA replication occurs is remarkably constant. In general, in normally dividing human cells, one round of cell cycle progression takes ~ 18-22 hours (G1 phase ~8-11 hours, S phase ~ 6-7 hours, G2 phase ~ 2-3 hours and M phase ~ 50 mins-1 hour (Figure 5, Hahn et al., 2009). For cell synchronization experiments, HeLa cells were treated with nocodazole (100 ng/ml), a microtubule polymerization inhibitor that blocks the cells at the late G2/ M boundary of the cell cycle and by shaking off loosely attached rounded, early mitotic cells. The cells were released into M phase by restoring the cells to normal growth medium (Terasima et al. 1963). Cells were harvested at various time points into M phase, throughout the G1 phase, and into the S phase of the cell cycle. Flow cytometer analysis (Figure 5) of the

DNA content shows that the cells were indeed block by nocodazole treatment and can progress into the following cell cycle phases after release. As per DNA content profiles in this experiments (Figure 5B), 0 hour corresponds to late G2 and early M phase, 3 hours corresponds to early G1 phase, 6 hours corresponds to mid G1, 9 hours corresponds to late G1 and in 12-hours cells start moving into S phase of the cell cycle.

31 Western blot analysis of chromatin bound proteins (Figure 6) at the indicated time points show that Orc2 is bound to the chromatin as early as late G2/ M phase and remained bound until the end of our analysis in S-phase (Figure 6). Binding of Orc2 indicates that ORC is part of the replication machinery that recognizes replication origins and serves as a platform for the recruitment of other replication factors onto the chromatin. Experiments from our lab using Xenopus system and many other groups have shown that MCM2-7 (the inactive form of helicase) follows binding of the ORC (Gao,

2012).

32 A B

Figure 5: Flow cytometry analysis shows that HeLa cells can be blocked at late

G2/M phase boundary by nocodazole and released into normal cell cycle phases.

(A) Cell cycle phases of normal dividing cells. In normally dividing cells, one round of cell cycle progression takes ~ 18-22 hours (G1 phase ~8-11 hours, S phase ~ 6-7 hours, G2 phase ~ 2-3 hours and M phase ~ 50 mins-1 hour. (B) DNA content of cells were analyzed for HeLa cells blocked and released after nocodazole treatment at indicated time points using Accuri C6 flow cytometer after staining with 50 ug/ml propidium iodide.

33 + nocodazole& release + nocodazole& release

Treslin

TopBP1

Cdc45

Orc2

DUE-B

Whole Cell Extract Chromatin Bound

Figure 6: Treslin, TopBP1 and DUE-B display similar chromatin binding profiles before replication initiation. Cdc45 chromatin binding follows the binding of DUE-

B, TopBP1 and Treslin.

HeLa cells were blocked with nocodazole (100 ng/ml) to synchronize cells in late

G2/M boundary. Sixteen hours after treatment plates were gently vortexed (shaken off) to obtain G2/M phase cells, washed once with PBS and released with DMEM containing

10% FBS. Cells were collected at indicated time points. Proteins from whole cell (left) or chromatin bound proteins (right) were isolated, separated in a 10% SDS-PAGE gel and transferred to PVDF membrane and detected using specific antibody. Orc2 was used as loading control.

34 TopBP1 has dual function in replication and the DNA damage checkpoint. Since the function of TopBP1 is to allow interaction of replication factors through its BRCT domains (Van Hatten et al., 2002), it was anticipated that TopBP1 would be bound to the chromatin earliest among the factors analyzed. Interestingly, DUE-B binding to the chromatin matched the profile of TopBP1 chromatin binding. The binding of the replication and checkpoint factor Treslin followed binding of TopBP1 and DUE-B, although trace amounts of Treslin bound the chromatin at similar times as TopBP1 and

DUE-B (Figure 6). Analysis of helicase activator, Cdc45 showed that binding of Cdc45 follows that of DUE-B, TopBP1 and Treslin indicating that DUE-B, Treslin and TopBP1 binding to the chromatin is likely a cue that allows for the binding of Cdc45 to the chromatin. Overall, this experiment shows that DUE-B, TopBP1 and Treslin follow similar chromatin binding kinetics during early G1 phase of cell cycle (3-6 hours after release from nocodazole block) and Cdc45 binding (~9 hrs) on the chromatin follows the loading of TopBP1, DUE-B and Treslin.

Summary

Data presented in this section highlights the importance of DUE-B in G1 phase of cell cycle where replication factors are preparing for the initiation of DNA replication for the following phase. These results show that timing of replication factor binding to the chromatin is ordered. Using Xenopus system, previous lab member has shown the importance of DUE-B for loading of TopBP1 and Cdc45 (Gao, 2012). In that study,

DUE-B, TopBP1 and Cdc45 bound to the chromatin at similar time points. I expand on that finding in mammalian cells and show that DUE-B, TopBP1 and Treslin bind to the

35 chromatin first during the G1 phase of cell cycle and Cdc45 is bound to chromatin following the binding of DUE-B, TopBP1 and Treslin.

II. Interdependence of replication factor chromatin binding before helicase activation.

DNA replication is a step-wise assembly process and requires chronological loading of replication factors onto the chromatin (Smith and Stillman, 1991). First, six sub-unit protein complex ORC1-6 is loaded at potential replication origins which allows for the facilitative binding of MCM2-7 helicase by the action of Cdc6 and Cdt1 to form pre-RC. During this phase, MCM2-7 is inactive and requires assembly and interaction of other replication proteins. Previous research from our lab has shown that DUE-B loading on the chromatin requires the presence of ORC (Chowdhury et al., 2010). DUE-B binding to the chromatin also requires MCM assembly because adding geminin to block

MCM loading on the chromatin also blocked chromatin loading of DUE-B (Gao, 2012) indicating that pre-RC assembly is required for the binding of DUE-B to chromatin.

Inhibition of RPA and Cdc45 binding on the chromatin in Xenopus after DUE-B depletion (Casper et al. 2005; Chowdhury et al., 2010) suggests that DUE-B is bound to the chromatin before DNA unwinding and helicase activation. These data suggest that the role of DUE-B during DNA replication comes after pre-RC assembly and before Cdc45 dependent activation of helicase.

Treslin, the Sld3 ortholog in humans, and TopBP1, a multi BRCT domain containing protein, are other important replication factors that come into play during similar times before Cdc45 binding (Figure 6). TopBP1 interaction with CDK

36 phosphorylated Treslin allows for Cdc45 binding to chromatin and Cdc45 levels are reduced after knockdown of Treslin (Kumagi et al. 2010), This evidence suggested that

Treslin, TopBP1 and DUE-B may regulate each other’s binding on the chromatin during the initiation of DNA replication, which in turn regulates the Cdc45 binding on the chromatin. To test this hypothesis, the chromatin binding statuses of Treslin, DUE-B,

TopBP1 and Cdc45 after knockdown with siRNA were analyzed.

DUE-B is necessary for binding of Treslin and Cdc45 on chromatin.

The process of DNA replication initiation involves ordered assembly of various proteins onto regions of DNA that are destined to serve as origins of replication (Bell and

Dutta, 2002; Méndez and Stillman, 2003; Sclafani and Holzen, 2007). In this process,

DUE-B comes into play after pre-RC assembly and before helicase activation. The roles and timing of Treslin and TopBP1 converge around similar timing, which is before

Cdc45 binding to MCM2-7 for helicase activation. To understand the role of DUE-B in this regard, knockdown experiments were performed in HeLa cells. Knockdown of DUE-

B using smartpool and individual siRNA in HeLa cells twice, 24 hours apart and analysis of chromatin bound proteins show that knockdown of DUE-B inhibited Cdc45 loading

(Chowdhury et al., 2010) and significantly reduced the levels of Treslin on the chromatin and soluble nucleus (Figure 7, Figure 8). This result suggests that DUE-B brings Treslin to the chromatin and stabilizes nuclear Treslin levels. Orc2 was used as a loading control for chromatin bound proteins, as ORC binding to the chromatin is the first step of DNA replication initiation (Bell and Dutta, 2002).

37 A. B.

Treslin Treslin Cdc45 Cdc45 DUE-B DUE-B

Orc2 Actin

Chromatin Bound Whole Cell Extract

Figure 7: Knockdown of DUE-B decreases binding of Treslin to the chromatin.

HeLa cells were either untreated or transfected with control siRNA or smartpool siRNA against DUE-B at a final concentration of 50 nM twice, 24 hours apart. Twenty- four hours after the final transfection, cells were harvested by trypsinization and chromatin bound (A) or whole cell (B) proteins were isolated, separated on a 10% SDS-

PAGE gel, transferred to a PVDF membrane and detected by using specific antibody.

Orc2 was used as a loading control for chromatin bound proteins.

38 Treslin Treslin Treslin Treslin TopBP1 TopBP1 TopBP1 TopBP1

Tubulin Orc2 Tubulin Orc2

DUE-B DUE-B DUE-B DUE-B Soluble Chromatin Soluble Chromatin Nucleus Bound Nucleus Bound

Figure 8: The effect of DUE-B knockdown on Treslin chromatin binding is specific.

HeLa cells were transfected with either control siRNA or previously described

siRNA #1 against DUE-B (Chowdhury et al., 2010) at a final concentration of 50 nM

twice 24 hours apart. Twenty-four hours after the final transfection, cells were harvested

by trypsinization and soluble nuclear (A) or chromatin bound (B) proteins were isolated,

separated on a 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by

using specific antibody. Orc2 was used as a loading control for chromatin bound proteins

and tubulin was used as a loading control for soluble nuclear proteins.

39 To test the specificity of the smartpool siRNA, previously described individual siRNA against DUE-B was used (Figure 8, Chowdhury et al., 2010). Knockdown of

DUE-B with individual siRNA decreased the levels of Treslin both on the soluble nuclear fraction and chromatin bound fraction (Figure 8). Analysis of TopBP1 levels on soluble nuclear fraction and chromatin bound fractions showed that TopBP1 levels were unchanged after knockdown with DUE-B which contradict the findings from Xenopus system where depletion of DUE-B reduced TopBP1 levels in G1 phase extracts

(Chowdhury et al., 2010). To further confirm these results, a siRNA resistant form of his6-tagged full length DUE-B was generated and used in rescue experiment (Appendix

3, 6, and 7; Figure 32). His6-tagged siRNA resistant WT DUE-B could rescue Treslin loading on the chromatin suggesting that indeed the effect of DUE-B on Treslin is specific (Figure 9). Overall, these experiments show that DUE-B is necessary for maintaining the levels of Treslin both on soluble nuclear and chromatin bound fraction in

HeLa cells. TopBP1 levels are unaffected by the knockdown of DUE-B in HeLa cells.

Importantly, DUE-B is necessary for Cdc45 chromatin binding a crucial step for helicase activation.

HeLasiDUE-B #1 siDUE-B

(-) (-) TreslinTreslin

Orc2 ORC2 His6 WT DUEHis(siRNA-B resistant DUE-B)DUE-B DUE-B DUEDUE-B (endogenous)-B (endogenous) Chromatin Bound Chromatin Bound

Figure 9: Wildtype DUE-B can rescue Treslin binding to the chromatin.

HeLa cells were transfected with control siRNA (50 nM), DUE-B siRNA (50 nM) or co-transfected with siR his6 WT DUE-B (400 ng) and DUE-B siRNA #1 (50 nM). The siRNA resistant plasmid was transfected once while the siRNAs were transfected twice,

24 hours apart. Twenty-four hours after final transfection chromatin bound proteins were isolated, run on a 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by specified antibodies. Orc2 was used as the loading control for chromatin bound proteins.

41 Treslin is necessary for binding of DUE-B, Cdc45 and TopBP1 onto the chromatin.

Treslin helps to trigger the initiation of DNA replication by promoting association of Cdc45 with the replicative helicase (Guo et al., 2015), as does DUE-B.

Phosphorylation of Treslin by the S-phase cyclin-dependent kinase (S-CDK) (Boos et al.,

2011; Kumagai et al., 2011) allows it to interact with TopBP1 to integrate Cdc45 onto the replicative helicase and to dictate the timing of S-phase. An analogous situation exists in budding yeast where phosphorylation of the Treslin homologue Sld3 by S-CDK is also critical for timely replication (Labib, 2010; Siddiqui et al., 2013; Tanaka and Araki,

2013). Previous experiments in this study (Figure 6) show that Treslin, DUE-B and

TopBP1 are bound to the chromatin before Cdc45. Knockdown of Treslin reduced the level of chromatin bound Cdc45 after siRNA treatment (Kumagi et al., 2010). Also, knockdown of DUE-B reduced the levels of Treslin on the chromatin and soluble nucleus. So, the role of Treslin in loading DUE-B, TopBP1 and Cdc45 was analyzed.

In HeLa cells, Treslin was knocked down using smartpool siRNA twice at 24- hour intervals. Twenty-four hours after final transfection soluble nuclear and chromatin bound proteins were analyzed. Knockdown of Treslin reduced the levels of DUE-B and

Cdc45 both in soluble nuclear and chromatin bound fraction (Figure 10). Orc2 was used as loading control for chromatin bound proteins and Tubulin for soluble nuclear loading.

To test the specificity of the smartpool siRNA, four individual siRNAs against

Treslin were used (Figure 11). Knockdown of Treslin with individual siRNAs showed similar results. Treslin knockdown decreased the levels of DUE-B both on the soluble nuclear fraction and chromatin bound fraction (Figure 11) suggesting that Treslin is necessary to load DUE-B on the chromatin and to stabilize nuclear levels of DUE-B.

42 Analysis of TopBP1 levels on soluble nuclear fraction and chromatin bound fractions showed that TopBP1 levels were unchanged in the soluble nuclear fraction but was significantly reduced on the chromatin after knockdown with Treslin. These results indicate that unlike DUE-B, presence of Treslin is necessary for TopBP1 chromatin binding. TopBP1 has been previously reported to bind to the chromatin independent of

Treslin in Xenopus egg extracts (Kumagi et al., 2010) and we believe our results differ because in human cells there is may have some higher order of regulation during replication. This may be due to interspecies difference between human cells and Xenopus.

Overall, these experiments show that Treslin is necessary for maintaining the levels of

DUE-B and Cdc45 both on soluble nucleus and chromatin and for chromatin binding of

TopBP1.

43 A. B.

Treslin Treslin Cdc45 Cdc45 Tubulin Orc2 DUE-B DUE-B

Chromatin Bound Soluble Nuclear

Figure 10: Treslin knockdown reduces soluble nuclear and chromatin bound DUE-

HeLa cells were either untreated or transfected with control siRNA or smartpool siRNA against Treslin at a final concentration of 50 nM twice, 24 hours apart. Twenty- four hours after the final transfection, cells were harvested by trypsinization, and soluble nuclear (A) or chromatin bound (B) proteins were isolated, separated on a 10% SDS-

PAGE gel, transferred to a PVDF membrane and detected by using specific antibody.

Orc2 was used as a loading control for chromatin bound proteins and Tubulin was used as loading control for soluble nuclear proteins.

44 A. B. Individual siTreslin Individual siTreslin

Treslin Treslin

TopBP1 TopBP1

Tubulin Orc2 DUE-B DUE-B

Soluble Nuclear Chromatin Bound

Figure 11: The effect of Treslin knockdown on DUE-B chromatin binding is specific.

HeLa cells were transfected with either control siRNA or four different individual siRNAs against Treslin at a final concentration of 50 nM twice, 24 hours apart. Twenty- four hours after the final transfection, cells were harvested by trypsinization and soluble nuclear (A) or chromatin bound (B) proteins were isolated, separated on a 10% SDS-

PAGE gel, transferred to a PVDF membrane and detected by using specific antibody.

Orc2 was used as a loading control for chromatin bound proteins and Tubulin was used as a loading control for soluble nuclear proteins.

45 TopBP1 is necessary for binding of Cdc45 on the chromatin but not for DUE-B and

Treslin.

In vertebrates, the interaction of Cdc45 and GINS with the MCMs depends on

TopBP1 (Boos et al., 2013; Kumagi et al., 2010). Experiments with fission yeast and

Xenopus revealed that the TopBP1 homologues of these organisms are required for chromatin loading of the replication protein Cdc45 (Van Hatten et al., 2002; Dolan et al.,

2004). In humans, TopBP1 and Cdc45 interaction occurs during G1/S phase boundary and this interaction is necessary to load Cdc45 on the chromatin (Schmidt et al., 2008).

From previous experiments (Figure 8 and 10), Treslin seems to be necessary for TopBP1 binding on the chromatin but DUE-B knockdown did not affect TopBP1 binding to the chromatin. Since TopBP1 seems to be at the nexus of regulating interaction between replication factors (DUE-B, Treslin and Cdc45) via its BRCT domains, the role of

TopBP1 for chromatin binding of DUE-B and Treslin was analyzed.

Using two different approaches, the chromatin binding profiles of DUE-B and

Treslin were analyzed (Figure 12). In HeLa cells a plasmid containing shRNA against

TopBP1 was transfected. Twenty-four hours after transfection chromatin bound proteins were isolated and analyzed. Knockdown of TopBP1 inhibited the loading of Cdc45 on the chromatin (Schmidt et al., 2008) but surprisingly did not affect Treslin and DUE-B chromatin binding (Figure 12A). To confirm the results of shRNA knockdown, a smartpool siRNA against TopBP1 was used for transfection in HeLa cells twice in 24- hour interval (Figure 12B). Chromatin bound proteins were isolated 24-hour after the final transfection and analyzed by western blotting. In this experiment, the results were consistent with previous finding (Figure 11A). DUE-B and Treslin levels on the

46 chromatin were unaffected by the knockdown of TopBP1 by smartpool siRNA or shRNA while Cdc45 binding to the chromatin was decreased with the knockdown of TopBP1.

Using two independent approaches, it was observed that TopBP1 knockdown does not affect binding of Treslin and DUE-B on the chromatin but Cdc45 loading on the chromatin requires TopBP1.

Summary

Data generated from this section shows the interplay and requirement of the stepwise assembly of replication factors during the process of DNA replication.

Previously our lab has shown that DUE-B is necessary for the loading of Cdc45 and RPA on the chromatin (Chowdhury et al., 2010). The results of this section further highlight the importance of DUE-B in DNA replication. DUE-B regulates soluble nuclear and chromatin bound levels of another important replication factor, Treslin. In reverse experiments, Treslin is also necessary for the maintaining the levels of DUE-B in soluble nucleus and chromatin. Treslin is also required for the chromatin binding of TopBP1.

While TopBP1 is required for Cdc45 chromatin binding, it is not necessary for the loading of DUE-B and Treslin on the chromatin in our analysis. Treslin and TopBP1 bind to the chromatin independently in Xenopus system (Kumagi et al., 2010). The binding of

Treslin and DUE-B with chromatin occurs when TopBP1 is knockdown in HeLa cells but the finding that TopBP1 binding to the chromatin requires Treslin suggests that Treslin is likely necessary to retain TopBP1 on the chromatin. Taken together, these results indicate a possibility that DUE-B and Treslin are bound to the chromatin independently of

TopBP1, and interact with TopBP1 once bound to the chromatin to form a complex. This

47 complex would subsequently facilitate the binding of Cdc45. It is also possible that DUE-

B/Treslin/TopBP1 complex is recruited to the MCM helicase as a ternary complex. Also since Cdc45 required TopBP1 to bind to the chromatin without affecting Treslin and

DUE-B, it appears that distinct pathways containing Treslin/DUE-B and TopBP1 ultimately converge to promote the loading of Cdc45. Since TopBP1 also interacts with

GEMC1 to load Cdc45, depletion of TopBP1 might inhibit Cdc45 binding to chromatin through loss of GEMC1 (Balestrini et al., 2010). In any case, a remote possibility exists, where chromatin binding does not necessarily mean binding to the origin and further experimentation are necessary to resolve this possibility. Also, TopBP1 bound to the chromatin may not necessarily be bound to the replication origins.

48 A. B.

Cdc45 Cdc45 Orc2 Orc2

Figure 12: TopBP1 knockdown reduces Cdc45 chromatin binding without affecting

DUE-B and Treslin levels on chromatin.

(A) HeLa cells were transfected with 2 ug of plasmid containing shRNA against luciferase or TopBP1 in a 6-well plate. Twenty-four hours after the final transfection, cells were harvested by trypsinization and chromatin bound proteins were isolated, separated on a 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by using specific antibody. (B) HeLa cells were transfected with 50 nM of either control siRNA or smartpool siRNA against TopBP1 twice 24 hours apart in a 6-well plate.

Twenty-four hours after the final transfection, cells were harvested by trypsinization and chromatin bound proteins were isolated, separated on a 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by using specific antibody. Orc2 was used as a loading control for chromatin bound proteins.

49 III. DUE-B interacts with Treslin and TopBP1 in vivo.

DUE-B has been previously shown to interact with TopBP1 and Cdc45 individually (Chowdhury et al., 2010). Immunoprecipitation results are also consistent with the formation of a ternary complex when extracts containing baculovirus-expressed

TopBP1, DUE-B, and Cdc45 are mixed (Chowdhury et al., 2010). The interaction between DUE-B, Cdc45, and TopBP1 also occurs in vivo as shown by co- immunoprecipitation from human cell lysates. TopBP1 and Cdc45 have also been reported to interact in cell extracts (Schmidt et al., 2008).

Treslin and TopBP1 also interact with each other in a CDK dependent manner

(Kumagi et al., 2010; Sansam et al., 2010). It is possible that Treslin exists in a multiprotein complex that is necessary for replication, which also might explain why recombinant Treslin cannot rescue the depleted extracts in the studies by Kumagi et al.

(2010), suggesting the possibility that Treslin requires other factors to play its role in

DNA replication in the Xenopus egg extract system. In view of the similar loading kinetics of DUE-B, TopBP1 and Treslin (Figure 6), and the fact that both DUE-B and

Treslin interact with TopBP1, we asked whether DUE-B could also interact with Treslin.

Endogenous Treslin and TopBP1 interact with recombinant DUE-B

Protein co-immunoprecipiation was used to test the interaction between DUE-B and Treslin using multiple cell lines and approaches. In pilot co-IP experiments, rabbit antisera (normal rabbit serum, WRSU1 (rabbit anti-DUE-B antibodies raised in rabbits against a His6-tagged recombinant human DUE-B expressed in bacteria (Casper et al.,

2005)) showed non-specific binding to both TopBP1 and Treslin which were resistant to

50 stringent high salt and detergent washes (data not shown). To get around this problem, tagged versions of DUE-B were used. When HeLa cells were transiently transfected with

N-terminus FLAG-tagged DUE-B and anti-FLAG antibody beads were used to IP DUE-

B, a specific band for TopBP1 was detected (Figure 13). This shows that FLAG-tagged

DUE-B can pull-down endogenous TopBP1.

TopBP1 has been previously shown to interact with DUE-B (Chowdhury et al.,

2010) and Treslin (Kumagi et al. 2010). To test if tagged DUE-B can also pull-down

Treslin, a similar IP technique was deployed. HeLa cells were transfected with N- terminus FLAG-tagged DUE-B and 24 hours after transfection, Red Anti-FLAG M2 beads were used to pull-down FLAG-tagged DUE-B and analyzed for the presence of

Treslin (Figure 14A). A specific signal for Treslin was observed in the FLAG-bead lane but not in the control lane indicating that FLAG-tagged DUE-B can pull-down Treslin.

To confirm the notion that DUE-B and Treslin interact in vivo, another approach was utilized. HeLa cells or HeLa derived A1 cells (Casper et al., 2005) that stably express his6-tagged DUE-B were used to pull-down Treslin with a Ni-NTA beads (14B). Pull- down of his6-tagged DUE-B from A1 cells also immunoprecipitated endogenous Treslin

(Figure 14B).

51 HeLa+ pcDNA FLAG DUE-B

TopBP1

FLAG (DUE-B)

Figure 13: DUE-B interacts with TopBP1 in vivo.

HeLa cells were transiently transfected with FLAG-tagged DUE-B. Twenty-four hours after transfection, cells were lysed with IP lysis buffer and pulled down using Red

Anti-FLAG M2 or Red IgG beads, washed with IP wash buffer 4 times, boiled in SDS sample buffer, and separated in 10% SDS-PAGE gel. Proteins were transferred to PVDF membrane and detected using specified antibodies. 4% of lysate was used for input.

52 A. B. IP: Ni-NTA HeLa + pcDNA3.1 FLAG DUE-B beads

Treslin Treslin

FLAG (DUE-B) His (DUE-B)

Figure 14: DUE-B interacts with Treslin in vivo.

(A) HeLa cells were transiently transfected with FLAG-tagged DUE-B. Twenty- four hours after transfection, cells were lysed with IP lysis buffer and pulled down using

Red Anti-FLAG M2 or Red IgG beads, washed with IP wash buffer 4 times, boiled in

SDS sample buffer, and separated in 10% SDS-PAGE gel. Proteins were transferred to

PVDF membrane and detected using specified antibodies. (B) HeLa cells or previously published HeLa derived A1 cells that stably express his6-tagged DUE-B were lysed with

IP buffer containing 10 mM imidazole, pulled down using Ni-NTA (nickel) beads, washed with wash buffer containing 50 mM imidazole, boiled in SDS sample buffer, and separated in 10% SDS-PAGE gel. Proteins were transferred to PVDF membrane and detected using specified antibodies.

53 To pursue this further, N-terminal FLAG-tagged DUE-B was cloned into a pcDNA5/TO/FRT vector (Figure 15) to create a tetracycline inducible cell line (Gossen et al., 1995). Using site directed mutagenesis PCR with pcDNA3.1 WT DUE-B-his6

(Gao et al., 2014) as a template, his6-tag from the C-terminus was removed and an N- terminal FLAG-tag was added to DUE-B cDNA (Figure 15A), the PCR product was digested by Bam HI and Not I (Figure 15A) and cloned into pcDNA5/TO/FRT vector

(Figure 15C). The final vector was sequence verified and expressed transiently in HeLa cells (Figure 15 D). In HeLa cells, pcDNA5/TO/FRT FLAG-tagged DUE-B showed expression better than positive control (pcDNA3.1 FLAG DUE-B) transiently (Figure

15D). Using similar approach, a C-terminal deletion mutant (60 amino acids deletion,

ΔCT DUE-B) was also created which also showed expression like the positive control.

The details of ΔCT DUE-B will be discussed in future chapters (Figure 15).

The pcDNA5/TO/FRT plasmid was transfected into HeLa T-Rex “Flp In” cells to generate a tetracycline inducible cell line. In this system, flp recombinase target (FRT), integrates into a single site in the genome of HeLa T-Rex cell line “Flp In” (Appendix 8).

Tet repressor represses transcription of the gene in the absence of tetracycline (inducer), but in the presence of tetracycline (or its analog like doxycycline) the transcription of the gene is turned on. Only a single copy of the gene of interest is stably integrated for regulated expression with tetracycline at an active site of the genome, which allows for the expression of the gene of interest (Gossen et al., 1995).

54 A. PCR products C. D. HeLa F - R F – R’

pcDNA5.TO. FRT. Flag. DUE-B NT NT

pcDNA5.TO. FRT Actin

B. WTDUE-B Wt DUE-B ΔCTDUE-B Flag Primer to add Flag tag N term and BamHI site, (F) ΔCT DUE-B Primer to remove His C Term, WT DUE-B, add NotI site, (R) Primer to remove His C Term, ΔCT DUE-B, add NotI site, (R’)

Figure 15: Cloning and Expression of FLAG-tagged wildtype (WT) DUE-B and

FLAG-tagged ΔCT DUE-B into a pcDNA5/TO/FRT vector.

(A) PCR products of FLAG WT-DUE-B and FLAG ΔCT DUE-B using primers

F-R and F-R’ combinations. Primer F adds a N-terminal FLAG-tag and a Bam HI site;

Primers R and R’ remove C-terminal his6-tag and add a Not I site. Templates for PCR were plasmids previously described (Gao et al., 2014). (B) Description of primers used in

(A). (C) Bam HI and Not I sites in pcDNA5/TO/FRT vector. (D) Transient expression of pcDNA5/TO/FRT FLAG WT DUE-B and pcDNA5/TO/FRT FLAG ΔCT DUE-B in

HeLa cells, pcDNA3.1 FLAG DUE-B was used as a positive control and no transfection was used as negative control.

55 To establish the concentration of doxycycline for the induction of the gene of interest, tetracycline inducible 293T T-Rex SRC2 cells was used (Figure 16). In 293T T-

Rex SRC2 cells, SRC2 is under the control of tetracycline. As observed, treatment with doxycycline for 24 hours at concentrations ranging from 250 ng/ml to 1000 ng/ml all displayed induction of SRC2 (Figure 16). For all further experiments with HeLa T-Rex inducible cells, 1000 ng/ml of doxycycline was picked as the concentration of choice.

After successful integration and selection with hygromycin, clones of the FLAG- tagged DUE-B (and FLAG-tagged ΔCT DUE-B) in HeLa T-Rex cell lines were picked and induced with doxycycline (a tetracycline analog 1000 ng/mL) for 24 hours. Mixed clones and single clones all displayed similar induction of FLAG-tagged WT DUE-B

(and FLAG-tagged ΔCT DUE-B) when induced with doxycycline (Figure 17).

Furthermore, induction of FLAG-tagged DUE-B in HeLa T-Rex cell lines and analysis of

DNA content by flow cytometry showed that the cell cycle progression profiles were unaffected when compared to HeLa T-Rex FLAG-tagged DUE-B cells without doxycycline (Figure 18).

Figure 16: Determination of concentration of doxycycline to induce FLAG-tagged

DUE-B in HeLa T-Rex inducible system.

Doxycycline was either not added or added to DMEM containing 10% FBS at the indicated final concentration for 24 hours to induce the expression of SRC2 in 293T T-

Rex SRC2. After induction, cells were lysed with M-Per buffer, proteins separated in a

10% SDS-PAGE gel, transferred on a PVDF membrane and detected by specified antibodies.

57 HeLaTrexHeLa T-Rex FLAG WT DUEFlag WT DUE--B B clonesClones M 1 2 3 4 5

+ - - + - + - + - + - + Dox Actin

FlagFLAG

HeLaTrexHeLa T-Rex FLAG ΔCT DUEFlag ΔCT DUE--B B clonesClones 1 2 3 4 5 - + - + - + - + - + Dox Actin

FlagFLAG

Figure 17: HeLa T-Rex FLAG-tagged WT DUE-B and FLAG-tagged ΔCT DUE-B clones induced with doxycycline.

HeLa T-Rex cells stably expressing FLAG-tagged WT DUE-B (top) and FLAG- tagged ΔCT DUE-B (bottom) under the control of tetracycline were created as described in Materials and Methods using HeLa T-Rex “Flp In” acceptor cells and pcDNA5/TO/FRT vectors (Figure 17). Hygromycin (100 ug/ml) was used to select integrated clones for 15 days, colonies picked and induced with doxycycline (1000 ng/ml) for 24 hours. After induction, cells were lysed with M-Per buffer (Thermofisher), separated in 10% and 12% SDS-PAGE gels respectively and transferred to a PVDF membrane. Proteins were detected with specified antibodies.

58 HeLaTHeLaT-Rex-RexFLAG DUE FlagDUE-B- NoB No DOX Dox HeLaTHeLaT-Rex-RexFLAG DUE FlagDUE-B -+DoxB +DOX 3000 3000

2250 2250

1500 1500 Count Count 750 750

0 0 5 6 6 5 6 6 9 x10 1.8 x10 2.6 x10 9 x10 1.8 x10 2.6 x10 FL2-A FL2-A

HeLaHeLaT T-Rex-RexFLAG DUE Flag DUE-B-B DOX induction induc tion.c 6 3000 HeLaT-RexHeLaT-RexFLAG DUE FlagDUE-B-B No DOX No Dox HeLaT-RexHeLaT-RexFLAG DUE FlagDUE-B-B +DOX +Dox 2250

1500 Count 750

3000

2250

1500 Count 750

0 5 6 6 9 x10 1.8 x10 2.6 x10 FL2-A

Figure 18: Induction of FLAG-tagged DUE-B in HeLa T-Rex cells does not change the cell cycle profile.

HeLa T-Rex FLAG-tagged DUE-B cells were either uninduced or induced with doxycycline (1000 ng/ml) for 24 hours. DNA content was analyzed for cells with or without doxycycline to check the cell cycle profiles using Accuri C6 flow cytometer after staining with 50 ug/ml propidium iodide and RNase digestion (25 ug/ml); (top left) HeLa

T-Rex FLAG-DUE-B (no doxycycline), (top right) HeLa T-Rex FLAG-tagged DUE-B

(with doxycycline) and (bottom) stacked view of HeLa T-Rex FLAG-tagged DUE-B with and without doxycycline.

59 Using HeLa T-Rex FLAG-DUE-B cells, the interaction between DUE-B and

Treslin was tested. Co-IP experiments were carried out as previously described which showed weak but clear bands for both FLAG (DUE-B) and Treslin (data not shown) and we hypothesized that the FLAG-proteins were not eluting with the previous elution conditions. Indeed, a significant amount of FLAG-tagged DUE-B was bound to the bead, which may explain the reason for weak signal (data not shown). To establish the appropriate concentration of salt (NaCl) for elution of FLAG-tagged WT DUE-B in the

FLAG Elution Buffer after co-IP, a salt concentration gradient (NaCl) was used (Figure

19) because we argued that varying salt concentration would release FLAG-tagged DUE-

B by decreasing non-specific interactions and allowing elution of bound proteins by disrupting hydrogen bonding between proteins (Klenova et al., 2002). Clearly, 700 mM

NaCl in the FLAG elution buffer showed the best interaction between FLAG-tagged

DUE-B and Treslin. Furthermore, using three different approaches, we observe that

DUE-B interacts with endogenous Treslin in vivo.

In a reverse experiment, HeLa cells were transfected with pcDNA5/TO/Treslin-

SF transiently, and 24 hours after the transfection a pull-down experiment was performed with Red Anti-FLAG M2 beads (Figure 20). Expression and pull-down with Red Anti-

FLAG M2 beads to pull-down FLAG-tagged Treslin immunoprecipitaed endogenous

DUE-B and TopBP1. TopBP1 served as a positive control for this experiment (Kumagi et al., 2010). These experiments show that the interaction between DUE-B and Treslin is relevant and the interaction occurs in vivo.

HeLa T-Rex FLAG WT DUE-B

FLAG

FLAG (DUE-B)

Figure 19: DUE-B pulls down endogenous Treslin in tetracycline inducible system using FLAG-tagged DUE-B.

HeLa T-Rex FLAG WT DUE-B cells was either uninduced or induced with doxycycline (1000 ng/ml) for 24 hours. Cells were harvested and lysed with IP lysis buffer, precleared with agarose beads and Red Anti-FLAG M2 resin was used to pull- down FLAG-tagged DUE-B and washed 4 times with IP wash buffer, FLAG-tagged

DUE-B was eluted with FLAG elution buffer containing the indicated concentration of sodium chloride. Eluates were heated with SDS sample buffer, separated in 10% SDS-

PAGE gel and transferred to PVDF membrane and specified antibody was used to detect protein.

61 HeLa+ pcDNA5/Treslin SF IP

FLAG (Treslin)

TopBp1

DUE-B

Figure 20: Transiently expressed FLAG-tagged Treslin can pull-down endogenous

DUE-B.

HeLa cells were transiently transfected with FLAG-tagged Treslin. Twenty-four hours after transfection, cells were lysed with IP lysis buffer and pulled down using Red

62 Chromatin binding is not necessary for the interaction of Treslin and DUE-B

DNA-dependent and DNA-independent associations of DNA-binding proteins are important in many types of cellular processes. The analysis of DNA-independent associations frequently relies on assaying protein interaction without DNA sequences. In many cases, contaminating DNA in protein preparations can stabilize DNA-dependent associations that may appear DNA-independent (Lai and Herr, 1992). Ethidium bromide is a general inhibitor of DNA binding proteins (Schröter et al., 1985). It is an intercalating agent that induces the release of proteins by distorting the DNA secondary structure. Data from the previous section shows that DUE-B and Treslin interact in vivo (Figure 14, 19 and 20). Moreover, DUE-B and Treslin were both bound to the chromatin before Cdc45 was bound to the chromatin and showed somewhat similar chromatin binding kinetics

(Figure 6). To exclude the possibility that DNA was bridging and stabilizing the interaction between DUE-B and Treslin, a co-IP was performed in the presence ethidium bromide (Lai and Herr, 1992). HeLa cells were transiently transfected with FLAG-tagged

DUE-B plasmid, harvested after 24 hours and lysed with IP lysis buffer. Before the co-IP experiments, samples were either untreated or treated with ethidium bromide for 30 minutes on ice (Lai and Herr, 1992) to test whether DUE-B and Treslin associations are bridged by DNA (Figure 21), and the precipitates pulled down by Red Anti-FLAG M2 beads. Treatment of lysate with ethidium bromide did not affect the interaction of FLAG- tagged DUE-B and endogenous Treslin (Figure 21), which argues against the bridging of these proteins by DNA, thus DNA is not required for the interaction of DUE-B and

Treslin (Figure 21).

63 HeLa + pcDNA3.1 FLAG DUE-B

IP: FLAG

(-) (+) EtBr

Treslin

FLAG (DUE-B)

Figure 21: Chromatin binding is not necessary for the interaction of DUE-B and

Treslin.

HeLa cells were transiently transfected with FLAG-tagged DUE-B. Twenty-four hours after transfection, cells were lysed with IP lysis buffer, treated with 50 ug/ml ethidium bromide on ice for 30 minutes and pulled down using Red Anti-FLAG M2 or

Red IgG beads, washed with IP wash buffer 4 times, boiled in SDS sample buffer, and separated in 10% SDS-PAGE gel. Proteins were transferred to PVDF membrane and detected using specified antibodies.

64 TopBP1 is necessary for the interaction of DUE-B and Treslin

DUE-B, Treslin and TopBP1 showed similar chromatin binding profiles before the binding of Cdc45 or the helicase activation step (Figure 6). Previous data from our laboratory has indicated that TopBP1 interacts with DUE-B in vivo because these proteins co-immunoprecipitate from human and insect cell lysates (Chowdhury et al.,

2010). TopBP1 also interacts with phosphorylated Treslin both during activation of the helicase in DNA replication and during checkpoint stimulation of Chk1 phosphorylation

(Hassan et al., 2013; Kumagi et al., 2010; Sansam et al., 2010). TopBP1 contains multiple BRCT motifs and motifs I and II in the N-terminal end that are essential and sufficient for the replication functions of TopBP1 (Zegerman and Diffley, 2007; Yan and

Michael, 2009; Kumagi et al. 2010) while BRCT’s VII and VIII are important for ATR dependent Chk1 phosphorylation in response to replication stress (Yan et al. 2006; Yan and Michael, 2009).

TopBP1 is a scaffolding protein that allows for protein-protein interaction through phospho-protein binding domains. To test if TopBP1 is required for the interaction of

DUE-B and Treslin, because TopBP1 interacts with DUE-B and Treslin, shRNA against

TopBP1 was used to deplete TopBP1 from tetracycline inducible HeLa T-Rex FLAG- tagged DUE-B cells (Figure 17). Knockdown with TopBP1 shRNA reduced the level of

TopBP1 in both doxycycline uninduced and induced HeLa T-Rex cell lines by about 80-

90% (Figure 22, lane 3 and lane 4, shRNA treated input lanes with and without doxycycline). HeLa T-Rex cell lines that were knocked down with shTopBP1 were used for co-IP experiments with Red Anti-FLAG M2 beads. Induction of DUE-B and pull- down with Red FLAG M2 beads show that FLAG-tagged DUE-B was efficiently able to

65 pull-down both TopBP1 and Treslin (lane 5 vs lane 6, Figure 22). In comparison knockdown of TopBP1 completely abolishes the interaction between DUE-B and Treslin

(lane 6 vs lane 8, Figure 22). These results show that DUE-B and Treslin interaction is mediated through TopBP1 and TopBP1 is necessary for DUE-B and Treslin to interact.

Summary

We used co-IP techniques to understand the interaction between Treslin and

DUE-B. Both DUE-B and Treslin have been previously shown to associate with TopBP1

(Chowdhury et al., 2010; Kumagi et al., 2010). In our study, using different approaches, we show that DUE-B and Treslin interact with each other in vivo. DUE-B expressed transiently or stably (his6-tagged or FLAG-tagged) in either C-terminus or N-terminus end was efficiently able to pull-down endogenous Treslin. In reverse experiments,

FLAG-tagged Treslin also pulled down endogenous DUE-B. Further analysis of DUE-B and Treslin showed that presence of DNA is not necessary for the interaction between

DUE-B and Treslin. On the other hand, the multi BRCT motif containing protein,

TopBP1, is required for the interaction of DUE-B and Treslin. This result indicates that

DUE-B, Treslin and TopBP1 can form a complex in the soluble nucleus.

66 HeLa THeLa -TRex FLAG WT DUE-Rex Flag DUE-B-B Input IP: FlagFLAG

shTopBP1 shTopBP1 (-) (+) (-) (+) (-) (+) (-) (+) Dox Treslin

TopBP1

Flag (DUEFLAG (DUE-B)-B)

1 2 3 4 5 6 7 8

Figure 22: TopBP1 is necessary for the interaction of DUE-B and Treslin.

HeLa T-Rex FLAG-tagged DUE-B were either induced (lanes 2, 4, 6 and 8) or uninduced (lanes 1, 3, 5 and 7) with doxycycline (1000 ng/ml) for 24 hours and shRNA against TopBP1 was transfected. Twenty-four hours after transfection cells were harvested, lysed with IP lysis buffer, Red Anti-FLAG M2 resins were used to pull-down

FLAG-tagged DUE-B and washed 4 times with IP wash buffer. FLAG elution buffer containing 5 ug/ml FLAG peptide was used to elute FLAG-tagged DUE-B, separated in a

10% SDS-PAGE gel, transferred to a PVDF membrane and detected with specified antibody.

Figure 23: Crystal structure of N-terminus domain of DUE-B.

A ribbon diagram of the crystal structure of the DUE-B dimer, with the active site magnesium ion is shown in green. Homodimerization of DUE-B is mediated by an extensive set of interactions that result in the formation of a continuous β-sheet structure between the two monomers. The three-dimensional structure of DUE-B reveals notable similarity to the overall domain structures of both D-aminoacyl-tRNA deacylases and the archaea-specific editing domain of threonyl-tRNA synthetase (Kemp et al., 2007)

Figure 24: C-terminal domain of DUE-B is conserved in higher eukaryotes.

Sequence alignment of C-terminal domain of DUE-B shows its conservation status in human, mouse, and frog highlighting the importance of the C-terminus domain.

It contains multiple phosphorylatable serine/threonine sites. CDC7 phosphorylate DUE-B

C-terminus residues and PP2A removes these phosphates. Phosphorylation of DUE-B C- terminus affects its ability to bind and load the MCM2-7 complex (Gao et al., 2014).

69 IV. C- terminal region of DUE-B and its role in interaction with Treslin.

The N- terminus of DUE-B is highly conserved throughout evolution as a D- aminoacyl tRNA deacylase (Kemp et al., 2007) and shows notable similarity with tRNA- editing enzymes in the N-terminal 150 amino acids of DUE-B. Previous biochemical and structural analyses have shown that DUE- is a homodimer (Casper et al., 2005; Kemp et al., 2007; Figure 23). Homodimerization of DUE-B is mediated by an extensive set of interactions that result in the formation of a continuous β-sheet structure between the two monomers. The three-dimensional structure of DUE-B reveals notable similarity to the overall domain structures of both D-aminoacyl-tRNA deacylases and the archaea-specific editing domain of threonyl-tRNA synthetase (Kemp et al., 2007).

DUE-B has acquired about 59 amino acids at the C-terminus tail in higher organisms. The C-terminal tail of DUE-B is conserved in higher eukaryotes (humans, mouse, frogs), which highlights the importance of the DUE-B C-terminus. This domain is not present in lower organisms and contains several potential serine/threonine phosphorylation sites (14 out of 60 aa, Figure 24), many of which are conserved sites for kinases regulating cell cycle progression. The DUE-B C- terminal tail is structurally disordered (Kemp et al., 2007; Gao et al., 2014) which renders it a favorable domain for protein-protein interactions or posttranslational modifications (Iakoucheva and Dunker,

2003). The C- terminal tail has been previously reported to be important for the interaction with TopBP1 and Cdc45 (Chowdhury et al., 2010). C-terminus truncated

DUE-B (ΔCT DUE-B) has very distinct properties compared with the wild type DUE-B because C-terminus regulates DUE-B subcellular localization. WT DUE-B localizes in both the nucleus and cytoplasm while ΔCT DUE-B preferentially localized in the nucleus

70 (Gao, 2012). Notably, ΔCT DUE-B cannot restore DNA replication in Xenopus egg extract (Gao et al., 2014) or human cells (Chowdhury et al., 2010).

C-Terminus tail of DUE-B is necessary for the interaction of DUE-B and Treslin.

DUE-B structural and biochemical studies have shown that the function of DUE-

B can be divided into two distinct domains. The N-terminal domain (160 amino acids) has aminoacyl tRNA proofreading activity and is required for homodimerization of DUE-

B, while the C-terminal domain (59 amino acids) which is present and conserved in higher eukaryotes, is required for its cellular localization and DNA replication activity

(Casper et al., 2005; Kemp et al., 2007; Chowdhury et al.; Gao et al., 2014). The C- terminal tail of DUE-B is disordered and facilitates interaction with other proteins.

During DNA replication, expression of a deletion mutant that lacks C-terminal domain does not rescue replication in Xenopus and human cells (Chowdhury et al., 2010; Gao et al., 2014).

The C-terminal tail has been previously shown to be important for the interaction of DUE-B with TopBP1 and Cdc45 (Chowdhury et al., 2014). Considering these backgrounds, we asked the question if interaction of DUE-B with Treslin is also mediated through the C-terminal tail. To carry out the experiments, previously described HeLa derived his6-tagged DUE-B cell (A1 cells, Chowdhury et al., 2014) and HeLa cells stably expressing his6-tagged ΔCT DUE-B were used. Using Ni-NTA beads, his6-tagged WT

DUE-B or ΔCT-DUE-B were pulled down. As shown in Figure 25, the interaction between full length DUE-B and Treslin is much stronger in comparison to the interaction between Treslin and ΔCT-DUE-B, which lacks the C-terminal tail. A faint interaction

71 between ΔCT-DUE-B and Treslin is observed likely because ΔCT-DUE-B can homodimerize with endogenous full length DUE-B to pull-down a small amount of

Treslin. In any case, this result shows that the interaction between DUE-B and Treslin is mediated through the C-terminal tail of DUE-B and the absence of C-terminal domain of

DUE-B strongly inhibits the interaction between DUE-B and Treslin.

72 Input IP: Ni-NTA

Treslin

WT DUE-B His

ΔCT DUE-B

Figure 25: C-terminal tail of DUE-B is necessary for the interaction with Treslin.

Stably expressing his6-tagged full length DUE-B (A1 cells) or his6-tagged ΔCT-

DUE-B cell lysates were used for pull-down DUE-B with Ni-NTA beads after lysing with IP lysis buffer containing 10 mM imidazole, washed 4 times with IP wash buffer containing 50 mM imidazole, eluted by heating with SDS sample buffer and separated by running a 12% SDS-PAGE gel. Proteins were transferred to a PVDF membrane and detected by using specified antibody.

73 Phosphorylation status of DUE-B does not affect DUE-B and Treslin interaction.

The C-terminal tail of DUE-B is conserved and contains multiple conserved serine (S) and threonine (T) sites. A previous laboratory member has shown that casein kinase II (CKII) can phosphorylate DUE-B from Sf9 cells at the C-terminal tail in vitro and these conserved CKII phosphorylation consensus (S/TXXD/E) located in a C- terminal tail of DUE-B are differentially phosphorylated between DUE-B purified from

Sf9 cells and DUE-B purified from HeLa cells (Kemp, 2006). Previous results using

Xenopus egg extract suggested that C terminal phosphorylation of DUE-B regulates its activity and serine/threonine residues in the C- terminal tail of DUE-B contains many conserved target sites for kinases and phosphatases (Gao et al., 2014). Furthermore, expression of non-phosphorylatable DUE-B, S/TA mutant displays stronger affinity for

Mcm3 and the soluble MCM complex than WT DUE-B suggesting that the phosphorylation status of the DUE-B C-terminus can regulate the interaction between

DUE-B and the MCM complex in vivo (Gao et al., 2014). HeLa cells expressing WT

DUE-B can restore Cdc45 loading and DUE-B S/TD does not significantly affect Cdc45 chromatin binding, but expression of DUE-B S/TA or ΔCT-DUE-B dramatically decreases Cdc45 loading, exerting a dominant-negative effect. Expression of unphosphorylatable S/TA DUE-B and knockdown of endogenous DUE-B also dominantly inhibited cell growth (Gao et al., 2014).

To study the physiological function of DUE-B C-terminus phosphorylation and its interaction with Treslin, point mutants targeting the C-terminus phosphorylation sites and the C-terminus deletion mutant were used (Gao et al., 2014). The deletion and S/T mutants of DUE-B have been previously described. Briefly, ΔCT-DUE-B lacks 59 amino

74 acids in the C-terminal domain, in S/TA mutants (S/TA DUE-B) 8 serine or threonine residues at the very end of the DUE-B C-terminus were mutated to non-phosphorylatable alanine (A) and in the S/TD mutants (S/TD DUE-B), the serine or threonine residues mutated in S/TA DUE-B were changed to phospho-mimetic aspartate (D) to simulate the phosphorylated residues. Different types of tags were added depending on the experimental needs. Switching tags or vectors backbone did not change the electrophoretic mobility when compared to each other (Figure 26A vs Figure 26B).

Although mutations of 8 S/T amino acids to D or to A, changed how the protein migrated in a gel (Gao et al., 2014). This phenomenon has been previously reported for smaller proteins, where the mutations causes some unexpected Stoke’s radius change or an unusual charge/ mass ratio change in the presence of SDS, or the acidic charge alteration from the mutation contributes to an unusual mobility in the presence of SDS (Shi et al.,

2012).

The C-terminus of DUE-B has been previously shown to be important for interaction with Treslin (Figure 25) and is also important for the interaction with TopBP1 and Cdc45 (Chowdhury et al., 2010). Phosphorylation status of the DUE-B C-terminal tail can regulate the interaction between DUE-B and the MCM complex in vivo (Gao et al., 2014). To test if DUE-B and Treslin interaction is mediated through S/T sites, pcDNA3.1 vector containing his6-tagged WT, S/TD or S/TA were transfected in HeLa and his6-tagged proteins were pulled down with Ni-NTA beads. WT, S/TD and S/TA mutants immunoprecipitated almost similar amounts of endogenous Treslin and a significant difference between WT, S/TD and S/TA were not observed.

75 A. B. HeLa HeLa pcDNA3.1 His pcDNA3.1 his6DUE-DUE-B -B pcDNA5.TO. pcDNA5.TO.FRT FRT FLAGflag DUE-DUE-B -B

Actin Actin

HisHis (DUE-B) Flag FLAG (DUE-B)

Figure 26: Expression of C- terminal his6-tagged and N-terminal FLAG-tagged

DUE-B, ΔCT, serine/threonine mutated to aspartic acid (S/TD) and serine/threonine mutated to alanine (S/TA) mutants.

(A) HeLa cells were transiently transfected with previously described his6-tagged

WT DUE-B or its mutant in a pcDNA3.1 vector (1 ug) in a 6-well plate and analyzed by western blotting 24 hours after transfection using specified antibody. (B) HeLa cells were transiently transfected with N-terminal FLAG-tagged DUE-B, ΔCT, S/TD or S/TA mutant in a pcDNA5.TO.FRT vector (1ug) in a 6-well plate and analyzed by western blotting 24 hours after transfection using specified antibody.

Figure 27: C-terminal serine/threonine phosphosites in DUE-B do not regulate the interaction between DUE-B and Treslin.

HeLa cells were transfected with WT DUE-B or ST/D DUE-B or ST/A DUE-B mutants in a 15cm plate. Twenty-four hours after transfection cells were lysed with IP lysis buffer containing 10 mM imidazole, pulled down with Ni-NTA beads washed with

IP wash buffer containing 50 mM imidazole 4 times and subjected to SDS sample buffer and heat. Proteins were separated in a 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by specified antibody.

77 To pursue this further and to perform a reverse experiment, HeLa T-Rex Treslin

SF cells were generated. First, we used pcDNA5/TO Treslin-SF to make tetracycline inducible cell lines (Gossen et al., 1995). After several unsuccessful results, Treslin-SF fragment was cloned into pcDNA5/TO/FRT vector by using Eco RV and Not I sites, and verified by colony PCR and sequencing. We reasoned that since the pcDNA5/TO vector did not have flp recombinase target (FRT), Treslin-SF fragments were integrated to heterochromatin (suppressed regions) of genome so adding a FRT site would target the plasmid to active “Flp-In” site in HeLa T-Rex genome. To generate a tetracycline inducible cell line pcDNA5/FRT/TO Treslin-SF was transfected to HeLa “Flp-In” T-Rex cell line along with pOG44 vector, treated with hygromycin for 15 days, clones picked and induced with doxycycline (Figure 28). All single clones displayed similar induction of FLAG-tagged Treslin when induced with doxycycline (Figure 28). Furthermore, induction of FLAG-tagged Treslin in HeLa T-Rex cell lines and analysis of DNA content by flow cytometry showed that the cell cycle progression profiles were unaffected when compared to HeLa T-Rex FLAG-tagged Treslin cells without doxycycline (Figure 29) suggesting that overexpression of Treslin for the duration of our experiment does not affect cell cycle progression (Figure 29, Sansam et al., 2015).

78 HeLa THeLa T--Rex Rex FLAG Flag TreslinTreslin SF ClonesSF clones 1 2 3 4 5 - + - + - + - + - + Dox

Flag (FLAG (TreslinTreslin))

Actin

Figure 28: HeLa T-Rex FLAG-tagged Treslin clones induced with doxycycline.

HeLa T-Rex cells stably expressing FLAG-tagged Treslin under the control of tetracycline was created as described in Materials and Methods using HeLa Flp-In T-Rex acceptor cell lines and pcDNA5/TO/FRT vectors. Hygromycin (100 ug/ml) was used to select integrated clones for 15 days, colonies picked and induced with doxycycline 1000 ng/ml for 24 hours. After induction cells were lysed with M-Per buffer (Thermofisher), separated in 10% SDS-PAGE gels and transferred to a PVDF membrane. Proteins were detected with the specified antibodies.

79 HeLaTHeLaT-Rex-RexFLAG DUE FlagDUE-B- NoB No DOX Dox HeLaTHeLaT-Rex-RexFLAG DUE FlagDUE-B -+DoxB +DOX 3000 3000

2250 2250

1500 1500 Count Count HeLaHeLaT TRex-RexFLAG TreslinTreslin NoDoxNo DOX HeLaHeLaT TRex-RexFLAG TreslinTreslin +Dox+DOX 750 750 6000 6000

4500 0 4500 0 5 6 6 5 6 6 3000 9 x10 1.8 x10 2.6 x10 3000 9 x10 1.8 x10 2.6 x10

Count FL2-A Count FL2-A 1500 1500

0 0 5 5 6 5 5 6 4.5 x10 9.8 x10 1.5 x10 4.5 x10 9.8 x10 1.5 x10 FL2-A FL2-A HeLaHeLaT T-Rex-RexFLAG DUE Flag DUE-B-B DOX induction induc tion.c 6 HeLaTHeLa -T-RexRexFLAG Flag TreslinTreslin induction.c6induction 3000 6000 HeLaHeLaT-RexHeLaTHeLaT TRex-RexFLAG DUE-RexFLAG Tres lin FlagDUE-BNoDoxTreslin-B No DOXNo DOX No Dox HeLa TRex Tres lin +Dox 4500 HeLaT-RexHeLaTHeLaT-RexFLAG DUE-RexFLAG FlagDUE-BTreslin-B +DOX+DOX +Dox 2250 3000 Count 1500 1500 6000 Count 4500 750 3000 Count 3000 1500

0 5 5 6 2250 4.5 x10 9.8 x10 1.5 x10 FL2-A

1500 Count 750

Figure 29: Induction of Treslin0 in HeLa T-Rex cells does not change the cell cycle 5 6 6 9 x10 1.8 x10 2.6 x10 progression profile. FL2-A

HeLa T-Rex FLAG Treslin cells were either uninduced or induced with doxycycline (1000 ng/ml) for 24 hours. DNA content of cells were analyzed for cells with or without doxycycline to check the cell cycle profiles using Accuri C6 flow cytometer after staining with 50 ug/ml propidium iodide and RNase digestion (25 ug/ml,

37 °C for 20 minutes).

80 Tetracycline inducible HeLa T-Rex FLAG-tagged Treslin cells were used to validate the results of phosphosite mutants in reverse immunoprecipitation experiments

(Figure 30). HeLa T-Rex FLAG-Treslin cells were either uninduced or induced (with doxycycline) and transfected with either his6-tagged WT or ΔCT or S/TD or S/TA DUE-

B simultaneously during induction. FLAG-tagged Treslin was used to pull-down Treslin with Red Anti-FLAG M2 beads and the interaction between DUE-B and Treslin was analyzed (Figure 30). The results of this experiment show that indeed S/T sites do not regulate interaction between DUE-B and Treslin because FLAG-tagged Treslin pulls down similar levels of his6-tagged WT-, S/TD- and S/TA- DUE-B. On the contrary,

FLAG-tagged Treslin could not pull-down his6-tagged ΔCT DUE-B which is consistent with the previous finding (Figure 25). Overall, S/T phosphosites in DUE-B do not regulate the interaction between Treslin and DUE-B, but the C-terminal tail is required for this interaction to occur. Together, the C terminus is needed for Cdc45, TopBP1,

Treslin and MCM binding (Gao et al., 2014), but phosphorylation only affects MCM binding. Dephosphorylated DUE-B binds to MCM during the G2/M phase but during S phase when CDK/DDK activity increases, phosphorylated DUE-B is released from the

MCM helicase (Gao et al., 2014). DUE-B phosphorylation is not necessary for the interaction with Treslin (Figure 27 and 30) and with TopBP1 and Cdc45 (Chowdhury et al., 2010) suggesting a possibility that unphosphorylated DUE-B that is bound to MCM helicase allows for recruitment of TopBP1, Treslin and Cdc45. There is a possibility that phosphorylation of Treslin is important for interaction with DUE-B which has not been tested in this study.

81 HeLa T-Rex FLAG Treslin

Input IP:FlagFLAGbeads

- -

- + + + + - + + + + Dox Flag (FLAG (TreslinTreslin) )

His (DUE-B)

Figure 30: Serine/threonine phosphosites do not regulate the interaction between

DUE-B and Treslin.

In a reverse experiment, HeLa T-Rex Treslin-SF were either induced (1000ng/ml) or uninduced with doxycycline and his6-tagged WT DUE-B or ΔCT or ST/D or ST/A

DUE-B were transiently transfected in FLAG-tagged Treslin induced cell lines. Twenty- four hours after induction and transfection, IP lysis buffer was used to lysed the cells,

FLAG-tagged Treslin was pulled down using Red Anti-FLAG M2 resins, washed 4 times with IP wash buffer, eluted with FLAG elution buffer (5 ug/ml FLAG peptide) and subjected to 12% SDS-PAGE gel. Proteins were transferred to a PVDF membrane and detected by using specified antibodies.

82 C-terminal domain in DUE-B is also necessary for binding of Treslin to chromatin.

C-terminus truncated DUE-B has very distinct property. The C-terminus domain regulates DUE-B subcellular localization because WT DUE-B localizes in both the nucleus and cytoplasm while ΔCT DUE-B preferentially localizes in the nucleus (Gao,

2012). Notably, ΔCT DUE-B alone cannot restore DNA replication (Gao et al., 2014) in

Xenopus egg extract and human cells (Chowdhury et al., 2010) and ΔCT-DUE-B dramatically decreases Cdc45 loading in depletion experiments, exerting a dominant- negative effect (Gao et al., 2014). Previously in this study, we have shown that C- terminal domain is required for interaction with Treslin (Figure 25 and 30) and siRNA resistant form of full length DUE-B could rescue Treslin binding to the chromatin after endogenous DUE-B was knocked down (Figure 9). To test if the C-terminal tail of DUE-

B is necessary for chromatin binding of Treslin, an siRNA resistant (siR) form of his6- tagged ΔCT-DUE-B was created using Gibson assembly, restriction digestion and cloning into the pcDNA3.1 vector (Appendix 3, 6 and 7; Figure 31A and 31B) and sequence verified. Sequence alignment of siR WT DUE-B and siR ΔCT-DUE-B with WT

DUE-B shows that indeed a siRNA resistant target sequence was inserted using Gibson assembly (Appendix 6, Gibson et al., 2008) and analysis of expression of pcDNA 3.1 his6-tagged siR ΔCT-DUE-B shows that his-tagged siR ΔCT-DUE-B expression matches siR WT DUE-B (Figure 31 C).

83 A. B. pcDNA3.1 siR His tagged C. pcDNA5/TO/FRT His siRNA resistant clones pcDNA3.1 siR His siR ΔCT ΔCT DUE-B1 HeLa siRWTDUE-B DUE-B1 DUE-B1 DUE-B1

siRΔCTDUE-B

BamHI NotI (-)

Actin

DUE-B

His ΔCT DUE-B

Figure 31: Analysis of siRNA resistant (siR) his6-tagged full length (fl) DUE-B and

ΔCT DUE-B.

(A) pcDNA3.1 his6 siR full length (fl) DUE-B and pcDNA3.1 his6 siR ΔCT DUE-

B were made by using mutagenesis PCR and Gibson assembly by adding Bam HI and

Not I sites. (B) pcDNA3.1 his6 siR full length (fl) DUE-B and pcDNA3.1 his6 siR ΔCT

DUE-B clones were digested with Bam HI and Not I and sequence verified (See alignment appendix 3) (C) siR fl DUE-B and siR ΔCT DUE-B were expressed in HeLa cells by transfecting 1 ug of plasmid, separated on a 12 % SDS-PAGE gel and analyzed by Western blotting with specified antibodies.

84 HeLa siDUE-B

Treslin

Orc2ORC2

His6siR-his siR flfl WT DUEDUE-B -B DUE-B (endogenous) DUE-B

siRHis6his ΔCT DUE-siR ΔCT DUE-B-B

Chromatin Bound

Figure 32: C-terminus deletion mutant cannot facilitate the binding of Treslin to the chromatin.

HeLa cells were transfected with control siRNA (50 nM), DUE-B siRNA (50 nM) or co transfected with his6-siR fl WT DUE-B DUE-B (400 ng) and siDUE-B or his6-siR

ΔCT DUE-B (400 ng) and siDUE-B. siRNAs were transfected twice 24 hours apart.

Twenty-four hours after the final transfection chromatin bound proteins were isolated, run on a 12% SDS-PAGE gel, transferred to a PVDF membrane and detected by specified antibodies.

85 Using siRNA resistant plasmids generated in Figure 31, a knockdown and rescue experiment was performed (Figure 32). Endogenous DUE-B was knocked down by transfection with siRNA #1 against DUE-B twice over a 24-hour interval and his6-tagged siR fl WT DUE-B and his6-tagged siR ΔCT DUE-B were used to rescue Treslin chromatin binding (Figure 32). DUE-B siRNA reduced the endogenous levels of DUE-B by about 90% and inhibited the binding of Treslin as previously described (Figure 7, 8 and 9) and siR fl WT DUE-B rescued Treslin chromatin binding to endogenous levels like previously described (Figure 9). Co-expression of siR ΔCT DUE-B with DUE-B siRNA could not rescue the chromatin binding of endogenous Treslin, suggesting that C-terminal tail of DUE-B is necessary for the chromatin binding of Treslin (Figure 32) although

ΔCT DUE-B can bind to the chromatin. Orc2 was used as a loading control for chromatin bound proteins. These experiments further highlight the importance of DUE-B, especially the C-terminus tail of DUE-B, in chromatin binding of Treslin.

Summary

Data from this chapter further highlight the importance of C-terminal domain of

DUE-B in DNA replication. Our laboratory has previously shown that the C-terminus tail of DUE-B in necessary for interaction with three essential replication factors, TopBP1,

Cdc45 and MCM sub-units (Chowdhury et al., 2010; Gao et al., 2014). From co-IP experiments in this study, it was observed that DUE-B interaction with Treslin is mediated through the same C-terminus tail. Phosphosites in the C-terminus domain are important for the incorporation of DUE-B into a high molecular weight complex (Gao et al., 2014) but phosphosite mutation do not regulate interaction with Treslin in this study.

86 The C-terminus domain of DUE-B is essential for loading Cdc45 on to the chromatin and lack of C-terminus domain shows dominant-negative effect for cell growth in depletion experiments (Chowdhury et al., 2010; Gao et al., 2014). Depletion and rescue experiments from this study shows that C-terminus tail is necessary for binding of Treslin to the chromatin. There a remote possibility that ΔCT DUE-B can homodimerize with endogenous DUE-B and pull-down and allow binding of small amount of Treslin.

Overall, C-terminus tail of DUE-B is necessary for the interaction with Treslin and its chromatin binding.

V. Interaction of DUE-B and Treslin is cell cycle regulated.

The process of DNA replication is regulated by the interaction of replication factors in a cell cycle dependent manner. Timing of interaction of replication factors is critical. For instance, replication factors Cdc6 and Cdt1 can facilitate the loading of inactive helicase only after ORC1-6 complex is formed, and the levels and activities of

Cdc6 and Cdt1 are strictly limited to the origin-licensing step just before replication initiation. Once the functions of Cdc6 are carried out, it is phosphorylated by CDK1 and targeted for proteosomal degradation (Drury et al., 1997). Cdt1 on the other hand is degraded or inhibited by the action of Geminin after replication initiation (reviewed in

Kim and Kipreos, 2007). This is one of the many events during DNA replication where interaction of replication factors is prevalent in a time and cell cycle dependent manner.

DNA replication also requires the sequential binding of replication proteins to the chromatin as shown by the evidence from this study (Figure 6). Several studies point to the existence of interactions of DNA synthesis proteins with cell cycle dependent protein

87 kinases or cyclins, as well as the phosphorylation of DNA synthesis proteins by CDKs

(Nasheuer et al., 1991; Loor et al., 1997).

DUE-B and Treslin interaction is enhanced during G1 phase before replication begins.

Previous data from Leffak laboratory has indicated that DUE-B is an essential component in the process of DNA replication (Casper et al., 2005; Chowdhury et al.,

2010) and its activity is regulated by phosphorylation status (Gao et al. 2014).

Phosphorylation of DUE-B is mainly controlled by the equilibrium between phosphorylation by DDK (Cdc7/Dbf4) and dephosphorylation by PP2A (Gao et al.,

2014). When PP2A activity is high, DUE-B is dephosphorylated and interacts with the

MCM helicase in G2/M phase. In this study, we have shown that DUE-B interacts with another important replication factor, Treslin (Figure 14 and 20) although phosphosites mutants in DUE-B showed no effect on Treslin interaction. When DUE-B gets phosphorylated by the action of DDK in G1/S phase transition, it disassociates from the

MCM complex (Gao, 2012). The phosphorylation-dependent binding of DUE-B to soluble MCM complex may reflect the binding of DUE-B to the chromatin-bound MCM complex. The timing of DUE-B chromatin loading and Treslin chromatin loading display similar kinetics (Figure 6). This suggests that when CDK levels are low DUE-B interacts with MCM and also as CDK activity increase phosphorylated Treslin are bound to the

MCM/ DUE-B. Once DUE-B gets completely phosphorylated, interaction with MCM complex is decreased (Gao, 2012). Because DUE-B is released from the chromatin when

DNA synthesis begins and phosphorylated DUE-B does not interact with MCM complex

88 we suspected that DUE-B and Treslin interaction is cell cycle dependent. To test the hypothesis that DUE-B interacts with Treslin before DNA replication begins, cell cycle dependent co-IP were carried out to analyze DUE-B and Treslin interaction.

Tetracycline inducible HeLa T-Rex FLAG-tagged DUE-B cells were used to perform co-IP experiments by block and release experiments as previously described

(Figure 5 and 6) along with induction of WT FLAG-tagged DUE-B by doxycycline. For cell synchronization experiments, HeLa T-Rex FLAG-tagged DUE-B cells were treated with nocodazole (100 ng/ml) to block the cells in late G2/M phase of the cell cycle and shaken off. The cells were released into M phase by changing the cells to drug-free growth medium (Terasima et al. 1963) without doxycycline. Cells were harvested at various time points into M phase, throughout the G1 phase and into S phase of the cell cycle. Flow cytometer analysis (Figure 33) of the DNA content shows that the cells were indeed blocked by nocodazole treatment, and that cells progressed normally into the following cell cycle phase after release with fresh medium. As per DNA content profiles in this experiments (Figure 33), 0 hour corresponds to late G2 and early M phase, 1 hour corresponds to M phase, 5 hours corresponds to early/ mid G1, 9 hours corresponds to late G1 phase and in 13-hours cells start moving into S phase of the cell cycle.

Figure 33: Flow profile for nocodazole blocked/released HeLa T-Rex FLAG WT

DUE-B cells after induction with doxycycline.

HeLa T-Rex FLAG DUE-B were induced (1000 ng/ml doxycycline) or uninduced for 24 hours and blocked with nocodazole (100 ng/ml) for 18 hours and released by using

DMEM with 10% FBS after shake-off into M phase. Doxycycline was not continued after removal of nocodazole. DNA content of cells was analyzed at the indicated time points using Accuri C6 flow cytometer after staining with 50 ug/ml propidium iodide.

90 DUE-B and Treslin interaction was analyzed by pull-down experiments for nocodazole blocked and released cells at indicated time points (Figure 33). Red Anti-

FLAG M2 beads were used to pull-down FLAG-tagged DUE-B and its interaction with

Treslin on a cell cycle dependent manner was assessed (Figure 34). Time course experiments using HeLa T-Rex FLAG WT DUE-B cells show that treatment with doxycycline induced FLAG-tagged DUE-B in all tetracycline inducible cells (input lanes). Treslin levels throughout our analysis seem somewhat similar and treatment with doxycycline and nocodazole did not affect the levels of endogenous Treslin (input lanes

Treslin blot; albeit a slight decrease is observed at timepoints 0 hour and 1hour indicating that the Treslin level itself may be cell-cycle regulated). Pull-down with FLAG-tagged

DUE-B shows that there is minimal interaction between DUE-B and Treslin during late

G2 and M phase of cell cycle (0 to 1 hour after release from nocodazole) and the interaction is significantly increased at time points 5 hour and 9 hours after release from nocodazole. This time point matches with mid/ late G1 phase of the cell cycle when cells prepare for the initiation of DNA replication. The association is possibly regulated by

CDK activity. Thirteen hours after release (during S phase) interaction between DUE-B and Treslin returns to background levels, suggesting that once cells start replicating the genome the interaction between DUE-B and Treslin is lost. This is consistent with the release of DUE-B following Cdc45 loading, DNA unwinding and RPA SSB loading

(Casper et al., 2005; Gao et al., 2014)

91 HeLa T-Rex FLAG WT DUE-B

Input: HeLa T-Rex Flag DUE-B IP Flag : HeLa T-Rex Flag DUE-B Input IP: FLAG

Time after nocodazole Time after nocodazole release release

- + + + + + + - + + + + + + Dox

Treslin

Flag (DUEFLAG (DUE-B)-B)

Figure 34: DUE-B and Treslin interaction is increased during G1 phase before DNA replication starts.

HeLa T-Rex FLAG DUE-B were induced (1000 ng/ml doxycycline) or uninduced for 24 hours and blocked with nocodazole (100 ng/ml) for 18 hours and released by using

DMEM with 10% FBS after shake-off into M phase. Cells were collected at indicated time points, IP lysis buffer was used to lysed the cells, FLAG-tagged DUE-B was pulled down using Red Anti-FLAG M2 resins, washed 4 times with IP wash buffer, eluted with

FLAG elution buffer (5 ug/ml FLAG peptide) and subjected to 10% SDS-PAGE gel.

Proteins were visualized as in Figure 6.

92 Summary

Cyclins, kinases and phosphatases primarily regulate the cell cycles phases. But protein-protein interactions during the process of DNA replication are also regulated by cell cycle. The interaction between replication factors allow for step-wise assembly of an active helicase for unwinding of DNA and process of DNA replication initiation. Data from this section shows two key helicase activation factors interact in a cell cycle dependent manner. Both DUE-B and Treslin have been reported to be necessary for loading of Cdc45 to activate the helicase onto the chromatin (Chowdhury et al., 2010;

Kumagi et al., 2010). There is minimal/no interaction of DUE-B and Treslin during

G2/M phase of cell cycle or after the DNA synthesis begins but the interaction is maximal during mid/late G1 phase when cell prepare for the activation of replicative helicase before DNA replication begins.

VI. Activation of checkpoint decreases DUE-B, Treslin and TopBP1 interaction and reduces DUE-B, Treslin and Cdc45 chromatin binding

The DNA damage checkpoint response comprises a series of signal transduction pathways that is activated in response to DNA injuries. It acts as a defense mechanism when replication is challenged. At the apical end of checkpoint pathway are three kinases: ATM, DNA-PK and ATR. ATR can be induced by a range of replicative stressors and DNA damaging agents. During replicative stress, ATR kinase is activated which acts as a barrier to prevent further DNA from duplication by stalling the cell cycle and firing of late origins. A major means to block DNA replication by checkpoint activation is by blocking kinases DDK and CDK, or by upregulating phosphatases (Falck

93 et al., 2001; Costanzo et al., 2003; Heideker et al., 2007; Lopez-Mosqueda et al., 2010;

Zegerman and Diffley, 2010). Among the checkpoint pathways that converge to stop replication by inactivation of the MCM helicase, inhibition of Cdc45 loading on the

MCM2-7 helicase, and inhibition of replicative polymerase (Waga et al., 1994).

DUE-B and Treslin are key regulators of Cdc45 chromatin binding in higher organisms. Treslin has been shown to play a direct role in DNA damage mediated checkpoint pathway (Hassan et al., 2013; Figure 35). When DNA damage pathway is activated ATR phosphorylates Chk1. Treslin stimulates ATR mediated phosphorylation of Chk1 and this requires the N-Terminal domain of TopBP1. Treslin also interacts with the same general region of TopBP1 as the 9-1-1 and MRN complexes (Delacroix et al.,

2007; Lee et al., 2007; Yoo et al., 2009) and cells lacking Treslin accumulate damaged

DNA, as indicated by the appearance of phosphorylated H2AX (Kumagi et al., 2010).

On the other hand, when damage is induced by the treatment of DNA stressing agents like aphidicolin or etoposide, DUE-B binding to the chromatin is severely affected

(Figure 36). This is an ATR dependent phenomenon because when DNA damage is induced and ATR is inhibited by the action of caffeine, DUE-B binding to the chromatin is rescued (Gao, 2012). Since DUE-B and Treslin interact during normal DNA replication and TopBP1 is required for the interaction of DUE-B and Treslin, and since Treslin and

TopBP1 play dual roles both in DNA replication and checkpoint pathway it will be interesting to assess whether DUE-B, Treslin and TopBP1 interaction persists when replicative stress is induced. To address this notion, DNA replication was challenged by two types of replicative stressors, aphidicolin (a competitive inhibitor of DNA polymerases), or hydroxyurea (inhibition of ribonucleotide reductase) treatment.

94 TopBP1 TopBP1 ATR TopBP1 ATRATR TopBP1 ATR Treslin TreslinTreslin Treslin

P P

Figure 35: Direct role of Treslin in checkpoint pathway.

(Right) When DNA damage pathway is activated ATR phosphorylates Chk1,

Treslin stimulates ATR mediated phosporylation of Chk1 and this requires the N-

Terminal domain of TopBP1. (Left) In the absence of Treslin, or when the interaction between Treslin and TopBP1 is blocked either by mutating serine 1000, or by expressing the N-terminal domain of TopBP1, the phosphorylation of Chk1 is blocked. Treslin is phosphorylated in a CDK/cyclin E-dependent manner, which increases its affinity for binding to TopBP1 and contributes to its replication and checkpoint functions (Hassan et al., 2013).

ATR

DUE-B

Normal replication DNA damage

Figure 36: DUE-B chromatin binding during normal DNA replication and in the presence of DNA damage.

(Left) When there is no DNA damage, DUE-B is normally bound to chromatin with the action/ interaction of replication factors. (Right) When damage is induced by the treatment of DNA stressing agents like aphidicolin or etoposide, DUE-B binding to the chromatin is severely affected. When DNA damage is induced along with the treatment of ATR inhibitor caffeine, DUE-B binding to the chromatin can be rescued suggesting this is a ATR dependent phenomenon (Gao, 2012).

96 Checkpoint activation with hydroxyurea and aphidicolin

Hydroxyurea is a potent inhibitor of DNA synthesis. Hydroxyurea decreases the production of deoxyribonucleotides via inhibition of the enzyme ribonucleotide reductase by scavenging tyrosyl free radicals, which are involved in the reduction of rNDPs (Platt,

2008). Biochemical studies using HU as a DNA replication inhibitor shows that HU blocks DNA synthesis by inhibiting dNTP expansion (Koç et al., 2004) and depletion of dNTP pools resulting in immediate stalling of replication forks (Bianchi et al., 1986).

Activation of checkpoint leads to Chk1phosphorylation on serine 345 (S345) with HU treatment (Liu et al., 2000).

Aphidicolin is a reversible inhibitor of eukaryotic DNA replication (Pedrali-Noy and Spadari, 1979). Aphidicolin inhibits DNA polymerase α, δ and ε activity and results in uncoupling the polymerases and the DNA unwinding helicase MCM (Sessa et al.,

1991; Byun et al., 2005). Aphidicolin treatment reduces the polymerase speed and generates single stranded DNA leading to activation of the replication checkpoint response (Guo et al., 2000).

To test if checkpoint pathway is functional and to establish the chronic concentrations of HU and APH required to activate the checkpoint pathway in HeLa T-

Rex cells, varying doses of HU (Figure 37) and APH (Figure 38) were used. Treatment of

HeLa T-Rex cells with chronic HU for 12 hours induced checkpoint in all doses tested (1,

2 and 5 mM) while the untreated sample did not induce checkpoint, as observed by pChk1 (S345) (Figure 37). Treatment of HeLa T-Rex cells with chronic dose of APH for

12 hours also induces checkpoint activation. The doses used for APH were 10, 20 and 30 uM (Figure 38). Phosphorylation of serine 345 was used to confirm checkpoint activation

97 in HeLa T-Rex cell lines. These experiments suggest that checkpoint pathway is functional in HeLa T-Rex FLAG DUE-B cell lines. For further checkpoint induction experiments, 2 mM of HU or 20 uM of APH was used.

98 HeLa THeLa -Rex FLAG WT DUET-Rex Flag DUE-B -B

(-) 1 2 5 HU (mM) pChk1

Actin

Figure 37: Activation of checkpoint by hydroxyurea.

HeLa T-Rex FLAG DUE-B cells were treated with indicated concentrations of hydroxyurea (HU) for 12 hours for the determination of concentration that induces the activation of checkpoint pathway. Twelve hours after treatment, cells were lysed by M-

Per buffer, separated by 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by indicated antibodies. P-Chk1 (S-345) antibody was used to check the phosphorylated Chk1 status.

99 HeLa HeLa TT-Rex Flag DUE-Rex FLAG WT DUE-B-B

(-) 10 20 30 APH (uM) pChk1

Actin

Figure 38: Activation of checkpoint by aphidicolin.

HeLa T-Rex FLAG DUE-B cells were treated with indicated concentrations of aphidicolin (APH) for 12 hours for determination of concentration that induces the activation of checkpoint pathway. Twelve hours after treatment, cells were lysed by M-

Per buffer, separated by 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by indicated antibodies. P-Chk1 (S345) antibody was used to check the phosphorylated Chk1 status.

100 Chronic Treatment with HU and APH reduces the interaction between DUE-B and

Treslin

Previously, we have shown that DUE-B and Treslin interacts in vivo (Figure 14,

19, and 20) and TopBP1 is required for the interaction of DUE-B and Treslin (Figure 22).

Treslin also interacts with TopBP1 during normal DNA replication (Kumagi et al., 2010) and during checkpoint activation to stimulate Chk1 phosphorylation through ATR mediated pathway (Hassan et al., 2013). The association between DUE-B, Treslin and

TopBP1 was analyzed during the activation of checkpoint pathway by the treatment with replicative stressors, HU and APH. Both HU and APH lead to stalling of replication forks, albeit by different mechanisms.

Tetracycline inducible HeLa T-Rex FLAG DUE-B cells were used in combination with replicative stress (HU, Figure 39) and (APH, Figure 40) to access the interaction between DUE-B, Treslin and TopBP1 during DNA replicative stress. HeLa T-

Rex FLAG DUE-B cells were induced with doxycycline (1000 ng/ml) or uninduced and simultaneously treated with chronic concentration of HU (2 mM) for 12 hours to activate the checkpoint (Figure 39). Treatment with HU activated the checkpoint pathway

(pChk1; lane 3, Figure 39). Like previous results, induction of FLAG-tagged DUE-B and pull-down with Red Anti-FLAG M2 beads immunoprecipitated endogenous TopBP1 and

Treslin (lane5, Figure 39) but activation of the checkpoint by HU treatment clearly abolished the interaction between DUE-B, Treslin and TopBP1 (Lane 6, Figure 39).

101 HeLa THeLa T-Rex FLAG WT DUE-Rex Flag DUE--B B

HeLa T-Rex FLAG WT DUE-B Input IP: FlagFLAG Input IP: FLAG HU HUHU HU (2 mM) (2mM)2 mM 2 mM Dox - + + - + + Dox Treslin Treslin TopBP1 TopBP1

pChk1pChk1

FLAG (DUEFlag (DUEFLAG (DUE--B)B) B) 1 2 3 4 5 6

Figure 39: Activation of checkpoint pathway by hydroxyurea reduces the interaction between DUE-B, Treslin and TopBP1.

HeLa T-Rex FLAG DUE-B cells were induced with doxycycline (1000 ng/ml) or uninduced and treated with chronic concentration of HU (2 mM) for 12 hours to activate the checkpoint. Following treatment cells were lysed with IP lysis buffer, FLAG-tagged

DUE-B was pulled down using Red Anti-FLAG M2 resins, washed 4 times with IP wash buffer, eluted with FLAG elution buffer (5 ug/ml FLAG peptide) and subjected to 10%

SDS-PAGE gel. Proteins were transferred to a PVDF membrane and detected by using the specified antibodies.

102 HeLa T-Rex FLAG WT DUE-B Input IP: FLAG APH APH 10 uM 10 uM Dox Treslin

TopBP1

pChk1

FLAG (DUE-B)

Figure 40: Activation of checkpoint pathway by aphidicolin reduces the interaction between DUE-B, Treslin and TopBP1.

HeLa T-Rex FLAG DUE-B cells were induced with doxycycline (1000 ng/ml) or uninduced and treated with chronic concentration of APH (10 uM) for 12 hours to activate the checkpoint. Following treatment cells were lysed with IP lysis buffer, FLAG- tagged DUE-B was pulled down using Red FLAG M2 resins, washed 4 times with IP wash buffer, eluted with FLAG elution buffer (5 ug/ml FLAG peptide) and subjected to

10% SDS-PAGE gel. Proteins were transferred to a PVDF membrane and detected by using the specified antibodies.

103 Similarly, a different kind of replicative stress, aphidicolin, which inhibits the

DNA polymerase α, δ and ε activity was used to activate the checkpoint pathway and analyze the interaction between DUE-B, Treslin and TopBP1. HeLa T-Rex FLAG DUE-

B cells were induced with doxycycline (1000 ng/ml) or uninduced and a simultaneous chronic treatment of APH (10 uM) was performed for 12 hours to activate the checkpoint

(Figure 40). Treatment with APH activated the checkpoint pathway (pChk1; lane 3,

Figure 40) and FLAG-tagged DUE-B pulled down endogenous TopBP1 and Treslin

(lane5, Figure 40) when Red Anti-FLAG M2 beads were used to pull-down FLAG- tagged DUE-B. Activation of checkpoint by APH treatment inhibited the interaction between DUE-B, Treslin and TopBP1 (Lane 6, Figure 40) just like HU results. Using two different types of replicative stressor, we show that DUE-B, Treslin and TopBP1 interaction is reduced when the checkpoint pathway is activated. In Xenopus extracts, when damage is induced by the treatment of DNA stressing agents like aphidicolin or etoposide, DUE-B binding to the chromatin is severely affected (Gao, 2012).

Checkpoint activation reduces DUE-B, Treslin and Cdc45 levels on the chromatin but not TopBP1

When cells sense damage, a transduction pathway comes into effect to overcome the assault. Activation of checkpoint pathways due to replicative stressors like HU and

APH converge to stop replication by inactivation of helicase through inhibition of Cdc45 loading on the MCM2-7 helicase. The detailed mechanism of how ATM/ ATR inhibits

Cdc45 is still unclear. Several models suggest two important kinases important for regulation of DNA replication, CDK and DDK, might be targets of the checkpoint

104 response (Heffernan et al., 2002; Sancar et al. 2004). Treslin, a CDK substrate in higher eukaryotes, plays dual role in checkpoint and replication to stimulate Chk1 phosphorylation (Hassan et al., 2013; Guo et al., 2015). Our laboratory has shown that

DUE-B chromatin loading is blocked after DNA damage in an ATR dependent fashion using the Xenopus system (Gao, 2012). To check the effect of replicative stress on the chromatin binding ability of replication factors in human cells, chronic treatment of HU and APH were performed for 12 hours. HeLa cells were either treated with HU or APH, chromatin bound proteins isolated and analyzed by western blotting. HU (Figure 41) and

APH (Figure 42) treatment activated checkpoint pathway in HeLa cells as observed by pChk1 levels. Analysis of chromatin bound proteins after HU to induce checkpoint activation shows that DUE-B, Treslin and Cdc45 binding to the chromatin is reduced but

TopBP1 levels are unchanged. Likewise, analysis of chromatin bound proteins after APH treatment shows that activation of checkpoint by APH also reduced DUE-B, Treslin and

Cdc45 levels without affecting TopBP1 levels. Overall, replicative stressors inhibit DUE-

B, Treslin and Cdc45 binding to the chromatin perhaps to stop activation of helicase by loading Cdc45 on to the chromatin until the damage is repaired but since TopBP1 falls under the sensor/mediator group of checkpoint proteins, it binds to chromatin because the checkpoint function kicks in when DNA damage is sensed.

105 HeLa

- + HU (2 mM)

Treslin

TopBP1

Cdc45

pChk1

Orc2

DUE-B

Chromatin bound

Figure 41: Checkpoint activation by hydroxyurea (HU) decreases the chromatin binding of DUE-B, Treslin, and Cdc45 but not TopBP1.

HeLa cells were treated with chronic dose of HU for 12 hours and chromatin bound proteins were isolated. Proteins were separated by running on a 10% SDS-PAGE gel, and visualized as in Figure 6. Orc2 was used as a loading control for chromatin bound proteins.

106 HeLa HeLa - + APH (10 HU (2mM)uM) Treslin Treslin TopBP1TopBP1

Cdc45CDC45

pChk1

Orc2ORC2 DUE--BB

Figure 42: Checkpoint activation by aphidicolin (APH) decreases the chromatin binding of DUE-B, Treslin, and Cdc45 but not TopBP1.

HeLa cells were treated with chronic dose of APH for 12 hours and chromatin bound proteins were isolated. Proteins were separated by running on a 10% SDS-PAGE gel, transferred to a PVDF membrane and detected by specified antibodies. Orc2 was used as a loading control for chromatin bound proteins.

107 Summary

Data from this section shows the importance of replication factors in the context of checkpoint activation. Since checkpoint pathway activation and the process of DNA replication are closely tied, there is cross talk between the two pathways. When DNA damage occurs, checkpoint pathway gets activated which sends signals to delay replication. The results from this chapter support this notion. Using HeLa derived tetracycline inducible system in the presence of replicative damage, we showed that the interaction between replication factors (DUE-B, Treslin and TopBP1), which is necessary to activate helicase, is reduced by replicative stressors like aphidicolin or hydroxyurea.

Replicative stressors also reduced the levels of chromatin bound DUE-B, Treslin and

Cdc45 in HeLa cells but not TopBP1. In checkpoint pathway, TopBP1 functions as a sensor and when damage occurs, TopBP1 interacts with ATRIP-ATR and phosphorylated

Rad9 in the 9-1-1 clamp. The ATR-activating domain of TopBP1 stimulates the kinase activity of ATR (reviewed in Xu and Leffak, 2010). So, stressors like APH and HU may not affect TopBP1 binding to the chromatin because checkpoint function of TopBP1 will sense the damage and bind to the chromatin

108 DISCUSSION

DUE-B is an important replication factor, which was identified by using the DNA unwinding element fragment of the human c-myc replicator as bait. DUE-B has been previously shown to be important for activation of the MCM replicative helicase. The data presented here further highlight the importance of DUE-B before activation of the helicase. Specifically, this study identified its interaction with another important replication factor and CDK substrate in higher eukaryotes, Treslin as a part of a DUE-

B/Treslin/TopBP1 complex.

I. DUE-B is required for the chromatin binding of Treslin and vice versa.

DUE-B is an important replication protein necessary for loading of helicase activator (Cdc45) on the helicase because depletion of DUE-B in Xenopus egg extracts and HeLa cells inhibited Cdc45 chromatin binding. This study confirms the results that

Cdc45 levels on the chromatin are reduced after knockdown of DUE-B (Chowdhury et al., 2010). Previous observations from our laboratory using Xenopus egg extracts have shown that TopBP1, DUE-B and Cdc45 bind to chromatin at roughly the same time but the results in this study in mammalian cell shows that there might be slight difference in the timing of replication factor loading in comparison to Xenopus system probably due how replication is regulated from one species to another, although the end goal of the interaction is to load Cdc45 on the chromatin. In human cells, we observe that TopBP1 and DUE-B bind to the chromatin before Cdc45 unlike in the Xenopus system where

109 DUE-B, Cdc45 and TopBP1 bind chromatin together (Gao, 2012). We also show that

Treslin, another replication factor and CDK substrate in higher eukaryotes, which is also necessary for binding of Cdc45 to the chromatin, is reduced in absence of DUE-B possibly because DUE-B/Treslin complex is loaded to the chromatin together. Indeed,

Treslin knockdown also decreased DUE-B binding to the chromatin suggesting that

Treslin and DUE-B most likely bind to chromatin together as a complex in the presence of TopBP1 (Table 3). Also, a small fraction of Treslin starts binding chromatin at similar time points as DUE-B and TopBP1 (Figure 6) which is consistent with report by Kumagi et al. (2010) in the context of TopBP1 and Treslin interaction. These data suggest that

DUE-B, TopBP1 and Treslin binding to the chromatin occurs during a similar temporal window before pre-IC formation.

Cdc45 binding occurs after DUE-B, Treslin and TopBP1 bind to the chromatin, indicating that chromatin binding DUE-B, Treslin and TopBP1 are perhaps necessary for

Cdc45 chromatin loading. Depletion of Treslin from Xenopus did not affect TopBP1 binding to the chromatin but in our system, knockdown of Treslin reduced TopBP1 binding to the chromatin but in reverse experiment TopBP1 knockdown did not affect

Treslin chromatin binding suggesting Treslin is required for retention of TopBP1 on the chromatin. DUE-B does not affect binding of TopBP1 to chromatin in HeLa cells.

TopBP1 knockdown does not affect Treslin or DUE-B chromatin binding but reduced Cdc45 chromatin loading consistent with previous finding (Kumagi et al. 2010;

Walter and Newport, 2000). DUE-B and Treslin regulate each other’s binding to the chromatin and Treslin is required for TopBP1 chromatin loading, allthough in Xenopus

TopBP1 and Treslin associate with chromatin independently. The results of all

110 knockdown experiments have been summarized in Table 3 (Appendices). In HeLa cells, since TopBP1 is required for the interaction of DUE-B and Treslin, a scenario occurs where these factors bind to the chromatin as a complex or sequentially where TopBP1 is necessary for the interaction of Treslin and DUE-B. In any case, binding of substantial fraction of DUE-B and Treslin to the chromatin relies on each other but there is a possibility that interaction with TopBP1 may occur on the chromatin once DUE-B and

Treslin are bound to chromatin. Nonetheless, a remote possibility occurs that active form of all these replication factors, DUE-B, Cdc45 and TopBP1, binding to the chromatin depends on pre-RC formation and only some fractions rely on each other.

Unphosphorylated DUE-B binds to MCM proteins in G2/M phase during the pre-RC formation step (Gao et al., 2014) and perhaps this interaction between DUE-B and MCM allows sequential binding of TopBP1, Treslin and eventually Cdc45. On a side note,

DUE-B possesses redundant function of Treslin like Cdc45 loading to the chromatin to activate the helicase suggesting that in higher eukaryotes Sld3 functions maybe distributed in few proteins. Indeed, another protein, GEMC1 is also is necessary for

Cdc45 chromatin loading, is phosphorylated by CDK and interacts with TopBP1

(Balestrini et al, 2010).

II. DUE-B, Treslin and TopBP1 interact in vivo and C terminus is necessary for the interaction of DUE-B and Treslin.

TopBP1 has previously been shown to interact with Treslin and DUE-B (Kumagi et al., 2010; Chowdhury et al., 2010). Interaction of TopBP1 with DUE-B has also been confirmed in this work. The interaction between DUE-B and TopBP1 requires the DUE-

111 B C-terminus tail. Using co-IP experiments, we showed that tagged-versions of DUE-B could efficiently pull-down Treslin and vice-versa. The interaction between DUE-B and

Treslin did not require the bridging by DNA suggesting that these replication factors can interact before binding on to the DNA. Furthermore, interaction of DUE-B and Treslin requires TopBP1. The interaction between DUE-B, Treslin and TopBP1 is important because in replication all these replication factors function before the helicase activation step to load Cdc45 on the chromatin.

DUE-B C-terminus domain is highly conserved in higher eukaryotes highlighting the importance of the C-terminus domain. It contains multiple conserved serine and threonine sites. C-terminus tail of DUE-B is disordered and mediates protein-protein interaction. Indeed, the C-terminus domain is required for the interaction with MCM sub- units, TopBP1 and Cdc45. By using tagged mutant versions of DUE-B the interaction with Treslin was analyzed. Analysis of ΔCT DUE-B showed that interaction of DUE-B with Treslin is abolished without C-terminus domain of DUE-B. Further analysis of C- terminal domain showed that absence of C-terminus domain couldn’t restore Treslin chromatin binding. Cdc45 interaction with DUE-B also requires the presence of C- terminal domain of DUE-B (Chowdhury et al., 2010).

C-terminus of DUE-B has multiple serine/threonine sites. Mutational analyses of these serine threonine sites to phospho-deficient alanine or phosphomimic aspartic acid bound Treslin with similar affinity suggesting phosphorylation of DUE-B is not necessary to interact with Treslin, although dephosphorylated DUE-B binds to MCM sub-units in G2/M phase in Xenopus. Previous report regarding interaction of DUE-B with TopBP1 or Cdc45 suggested similar predication because binding of baculovirus-

112 expressed DUE-B, TopBP1, and Cdc45 implied that DUE-B phosphorylation was not essential for their interaction (Chowdhury et al., 2014). Since Treslin is also phosphorylated by CDK, we speculate that phosphorylation in Treslin may regulate the interaction between the DUE-B C-terminus and Treslin. Alternatively, phosphorylation may be important after the interaction of DUE-E, Treslin with TopBP1. More experiments are necessary to address these questions.

III. Cell cycle dependent analysis of DUE-B and Treslin shows that DUE-B and

Treslin interaction is enhanced just before replication begins.

The process of DNA replication is regulated by the interaction of replication factors in a cell cycle dependent manner and timing of interaction of replication factors is critical. DNA replication also requires the sequential binding of replication proteins to the chromatin as shown by the evidence from this study (Figure 6). Several studies point to the interactions of DNA synthesis proteins with cell cycle dependent protein kinases or cyclins (Nasheuer et al., 1991; Loor et al., 1997). DUE-B is regulated by phosphorylation controlled by DDK and PP2A and dephosphorylated DUE-B interacts with MCM helicase but during S phase DDK activity relieves phosphorylated DUE-B from the chromatin. A cell cycle dependent analysis was carried out to understand the interaction behavior of DUE-B with Treslin. Using co-IP of tetracycline inducible FLAG-tagged

DUE-B in nocodazole block and release experiments, we showed that interaction of

DUE-B and Treslin is minimal during G2-M phase suggesting that perhaps DDK and

CDK activity may be necessary for DUE-B and Treslin interaction. CDK and DDK phosphorylate Treslin (Kumagi et al., 2010; Bruck and Kaplan, 2015). Interaction is

113 significantly increased at/during mid to late G1 phase. We speculate that this is when cells are preparing for helicase activation to fire early origins and the replication factors like DUE-B and Treslin which load the helicase activator are expected to be primed to serve their function and interact with each other. In 13-hours the interaction between

DUE-B and Treslin goes back to basal level because once the S-phase commences, DUE-

B and Treslin interaction is not necessary and because Cdc45 would have been primed for activation of the helicases. Recent study of Sld3 (Treslin ortholog in yeast) also shows that Sld3 interacts with MCM sub-units in vitro (Fang et al., 2016). The finding of previous 3 sections of discussion and previously published data from our lab can be summarized in the following model (Figure 44).

114 CDK/ DDK low MCM 2-7 DUE-B

ORC 1-6 MCM 2MCM 2-7-7 pre-RC ORC 1ORC 1-6-6 Treslin prepre-RC-RC GINS CDK TopBP1 Cdc45 N terminus CDK/ DDK high GINS CDKCDK GINS DUE-B Cdc45Cdc45Treslin N terminusN terminusP G1 ORC 1-6 DUEDUE-BTopBP1-B TreslinTreslin P G1G1 ORC 1-6 P ORC 1-6 TopBP1TopBP1 Treslin

TreslinTreslin DUE-B

DUEDUE-B-B CMG helicase P pre-IC CMG helicaseCMG helicase pre-IC pre-IC CMG helicase S

CMG helicaseCMG helicase

Figure 43: Model for DUE-B, Treslin and TopBP1 interaction during DNA replication.

During DNA replication, dephosphorylated C-terminus of DUE-B interacts with pre-RC (specifically MCM helicase sub-units). And as cells progress in G1 phase, DUE-

B interacts with Treslin and TopBP1 because interaction of DUE-B and Treslin increases before the initiation of DNA replication during mid/ late G1 phase. DUE-B is necessary for Treslin to bind to the chromatin and interaction with TopBP1 is important for the

DUE-B and Treslin association. Combined interaction of Treslin, DUE-B and TopBP1 allows for the Cdc45 loading on the chromatin. But once the helicase occurs in S phase, phosphorylated DUE-B does not interact with MCM and loses its affinity for MCM.

Meanwhile, DUE-B interaction with Treslin is also lost once the helicase activates and origin firing occurs.

115 IV. Activation of checkpoint pathway decreases DUE-B, Treslin and TopBP1 interaction and reduces DUE-B, Treslin and Cdc45 chromatin binding

DNA damage checkpoint response is activated in response to DNA injuries. It acts as a defense mechanism when replication is challenged. Activation of checkpoint leads to activities that protect the genome like to fork stabilization, prevention of late origin firing and inhibition of replication helicase movement. The area where checkpoint and replication merge is still quite elusive but several studies point towards Cdc45 inhibition to block helicase activation. The mechanism of how checkpoint inhibits Cdc45 is not yet known. Models proposed by different groups indicate blocking kinases like

DDK and CDK (Falck et al., 2001; Costanzo et al., 2003; Heideker et al., 2007) to inhibit

Cdc45 binding. These models propose that the goal of checkpoint pathways is to stop replication by inactivation of helicase by inhibition of Cdc45 loading on the MCM2-7 helicase. Both DUE-B and Treslin are required for loading of Cdc45 on the chromatin, which we interpret as MCM binding.

In this study, two replicative stressors aphidicolin and hyroxyurea were used to test the effect of replicative stress on interaction between DUE-B and Treslin. When the

DNA damage pathway is activated ATR phosphorylates Chk1. Treslin stimulates ATR mediated phosphorylation of Chk1 (Hassan et al., 2013). On the other hand, when damage is induced by the treatment with DNA stressing agents like aphidicolin, hydroxyurea or etoposide, DUE-B binding to the chromatin is severely affected. This is an ATR dependent phenomenon because when DNA damage is induced and ATR is inhibited by the action of ATR inhibitor caffeine, DUE-B binding to the chromatin is rescued (Gao, 2012). Since Treslin and TopBP1 play dual roles both in DNA replication

116 and checkpoint pathway we asked whether the DUE-B, Treslin and TopBP1 interactions persist when replicative stress is induced. In presence of HU or APH, a pull-down experiment with FLAG-tagged DUE-B was carried out. Activation of checkpoint with both HU and APH significantly reduced the interaction between DUE-B, Treslin and

TopBP1. Moreover, activation of checkpoint by HU and APH in HeLa cells and analysis of chromatin bound proteins showed DUE-B, Treslin and Cdc45 binding to the chromatin was modestly reduced but TopBP1 levels were unchanged. Replicative stressors negatively regulate the replication factors, importantly Cdc45. Combining the results from these two experiments, the loss of interaction between DUE-B, Treslin and TopBP1 due to replicative stress does not allow for the binding of replication factors (DUE-B,

Treslin, Cdc45) to the chromatin which in turn blocks the helicase activation and prevents origin firing. Alternatively, since replication factors (DUE-B, Treslin and Cdc45) cannot load to the chromatin and interact with TopBP1, which is a sensor/mediator of checkpoint pathway, and since DUE-B and Treslin require TopBP1 to interact for the loading of

Cdc45, replication is blocked (Figure 44).

117 Replicative Stress

MCM 2-7 ORC 1-6

DUE-B Treslin Checkpoint Treslin

TopBP1 CDC45/ DUE-B

CMG helicase

Figure 44: Model during DNA damage.

When there is replicative stress, the interaction between DUE-B, Treslin and

TopBP1 is lost, which converges to inhibit the binding of Cdc45 to the chromatin. This delays the activation of CMG helicase allowing the cells to repair the damage.

118 CONCLUSION:

DUE-B is an important replication factor necessary during the helicase activation step of replication initiation. In this study, we show that DUE-B interacts with Treslin,

Sld3 ortholog in higher eukaryotes. The interaction between DUE-B and Treslin is mediated through the C-terminus tail of DUE-B and TopBP1 is necessary for the interaction between DUE-B and Treslin. The interaction DUE-B and Treslin occurs through TopBP1 perhaps to form a ternary complex. Further studies are necessary to understand if the interaction between DUE-B and Treslin is direct. Interaction between

DUE-B and Treslin is cell cycle regulated and their interaction is substantially increased in mid/late G1 just before the process of replication initiation occurs. Knockdown of

DUE-B reduces the binding of Treslin and Cdc45 on the chromatin. In reverse experiments, Treslin knockdown also reduced the levels of DUE-B and Cdc45 on the chromatin. TopBP1 knockdown reduced Cdc45 levels on chromatin without affecting

DUE-B and Treslin. During replicative stress, the interaction between DUE-B, Treslin and TopBP1 is reduced and DUE-B, Treslin and Cdc45 binding to the chromatin is reduced. Moreover, we extend to the knowledge of DUE-B with evidence that suggests that the functions of yeast Sld3 could be distributed in different replication factors for the maintenance of complex nature of human genome. Overall, DUE-B is an important DNA replication protein which interacts with many replication factors for the faithful replication of genome.

119 APPENDICES

Appendix 1

Plasmids used in this study

120

AgeI AgeI AgeI AgeI

Gao et al., 2014

121 AgeI AgeI AgeI AgeI

Gao et al., 2014

122

123 Appendix 2

Sequence Alignment of WT DUE-B, ΔCT DUE-B, ST/D DUE-B and ST/A DUE-B.

Default parameters was used in DNAMAN (Lynnon Biosoft) was used to align the C terminal end of WT, ΔCT, ST/D and ST/A DUE-B after mutagenesis and sequencing. Sequencing services were provided by Retrogen.

124 Appendix 3

Sequence alignment of WT DUE-B and siRNA resistant full length DUE-B and siRNA resistant ΔCT DUE-B

125 Appendix 4

Site directed mutagenesis

Primer- Add FLAG N term and add Bam HI Forward 5’TCGGATCCGATGGACTACAAGGACGACGATGATAAGATGAAGGCCGTGGT GCAGC 3’

DUE-B Target sequence 5’AACTTAAGCTTGGTACCGAGCTCGGATCCATGAAGGCCGTGGTGCAGC…….

126 Appendix 5

Colony PCR to test the integration of restriction digested fragments in a vector.

PCR products of primers Add FLAG N term and add Bam HI Forward and

Remove his6 and add Not I WT DUE-B Reverse were digested by Bam HI and Not I and cloned into pcDNA3.1 vector that was digested with Bam HI and Not I. The fragments were ligated overnight with DNA ligase (New England Bio) and transformed into DH5α cells. Colonies were directly used as a template for PCR by using indicated primers.

Correct clones give a product of desired length. Correct clones are sent out for sequencing.

pcDNA3.1 Flag WTDUE-B

Colony PCR DUE-B pcDNA3.1 Forward Primers Colony PRC DUE-B (N-terminus of DUE-B) Reverse

1 2 3 4 5 6 7 8 9 10 11

Correct Clones

127

Appendix 6

Gibson Assembly: General scheme of assembly or multiple overlapping oligos / PCR products (upto 6) into a vector.

128 Appendix 7

Oligos used for Gibson Assembly to make siRNA Resistant DUE-B plasmids in a pcDNA3.1 vector. Both oligos were ordered from Integrated DNA Technologies

Oligo 1 Sequence before Bam HI site overlaps with pcDNA3.1 vector when the vector is linearized with Bam HI, siRNA resistant fragment where neucleotides have been substituted to make DUE-B cDNA siRNA resistant when co-expressed with a siRNA #1.

AGCTTGGTACCGAGCTCGGATCCATGAAGGCCGTGGTGCAGCGCGTCACCCG GGCCAGCGTCACAGTTGGAGGAGAGCAGATTAGTGCCATTGGAAGGGGCAT ATGTGTGTTGCTGGGTATTTCCCTGGAGGATACGCAGAAGGAACTGGAACAC ATGGTCCGAAAGATTCTAAGCCTGCGTGTATTTGAGGATGAGAGTGGGAAAC ATTGGAGCAAATCCGTCATGGACAAACAGTACGAGATTCTGTGTGTCAGTCA GTTTACCCTCCAGTGTGTCCTGAAGGGAAACAAGCCTGATTTCCACCTAGCAA TGCCCACGGAGCAGGCAGAGGGCTTCTACAACAGCTTCCTG

Oligo 2 Sequence after Bbv CI overlap with C-terminus end of DUE-B.

GCAGGCAGAGGGCTTCTACAACAGCTTCCTGGAGCAGCTGCGTAAAACATAC AGGCCGGAGCTTATCAAAGATGGCAAGTTTGGGGCCTACATGCAGGTGCACA TTCAGAATGATGGGCCTGTGACCATAGAGCTGGAATCGCCAGCTCCCGGCAC TGCTACCTCTGACCCAAAGCAGCTGTCAAAGCTCGAAAAACAGCAGCAGAGG AAAGAAAAGACCAGAGCTAAGGGACCTTCTGAATCAAGCAAGGAAAGAAAC ACTCCCCGAAAAGAAGACCGCAGTGCCAGCAGCGGGGCTGAGGGCGACGTG TCCTCTGAACGGGAGCCGGG

129 Appendix 8

Creation of tetracycline inducible HeLa T-Rex cell lines.

In the presence of Flp recombinase, pcDNA5/FRT/TO integrates into a single site in the genome of HeLa “Flp In” T-Rex cell line. The Tet repressor suppresses transcription of the gene of interest in the absence of inducer (doxycycline). A single copy of the gene of interest is stably integrated for regulated expression with tetracycline

(Gossen et al., 1995).

HeLa Trex Flip in acceptor cell line

130 Table 1: Primers used in this study (all primers in this study were ordered from

Integrated DNA Technologies)

Pimer Name Sequence Add FLAG N term 5' and add Bam HI TCGGATCCGATGGACTACAAGGACGACGATG Forward ATAAGATGAAGGCCGTGGTGCAGC3’ Remove his6 and add 5’ Not I WT DUE-B GAGCGGCCGCCAtcaACCGGTACCCGGCTCCC Reverse GTTCAG 3’ Remove his6 and add 5’ Not I ΔCT DUE-B GAGCGGCCGCCAtcaAGCTGGCGATTCCAGCT Reverse 3’ Remove his6 and add 5’ Not I ST/D DUE-B GAGCGGCCGCCAtcaACCGGTACCCGGCTCCC Reverse GTTCAT 3’ Remove his6 and add 5’ Not I ST/A DUE-B GAGCGGCCGCCAtcaCGGCTCCCGTTCTGCTGC Reverse CACGT 3’ Colony PCR DUE-B 5’ GCTCGTTTAGTGAACCGTCAGAT 3’ pcDNA5FRT TO Forward Colony PCR DUE-B 5’ GCTAACTAGAGAACCCACTGCTTACT 3’ pcDNA3.1 Forward Colony PRC DUE-B 5’ GGGCATTGCTAGGTGGAAATCAGG 3’ (N-terminus of DUE- B) Reverse Colony PCR 5’ CGCTGTTTTGACCTCCATAGAAGAC 3’ pcDNA5/FRT/TO Treslin Forward Colony PCR Treslin 5’ GGCAACTCAGATAGGTGAGGAG 3’ Reverse

131 Table 2: siRNAs used in this study

i. siGENOME Human TICRR/ Treslin (Dharmacon) siRNA- SMARTpool siRNA Target Sequence siRNA 1 GAAGGAGCAUCGUGGAGUG siRNA 2 GAACUUAUACACGGAAGAA siRNA 3 GAUGCAAGCUUCUGGCCUU siRNA 4 CAGCAGGUCCUUAAGCAAA

ii. siSMARTpool Human DUE-B Hs_DTD1 (Qiagen) siRNA (DUE-B) siRNA Target Sequence Hs_DTD1_1 CAGGCCGGAGCTTATCAAAGA Hs_DTD1_2 CTGGTCGAAGAGTGTGATGGA (siRNA#1, Chowdhury et al., 2010) Hs_DTD1_3 AGGGACCTTCTGAATCAAGCA Hs_DTD1_4 CACATGGTCCGAAAGATTCTA

iii.siGENOME Human TopBP1 (Dharmacon) siRNA- SMARTpool siRNA Target Sequence siRNA 1 ACACUAAUCGGGAGUAUAA siRNA2 GAGCCGAACAUCCAGUUUA siRNA 3 AACCAUAUAUCCAUGCUAA siRNA 4 GGAAUCACCUCCUCA

132 Table 3: Summary of siRNA knockdown on chromatin binding profiles of replication factors

siRNA DUE-B Treslin TopBP1 CDC45 Figure

DUE-B NA - no change - Figure 7 & 8

Treslin - NA no change - Figure 10 & 11

TopBP1 no change - NA - Figure 12

133 REFERENCE

Abdurashidova G, Danailov MB, Ochem A, Triolo G, Djeliova V, Radulescu S, Vindigni A, Riva S, and Falaschi A (2003). Localization of proteins bound to a replication origin of human DNA along the cell cycle. The EMBO Journal 22(16), 4294–4303.

Aladjem MI (2004). The mammalian β-globin origin of DNA replication. Front Biosci 9:2540-7 Aladjem MI, Rodewald LW, Kolman JL, and Wahl GM (1998). Genetic dissection of a mammalian replicator in the human beta-globin locus. Science 281(5379): 1005-9.

Altman AL, and Fanning E (2002). The Chinese hamster dihydrofolate reductase replication origin beta is active at multiple ectopic chromosomal locations and requires specific DNA sequence elements for activity. Mol Cell Biol. 21 (4): 1098-110. Erratum in: Mol Cell Biol. 22(17): 6319.

Aparicio OM, Weinstein DM, and Bell SP (1997). Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p during S phase. Cell, 91, 59–69.

Bakkenist CJ, and Kastan MB (2003). DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature. 421(6922):499-506.

Balestrini A, Cosentino C, Errico A, Garner E, and Costanzo V (2010). GEMC1 is a TopBP1-interacting protein required for chromosomal DNA replication. Nat Cell Biol 12(5): 484-491.

Bartek J, and Lukas J (2003). Chk1 and Chk2 kinases in checkpoint control and cancer. Cancer Cell 3(5): 421-429.

Bell SP, and Dutta A (2002). DNA Replication in Eukaryotic Cells. Annual Review of Biochemistry, 71(1): 333-374.

Bell SP, and Stillman B (1992). ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357(6374): 128-134.

Berberich S, Trivedi A, Daniel DC, Johnson EM, and Leffak M (1995). In vitro replication of plasmids containing human c-myc DNA. J Mol Biol 245(2): 92-109.

134

Biamonti G, Perini G, Weighardt F, Riva S, Giacca M, Norio P, Zentilin L, Diviacco S, Dimitrova D, and Falaschi A (1992). A human DNA replication origin: localization and transcriptional characterization. Chromosoma 102(1 Suppl): S24-31.

Bianchi V, Pontis E, and Reichard P (1986). Changes of deoxyribonucleoside triphosphate pools induced by hydroxyurea and their relation to DNA synthesis. J. Biol. Chem. 261:16037–16042.

Bikard D, Loot C, Baharoglu Z, and Mazel D (2010). Folded DNA in action: hairpin formation and biological functions in prokaryotes. Microbiol Mol Biol Rev, (4):570-88.

Blow JJ, Ge XQ, and Jackson DA (2011). How dormant origins promote complete genome replication. Trends Biochem Sci 36: 405–414.

Boos D, Sanches-Pulido L, Rappas M, Pearl LH, Oliver AW, Ponting CP, and Diffley JF (2011). Regulation of DNA replication through Sld3-Dpb11 interaction is conserved from yeast to humans. Current Biology.

Boos D, Yekezare M, and Diffley JF (2013). Identification of a heteromeric complex that promotes DNA replication origin firing in human cells. Science. 340(6135): 981-4.

Bruck I, and Kaplan DL (2011). GINS and Sld3 compete with one another for Mcm2-7 and Cdc45 binding. J Biol Chem. 286(16): 14157-67.

Bruck I, and Kaplan DL (2015). Conserved mechanism for coordinating replication fork helicase assembly with phosphorylation of the helicase. Proc Natl Acad Sci. 112(36): 11223-8.

Bruck I, and Kaplan DL (2015). The Replication Initiation Protein Sld3/Treslin Orchestrates the Assembly of the Replication Fork Helicase during S Phase. J Biol Chem, 290(45): 27414-24.

Bueno A, and Russell P (1992). Dual functions of CDC6: a yeast protein required for DNA replication also inhibits nuclear division. EMBO J. 11(6):2167-76.

Burhans WC, Vassilev LT, Wu J, Sogo JM, Nallaseth FS, and DePamphilis ML (1991). Emetine allows identification of origins of mammalian DNA replication by imbalanced DNA synthesis, not through conservative nucleosome segregation. Embo J 10: 4351-60.

Burgers PMJ (2009). Polymerase Dynamics at the Eukaryotic DNA Replication Fork. Journal of Biological Chemistry 284(7): 4041-4045.

Byun TS, Pacek M, Yee MC, Walter JC, and Cimprich KA (2005). Functional uncoupling of MCM helicase and DNA polymerase activities activates the ATR- dependent checkpoint. Genes Dev. 19(9):1040-52.

135

Casper JM, Kemp MG, Ghosh M, Randall GM, Vaillant A, and Leffak M (2005). The c- myc DNA-unwinding element-binding protein modulates the assembly of DNA replication complexes in vitro. J Biol Chem. 280(13):13071-83.

Choi JH, Lindsey-Boltz LA, Kemp M, Mason AC, Wold MS, and Sancar A (2010). Reconstitution of RPA-covered single-stranded DNA-activated ATR-Chk1 signaling. Proc Natl Acad Sci U S A. 107(31): 13660-5.

Chowdhury A, Liu G, Kemp M, Chen X, Katrangi N, Myers S, Ghosh M, Yao J, Gao Y, Bubulya P, and Leffak M (2010). The DNA Unwinding Element Binding Protein DUE-B Interacts with Cdc45 in Preinitiation Complex Formation. Mol. Cell. Biol. 30(6): 1495-1507.

Chuang RY, and Kelly TJ (1999). The fission yeast homologue of Orc4p binds to replication origin DNA via multiple AT-hooks. Proceedings of the National Academy of Sciences 96(6): 2656-2661.

Chen X, Liu G, and Leffak M (2013). Activation of a human chromosomal replication origin by protein tethering. Nucleic Acids Res. 41(13):6460-74.

Ciccia A, and Elledge SJ (2010) The DNA damage response: Making it safe to play with knives. Mol. Cell 40, 179 – 204.

Cortez D, Guntuku S, Qin J, and Elledge SJ (2001). ATR and ATRIP: partners in checkpoint signaling. Science. 294(5547):1713-6.

Costanzo V, Shechter D, Lupardus PJ, Cimprich KA, Gottesman M, and Gautier J (2003). An ATR- and Cdc7-dependent DNA damage checkpoint that inhibits initiation of DNA replication. Mol Cell. (1):203-13.

Dai Y, and Grant S (2010). New insights into checkpoint kinase 1 in the DNA damage response signaling network. Clin Cancer Res. 16(2):376-83. Review.

Debatisse M, Toledo F, and Anglana M (2004). Replication initiation in mammalian cells: changing preferences. Cell Cycle. 2004 Jan;3(1):19-21. Review.

De Piccoli G, Katou Y, Itoh T, Nakato R, Shirahige K, and Labib K (2012). Replisome stability at defective DNA replication forks is independent of S phase checkpoint kinases. Mol Cell 45:696-704.

Delacroix S, Wagner JM, Kobayashi M, Yamamoto K, and Karnitz LM (2007). The Rad9-Hus1-Rad1 (9-1-1) clamp activates checkpoint signaling via TopBP1. Genes Dev. 21, 1472–1477.

136 DePamphilis ML (2005). Cell cycle dependent regulation of the origin recognition complex. Cell Cycle 4(1): 70-79.

Dhar MK, Sehgal S, and Kaul S (2012). Structure, replication efficiency and fragility of yeast ARS elements. Research in Microbiology 163(4): 243-253.

Diffley JF, Cocker JH, Dowell SJ, and Rowley A (1994). Two steps in the assembly of complexes at yeast replication origins in vivo. Cell 78, 303–316.

Diffley JF, Cocker JH, Dowell SJ, Harwood J, and Rowley A (1995). Stepwise assembly of initiation complexes at budding yeast replication origins during the cell cycle. J. Cell Sci. Suppl., 19, 67–72.

Diffley JF (2004). Regulation of early events in chromosome replication. Curr Biol 14: R778–786.

Dimitrova DS, and Gilbert DM (2000). Temporally coordinated assembly and disassembly of replication factories in the absence of DNA synthesis. Nat Cell Biol 2(10): 686-694.

Dolan WP, Sherman DA, and Forsburg SL (2004). Schizosaccharomyces pombe replication protein Cdc45/Sna41 requires Hsk1/Cdc7 and Rad4/Cut5 for chromatin binding. Chromosoma. 113(3):145-56.

Douglas ME, and Diffley JF (2016). Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex. J Biol Chem. 11; 291(11):5879-88.

Donovan S, Harwood J, Drury LS, and Diffley JF (1997). Cdc6p-dependent loading of Mcm proteins onto pre-replicative chromatin in budding yeast. Proc. Natl Acad. Sci. USA, 94, 5611–5616.

Drury LS, Perkins G, and Diffley JF (1997). The Cdc4/34/53 pathway targets Cdc6p for proteolysis in budding yeast. EMBO J. 16(19): 5966-76.

Dungrawala H, Rose KL, Bhat KP, Mohni KN, Glick GG, Couch FB, and Cortez D (2015). The Replication Checkpoint Prevents Two Types of Fork Collapse without Regulating Replisome Stability. Mol Cell 59:998-1010.

Falck J, Mailand N, Syljuåsen RG, Bartek J, and Lukas J (2001). The ATM-Chk2- Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 410(6830): 842-847.

Fan W, and Luo J (2008). RecQ4 Facilitates UV Light-induced DNA Damage Repair through Interaction with Nucleotide Excision Repair Factor Xeroderma Pigmentosum Group A (XPA). Journal of Biological Chemistry 283(43): 29037-29044.

137

Fang D, Cao Q, and Lou H (2016). Sld3-MCM Interaction Facilitated by Dbf4- Dependent Kinase Defines an Essential Step in Eukaryotic DNA Replication Initiation. Front Microbiol. 7: 885.

Fragkos M, Ganier O, Coulombe P, and Méchali M (2015). DNA replication origin activation in space and time. Nat Rev Mol Cell Biol. 6:360-74.

Furnari B, and Rhind N et al. (1997). Cdc25 Mitotic Inducer Targeted by Chk1 DNA Damage Checkpoint Kinase. Science 277(5331): 1495-1497.

Garcia V, Furuya K, and Carr AM (2005). Identification and functional analysis of TopBP1 and its homologs. DNA Repair (Amst). 4(11): 1227-39. Review. 25

Gaggioli V, Zeiser E, Rivers D, Bradshaw CR, Ahringer J, and Zegerman P (2014). CDK phosphorylation of SLD-2 is required for replication initiation and germline development in C. elegans. J Cell Biol. 204(4): 507-22

Gao, Y (2012). Regulation of The DNA Unwinding Element Binding Protein DUE-B in The Cell. (Electronic Dissertation) http://rave.ohiolink.edu/etdc/view?acc_num=wright1355250568

Gao Y, Yao J, Poudel S, Romer E, Abu-Niaaj L, and Leffak M (2014). Protein phosphatase 2A and Cdc7 kinase regulate the DNA unwinding element-binding protein in replication initiation. J Biol Chem, 289(52): 359876000.

Gibson DG, Benders GA, Axelrod KC, Zaveri J, Algire MA, Moodie M, Montague MG, Venter JC, Smith HO, and Hutchison CA 3rd (2008). One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome. Proc Natl Acad Sci U S A. 105(51):20404-9.

Gilbert DM (2002). Replication timing and transcriptional control: beyond cause and effect. Curr Opin Cell Biol. 14(3): 377-83.

Gossen M, Freundlieb S, Bender G, Müller G, Hillen W, and Bujard H (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268 (5218): 1766–1769.

Guo C, Kumagai A, Schlacher K, Shevchenko A, Shevchenko A, and Dunphy WG (2015). Interaction of Chk1 with Treslin negatively regulates the initiation of chromosomal DNA replication. Mol Cell. 57(3):492-505.

Hahn AT, Jones JT, and Meyer T (2009). Quantitative analysis of cell cycle phase durations and PC12 differentiation using fluorescent biosensors. Cell Cycle. 8(7):1044- 52.

138 Hamlin JL (1992). Mammalian origins of replication. Bioessays. (10):651-9. Review.

Hardy CF, and Dryga O et al. (1997). Mmcm5/cdc46-bob1 bypasses the requirement for the S phase activator Cdc7p. Proc Natl Acad Sci U S A 94(7): 3151-3155

Harvey KJ, and Newport J (2003). Metazoan origin selection: origin recognition complex chromatin binding is regulated by CDC6 recruitment and ATP hydrolysis. J Biol Chem. 278(49):48524-8.

Hassan BH, Lindsey-Boltz LA, Kemp MG, and Sancar A (2013). Direct role for the replication protein treslin (Ticrr) in the ATR kinase-mediated checkpoint response. J Biol Chem 288(26): 18903-10.

Heffernan TP, Simpson DA, Frank AR, Heinloth AN, Paules RS, Cordeiro-Stone M, and Kaufmann WK (2002). An ATR- and Chk1-dependent S checkpoint inhibits replicon initiation following UVC-induced DNA damage. Mol Cell Biol. (24):8552-61.

Heideker J, Lis ET, and Romesberg FE (2007). Phosphatases, DNA damage checkpoints and checkpoint deactivation. Cell Cycle. (24):3058-64. Review.

Heintz NH, Milbrandt JD, Greisen KS, and Hamlin JL (1983). Cloning of the initiation region of a mammalian chromosomal replicon. Nature 02(5907): 439-41.

Hofmann JF, and Beach D (1994). Cdt1 is an essential target of the Cdc10/Sct1 transcription factor: requirement for DNA replication and inhibition of mitosis. EMBO J. 13(2): 425-34.

Iakoucheva LM, and Dunker AK (2003). Order, Disorder, and Flexibility: Prediction from Protein Sequence. Structure (London, England: 1993) 11(11): 1316-1317.

Im JS, Ki SH, Farina A, Jung DS, Hurwitz J, and Lee JK (2009). Assembly of the Cdc45- Mcm2-7-GINS complex in human cells requires the Ctf4/And-1, RecQL4, and Mcm10 proteins. Proc. Natl. Acad. 106: 15628–15632.

Ilves I, Petojevic T, Pesavento JJ, and Botchan MR (2010). Activation of the MCM2- 7 helicase by association with Cdc45 and GINS proteins. Mol Cell. 37(2): 247- 58.

Ishimi Y (1997). A DNA helicase activity is associated with an MCM4, -6, and -7 protein complex. Journal of Biological Chemistry 272(39): 24508-24513

Jacob F, Brenner S, and Cuzin F (1963) On the regulation of DNA replication in bacteria. Cold Spring Harbor Symp Quant Biol 28: 329–347.

Jeon Y, Bekiranov S, Karnani N, Kapranov P, Ghosh S, MacAlpine D, Lee C, Hwang

139 DS, Gingeras TR, and Dutta A (2005). Temporal profile of replication of human chromosomes. Proceedings of the National Academy of Sciences of the United States of America 102(18): 6419- 6424.

Kamimura Y, Masumoto, H, Sugino A, and Araki H. (1998) Sld2, which interacts with Dpb11 in Saccharomyces cerevisiae, is required for chromosomal DNA replication. Mol. Cell. Biol., 18, 6102–6109.

Kamimura Y, Tak YS, Sugino A, and Araki H (2001) Sld3, which interacts with Cdc45 (Sld4), functions for chromosomal DNA replication in Saccharomyces cerevisiae. EMBOJ 20: 2097–2107.

Karnani N, Taylor CM, Malhotra A, and Dutta A. (2010). Genomic study of replication initiation in human chromosomes reveals the influence of transcription regulation and chromatin structure on origin selection. Mol Biol Cell, 21(3): 393-404.

Kemp M, Bae B, Yu JP, Ghosh M, Leffak M, and Nair SK (2007). Structure and Function of the c-myc DNA-unwinding Element- binding Protein DUE-B. Journal of Biological Chemistry 282(14): 10441-10448.

Kim Y, and Kipreos ET (2007). Cdt1 degradation to prevent DNA re-replication: conserved and non-conserved pathways. Cell Di, 2:18.

Klenova E, Chernukhin I, Inoue T, Shamsuddin S, and Norton J (2002). Immunoprecipitation techniques for the analysis of transcription factor complexes. Methods. 26(3):254-9.

Kneissl M, Pütter V, Szalay AA, and Grummt F 2003. Interaction and assembly of murine pre-replicative complex proteins in yeast and mouse cells. J Mol Biol 327(1): 111-28.

Koç A, Wheeler LJ, Mathews CK, and Merrill GF (2004). Hydroxyurea arrests DNA replication by a mechanism that preserves basal dNTP pools. J Biol Chem. 279(1): 223- 30.

Kumagai A, Lee J, Yoo HY, and Dunphy WG (2006). TopBP1 activates the ATR-ATRIP complex. Cell. 124(5):943-55.

Kumagai A, Shevchenko A, and Dunphy WG (2010). Treslin collaborates with TopBP1 in triggering the initiation of DNA replication. Cell. 140:349–359.

Kumagai A, Shevchenko A, and Dunphy WG (2011). Direct regulation of Treslin by cyclin-dependent kinase is essential for the onset of DNA replication. J Cell Biol. 193: 995–1007.

140 Labib K (2010). How do Cdc7 and cyclin-dependent kinases trigger the initiation of chromosome replication in eukaryotic cells? Genes Dev. 24:1208–1219.

Lai JS, and Herr W (1992). Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations. Proc Natl Acad Sci U S A. 89(15):6958- 62.

Lavin MF, and Kozlov S (2007). ATM activation and DNA damage response. Cell cycle (Georgetown, Tex.) 6(8): 931-942.

Lee JH, and Paull TT (2007). Activation and regulation of ATM kinase activity in response to DNA double-strand breaks. Oncogene. 26(56):7741-8. Review.

Lee J, Kumagai A, and Dunphy WG (2007). The Rad9-Hus1-Rad1 checkpoint clamp regulates interaction of TopBP1 with ATR. J. Biol. Chem. 282, 28036–28044.

Leffak M, and CD James (1989). Opposite replication polarity of the germ line c-myc gene in HeLa cells compared with that of two Burkitt lymphoma cell lines. Molecular and Cellular Biology 9(2): 586-593.

Liang C, and Stillman, B. (1997) Persistent initiation of DNA replication and chromatin- bound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev., 11, 3375–3386.

Li CJ, and DePamphilis ML (2002). Mammalian Orc1 protein is selectively released from chromatin and ubiquitinated during the S-to-M transition in the cell division cycle. Mol Cell Biol. 22(1): 105-16.

Liu G, Bissler JJ, Sinden RR, and Leffak M (2007). Unstable Spinocerebellar Ataxia Type 10 (ATTCT)¬∑ (AGAAT) Repeats Are Associated with Aberrant Replication at the ATX10 Locus and Replication Origin-Dependent Expansion at an Ectopic Site in Human Cells. Molecular and Cellular Biology 27(22): 7828-7838.

Liu G, Malott M, and Leffak M (2003). Multiple Functional Elements Comprise a Mammalian Chromosomal Replicator. Mol. Cell. Biol. 23(5): 1832-1842.

Liu Q, Guntuku S, Cui XS, Matsuoka S, Cortez D, Tamai K, Luo G, Carattini-Rivera S, DeMayo F, Bradley A, Donehower LA, and Elledge SJ (2000). Chk1 is an essential kinase that is regulated by Atr and required for the G (2)/M DNA damage checkpoint. Genes Dev. 14(12):1448-59.

Lopez-Mosqueda J, Maas NL, Jonsson ZO, Defazio-Eli LG, Wohlschlegel J, and Toczyski DP (2010). Damage-induced phosphorylation of Sld3 is important to block late origin firing. Nature. 467:479–483.

Loor G, Zhang SJ, Zhang P, Toomey NL, and Lee MY (1997). Identification of DNA

141 replication and cell cycle proteins that interact with PCNA. Nucleic Acids Res. 25(24):5041-6.

Lupardus PJ, Byun T, Yee MC, Hekmat-Nejad M, and Cimprich KA (2002). A requirement for replication in activation of the ATR-dependent DNA damage checkpoint. Genes Dev. 16(18):2327-32.

Maiorano D, Cuvier O, Danis E, and Méchali M (2005). MCM8 is a MCM2-7-related protein that functions as a DNA helicase during replication elongation and not initiation. Cell. 120(3):315-28.

Malott M, and Leffak M (1999). Activity of the c-myc replicator at an ectopic chromosomal location. Mol Cell Biol. 19 (8): 5685-95.

Marahrens Y, and Stillman B (1992). A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science 255(5046): 817-823.

Masai H, Matsumoto S, You Z, Yoshizawa-Sugata N, and Oda M (2010). Eukaryotic chromosome DNA replication: where, when, and how? Annu Rev Biochem. 79:89-130.

Matsuno K, Kumano M, Kubota Y, Hashimoto Y, and Takisawa H (2006). The N- terminal noncatalytic region of Xenopus RecQ4 is required for chromatin binding of DNA polymerase alpha in the initiation of DNA replication. Mol Cell Biol. 26:4843– 4852.

Méchali M (2010). Eukaryotic DNA replication origins: Many choices for appropriate answers. Nature Rev Mol Cell Biol 11: 728–738.

Méndez J, and Stillman B (2003). Perpetuating the double helix: molecular machines at eukaryotic DNA replication origins. Bioessays. 25:1158–1167.

Michael WM, Ott R, Fanning E, and Newport J (2000). Activation of the DNA replication checkpoint through RNA synthesis by primase. Science. 289(5487):2133-7.

Mueller AC, Keaton MA, and Dutta A (2011). DNA replication: Mammalian Treslin- TopBP1 Interaction Mirrors Yeast Sld3-Dpb11. Curr Biol. 21 (16): R638-40.

Nasheuer HP, Moore A, Wahl AF, and Wang TS (1991). Cell cycle-dependent phosphorylation of human DNA polymerase alpha. J Biol Chem. 266(12):7893-903.

Nieduszynski CA, Hiraga S, Ak P, Benham CJ, and Donaldson AD (2007). OriDB: a DNA replication origin database. Nucleic Acids Research 35(suppl 1): D40-D46.

Oakley GG, and Patrick SM (2010). Replication protein A: directing traffic at the intersection of replication and repair. Front Biosci (Landmark Ed). 15:883-900. Review.

142 Paixão S, Colaluca IN, Cubells M, Peverali FA, Destro A, Giadrossi S, Giacca M, Falaschi A, Riva S, and Biamonti G (2004). Modular Structure of the Human Lamin B2 Replicator. Molecular and Cellular Biology 24(7): 2958-2967.

Pedrali-Noy G, and Spadari S (1979). Effect of aphidicolin on viral and human DNA polymerases. Biochem Biophys Res Commun. 88(4):1194-202.

Petermann E, Woodcock M, and Helleday T (2010). Chk1 promotes replication fork progression by controlling replication initiation. Proc Natl Acad Sci. 107(37):16090-5.

Platt OS (2008). Hydroxyurea for the treatment of sickle cell anemia. N. Engl. J. Med. 358 (13): 1362–9. Raghuraman MK, Winzeler EA, Collingwood D, Hunt S, Wodicka L, Conway A, Lockhart DJ, Davis RW, Brewer BJ, and Fangman WL (2001). Replication dynamics of the yeast genome. Science. 294(5540): 115-21.

Remus D, Beall EL, and Botchan MR (2004). DNA topology, not DNA sequence, is a critical determinant for Drosophilla ORC-DNA binding. EMBO J 23:897-907.

Sancar A, Lindsey-Boltz LA, Unsal-Kaçmaz K, and Linn S (2004). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem. 73:39-85. Review.

Sanchez-Pulido L, Diffley JF, and Ponting CP (2010). Homology explains the functional similarities of Treslin/Ticrr and Sld3. Curr Biol. 20: R509–510.

Sangrithi MN, Bernal JA, Madine M, Philpott A, Lee J, Dunphy WG, and Venkitaraman AR (2005). Initiation of DNA replication requires the RECQL4 protein mutated in Rothmund-Thomson syndrome. Cell. 121: 887–898.

Sansam CL, Cruz NM, Danielian PS, Amsterdam A, Lau ML, Hopkins N, and Lees JA (2010). A vertebrate gene, ticrr, is an essential checkpoint and replication regulator. Genes Dev. 24, 183–194.

Sansam CG, Goins D, Siefert JC, Clowdus EA, and Sansam CL. Cyclin-dependent kinase regulates the length of S phase through TICRR/TRESLIN phosphorylation (2015). Genes Dev. 29(5):555-66.

Santocanale C, and Diffley JF (1998). A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication. Nature 395(6702): 615-618.

Schmidt U, Wollmann Y, Franke C, Grosse F, Saluz HP, and Hanel F (2008). Characterization of the interaction between the human DNA topoisomerase IIb-binding protein 1 (TopBP1) and the cell division cycle 45 protein (CDC45). Biochem J 409:169– 177

143 Schröter H, Maier G, Ponstingl H, and Nordheim A (1985). DNA intercalators induce specific release of HMG 14, HMG 17 and other DNA-binding proteins from chicken erythrocyte chromatin. EMBO J. 4(13B):3867-72.

Sclafani RA, and Holzen TM (2007). Cell cycle regulation of DNA replication. Annu Rev Genet. 41:237-80. Review.

Sessa C, Zucchetti M, Davoli E, Califano R, Cavalli F, Frustaci S, Gumbrell L, Sulkes A, Winograd B, and D'Incalci M (1991). Phase I and clinical pharmacological evaluation of aphidicolin glycinate. J Natl Cancer Inst. 83(16):1160-4.

Sheu YJ, and Stillman B (2006). Cdc7-Dbf4 phosphorylates MCM proteins via a docking site-mediated mechanism to promote S phase progression. Molecular Cell, 24(1), 101– 113.

Shi Y, Mowery RA, Ashley J, Hentz M, Ramirez AJ, Bilgicer B, Slunt-Brown H, Borchelt DR, and Shaw BF (2012). Abnormal SDS-PAGE migration of cytosolic proteins can identify domains and mechanisms that control surfactant binding. Protein Sci. (8):1197-209.

Siddiqui K, On KF, and Diffley JF (2013). Regulating DNA replication in eukarya. Cold Spring Harb Perspect Biol. 5(9). pii: a012930. Review

Sogo JM, Lopes M, and Foiani M (2002). Fork reversal and ssDNA accumulation at stalled replication forks owing to checkpoint defects. Science. 297(5581):599-602.

Smith S, and Stillman B (1991). Stepwise assembly of chromatin during DNA replication in vitro. The EMBO Journal, 10(4), 971–980.

Symington LS, and Gautier J (2011). Double-strand bre ak end resection and repair pathway choice. Annu. Rev. Genet, 45 , 247– 271.

Tanaka T, Knapp D, and Nasmyth K (1997). Loading of Mcm protein onto DNA replication origins is regulated by Cdc6p and CDKs. Cell, 90, 649–660.

Takara TJ, and Bell SP (2011). Multiple Cdt1 molecules act at each origin to load replication-competent Mcm2-7 helicases. EMBO J 30(24): 4885-4896.

Tanaka S, and Araki H (2011). Multiple Regulatory Mechanisms to Inhibit Untimely Initiation of DNA Replication Are Important for Stable Genome Maintenance. PLoS Genet 7(6): e1002136.

Tanaka S, and Araki H (2013). Helicase activation and establishment of replication forks at chromosomal origins of replication. Cold Spring Harb Perspect Biol. 5(12): a010371. Review.

144 Tanaka S, Nakato R, Katou Y, Shirahige K, and Araki H (2011). Origin association of Sld3, Sld7, and Cdc45 proteins is a key step for determination of origin- firing timing. Curr Biol. 21(24):2055-63.

Terasima T, and Tolmach L J (1963). Growth and nucleic acid synthesis in synchronously dividing populations of HeLa cells. Exp. Cell Res. 30, 344–362.

Trivedi A, Waltz SE, Kamath S, and Leffak M (1998). Multiple initiations in the cmyc replication origin independent of chromosomal location. DNA Cell Biol, 17(10): 885-96.

Tsuji T, Lau E, Chiang GG, and Jiang W (2008). The role of Dbf4/Drf1-dependent kinase Cdc7 in DNA-damage checkpoint control. Mol Cell. 32(6):862-9.

Van Hatten RA, Tutter AV, Holway AH, Khederian AM, Walter JC, and Michael WM (2002). The Xenopus Xmus101 protein is required for the recruitment of Cdc45 to origins of DNA replication. J Cell Biol 159: 541–547.

Vo N, Taga A, Inaba Y, Yoshida H, Cotterill S, and Yamaguchi M (2014). Drosophila Mcm10 is required for DNA replication and differentiation in the compound eye. PLoS One. 9(3): e93450.

Walter J, and Newport J (2000). Initiation of eukaryotic DNA replication: origin unwinding and sequential chromatin association of Cdc45, RPA, and DNA polymerase alpha. Mol Cell. (4):617-27.

Waga S, Hannon GJ, Beach D, and Stillman B (1994). The p21 inhibitor of cyclin- dependent kinases controls DNA replication by interaction with PCNA. Nature. 369(6481):574-8.

Woodward AM, Göhler T, Luciani MG, Oehlmann M, Ge X, Gartner A, Jackson DA, and Blow JJ (2006). Excess Mcm2-7 license dormant origins of replication that can be used under conditions of replicative stress. The Journal of Cell Biology 173(5): 673-683.

Wyrick JJ, Aparicio JG, Chen T, Barnett JD, Jennings EG, Young RA, Bell SP, and Aparicio OM (2001). Genome-Wide Distribution of ORC and MCM Proteins in S. cerevisiae: High-Resolution Mapping of Replication Origins. Science 294(5550): 2357- 2360.

Xu W, Aparicio JG, Aparicio OM, and Tavaré S (2006). Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S-cerevisiae. Bmc Genomics 7.

Xu X, Tsvetkov LM, and Stern DF (2002). Chk2 activation and phosphorylation- dependent oligomerization. Mol Cell Biol. (12):4419-32.

145 Xu YJ, and Leffak M (2010). ATRIP from TopBP1 to ATR--in vitro activation of a DNA damage checkpoint. Proc Natl Acad Sci U S A. 107(31):13561-2.

Yamada Y, Nakagawa T, and Masukata H (2004). A novel intermediate in initiation complex assembly for fission yeast DNA replication. Mol Biol Cell. (8): 3740-50.

Yan S, and Michael WM (2009). TopBP1 and DNA polymerase-a directly recruits the 9– 1–1 complex to stalled DNA replication forks. J Cell Biol 184: 793–804.

Yan S, Lindsay HD, and Michael WM (2006). Direct requirement for Xmus101 in ATR- mediated phosphorylation of Claspin bound Chk1 during checkpoint signaling. J Cell Biol. 173: 181–186.

Yoo HY, Kumagai A, Shevchenko A, Shevchenko A, and Dunphy WG (2009). The Mre11-Rad50-Nbs1 complex mediates activation of TopBP1 by ATM. Mol. Biol. Cell 20, 2351–2360.

Zegerman P, and Diffley JF (2007). Phosphorylation of Sld2 and Sld3 by cyclin- dependent kinases promotes DNA replication in budding yeast. Nature 445(7125): 281- 285.

Zegerman P, and Diffley JF (2010). Checkpoint-dependent inhibition of DNA replication initiation by Sld3 and Dbf4 phosphorylation. Nature. 467:474– 478.

Zhou ZW, Liu C, Li TL, Bruhn C, Krueger A, Min W, Wang ZQ, and Carr AM (2013). An essential function for the ATR-activation-domain (AAD) of TopBP1 in mouse development and cellular senescence. PLoS Genet. 9(8): e1003702.

Zou L, and Elledge SJ (203). Sensing DNA damage through ATRIP recognition of RPA- ssDNA complexes. Science. 300(5625):1542-8.

Zou L and Stillman B (2000). Assembly of a Complex Containing Cdc45p, Replication Protein A, and Mcm2p at Replication Origins Controlled by S-Phase Cyclin-Dependent Kinases and Cdc7p-Dbf4p Kinase. Mol. Cell. Biol. 20(9): 3086-3096.

146