ANRV361-GE42-15 ARI 3 October 2008 10:10 ANNUAL How Shelterin Protects REVIEWS Further Click here for quick links to Annual Reviews content online, Mammalian Telomeres including: • Other articles in this volume 1 • Top cited articles Wilhelm Palm and Titia de Lange • Top downloaded articles • Our comprehensive search Laboratory for Cell Biology and Genetics, The Rockefeller University, New York, NY 10021; email: [email protected] 1Current address: Max Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany Annu. Rev. Genet. 2008. 42:301–34 Key Words First published online as a Review in Advance on ATM, ATR, cancer, NHEJ, HR August 4, 2008 by Rockefeller University on 10/13/09. For personal use only. The Annual Review of Genetics is online at Abstract genet.annualreviews.org The genomes of prokaryotes and eukaryotic organelles are usually cir- This article’s doi: cular as are most plasmids and viral genomes. In contrast, the nuclear Annu. Rev. Genet. 2008.42:301-334. Downloaded from arjournals.annualreviews.org 10.1146/annurev.genet.41.110306.130350 genomes of eukaryotes are organized on linear chromosomes, which Copyright c 2008 by Annual Reviews. require mechanisms to protect and replicate DNA ends. Eukaryotes All rights reserved navigate these problemswith the advent of telomeres, protective nucle- 0066-4197/08/1201-0301$20.00 oprotein complexes at the ends of linear chromosomes, and telomerase, the enzyme that maintains the DNA in these structures. Mammalian telomeres contain a specific protein complex, shelterin, that functions to protect chromosome ends from all aspects of the DNA damage re- sponse and regulates telomere maintenance by telomerase. Recent ex- periments, discussed here, have revealed how shelterin represses the ATM and ATR kinase signaling pathways and hides chromosome ends from nonhomologous end joining and homology-directed repair. 301 ANRV361-GE42-15 ARI 3 October 2008 10:10 MAMMALIAN TELOMERIC DNA peats can seed the formation of a fully func- tional telomere (7, 57, 71), and telomerase in- The telomeric DNA of most eukaryotes, rang- hibition experiments showed that a reduction ing from protists to higher plants and mam- of telomere length to <1 kb is needed to in- mals, is composed of double-stranded (ds) short duce senescence in tumor cell lines (46). PCR- tandem repeats that are maintained by telom- mediated analysis of short telomeres in human erase. A general property of telomeres is that fibroblasts showed that at least 13 TTAGGG the strand that constitutes the 3 -end is rich repeats (78 bp) are required to prevent telomere in guanosine and devoid of cytosine. In ref- fusions (5, 19). Whether such short stretches erence to this G/C bias, the two strands of are sufficient to repress the DNA damage re- the telomeric DNA are called the G- and C- sponse at telomeres is not yet clear because this strands (Figure 1a). Mammals, like the major- analysis was done in a context where check- ity of eukaryotes, use the sequence TTAGGG points are disabled. A confounding issue in at their chromosome ends. The length of the these types of studies is that natural human telomeric repeat tracts varies between different telomeres also contain TTAGGG repeat-like mammals. For instance, the length of human sequences in their subtelomeric regions that telomeres is typically 10–15 kilobases (kb) at might contribute to telomere protection. birth, whereas the telomeres of laboratory mice The actual terminus of mammalian telom- and rats are 20–50 kb (50, 73, 100, 109). Re- eres is not blunt-ended, but consists of a single- cent findings that telomere length changed fre- stranded 3-protrusion of the G-strand, known quently within the mammalian lineage suggests as the 3 overhang (Figure 1a) (127, 133). This that alterations in telomere length can evolve feature is conserved throughout the eukary- quickly (W. Wright, personal communication). otic kingdom. The 3 overhang of mammalian The adaptive advantages of the longer telom- telomeres varies between 50–500 nt, which is eres of some rodents remain to be determined. considerably longer than the protrusion of most Recent work is addressing the minimal num- other eukaryotes. It is still unclear how the 3 ber of telomeric repeats required for telomere overhang of mammalian telomeres is gener- protection. Early transfection experiments had ated but it has been excluded that they are the shown that as little as 400 bp of TTAGGG re- a 2–20 kb ds [TTAGGG]n 50–500 nt 3' overhang 3' 5' by Rockefeller University on 10/13/09. For personal use only. Subtelomeric Degenerate repeats TTAGGG repeats G-strand GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA 3' C-strand CCCAATCCCAATC 5' Annu. Rev. Genet. 2008.42:301-334. Downloaded from arjournals.annualreviews.org t-loop b Variable D loop loop size 5' 3' Strand-invasion of 3´ overhang Figure 1 The structure of human telomeres. (a) Human chromosomes end in an array of TTAGGG repeats that varies in length. Proximal to the telomeric repeats is a segment of degenerate repeats and subtelomeric repetitive elements. The telomere terminus contains a long G-strand overhang. The 3 end is not precisely defined whereas the 5> end of human chromosomes nearly always features the sequence ATC-5. (b) Schematic of the t-loop structure. The size of the loop is variable. 302 Palm · Lange ANRV361-GE42-15 ARI 3 October 2008 10:10 product of telomerase (76, 145). As discussed SHELTERIN below, resection of the C-strand by a nucle- The TTAGGG repeats of mammalian chro- ase, as first postulated by Langmore and col- mosome ends associate with the six-protein leagues (127), is generally anticipated. Consis- complex, shelterin (48) (Figure 2). Shelterin tent with such active processing, the 5-end of enables cells to distinguish their natural human telomeres is accurately defined and pre- chromosome ends from DNA breaks, re- dominantly ends on the sequence ATC-5 (167) presses DNA repair reactions, and regulates (Figure 1a). In contrast, the last base of the 3 telomerase-based telomere maintenance. The overhang is variable and appears to be almost components of shelterin specifically localize random in telomerase-negative cells (167). to telomeres; they are abundant at telomeres Electron microscopy revealed that mouse throughout the cell cycle; and they do not and human telomeres are organized in a function elsewhere in the nucleus. In addition, large duplex lariat structure, the t-loop (68) telomeres also contain a large number of non- (Figure 1b). T-loops are presumably formed shelterin proteins which unlike the subunits through strand invasion of the duplex telomeric of shelterin also have nontelomeric functions; repeat by the 3 overhang. The overhang then these factors are discussed separately below. forms base pairs with the C-rich strand, displac- The specificity of shelterin for telomeric ing the G-strand at this site into a displacement DNA is due to the recognition of TTAGGG re- loop (D loop). In initial experiments, t-loops peats by three of its components: TelomericRe- were observed in protein-free DNA after the peat binding Factor 1 and 2 (TRF1 and TRF2) in vivo introduction of interstrand cross-links bind the duplex part of telomeres, whereas Pro- with psoralen (68). Subsequently, t-loops were tection Of Telomeres1 (POT1) can bind the ss observed in native telomeric chromatin that TTAGGG repeats present at the 3 overhang was isolated without cross-linking, and in this and in the D loop of the t-loop configuration. analysis nucleosomes were found to be present TRF1 and TRF2 recruit the other four shel- on the loop (146). T-loops also occur in try- terin components to telomeres: the TRF2- and panosomes, ciliates, plants, Caenorhabditis ele- TRF1-Interacting Nuclear protein 2 (TIN2), , and in some settings, in yeast (24, 25, 49, gans Rap1 (the human ortholog of the yeast Re- 139, 140, 159). pressor/Activator Protein 1), TPP1 (formerly The key feature of t-loops is the fact that known as TINT1, PTOP,or PIP1), and POT1. this structure sequesters the chromosome end. Shelterin forms a stable complex in the absence It has been proposed that t-loops provide an of telomeric DNA, as demonstrated by its isola- by Rockefeller University on 10/13/09. For personal use only. architectural solution to the problem of telom- tion from nuclear cell extracts (119, 203). Sub- ere protection by hiding the telomere termi- complexes of shelterin, lacking either TRF1 or nus from the DNA damage repair machinery TRF2/Rap1, have been observed in cell extracts Annu. Rev. Genet. 2008.42:301-334. Downloaded from arjournals.annualreviews.org (68). The size of the circular part of t-loops does and at telomeres but their specific functions are not seem relevant for its function; it varies be- not yet known (21, 119, 203). tween individual telomeres of a particular cell as well as between different organisms. Loop sizes range from as small as 0.3 kb in trypanosomes TRF1 and TRF2 (139) to up to 30 kb in mice (68) and 50 kb TRF1 and TRF2 share a common domain in peas (24). Little is known about the dynam- structure consisting of the TRF homology ics of the t-loop and the way its formation is (TRFH) domain and a C-terminal SANT/Myb governed by telomeric proteins. It is also not DNA-binding domain, which are connected clear whether t-loops persist throughout the through a flexible hinge domain (11, 13, 15, cell cycle or require prolonged resolution dur- 31, 33, 40, 56, 69, 147). The very N termi- ing DNA replication. nus of TRF2, preceding the TRFH domain, www.annualreviews.org • How Shelterin Protects Mammalian Telomeres 303 ANRV361-GE42-15 ARI 3 October 2008 10:10 TIN2 FxLxP 304 Palm TPP1 OB-fold TRF1 TRFH dimer bound to TIN2 peptide a · OB POT1 TIN2 D/E TRFH Myb TRF1 Lange TPP1 POT1 TTAGGGTTAGGGTTAG 3' OB1 OB2 OB3? TPP1 TPP1 + TRF2 TIN2 AATCCCAATCCCAATC 5' TTAGGGTTAGGGTTAGGGTTAGTTAGGGTTAGAGGGTTAG TAGGGTTATAGGGTTAGG 3' GAR TRFH Myb TRF2 by Rockefeller University on 10/13/09.