DOCSLIB.ORG

How Shelterin Protects Mammalian Telomeres 303 ANRV361-GE42-15 ARI 3 October 2008 10:10 (See 3' 5' TRF2 S Mplex

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
How Shelterin Protects Mammalian Telomeres 303 ANRV361-GE42-15 ARI 3 October 2008 10:10 (See 3' 5' TRF2 S Mplex ANRV361-GE42-15 ARI 3 October 2008 10:10 ANNUAL How Shelterin Protects REVIEWS Further Click here for quick links to Annual Reviews content online, Mammalian Telomeres including: • Other articles in this volume 1 • Top cited articles Wilhelm Palm and Titia de Lange • Top downloaded articles • Our comprehensive search Laboratory for Cell Biology and Genetics, The Rockefeller University, New York, NY 10021; email: [email protected] 1Current address: Max Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany Annu. Rev. Genet. 2008. 42:301–34 Key Words First published online as a Review in Advance on ATM, ATR, cancer, NHEJ, HR August 4, 2008 by Rockefeller University on 10/13/09. For personal use only. The Annual Review of Genetics is online at Abstract genet.annualreviews.org The genomes of prokaryotes and eukaryotic organelles are usually cir- This article’s doi: cular as are most plasmids and viral genomes. In contrast, the nuclear Annu. Rev. Genet. 2008.42:301-334. Downloaded from arjournals.annualreviews.org 10.1146/annurev.genet.41.110306.130350 genomes of eukaryotes are organized on linear chromosomes, which Copyright c 2008 by Annual Reviews. require mechanisms to protect and replicate DNA ends. Eukaryotes All rights reserved navigate these problemswith the advent of telomeres, protective nucle- 0066-4197/08/1201-0301$20.00 oprotein complexes at the ends of linear chromosomes, and telomerase, the enzyme that maintains the DNA in these structures. Mammalian telomeres contain a specific protein complex, shelterin, that functions to protect chromosome ends from all aspects of the DNA damage re- sponse and regulates telomere maintenance by telomerase. Recent ex- periments, discussed here, have revealed how shelterin represses the ATM and ATR kinase signaling pathways and hides chromosome ends from nonhomologous end joining and homology-directed repair. 301 ANRV361-GE42-15 ARI 3 October 2008 10:10 MAMMALIAN TELOMERIC DNA peats can seed the formation of a fully func- tional telomere (7, 57, 71), and telomerase in- The telomeric DNA of most eukaryotes, rang- hibition experiments showed that a reduction ing from protists to higher plants and mam- of telomere length to <1 kb is needed to in- mals, is composed of double-stranded (ds) short duce senescence in tumor cell lines (46). PCR- tandem repeats that are maintained by telom- mediated analysis of short telomeres in human erase. A general property of telomeres is that fibroblasts showed that at least 13 TTAGGG the strand that constitutes the 3 -end is rich repeats (78 bp) are required to prevent telomere in guanosine and devoid of cytosine. In ref- fusions (5, 19). Whether such short stretches erence to this G/C bias, the two strands of are sufficient to repress the DNA damage re- the telomeric DNA are called the G- and C- sponse at telomeres is not yet clear because this strands (Figure 1a). Mammals, like the major- analysis was done in a context where check- ity of eukaryotes, use the sequence TTAGGG points are disabled. A confounding issue in at their chromosome ends. The length of the these types of studies is that natural human telomeric repeat tracts varies between different telomeres also contain TTAGGG repeat-like mammals. For instance, the length of human sequences in their subtelomeric regions that telomeres is typically 10–15 kilobases (kb) at might contribute to telomere protection. birth, whereas the telomeres of laboratory mice The actual terminus of mammalian telom- and rats are 20–50 kb (50, 73, 100, 109). Re- eres is not blunt-ended, but consists of a single- cent findings that telomere length changed fre- stranded 3-protrusion of the G-strand, known quently within the mammalian lineage suggests as the 3 overhang (Figure 1a) (127, 133). This that alterations in telomere length can evolve feature is conserved throughout the eukary- quickly (W. Wright, personal communication). otic kingdom. The 3 overhang of mammalian The adaptive advantages of the longer telom- telomeres varies between 50–500 nt, which is eres of some rodents remain to be determined. considerably longer than the protrusion of most Recent work is addressing the minimal num- other eukaryotes. It is still unclear how the 3 ber of telomeric repeats required for telomere overhang of mammalian telomeres is gener- protection. Early transfection experiments had ated but it has been excluded that they are the shown that as little as 400 bp of TTAGGG re- a 2–20 kb ds [TTAGGG]n 50–500 nt 3' overhang 3' 5' by Rockefeller University on 10/13/09. For personal use only. Subtelomeric Degenerate repeats TTAGGG repeats G-strand GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA 3' C-strand CCCAATCCCAATC 5' Annu. Rev. Genet. 2008.42:301-334. Downloaded from arjournals.annualreviews.org t-loop b Variable D loop loop size 5' 3' Strand-invasion of 3´ overhang Figure 1 The structure of human telomeres. (a) Human chromosomes end in an array of TTAGGG repeats that varies in length. Proximal to the telomeric repeats is a segment of degenerate repeats and subtelomeric repetitive elements. The telomere terminus contains a long G-strand overhang. The 3 end is not precisely defined whereas the 5> end of human chromosomes nearly always features the sequence ATC-5. (b) Schematic of the t-loop structure. The size of the loop is variable. 302 Palm · Lange ANRV361-GE42-15 ARI 3 October 2008 10:10 product of telomerase (76, 145). As discussed SHELTERIN below, resection of the C-strand by a nucle- The TTAGGG repeats of mammalian chro- ase, as first postulated by Langmore and col- mosome ends associate with the six-protein leagues (127), is generally anticipated. Consis- complex, shelterin (48) (Figure 2). Shelterin tent with such active processing, the 5-end of enables cells to distinguish their natural human telomeres is accurately defined and pre- chromosome ends from DNA breaks, re- dominantly ends on the sequence ATC-5 (167) presses DNA repair reactions, and regulates (Figure 1a). In contrast, the last base of the 3 telomerase-based telomere maintenance. The overhang is variable and appears to be almost components of shelterin specifically localize random in telomerase-negative cells (167). to telomeres; they are abundant at telomeres Electron microscopy revealed that mouse throughout the cell cycle; and they do not and human telomeres are organized in a function elsewhere in the nucleus. In addition, large duplex lariat structure, the t-loop (68) telomeres also contain a large number of non- (Figure 1b). T-loops are presumably formed shelterin proteins which unlike the subunits through strand invasion of the duplex telomeric of shelterin also have nontelomeric functions; repeat by the 3 overhang. The overhang then these factors are discussed separately below. forms base pairs with the C-rich strand, displac- The specificity of shelterin for telomeric ing the G-strand at this site into a displacement DNA is due to the recognition of TTAGGG re- loop (D loop). In initial experiments, t-loops peats by three of its components: TelomericRe- were observed in protein-free DNA after the peat binding Factor 1 and 2 (TRF1 and TRF2) in vivo introduction of interstrand cross-links bind the duplex part of telomeres, whereas Pro- with psoralen (68). Subsequently, t-loops were tection Of Telomeres1 (POT1) can bind the ss observed in native telomeric chromatin that TTAGGG repeats present at the 3 overhang was isolated without cross-linking, and in this and in the D loop of the t-loop configuration. analysis nucleosomes were found to be present TRF1 and TRF2 recruit the other four shel- on the loop (146). T-loops also occur in try- terin components to telomeres: the TRF2- and panosomes, ciliates, plants, Caenorhabditis ele- TRF1-Interacting Nuclear protein 2 (TIN2), , and in some settings, in yeast (24, 25, 49, gans Rap1 (the human ortholog of the yeast Re- 139, 140, 159). pressor/Activator Protein 1), TPP1 (formerly The key feature of t-loops is the fact that known as TINT1, PTOP,or PIP1), and POT1. this structure sequesters the chromosome end. Shelterin forms a stable complex in the absence It has been proposed that t-loops provide an of telomeric DNA, as demonstrated by its isola- by Rockefeller University on 10/13/09. For personal use only. architectural solution to the problem of telom- tion from nuclear cell extracts (119, 203). Sub- ere protection by hiding the telomere termi- complexes of shelterin, lacking either TRF1 or nus from the DNA damage repair machinery TRF2/Rap1, have been observed in cell extracts Annu. Rev. Genet. 2008.42:301-334. Downloaded from arjournals.annualreviews.org (68). The size of the circular part of t-loops does and at telomeres but their specific functions are not seem relevant for its function; it varies be- not yet known (21, 119, 203). tween individual telomeres of a particular cell as well as between different organisms. Loop sizes range from as small as 0.3 kb in trypanosomes TRF1 and TRF2 (139) to up to 30 kb in mice (68) and 50 kb TRF1 and TRF2 share a common domain in peas (24). Little is known about the dynam- structure consisting of the TRF homology ics of the t-loop and the way its formation is (TRFH) domain and a C-terminal SANT/Myb governed by telomeric proteins. It is also not DNA-binding domain, which are connected clear whether t-loops persist throughout the through a flexible hinge domain (11, 13, 15, cell cycle or require prolonged resolution dur- 31, 33, 40, 56, 69, 147). The very N termi- ing DNA replication. nus of TRF2, preceding the TRFH domain, www.annualreviews.org • How Shelterin Protects Mammalian Telomeres 303 ANRV361-GE42-15 ARI 3 October 2008 10:10 TIN2 FxLxP 304 Palm TPP1 OB-fold TRF1 TRFH dimer bound to TIN2 peptide a · OB POT1 TIN2 D/E TRFH Myb TRF1 Lange TPP1 POT1 TTAGGGTTAGGGTTAG 3' OB1 OB2 OB3? TPP1 TPP1 + TRF2 TIN2 AATCCCAATCCCAATC 5' TTAGGGTTAGGGTTAGGGTTAGTTAGGGTTAGAGGGTTAG TAGGGTTATAGGGTTAGG 3' GAR TRFH Myb TRF2 by Rockefeller University on 10/13/09.
Load more

Recommended publications
  • Dyskerin Mutations Present in Dyskeratosis Congenita Patients Increase Oxidative Stress and DNA Damage Signalling in Dictyostelium Discoideum
    cells Article Dyskerin Mutations Present in Dyskeratosis Congenita Patients Increase Oxidative Stress and DNA Damage Signalling in Dictyostelium Discoideum Javier Rodriguez-Centeno, Rosario Perona and Leandro Sastre * Instituto de Investigaciones Biomedicas, CSIC/UAM and Centro de Investigación Biomédica en Red de Enfermedades Raras, CIBERER, 28029 Madrid, Spain; [email protected] (J.R.-C.); [email protected] (R.P.) * Correspondence: [email protected]; Tel.: +3491-585-4437 Received: 11 October 2019; Accepted: 5 November 2019; Published: 8 November 2019 Abstract: Dyskerin is a protein involved in the formation of small nucleolar and small Cajal body ribonucleoproteins. These complexes participate in RNA pseudouridylation and are also components of the telomerase complex required for telomere elongation. Dyskerin mutations cause a rare disease, X-linked dyskeratosis congenita, with no curative treatment. The social amoeba Dictyostelium discoideum contains a gene coding for a dyskerin homologous protein. In this article D. discoideum mutant strains that have mutations corresponding to mutations found in dyskeratosis congenita patients are described. The phenotype of the mutant strains has been studied and no alterations were observed in pseudouridylation activity and telomere structure. Mutant strains showed increased proliferation on liquid culture but reduced growth feeding on bacteria. The results obtained indicated the existence of increased DNA damage response and reactive oxygen species, as also reported in human Dyskeratosis congenita cells and some other disease models. These data, together with the haploid character of D. discoideum vegetative cells, that resemble the genomic structure of the human dyskerin gene, located in the X chromosome, support the conclusion that D. discoideum can be a good model system for the study of this disease.
    [Show full text]
  • Single-Molecule Analysis of the Human Telomerase RNA Center Dot Dyskerin Interaction and the Effect of Dyskeratosis Congenita Mu
    Single-Molecule Analysis of the Human Telomerase RNA center dot Dyskerin Interaction and the Effect of Dyskeratosis Congenita Mutations Ashbridge, B; Orte, A; Yeoman, JA; Kirwan, M; Vulliamy, T; Dokal, I; Klenerman, D; Balasubramanian, S © 2009 American Chemical Society http://pubs.acs.org/page/policy/authorchoice_termsofuse.html For additional information about this publication click this link. http://qmro.qmul.ac.uk/xmlui/handle/123456789/14851 Information about this research object was correct at the time of download; we occasionally make corrections to records, please therefore check the published record when citing. For more information contact [email protected] 10858 Biochemistry 2009, 48, 10858–10865 DOI: 10.1021/bi901373e Single-Molecule Analysis of the Human Telomerase RNA 3 Dyskerin Interaction and the Effect of Dyskeratosis Congenita Mutations† Beth Ashbridge,‡,^ Angel Orte,‡,^,@ Justin A. Yeoman,‡,^,# Michael Kirwan, ) Tom Vulliamy, ) Inderjeet Dokal, ) David Klenerman,*,‡,r and Shankar Balasubramanian*,‡,§,r ‡University Chemical Laboratories, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, U.K., §School of Clinical Medicine, University of Cambridge, Cambridge CB2 0SP, U.K., and Centre) for Paediatrics, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary, University of London, London E1 2AT, U.K. ^These authors contributed equally to this work. @Present address: Department of Physical Chemistry, Faculty of Pharmacy, Campus Cartuja, Granada 18071, Spain. #Present address: National Centre for Biological Sciences, Tata Institute of Fundamental Research, UAS GKVK, Bellary Road, Bangalore 560 065, India. rJoint senior authorship. Received August 7, 2009; Revised Manuscript Received October 1, 2009 ABSTRACT: It has been proposed that human telomerase RNA (hTR) interacts with dyskerin, prior to assembly of the telomerase holoenzyme.
    [Show full text]
  • Transcriptome-Wide Profiling of Multiple RNA Modifications Simultaneously at Single-Base Resolution,” by Vahid Khoddami, Archana Yerra, Timothy L
    Correction BIOCHEMISTRY, CHEMISTRY Correction for “Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution,” by Vahid Khoddami, Archana Yerra, Timothy L. Mosbruger, Aaron M. Fleming, Cynthia J. Burrows, and Bradley R. Cairns, which was first published March 14, 2019; 10.1073/pnas.1817334116 (Proc Natl Acad Sci USA 116:6784–6789). The authors note that the following statement should be added to the Acknowledgments: “This work was also supported by Grant R01 GM093099 from the NIH/National Institute of General Medical Sciences (to C.J.B.).” Published under the PNAS license. Published online April 22, 2019. www.pnas.org/cgi/doi/10.1073/pnas.1905628116 9136 | PNAS | April 30, 2019 | vol. 116 | no. 18 www.pnas.org Downloaded by guest on October 2, 2021 Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution Vahid Khoddamia,b,c,1,2, Archana Yerrab,c,1, Timothy L. Mosbrugerd, Aaron M. Fleminge, Cynthia J. Burrowse,3, and Bradley R. Cairnsb,c,3 aDepartment of Cell Biology, Harvard Medical School, Boston, MA 02115; bHoward Hughes Medical Institute, University of Utah School of Medicine, Salt Lake City, UT 84112; cDepartment of Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84112; dBioinformatics Shared Resource, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84112; and eDepartment of Chemistry, University of Utah, Salt Lake City, UT 84112 Contributed by Cynthia J. Burrows, January 25, 2019 (sent for review October 9, 2018; reviewed by Juan D. Alfonzo, Thomas Carell, and Peter C.
    [Show full text]
  • Signature of Progression and Negative Outcome in Colorectal Cancer
    Oncogene (2010) 29, 876–887 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc ORIGINAL ARTICLE A ‘DNA replication’ signature of progression and negative outcome in colorectal cancer M-J Pillaire1,7, J Selves2,7, K Gordien2, P-A Gouraud3, C Gentil3, M Danjoux2,CDo3, V Negre4, A Bieth1, R Guimbaud2, D Trouche5, P Pasero6,MMe´chali6, J-S Hoffmann1 and C Cazaux1 1Genetic Instability and Cancer Group, Department Biology of Cancer, Institute of Pharmacology and Structural Biology, UMR5089 CNRS, University of Toulouse, University Paul Sabatier, Toulouse, France; 2INSERM U563, Federation of Digestive Cancerology and Department of Anatomo-pathology, University of Toulouse, University Paul Sabatier, Toulouse, France; 3Service of Epidemiology, INSERM U558, Faculty of Medicine, University of Toulouse, University Paul Sabatier, Alle´es Jules Guesde, Toulouse, France; 4aCGH GSO Canceropole Platform, INSERM U868, Val d’Aurelle, Montpellier, France; 5Laboratory of Cellular and Molecular Biology of Cell Proliferation Control, UMR 5099 CNRS, University of Toulouse, University Paul Sabatier, Toulouse, France and 6Institute of Human Genetics UPR1142 CNRS, Montpellier, France Colorectal cancer is one of the most frequent cancers Introduction worldwide. As the tumor-node-metastasis (TNM) staging classification does not allow to predict the survival of DNA replication in normal cells is regulated by an patients in many cases, additional prognostic factors are ‘origin licensing’ mechanism that ensures that it occurs needed to better forecast their outcome. Genes involved in just once per cycle. Once cells enter the S-phase, the DNA replication may represent an underexplored source stability of DNA replication forks must be preserved to of such prognostic markers.
    [Show full text]
  • Crosstalk Between Repair Pathways Elicits Double-Strand Breaks In
    RESEARCH ARTICLE Crosstalk between repair pathways elicits double-strand breaks in alkylated DNA and implications for the action of temozolomide Robert P Fuchs1†*, Asako Isogawa2, Joao A Paulo3, Kazumitsu Onizuka4, Tatsuro Takahashi5, Ravindra Amunugama1, Julien P Duxin1‡, Shingo Fujii2 1Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, United States; 2Cancer Research Center of Marseille, UMR7258, CNRS, Marseille, France; 3Department of Cell Biology, Harvard Medical School, Boston, United States; 4Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai, Japan; 5Faculty of Science, Kyushu University, Fukuoka, Japan Abstract Temozolomide (TMZ), a DNA methylating agent, is the primary chemotherapeutic drug used in glioblastoma treatment. TMZ induces mostly N-alkylation adducts (N7-methylguanine and N3-methyladenine) and some O6-methylguanine (O6mG) adducts. Current models propose that *For correspondence: during DNA replication, thymine is incorporated across from O6mG, promoting a futile cycle of [email protected] mismatch repair (MMR) that leads to DNA double-strand breaks (DSBs). To revisit the mechanism † Present address: Marseille of O6mG processing, we reacted plasmid DNA with N-methyl-N-nitrosourea (MNU), a Medical Genetics, UMR1251, temozolomide mimic, and incubated it in Xenopus egg-derived extracts. We have shown that in this ‡ Marseille, France; The Novo system, MMR proteins are enriched on MNU-treated DNA and we observed robust, MMR- Nordisk Foundation Center for dependent, repair synthesis. Our evidence also suggests that MMR, initiated at O6mG:C sites, is Protein Research, University of strongly stimulated in cis by repair processing of other lesions, such as N-alkylation adducts. Copenhagen, Copenhagen, Denmark Importantly, MNU-treated plasmids display DSBs in extracts, the frequency of which increases linearly with the square of alkylation dose.
    [Show full text]
  • The Licensing Protein Orc4 Is Required for Polar Body Extrusion During Murine Meiosis
    THE LICENSING PROTEIN ORC4 IS REQUIRED FOR POLAR BODY EXTRUSION DURING MURINE MEIOSIS A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAIʻI AT MĀNOA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTORAL OF PHILOSOPHY IN DEVELOPMENTAL AND REPRODUCTIVE BIOLOGY DECEMBER 2017 By Hieu Thi Nguyen Dissertation Committee: David M. Jameson, Ph.D., University Representative W. Steven Ward, Ph.D., Chairperson Monika Ward, Ph.D. Yusuke Marikawa, Ph.D. Yukiko Yamazaki, Ph.D. Keywords: DNA replication, chromosomes, embryo development, ORC4, Polar body extrusion DEDICATION I dedicate this dissertation to my mom (My Thu), my dad (Nguyen Van Ngu), Tu, Lam, Gieng, Thao, Van, Hanh and to the rest of the members of the Nguyen family past and future, and especially to my husband (Nick James) whom provided me with guidance through the hardest times of graduate school. ii ACKNOWLEDGEMENTS I would firstly like to express my sincere gratitude to my advisor Dr. W. Steven Ward who has provided strong support of my dissertation and helped me through this process with patience, intellectual support, motivating me to take questions further, and his caring nature. There was never a time that I could not ask Dr. Ward for his assistance, whether for research or life questions, and for that I will forever be grateful. I could not image having a better advisor for my Ph.D. research. I would also like to thank my dissertation committee: Dr. Monika Ward, Dr. Yusuke Marikawa, Dr. Yukiko Yamazaki, and Dr. David Jameson for their time, effort, insightful comments, and encouragement during my Ph.D.
    [Show full text]
  • Qt38n028mr Nosplash A3e1d84
    ! ""! ACKNOWLEDGEMENTS I dedicate this thesis to my parents who inspired me to become a scientist through invigorating scientific discussions at the dinner table even when I was too young to understand what the hippocampus was. They also prepared me for the ups and downs of science and supported me through all of these experiences. I would like to thank my advisor Dr. Elizabeth Blackburn and my thesis committee members Dr. Eric Verdin, and Dr. Emmanuelle Passegue. Liz created a nurturing and supportive environment for me to explore my own ideas, while at the same time teaching me how to love science, test my questions, and of course provide endless ways to think about telomeres and telomerase. Eric and Emmanuelle both gave specific critical advice about the proper experiments for T cells and both volunteered their lab members for further critical advice. I always felt inspired with a sense of direction after thesis committee meetings. The Blackburn lab is full of smart and dedicated scientists whom I am thankful for their support. Specifically Dr. Shang Li and Dr. Brad Stohr for their stimulating scientific debates and “arguments.” Dr. Jue Lin, Dana Smith, Kyle Lapham, Dr. Tet Matsuguchi, and Kyle Jay for their friendships and discussions about what my data could possibly mean. Dr. Eva Samal for teaching me molecular biology techniques and putting up with my late night lab exercises. Beth Cimini for her expertise with microscopy, FACs, singing, and most of all for being a caring and supportive friend. Finally, I would like to thank Dr. Imke Listerman, my scientific partner for most of the breast cancer experiments.
    [Show full text]
  • Drosophila Melanogaster Marat Sabirov1,2†, Olga Kyrchanova1,2†, Galina V
    Sabirov et al. Epigenetics & Chromatin (2021) 14:16 https://doi.org/10.1186/s13072-021-00391-x Epigenetics & Chromatin RESEARCH Open Access Mechanism and functional role of the interaction between CP190 and the architectural protein Pita in Drosophila melanogaster Marat Sabirov1,2†, Olga Kyrchanova1,2†, Galina V. Pokholkova3†, Artem Bonchuk1,2†, Natalia Klimenko2, Elena Belova1,2, Igor F. Zhimulev3, Oksana Maksimenko2* and Pavel Georgiev1* Abstract Background: Pita is required for Drosophila development and binds specifcally to a long motif in active promoters and insulators. Pita belongs to the Drosophila family of zinc-fnger architectural proteins, which also includes Su(Hw) and the conserved among higher eukaryotes CTCF. The architectural proteins maintain the active state of regulatory elements and the long-distance interactions between them. In particular, Pita is involved in the formation of several boundaries between regulatory domains that controlled the expression of three hox genes in the Bithorax complex (BX-C). The CP190 protein is recruited to chromatin through interaction with the architectural proteins. Results: Using in vitro pull-down analysis, we precisely mapped two unstructured regions of Pita that interact with the BTB domain of CP190. Then we constructed transgenic lines expressing the Pita protein of the wild-type and mutant variants lacking CP190-interacting regions. We have demonstrated that CP190-interacting region of the Pita can maintain nucleosome-free open chromatin and is critical for Pita-mediated enhancer blocking activity in BX-C. At the same time, interaction with CP190 is not required for the in vivo function of the mutant Pita protein, which binds to the same regions of the genome as the wild-type protein.
    [Show full text]
  • Inhibition of MRN Activity by a Telomere Protein Motif
    ARTICLE https://doi.org/10.1038/s41467-021-24047-2 OPEN Inhibition of MRN activity by a telomere protein motif Freddy Khayat1,6, Elda Cannavo2,6, Majedh Alshmery1, William R. Foster1, Charly Chahwan 1,4, Martino Maddalena1,5, Christopher Smith 1, Antony W. Oliver 1, Adam T. Watson1, Antony M. Carr 1, ✉ Petr Cejka2,3 & Alessandro Bianchi 1 The MRN complex (MRX in Saccharomyces cerevisiae, made of Mre11, Rad50 and Nbs1/Xrs2) 1234567890():,; initiates double-stranded DNA break repair and activates the Tel1/ATM kinase in the DNA damage response. Telomeres counter both outcomes at chromosome ends, partly by keeping MRN-ATM in check. We show that MRX is disabled by telomeric protein Rif2 through an N- terminal motif (MIN, MRN/X-inhibitory motif). MIN executes suppression of Tel1, DNA end- resection and non-homologous end joining by binding the Rad50 N-terminal region. Our data suggest that MIN promotes a transition within MRX that is not conductive for endonuclease activity, DNA-end tethering or Tel1 kinase activation, highlighting an Achilles’ heel in MRN, which we propose is also exploited by the RIF2 paralog ORC4 (Origin Recognition Complex 4) in Kluyveromyces lactis and the Schizosaccharomyces pombe telomeric factor Taz1, which is evolutionarily unrelated to Orc4/Rif2. This raises the possibility that analogous mechanisms might be deployed in other eukaryotes as well. 1 Genome Damage and Stability Centre, School of Life Sciences, University of Sussex, Brighton, UK. 2 Institute for Research in Biomedicine, Faculty of Biomedical Sciences, Universitàdella Svizzera italiana (USI), Bellinzona, Switzerland. 3 Department of Biology, Institute of Biochemistry, Eidgenössische Technische Hochschule (ETH), Zürich, Switzerland.
    [Show full text]
  • Identification of Proteins Involved in the Maintenance of Genome Stability
    Identification of Proteins Involved in the Maintenance of Genome Stability by Edith Hang Yu Cheng A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto ©Copyright by Edith Cheng2015 Identification of Proteins Involved in the Maintenance of Genome Stability Edith Cheng Doctor of Philosophy Department of Biochemistry University of Toronto 2015 Abstract Aberrant changes to the genome structure underlie numerous human diseases such as cancers. The functional characterization ofgenesand proteins that maintain chromosome stability will be important in understanding disease etiology and developing therapeutics. I took a multi-faceted approach to identify and characterize genes involved in the maintenance of genome stability. As biological pathways involved in genome maintenance are highly conserved in evolution, results from model organisms can greatly facilitate functional discovery in humans. In S. cerevisiae, I identified 47 essential gene depletions with elevated levels of spontaneous DNA damage foci and 92 depletions that caused elevated levels of chromosome rearrangements. Of these, a core subset of 15 DNA replication genes demonstrated both phenotypes when depleted. Analysis of rearrangement breakpoints revealed enrichment at yeast fragile sites, Ty retrotransposons, early origins of replication and replication termination sites. Together, thishighlighted the integral role of DNA replicationin genome maintenance. In light of my findings in S. cerevisiae, I identified a list of 153 human proteins that interact with the nascentDNA at replication forks, using a DNA pull down strategy (iPOND) in human cell lines. As a complementary approach for identifying human proteins involved in genome ii maintenance, I usedthe BioID techniqueto discernin vivo proteins proximal to the human BLM- TOP3A-RMI1-RMI2 genome stability complex, which has an emerging role in DNA replication progression.
    [Show full text]
  • The Kinesin Spindle Protein Inhibitor Filanesib Enhances the Activity of Pomalidomide and Dexamethasone in Multiple Myeloma
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX The kinesin spindle protein inhibitor filanesib enhances the activity of pomalidomide and dexamethasone in multiple myeloma Susana Hernández-García, 1 Laura San-Segundo, 1 Lorena González-Méndez, 1 Luis A. Corchete, 1 Irena Misiewicz- Krzeminska, 1,2 Montserrat Martín-Sánchez, 1 Ana-Alicia López-Iglesias, 1 Esperanza Macarena Algarín, 1 Pedro Mogollón, 1 Andrea Díaz-Tejedor, 1 Teresa Paíno, 1 Brian Tunquist, 3 María-Victoria Mateos, 1 Norma C Gutiérrez, 1 Elena Díaz- Rodriguez, 1 Mercedes Garayoa 1* and Enrique M Ocio 1* 1Centro Investigación del Cáncer-IBMCC (CSIC-USAL) and Hospital Universitario-IBSAL, Salamanca, Spain; 2National Medicines Insti - tute, Warsaw, Poland and 3Array BioPharma, Boulder, Colorado, USA *MG and EMO contributed equally to this work ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2017.168666 Received: March 13, 2017. Accepted: August 29, 2017. Pre-published: August 31, 2017. Correspondence: [email protected] MATERIAL AND METHODS Reagents and drugs. Filanesib (F) was provided by Array BioPharma Inc. (Boulder, CO, USA). Thalidomide (T), lenalidomide (L) and pomalidomide (P) were purchased from Selleckchem (Houston, TX, USA), dexamethasone (D) from Sigma-Aldrich (St Louis, MO, USA) and bortezomib from LC Laboratories (Woburn, MA, USA). Generic chemicals were acquired from Sigma Chemical Co., Roche Biochemicals (Mannheim, Germany), Merck & Co., Inc. (Darmstadt, Germany). MM cell lines, patient samples and cultures. Origin, authentication and in vitro growth conditions of human MM cell lines have already been characterized (17, 18). The study of drug activity in the presence of IL-6, IGF-1 or in co-culture with primary bone marrow mesenchymal stromal cells (BMSCs) or the human mesenchymal stromal cell line (hMSC–TERT) was performed as described previously (19, 20).
    [Show full text]
  • Mutations in the Telomerase Component NHP2 Cause the Premature Ageing Syndrome Dyskeratosis Congenita
    Mutations in the telomerase component NHP2 cause the premature ageing syndrome dyskeratosis congenita Tom Vulliamy†‡, Richard Beswick†, Michael Kirwan†, Anna Marrone†§, Martin Digweed¶, Amanda Walne†, and Inderjeet Dokal† †Academic Unit of Paediatrics, Institute of Cell and Molecular Science, Barts and the London School of Medicine and Dentistry, London E1 2AT, United Kingdom; and ¶Institut fu¨r Humangenetik, Charite´-Universita¨tsmedizin Berlin, Campus Virchow-Klinikum, 13353 Berlin, Germany Edited by Ernest Beutler, The Scripps Research Institute, La Jolla, CA, and approved April 14, 2008 (received for review January 3, 2008) Dyskeratosis congenita is a premature aging syndrome character- congenita patients have very short telomeres (10, 15), and some ized by muco-cutaneous features and a range of other abnormal- have been shown to have reduced levels of TERC (the RNA ities, including early greying, dental loss, osteoporosis, and malig- component of telomerase) (16, 17). It has been suggested nancy. Dyskeratosis congenita cells age prematurely and have very therefore that dyskeratosis congenita may primarily be a disor- short telomeres. Patients have mutations in genes that encode der of telomere maintenance. The most compelling evidence components of the telomerase complex (dyskerin, TERC, TERT, and supporting this view is that autosomal dominant dyskeratosis NOP10), important in the maintenance of telomeres. Many dys- congenita can result from TERC mutations (18), which cause a keratosis congenita patients remain uncharacterized. Here, we reduction in telomerase activity and give rise to disease via describe the analysis of two other proteins, NHP2 and GAR1, that haploinsufficiency (19–21). Heterozygous missense mutations in together with dyskerin and NOP10 are key components of telom- the reverse transcriptase component of telomerase (TERT) that erase and small nucleolar ribonucleoprotein (snoRNP) complexes.
    [Show full text]