Replisome Assembly at Oric, the Replication Origin of E. Coli, Reveals an Explanation for Initiation Sites Outside an Origin

Home , DnaC, DNA unwinding element, Replisome

Molecular Cell, Vol. 4, 541–553, October, 1999, Copyright 1999 by Cell Press Replisome Assembly at oriC, the Replication Origin of E. coli, Reveals an Explanation for Initiation Sites outside an Origin

Linhua Fang,*§ Megan J. Davey,† and Mike O’Donnell†‡ have not been addressed. For example, is the local un- *Microbiology Department winding sufficiently large for two helicases to assemble Joan and Sanford I. Weill Graduate School of Medical for bidirectional replication, or does one helicase need Sciences of Cornell University to enter first and expand the bubble via helicase action New York, New York 10021 to make room for the second helicase? The known rep- † The Rockefeller University and licative helicases are hexameric and encircle ssDNA. Howard Hughes Medical Institute Which strand does the initial helicase(s) at the origin New York, New York 10021 encircle, and if there are two, how are they positioned relative to one another? Primases generally require at least transient interaction with helicase to function. Can Summary primase function with the helicase(s) directly after helicase assembly at the origin, or must helicase-catalyzed This study outlines the events downstream of origin DNA unwinding occur prior to RNA primer synthesis? unwinding by DnaA, leading to assembly of two repli- Chromosomal replicases are comprised of a ring-shaped cation forks at the E. coli origin, oriC. We show that protein clamp that encircles DNA, a clamp-loading com- two hexamers of DnaB assemble onto the opposing plex that uses ATP to assemble the clamp around DNA, strands of the resulting bubble, expanding it further, and a DNA polymerase that binds the circular clamp, yet helicase action is not required. Primase cannot act thereby remaining tightly bound to DNA for highly pro- until the helicases move 65 nucleotides or more. Once cessive synthesis (Kelman and O’Donnell, 1995). Can primers are formed, two molecules of the large DNA this entire replicating machinery assemble at the origin polymerase III holoenzyme machinery assemble into with the helicase before DNA unwinding, or does this the bubble, forming two replication forks. Primer loca- assembly process occur in a separate stage after the tions are heterogeneous; some are even outside oriC. helicases generate sufficient space to accommodate This observation generalizes to many systems, pro- these large machines? If so, how much space is needed? karyotic and eukaryotic. Heterogeneous initiation sites This report addresses these questions through a are likely explained by primase functioning with a mov- study of the stepwise events leading to the point at ing helicase target. which two replisomes are assembled in opposite directions at the E. coli origin, oriC. The study utilizes 19 different proteins produced by recombinant methods. Introduction The E. coli chromosome is replicated bidirectionally from oriC (Kornberg and Baker, 1992). Several copies Replication origins are cis-acting sequences that direct of the initiator protein, DnaA, bind specifically to at least the assembly of proteins onto DNA for the replication four 9-mer DNA-binding sites within the 245 bp oriC process, producing two copies of the genetic material (Fuller et al., 1984). In the presence of ATP, the interac- (Kornberg and Baker, 1992). Generally, initiation from tion of DnaA with oriC melts 26 bp within a region of an origin requires an origin-binding protein, which may three tandem 13-mer AT-rich repeats at one end of oriC act in concert with other DNA-binding factors to locally to form the “open complex” (Bramhill and Kornberg, unwind an AT-rich region within the origin sequence. 1988; Gille and Messer, 1991). Open complex formation This unwound bubble region is thought to provide an is aided by HU protein or IHF (integration host factor) entry point leading to assembly of two helicases that (Hwang and Kornberg, 1992). Following this, at least one move in opposite directions. Two copies of the primase molecule of the replicative helicase, the hexameric DnaB and replicase must also be recruited to form two replica- protein, assembles onto the origin in a reaction that tion forks for bidirectional synthesis of the DNA. depends on DnaC protein to form the prepriming com- Events leading to localized unwinding of DNA within plex (Baker et al., 1987; Funnell et al., 1987; Bramhill and the origin have been characterized in several systems, Kornberg, 1988). Electron microscopy studies suggest including the E. coli origin, oriC (Bramhill and Kornberg, that DnaB binds oriC in the vicinity of the open complex 1988); the bacteriophage ␭ origin, ori ␭ (Schnos et al., (Funnell et al., 1987). ATP is needed by DnaA and DnaC 1988); the origins of E. coli plasmids R6K (Mukherjee et in these initial steps, and therefore, the DnaB helicase al., 1985) and RK2 (Konieczny et al., 1997); bacterio- is active and mobile during this assembly reaction. The phage P1 (Mukhopadhyay and Chattoraj, 1993); and ori- mobility of DnaB has prevented determination of its ex- gins of viruses SV40 (Borowiec et al., 1990), HSV-1 (Lee act assembly site(s) at oriC and whether one or two and Lehman, 1997), EBV (Frappier and O’Donnell, 1992), DnaB hexamers assemble at oriC before helicase action. and BPV (Gillette et al., 1994). However, important ques- Steps downstream of DnaB assembly have not been tions about events that occur downstream of this step described in detail but must include priming by primase (DnaG), and the assembly of two molecules of the chromosomal replicase, DNA polymerase III holoenzyme, to ‡ To whom correspondence should be addressed (e-mail: odonnel@ rockvax.rockefeller.edu). form bidirectional replication forks. § Present address: Molecular Staging Inc., 66 High Street, Guilford, This report examines origin activation events that oc- Connecticut 06437. cur downstream of the DnaA/HU-mediated open com- Molecular Cell 542

plex. The position and stoichiometry of DnaB at oriC of the origin. In the absence of gyrase, the unwinding has been determined in advance of helicase-catalyzed of a supercoiled 6.6 kb plasmid by DnaB helicase is unwinding using a mutant of DnaB that assembles onto restricted to approximately 6.4% Ϯ 2.4% of the plasmid DNA but is inactive as a helicase. The results demon- length, being limited by the topological tension gener- strate that DnaC delivers two DnaB hexamers to oriC ated upon unwinding a closed duplex circle (Baker et in the absence of helicase action; DnaC does not remain al., 1987). The oriC sequence was cloned into pUC18 on the DNA. DnaB assembly onto oriC results in an to generate pUC18oriC (3.1 kb final), and the extent expansion of the ssDNA in the open complex unaided of unwinding by DnaB in the absence of gyrase was by helicase activity. Footprint analysis indicates that the examined by measuring the length of nascent leading two helicases are positioned face to face, one on each strand chains (as in Hiasa et al., 1996). The largest length strand, such that they pass each other early in the un- of these nascent chains averaged 65–83 nucleotides, winding process. Primase is unable to prime oriC in which indicates a bubble size of 66–99 nucleotides, as- the absence of helicase action, even though the origin suming the start sites mapped later in this study, in contains two DnaB hexamers. For want of a primed site, Figure 5. This value is within 2-fold of the 6.4% deter- replication forks containing DNA polymerase III holoen- mined by the earlier electron microscopy study. To de- zyme also do not assemble in the absence of helicase termine whether two DnaB hexamers, and one or two action. Hence, origin activation proceeds to the point molecules of DNA polymerase III holoenzyme, could as- of assembly of two helicases onto DNA but thereafter semble onto this unwound DNA, we radiolabeled pro- requires helicase motion for priming and assembly of teins and added them to either pUC18oriC or pUC18. replication forks. The stoichiometry of proteins bound to the DNA was Helicase-mediated unwinding of approximately 100 then determined by gel filtration analysis using the large nucleotides is sufficient for primase action on both pore BioGel A-15m resin. The large plasmid DNA and strands, and for assembly of two molecules of the DNA proteins bound to it elute early in the excluded volume polymerase III holoenzyme machinery. We propose that (fractions 10–15); proteins not bound to DNA are in- each DNA polymerase III holoenzyme extends these ini- cluded and elute later (fractions 18–35). Five experi- tial two primers across the replication bubble until they ments were performed using DnaA, HU, DnaB, DnaC, encounter, and couple, with the DnaB on the opposite DnaG, SSB, Pol III* (DNA polymerase III holoenzyme strand. lacking only ␤), and ␤ in which either 32P-DnaB, 3H-DnaC, The RNA/DNA junctions of the primed start sites in 32P-primase, 3H-Pol III*, or 3H-␤ was substituted for its this in vitro system demonstrate that they are dispersed, unlabeled counterpart. occurring at any of several positions, and are located The results, in Figure 1 (quantitated in Table 1), indi- inside and outside the origin. Heterogeneous location cate that approximately two molecules of DnaB (as of primed sites is consistent with earlier in vivo mapping hexamer), two molecules of Pol III*, and two ␤ clamps studies (Hirose et al., 1983; Kohara et al., 1985). The assemble onto pUC18oriC. Primase did not bind pU- nearest primed sites to the initial position of DnaB at C18oriC, and less than one DnaC monomer was re- oriC imply that each DnaB moves 65 nucleotides or tained, consistent with the known distributive action of more before primase synthesizes an RNA primer. The primase (Marians, 1992) and apparent absence of DnaC requirement of DnaB to move for primase to act on in the prepriming complex at oriC (Funnell et al., 1987). oriC provides an explanation for the heterogeneity of Interaction of DnaB, Pol III*, and ␤ with DNA required the initiating RNA/DNA junctions. Namely, since primase re- oriC sequence as illustrated in Figure 1 for the plasmid quires at least transient interaction with DnaB to func- lacking oriC (pUC18). Presumably, two replisomes, each tion, it must associate with a moving target, resulting in containing one DnaB hexamer, one Pol III* (each having dispersal of primed sites in the vicinity of the origin. This two core DNA polymerases), and one ␤ clamp, assem- finding may generalize, as heterogeneous location of bled onto each molecule of pUC18oriC (recovery of DNA start sites is observed in several replication systems, was typically 85%–95%). including bacteriophage ␭, (Tsurimoto and Matsubara, These isolated protein–DNA complexes are func- 1984; Yoda et al., 1988); R6K plasmid (Chen et al., 1998); tional, requiring only gyrase for activity. Further, the iso- plasmid R1 (Bernander et al., 1992); the simian virus, lated complexes display bidirectional replication from SV40 (Hay and DePamphilis, 1982; Bullock and Denis, oriC (not shown, but experimental design and results 1995); and the S. cerevisiae origin, ARS1 (Bielinsky and are similar to those of Figure 5D). It is interesting to Gerbi, 1998). Based on these studies of E. coli oriC,it note that only one ␤ clamp is present for the two core seems likely that heterogeneity in priming sites at origins polymerases within Pol III*. Thus, only the leading (or of other systems will also be explained by the need for lagging) strand core polymerase is tethered to DNA by helicase motion to support primase action. a ␤ clamp. It is unlikely that one replisome contains two ␤ clamps, one for each core polymerase, and the other replisome lacks ␤, as additional studies not shown here Results did not detect Pol III* on pUC18oriC in reactions lacking ␤. A Small Bubble at oriC Supports Assembly of Two Replisomes How Far Does Orisome Assembly Proceed In this first experiment, we asked whether two full repli- in the Absence of Helicase Action? somes can assemble onto DNA upon constraining the The experiment of Figure 1 demonstrated that two repli- unwinding of the plasmid to a small area in the vicinity cation forks assemble on an oriC plasmid in the absence Replisome Assembly at oriC 543

The ssDNA created by binding of the DnaA/HU to form open complex is approximately 26 nucleotides of melted

DNA, as determined by KMnO4 modification (Gille and Messer, 1991). Is this DNA structure sufficient to support assembly of two helicases, two priming events, and two molecules of DNA polymerase III holoenzyme in the absence of further unwinding catalyzed by DnaB? The DnaB hexamer forms a ring (San Martin et al., 1995; Yu et al., 1996) that encircles ssDNA (Yuzhakov et al., 1996) and appears to require 20 Ϯ 3 nucleotides of ssDNA for tight binding (Jezewska et al., 1996). From this informa- tion, a 26-residue “bubble” would accommodate only one molecule of DnaB, although it may be possible that each strand of the bubble could accommodate one DnaB hexamer. Our strategy to determine whether one or two DnaB hexamers, and other components of the replisome, assemble into the open complex at oriC without helicase action was to construct a DnaB mutant that lacks helicase activity. The sequence of DnaB contains a Walker A nucleotide-binding motif between amino acid residues 223 and 244. We replaced Lys-236, the most conserved residue in the Walker A motif, with either Arg or Ala. The mutations were introduced into a dnaB gene that also includes a cAMP-dependent protein kinase motif in the N terminus (Yuzhakov et al., 1996). The N-terminal modification, which has little effect on the activities of DnaB (Yuzhakov et al., 1996), enables radiolabeling of the protein using [␥-32P]ATP and a protein kinase. In addition to supporting in vitro oriC replication, wild- Figure 1. Assembly of Proteins at the Origin type DnaB has many other enzymatic activities. These Five different experiments, differing only in which radioactive-labeled DnaB activities include: ATP binding, ssDNA-dependent protein was added in place of the unlabeled protein, were performed ATP hydrolysis, duplex DNA unwinding, and activation as described in Experimental Procedures. Proteins were assembled of primase on an ssDNA template (general priming activ- onto plasmid DNA either containing oriC (closed circles), or lacking ity). In Figure 2, we characterized the ATP site mutants it (open circles) followed by gel filtration. Radiolabeled proteins were located in column fractions by liquid scintillation and quantitated of DnaB by comparing these enzymatic activities with from their known specific activity: (A) 32P-DnaB, (B) 3H-DnaC, (C) those of wild-type DnaB. 3H-Pol III*, (D) 3H-␤, and (E) 32P-primase. The diagram at the top The results show that substitution of Arg for Lys-236 summarizes the results. Two hexamers of DnaB are shown as encir- (DnaBPKK236R) resulted in a DnaB that retained full ac- cling ssDNA. The two ring-shaped ␤ clamps are each shown as tivity in all four assays tested (Figures 2A–2E). As we a torus encircling a primed site. Each Pol III* contains two core desire a DnaB lacking helicase activity, the K236R mu- polymerases and one ␥ complex clamp loader (not shown). tant is not discussed further in this report. Replacement of Lys-236 with Ala (DnaBPKK236A) resulted in the de- of gyrase. This result indicates that unwinding of approx- sired DnaB mutant; it had only weak ATPase activity imately 66–99 bp is sufficient for assembly of all the (Figure 2B), no detectable helicase activity (Figure 2C), machinery needed for bidirectional replication. Perhaps and no activity in the oriC replication system (Figure 2E). these events are so tightly coupled that all of these However, DnaBPKK236A retained the ability to bind ATP proteins assemble at oriC even before helicase action. (Kd ϭ 7 ␮M, Figure 2A), and to support primase action in general priming (Figure 2D) (DnaBPKK236A is still a hexamer, not shown). In fact, DnaBPKK236A was about Table 1. Stoichiometry of Replisome Components 3-fold more active than DnaBPK in general priming, con- Component Protein on DNA (fmol) Ratio of Protein/DNA sistent with an earlier study of a DnaB mutant defective in ATP hydrolysis (Shrimankar et al., 1992). DnaB 475 Ϯ 91 (Hexamer) 1.8 Ϯ 0.4a DnaC 202 Ϯ 27 (Monomer) 0.8 Ϯ 0.1a Pol III* 520 Ϯ 23 (Dimeric 2.1 Ϯ 0.1b Two DnaB Hexamers Assemble onto an oriC- polymerases) Containing Plasmid in the Absence ␤ clamp 461 Ϯ 145 (Dimer) 1.9 Ϯ 0.6b of Helicase Activity PK Proteins were assembled onto 252 fmol pUC18oriC DNA followed A simple explanation for the inability of DnaB K236A by gel filtration to separate protein assembled on DNA from protein to support oriC replication is lack of helicase activity. not bound to DNA (described in Experimental Procedures). The However, it is also possible that DnaBPKK236A is unable results are the mean of several experiments. to interact with DnaC and thus fails to assemble onto a n ϭ 4 oriC. Therefore, we radiolabeled both DnaBPK and DnaB- b n ϭ 5 PKK236A in order to determine directly whether the DnaB Molecular Cell 544

Figure 2. Characterization of DnaB ATP Site Mutants Assays were performed as described under Experimental Proce- dures. In each assay, all components were kept the same except for Figure 3. Two DnaB Hexamers Assemble onto oriC in the Absence the type of DnaB used: DnaBPK (circles), DnaBPKK236R (diamonds), of Helicase Action DnaBPKK236A (triangles), or no DnaB ([D] only, squares). (A) ATP DnaB assembly experiments are described in Experimental Proce- binding. (B) ATPase activity using M13mp18 ssDNA as a DNA ef- dures. (A) Assembly of DnaBPK (left panel) or DnaBPKK236A (right fector. (C) Oligonucleotide displacement from M13mp18 ssDNA. (D) panel) onto M13mp18 ssDNA in the presence (triangles) or absence General priming activity testing the ability of different DnaB proteins (circles) of DnaC. (B) 32P-labeled DnaBPKK236A and 3H-DnaC were to support general priming by primase on M13mp18 ssDNA. (E) oriC incubated with plasmid DNA along with DnaA protein, HU, and SSB. replication assays. Assembly of DnaBPKK236A, left panel; 3HDnaC (right panel); pU- C18oriC, triangles; pUC18, circles. mutant can assemble onto either ssDNA pUC18oriC and SSB, were incubated with 252 fmol of either pUC18 (Figure 3). 32P-DnaBPK or 32P-DnaBPKK236A was incu- or pUC18oriC, and then analyzed by gel filtration to bated with circular M13mp18 ssDNA in the presence of quantitate protein bound to DNA (Figure 3B). The results ATP, with or without DnaC, then the amount of DnaB that show that approximately 510 fmol (as hexamer) of 32P- assembled onto DNA was quantitated by gel filtration DnaBPKK236A comigrated with pUC18oriC (Figure 3B, analysis. The results demonstrate that DnaC stimulates triangles in the left panel). The reaction contained a the assembly of DnaBPK onto M13mp18 ssDNA (Figure 5-fold molar excess of DnaC (as monomer) per hexamer 3A, left panel), consistent with an earlier study (Wahle et of DnaB, yet only about one 3H-DnaC monomer was al., 1989). The results using DnaBPKK236A demonstrate retained on pUC18oriC (Figure 3B, triangles in the right that it too assembles onto ssDNA and is stimulated by panel). This result confirms that most of the DnaC disso- DnaC (Figure 3A, right panel). The ability of DnaBP- ciates from DNA after loading the DnaB mutant onto KK236A to function with DnaC in assembly onto DNA oriC. Hence, helicase action is not required for DnaC to suggests that the inactivity of DnaBPKK236A in oriC repli- dissociate from DnaB. Plasmid lacking oriC did not re- cation is not due to inherent inability of the DnaB mutant tain significant amounts of either 32P-DnaBPKK236A or to function with DnaC, or to assemble onto ssDNA. 3H-DnaC (Figure 3B, circles in the left and right panels, Next, 32P-DnaBPKK236A was used to directly assess respectively). whether it can assemble onto oriC, and if so, to measure The overall conclusion of these experiments is that the stoichiometry of DnaB on the origin in the absence two hexamers of DnaB can assemble onto oriC in the of helicase activity. 3H-DnaC was also used in the same absence of helicase activity. Hence, the helicase action experiment to determine the fate of DnaC with this DnaB of one DnaB hexamer is not required to generate addi- mutant. The radiolabeled proteins, along with DnaA, HU, tional ssDNA for assembly of the second DnaB hexamer. Replisome Assembly at oriC 545

It may be presumed that priming of the origin must occur in order for Pol III* and the ␤ clamp to assemble onto the DNA. To determine whether primase can function at oriC in the absence of helicase activity, we assembled DnaBPKK236A onto pUC18oriC using DnaC along with DnaA and HU, then measured RNA synthesis upon adding primase. As a control, a parallel experiment was performed using DnaBPK in place of DnaBPKK236A. The results, in Figure 4B, show that DnaBPK, but not DnaBPKK236A, supports primer synthesis at oriC. Hence, DnaB helicase motion is required for primase action at oriC. This result was somewhat surprising as primase is fully active with DnaBPKK236A in general priming on ssDNA (Figure 2D). Therefore, the inability of DnaBP- KK236A to activate primase at oriC is not due to an inability of primase to interact, or otherwise function, with DnaBPKK236A. Presumably there is simply insufficient ssDNA template upon which primase can act in the origin, and helicase action is required to produce the ssDNA necessary for primase action. Quantitation of RNA synthesis produced in the reaction using DnaBPK (and wild-type DnaB; data not shown) yielded approximately 22 ribonucleotides incorporated into each oriC plasmid on average (Figure 4B, 20 min time point). Assuming a primer size of 10–12 nucleotides, as determined for E. coli primase in another study (Kitani et al., 1985), approximately two primers are synthesized Figure 4. Helicase Action Is Needed for Priming and Replisome As- per oriC plasmid in this study. Two primers per origin sembly is consistent with the value of two ␤ clamps assembled (A) Assembly of Pol III* (left panel) and ␤ (right panel) on pUC18oriC onto each oriC plasmid as determined in Figure 1. was performed using either DnaBPK (closed circles) or DnaBPKK236A (open circles). (B) RNA synthesis on pUC18oriC was performed using either DnaBPK Amount of Unwinding Needed (closed circles) or DnaBPKK236A (open circles). for Replisome Assembly The experiments presented thus far demonstrate that This ability to assemble two DnaB hexamers onto oriC, origin activation is divided into two very distinct stages: even before helicase action, ensures bidirectional repli- events that lead to assembly of two DnaB hexamers cation of the chromosome and likely underlies the obser- at oriC and events downstream of helicase-catalyzed vations of an earlier study (Baker et al., 1987) demon- unwinding that lead to assembly of two replisomes. How strating that replication from oriC appears bidirectional far must the helicases travel for primase to act? To even when limiting protein components are supplied to address this question, we mapped the initial positions the reaction. (RNA/DNA junctions) at which primase acts at oriC using Do two complete replisomes assemble at oriC in the native DnaB. absence of helicase action? The use of a DnaB mutant To determine the location of start sites, newly repli- to assemble two DnaB hexamers at oriC in the absence cated pUC18oriC was purified from protein and then of helicase activity makes it possible to test for priming treated with alkali to remove RNA primers. The RNA/ 32 and assembly of DNA polymerase III holoenzyme at oriC DNA junction sites were mapped by extending P-prim- without further helicase-catalyzed DNA unwinding. ers that anneal to one or the other strand of the duplex. Primer extension, using the Klenow fragment of E. coli Primase Action at oriC Requires the Helicases DNA polymerase I, proceeds to the end of the DNA to Move strand, which, for strands initiating in or near oriC, will The experiment of Figure 3 demonstrates that two hex- result in products less than 1 kb in length. amers of the inactive helicase, DnaBPKK236A, assemble The mapping results, shown in Figure 5, indicate that onto the origin. Can two molecules of DNA polymerase primed start sites occur at multiple positions on both III holoenzyme also assemble onto the origin in the ab- strands near the left part of oriC (Figures 5A and 5B). sence of DNA unwinding? This was tested in Figure 4A This is the region of the open complex where DnaB is upon adding primase, 3H-Pol III* and ␤ (or Pol III* and thought to assemble, as will be demonstrated later (Fig- 3H-␤) along with DnaA, HU, DnaC, and either DnaBPK ure 6). The position and frequency of the observed RNA/ or DnaBPKK236A. Reactions were then analyzed by gel DNA junction sites are summarized in Figure 5C. The filtration. The results demonstrate that neither 3H-Pol III* asymmetric distribution of the initiation sites for the two nor 3H-␤ assembled onto the origin using the inactive strands with respect to oriC is consistent with previous helicase mutant; the control reaction using active heli- in vivo mapping studies of the bidirectional start sites case showed the expected amounts of 3H-Pol III* and from oriC (Hirose et al., 1983; Kohara et al., 1985). Hence, 3H-␤ bound to pUC18 oriC. the counterclockwise strand initiates within oriC, and Molecular Cell 546

Figure 5. Mapping of RNA/DNA Junctions of Initial Start Sites at oriC Primer extension using 32P-labeled primers was used to determine the location of RNA/DNA junctions on replicated pUC18oriC as described under Experimental Procedures. (A) Autoradiogram of a sequencing gel of 32P-primer extension products that map RNA/DNA junctions on the bottom strand. (B) Autoradiogram of 32P-primer extension products on the top strand. The positions of the 13-mer repeats (L, M, and R) and AT-rich region in oriC are illustrated on the side of the gels. (C) Summary of initiation sites using 96 nM primase. Vertical line heights reflect relative intensities in the sequencing gels. Horizontal arrows indicate direction of DNA synthesis. The vertical arrow, at position 392358 9 (ϩ1), indicates the left boundary of oriC. Numbers reflect the position in the E. coli genome. The number within parentheses indicates the position in the minimal oriC sequence (Kornberg and Baker, 1992). (D) Bidirectional replication was confirmed using pBROTB (shown in upper panel) as described in Experimental Procedures. The 2 and 3 kb fragments between terB sites and oriC are indicated on the plasmid map. An autoradiogram of a denaturing agarose gel of the replication products (lower panel) with increasing amounts of DnaB (as indicated) is shown. Quantitation of the 2 and 3 kb bands using a phosphorimager indicates equal amounts of each in every lane (taking into account differences in intensity due to their different sizes). the clockwise strand initiates outside the left boundary experiment was performed at several different concen- of oriC (note the solid arrows in Figure 5C). Essentially trations of primase. As the concentration of primase is all of the observed junctions are within 12 nucleotides elevated, the sites closest to the origin are generated of an upstream 5Ј-APu-3Ј in the complementary strand, more frequently, consistent with the observation that a the preferred two-nucleotide initiation sequence for E. high concentration (80 nM) of primase promotes efficient coli primase (template strand, 5Ј-PyT-3Ј) (Kitani et al., bidirectional DNA replication (Hiasa and Marians, 1994). 1985). It is interesting to note that the most frequent Another interesting feature of the mapping results is that RNA/DNA junction sites on the lower strand template the junction sites located on the top and bottom strands occur approximately 60–70 bp outside the left boundary are separated by at least 69 bp. This result suggests of oriC, although some sites are much closer, up to that the extension products from these primed sites seven nucleotides distant from the left oriC boundary overlap, and therefore, the two replicases pass one an- (see Figure 5C). The RNA/DNA junction sites on the other during chain extension (explained more fully in the upper strand fall within the leftmost region of oriC. The Discussion). Replisome Assembly at oriC 547

Figure 6. Footprint Analysis of DnaB on oriC

Using KMnO4

(A) KMnO4 modification experiments were performed as described under Experimental Procedures. In brief, pUC18oriC was incubated with DnaA and/or DnaBPKK236A plus

DnaC, then treated with KMnO4, followed by location of the modified residues by primer extension analysis in a sequencing gel. The left gel is the upper strand analysis, and the lower strand is shown to the right. All reactions except lane 1 contained 0.46 ␮g DnaA. Lane 1, 0.35 ␮g DnaBPKK236A; lane 2, no DnaBPKK236A; lane 3, 0.18 ␮g DnaBPKK236A; and lane 4, 0.35 ␮g DnaBPKK236A. DnaC was added at an equimolar ratio to DnaBPKK236A (monomer to monomer). The diagram between the gels shows ssDNA in the DnaA- induced open complex (middle diagram) compared to the DnaBC-induced expanded melted region of the origin to include the L 13-mer and AT-rich region (bottom diagram). The direction of helicase movement is indicated by the arrows. (B) Scale representation of DnaB on a 55 nt bubble. The dimensions of DnaB are based on those from electron microscope studies.

It seems likely that most of the sites noted in Figure titration, demonstrating bidirectional replication from 5C are leading strand start sites. However, the possibility oriC. A similar titration of Pol III* into this assay yielded that some of these are lagging strand start sites (i.e., comparable results to the DnaB titration, indicating co- for the other replicase) cannot be rigorously excluded. operative assembly of the two replisomes (data not An argument indicating these to be mainly initiating sites shown). These results are consistent with the conclu- is as follows. If only one or two of these sites were sions of an earlier study in which each replication protein initiating leading strand sites, and the rest were lagging was titrated into the oriC replication assay (Baker et al., strand RNA/DNA junctions, then the relative intensity of 1987). The fact that bidirectional replication is observed the few leading strand sites would be greater (i.e., even at very low Pol III* or DnaB suggests that assembly greater than 5-fold) than the many lagging strand start of the two replisomes is a cooperative process, although sites. However, the intensity of the various sites, while an alternative explanation that replication is unidirec- far from uniform, does not show an exceptionally strong tional and random, yielding an equal population of plas- signal for just one or two sites. mids with only one fork traveling in either direction, can- To confirm that two replication forks are formed when not be ruled out. all the proteins are assembled close to oriC, the replication products were examined using a system de- Two DnaB Helicases Face Each Other at the Left veloped by Hiasa and Marians (1994) to analyze the Edge of oriC leading strands. This system makes use of a construct, The experiment of Figure 5 demonstrated that the RNA/ pBROTB, which contains the minimal oriC sequence DNA junctions on one strand are located within oriC, flanked on either side by a replication termination site and the junctions on the other strand lie outside, but terB (see diagram in Figure 5D). One terB site is 2896 near, the left boundary of oriC. Presumably DnaB initially bp from the right edge of oriC (DnaA box 4), and the assembles onto oriC in the vicinity of these initiation other is 1823 bp from the left edge of oriC (the L 13- sites. This region is about where the melted DNA of mer). In the presence of Tus protein, fork movement is the open complex resides, at which DnaB has been blocked at the terB site, limiting chain extension to either proposed to assemble (Baker et al., 1987; Funnell et al., 2 kb (leftward) or 3 kb (rightward). In Figure 5D, DnaB 1987; Bramhill and Kornberg, 1988). Footprint analysis was titrated into the pBROTB oriC replication assay, of DnaB at oriC is hampered by the mobile nature of and replication products were analyzed in an alkaline the DnaB helicase in the presence of ATP (ATP is re- agarose gel. The results show that both the 2 and 3 kb quired for DnaA and DnaC function). Hence, DnaBPK- fragments were produced equally throughout the DnaB K236A, which assembles at oriC but is inactive as a Molecular Cell 548

helicase, should remain stationary, thereby allowing that protection of ssDNA by DnaB is a simple explana- footprint analysis of DnaB at the origin. DnaB binds tion that is consistent with the known binding mode of ssDNA (Jezewska et al., 1996) and encircles it (Yuzhakov this enzyme on DNA. The location of one DnaB on each et al., 1996). We presume that DnaB encircles ssDNA strand is also consistent with the observed bidirectional at oriC, especially since DnaC does not remain at oriC replication using these same proteins and assay condi- to act as a protein bridge between DnaB and the DNA. tions (shown in Figure 5D). Control reactions not shown Therefore, the single-strand DNA modification reagent, here indicate that when either DnaBPKK236A or DnaC is potassium permanganate, was used in this footprinting added separately, the pattern of modification by KMnO4 study (DNase was tried as well). This reagent modifies is unaltered. We have also used the double-strand cleav- single-stranded T residues, which block Pol I, providing age agent, DNase I, in these studies, but the results a means of mapping them using 32P–end labeled primers were not informative as the oriC sequence is mostly and primer extension. protected (e.g., by DnaA) with or without addition of In Figure 6A, KMnO4 modification, and protection of DnaB/DnaC (data not shown). modification by DnaB, was examined to determine the Given the 5Ј-to-3Ј directionality of DnaB unwinding, location of DnaB at oriC. Initially, the entire oriC se- and the location of the two helicases indicated by the quence was analyzed, but Figure 6A focuses on the footprinting study, the DnaB hexamers are oriented leftmost region of oriC as all significant DnaB/DnaC- head to head (i.e., they face one another) and must pass mediated alterations occurred in and near the open one another during the initial unwinding of the origin. complex. A previous study of KMnO4 modification of These initial positions of the DnaB hexamers are sepa- oriC plasmid DNA in the presence of DnaA and 5 mM rated from the RNA/DNA junction sites mapped in Figure ATP indicated that two of the three 13-mers (R and M) 2 by at least 65 residues. Hence, the helicases move at became unwound (Gille and Messer, 1991), consistent least 65 nt, before the first priming event occurs. with the known region of oriC that is melted by DnaA The model in Figure 6B uses the dimensions of DnaB in the open complex (Bramhill and Kornberg, 1988). A from microscopic studies and a bubble size of 55 bp. similar result is observed in Figure 6A in which DnaA The model indicates that there is very little ssDNA avail- and HU are incubated with pUC18oriC in the absence able on the side of DnaB on which primase is expected of DnaB and DnaC (lane 1 for both upper [left panel] to function. Given these tight spatial constraints to pri- PK and lower [right panel] strands). The DnaB K236A and mase, it is not surprising that priming does not occur in DnaC were then added in increasing amounts (but at a the absence of helicase motion. constant ratio to each other) to the DnaA-induced open complex. The results demonstrate that addition of DnaC Discussion and DnaBPKK236A, besides enhancing activity of some residues, protects the R and M 13-mers of one strand Extent of Orisome Assembly in the Absence (the lower strand in Figure 6A), suggesting that at least of Helicase Action one DnaB hexamer may reside in this region. The strand The E. coli origin of replication, oriC, is bidirectional, opposite this sequence (upper strand in Figure 6A) be- and therefore, two replisomes assemble onto DNA and comes enhanced for reactivity with KMnO . This result 4 commence replication in opposite directions. Going into is consistent with DnaB encircling the lower strand, this study, it seemed possible that replisome assembly thereby protecting it, but enhancing reactivity of the would be tightly coupled to open complex formation at upper strand by increasing the percentage of time the the origin and that two replisomes may even assemble upper strand is single stranded at steady state. Although at the origin before the helicases start to move. Indeed, the outside strand is modified, we do not interpret this to mean that there is no contact of this strand with DnaB. this report shows that two hexamers of the DnaB heli- Rather, we suggest that any interaction of the outside case assemble onto the DnaA-activated origin in the strand with DnaB is insufficient to completely prevent absence of helicase motion (using an ATP site mutant). modification by this small chemical probe. In this regard, However, the study proceeds to demonstrate that in a DNase I footprinting study of SV40 T antigen on a the absence of helicase action, orisome assembly is synthetic bubble yielded similar results; the encircled blocked to further action. Primase does not function strand was well protected whereas the outside strand until after the helicases have moved. Lacking a primed was only weakly protected (Smelkova and Borowiec, site, DNA polymerase III holoenzyme cannot lock onto 1998). the DNA. However, only limited helicase movement, ap- The addition of DnaB and DnaC also appears to ex- proximately 100 nucleotides or less, is sufficient for pri- pand the open complex bubble as evidenced by new mase action and the assembly of two molecules of DNA polymerase III holoenzyme onto the DNA. The initial KMnO4 reactivity of the L 13-mer and AT-rich region on the lower strand. However, the upper strand opposite positions at which DnaB assembles onto oriC were iden- these new sites is not reactive, even though it contains tified by footprinting to be within the open complex several T residues. This result suggests that a DnaB region known to be melted by DnaA. Mapping of the hexamer may occupy this region encircling the upper RNA/DNA junctions at oriC supports the conclusion that strand, protecting it from modification, and that the op- helicase motion precedes priming, as the closest junc- posite strand, which is not located inside the DnaB ring, tion sites are at least 65 residues from the positions at is left as nearly unprotected single-strand DNA, ex- which DnaB assembles onto oriC. plaining its high degree of modification. Although there The results of this report indicate that events oc- are other possible explanations for these observations, curring directly at the origin are limited to helicase entry, such as kinks or other distortions of origin DNA, we feel and that replication forks assemble at a different time Replisome Assembly at oriC 549

and place, and thus can be considered a distinct stage of the replication process. Presumably, the product of the first stage, in which two helicases are present on the origin, must undergo some alteration before primase can function. Limited helicase motion catalyzes this alteration, allowing transit to the priming and replisome assembly stage. The fact that the first priming site junctions on each DNA strand of oriC are only 69 nucleotides apart suggests that the helicases need not travel too far for priming to occur. These studies also demonstrate that an ATP site mutant of DnaB assembles onto oriC, and therefore, DnaB does not need to hydrolyze ATP during the assembly process. However, DnaC is an ATP interacting protein, and its presence is required for DnaB assembly onto oriC (Funnell et al., 1987; Wahle et al., 1989). In studies not reported here, we find that an ATP site mutant of DnaC, while still capable of binding to DnaB, is inactive for assembly of DnaB at oriC (L. F. and M. O., unpub- lished data). Hence, ATP is required for DnaB assembly at oriC, but this ATP requirement is mediated through the action of DnaC. The present study shows that DnaC is not retained with DnaB at oriC, consistent with the inability to detect DnaC with DnaA and DnaB at oriC by electron microscopy (Funnell et al., 1987) and the finding that DnaC does not remain in the assembled primosome on the ssDNA genome of the ␸X174 phage (Kobori and Korn- berg, 1982; Ng and Marians, 1996). The absence of DnaC at oriC suggests that DnaB has been fully assembled around ssDNA at the origin rather than simply being held to the origin indirectly through the action of DnaC. DnaB has also been shown to interact with DnaA (Mars- zalek and Kaguni, 1994), but this interaction alone is insufficient to hold DnaB tightly to the origin since addition of DnaB to the oriC-containing plasmid in the pres- Figure 7. Stages in Assembly of Two Opposed Replication Forks at oriC ence of DnaA, but absence of DnaC, does not result in association of DnaB with oriC (data not shown). (A) Stages in replisome assembly. Stage I, two DnaB hexamers are assembled onto the DnaA-activated open complex through the This report demonstrates that helix destabilization of action of DnaC. Stage II, DnaB helicases pass each other creating oriC by DnaA/HU is sufficient for the assembly of two ssDNA for primase action. The passing action ensures that the re- DnaB hexamers. Prior to this study, it was equally possi- gion between the helicases is melted and remains so upon being ble that only one DnaB hexamer initially assembled onto coated with SSB. Primase must interact with DnaB to initiate RNA oriC, and that assembly of the second DnaB hexamer synthesis resulting in RNA primers in cis to DnaB. Stage III, two required the first DnaB to enlarge the region of ssDNA replicases assemble onto the two primed sites. Stage IV, the two molecules of Pol III holoenzyme extend DNA opposite the motion at oriC via its helicase activity, thereby making a bubble of DnaB assembled on the same strand. Hence, the polymerases of sufficient size for the second DnaB. pass one another to reach the DnaB helicases on the opposite strand, which move in the same direction as DNA polymerization. A Model of Replisome Assembly at oriC (B) The factory model for replication indicates that the polymerases This study indicates the stages in assembly of replica- remain fixed while the DNA moves. tion forks at an origin illustrated in Figure 7. In the first stage, two DnaB hexamers assemble at, and enlarge, the open complex (no helicase action needed). DnaC is ribonucleotides per origin, two ␤ clamps assemble on necessary for this stage but dissociates upon assembly the DNA, suggesting the presence of two RNA primers of DnaB onto DNA. Primase cannot act in stage I, possi- (e.g., each 10–12 nucleotides in length). We propose bly due to a general lack of available ssDNA behind the that these primers initiate the two opposed leading helicase where ssDNA exits the DnaB ring (i.e., primase strands (see below). In stage III, two ␤ clamps are assem- acts on ssDNA, requires interaction with DnaB for activ- bled onto the primed sites, and two molecules of Pol ity, and synthesizes RNA in the direction opposite DnaB III* assemble with them. Since there are two core poly- motion). In progressing to stage II, limited helicase mo- merases within one molecule of Pol III*, each ␤ clamp tion (or DNA motion through the helicases, explained must tether only one of the two core polymerases within below) provides the ssDNA template needed for primase Pol III* to DNA. to synthesize an RNA primer. The results of this study The direction of chain elongation by DNA polymerase indicate that upon incorporation of approximately 22 III holoenzyme is opposite that of DnaB. Therefore, once Molecular Cell 550

DNA polymerase III holoenzyme assembles onto an ini- Primase Hits a Moving Target as the Basis Underlying tiating RNA primer, it extends it in the direction opposite Initiation Site Heterogeneity the motion of the DnaB that is on the same strand as the Primase must interact with DnaB to synthesize a primer polymerase. In stage IV, DNA polymerase III eventually (Arai and Kornberg, 1979). Helicase motion is not re- catches up with the other DnaB that is on the opposite quired for primase to function with DnaB since the ATP strand, moving in the same direction as the polymerase. site mutant, DnaBPKK236A, supports primase activity in This encounter results in a replisome in which DNA poly- general priming on ssDNA. Nevertheless, DnaB motion merase III holoenzyme, located on the leading strand, is a requirement for primase action at oriC. A likely rea- couples to DnaB on the lagging strand (through the ␶ son that helicase must move for primase action is the subunit of DNA polymerase III holoenzyme; Kim et al., need to produce template for primase. The requirement 1996; Yuzhakov et al., 1996). The action of primase with that helicase unwind DNA for primase action at oriC DnaB produces the first lagging strand RNA primer pro- implies that primase must locate a moving target in order viding the substrate for assembly of another ␤ clamp to synthesize an RNA primer. The mobile nature of the and association of the second core of Pol III* with this substrate for primase explains why priming sites are not clamp (stage V, not shown). The resulting replisome is located in a single unique spot on each strand within now engaged on both leading and lagging strands. The the origin sequence but instead are located at one of actions described above for the assembly of one repli- several positions both inside and outside the origin some are mirrored at the fork advancing in the other boundaries. direction, resulting in bidirectional replication. The rate of DnaB helicase–catalyzed unwinding in the It is unlikely that the first core within the holoenzyme absence of DNA polymerase III holoenzyme is only about that associates with the ␤ clamp on the initiating primer 35 nucleotides per second and requires interaction with acts as the lagging strand polymerase. If this were the the ␶ subunit of DNA polymerase III holoenzyme for case, the leading strand would also need to be primed, efficient unwinding (800 nucleotides per second) (Kim and this action would require DnaB to switch strands et al., 1996). Hence, DnaB at the origin, prior to replisome two times, from the lagging strand to the leading strand assembly, would move slowly, increasing the probability for primase action, and then back to the lagging strand. that primase action will be localized near the origin. The ability of DnaB to switch strands once has been documented; however, this action required the assis- Generality of This Model to Eukaryotes and Phage ␭ tance of other proteins not present in this study (Allen Replication origins from prokaryotes to yeast, and sev- et al., 1993). eral mammalian viruses (HSV, EBV, SV40, and BPV), Study of Bacillus subtilis indicates that the several contain an origin recognition element (e.g., DnaA-bind- molecules of Pol III remain fixed at midcell during repli- ing sites of oriC) and a DNA-unwinding element (e.g., cation (Lemon and Grossman, 1998) and that the origin the 13-mer AT-rich region of oriC). Association of an moves from midcell to the poles (Webb et al., 1997). origin-binding protein with the origin recognition ele- This “factory model,” in which DNA moves through fixed ment produces a limited unwinding of the DNA unwind- replisomes, is illustrated for stages III and IV in Figure ing element. Presumably the replicative helicase(s) as- 7B. Here, the two DnaB hexamers form a fixed double sembles on the unwound DNA, possibly as a dual set hexamer that spools ssDNA out from between them. for bidirectional unwinding as illustrated herein for the The ssDNA loop grows from both directions. The first E. coli system. As noticed in several other replication RNA primer is extended around the loop to become the systems, the initiation sites on the two strands are het- leading strand (left diagram). Continued DNA unwinding generates the lagging strand (right diagram). erogeneous, being located in various positions inside and outside the origin. This study identifies the underly- Advantages of Two Helicases that Face and Pass ing basis for initiation site heterogeneity as a require- One Another ment that the DnaB helicases move for primase to func- The results of this study indicate that two DnaB hexam- tion. The need for primase to associate with a moving ers at oriC are positioned face to face, such that they target results in dispersal of the initiation sites in and pass one another as they translocate on ssDNA (Figure around the origin. The conservation in initiation mecha- 7). As the helicases move, duplex DNA is unwound, and nisms among a large variety of replication systems sug- SSB prevents the strands from reannealing. During the gests that the results of this study will generalize. proposed exchange of the replicases from one helicase to the other (stage IV), the region of DNA between the Experimental Procedures two helicases must be traversed without further assis- Materials and DNAs tance of helicase action. Helicases that pass one an- Radioactive nucleotides were from New England Nuclear; unlabeled other, as in Figure 7, will have already melted the region nucleotides, Pharmacia; DNA modification enzymes, New England between them, and the strands will remain separated Biolabs; DNA oligonucleotides, Oligos Etc. Protein concentrations by the action of SSB, allowing smooth transit of DNA were determined using the Bio-Rad Protein Assay kit with BSA as polymerase III holoenzyme from one side to the other. a standard. Reaction buffer is 40 mM HEPES-NaOH (pH 7.4), 10 mM However, if the two helicases had assembled on the MgCl2, 5 mM DTT, 100 ␮g of BSA/ml; sonication buffer is 20 mM origin back to back, the section of DNA between them Tris–HCl (pH 8.0), 100 mM NaCl; ATP binding buffer is 50 mM Tris– HCl (pH 7.9), 5 mM MgCl , 10% glycerol, and 20 mM NaCl; buffer may contain unmelted duplex DNA. In this event, DNA 2 A is 25 mM HEPES-NaOH (pH 7.4), 1 mM EDTA, 2 mM DTT, 15% polymerase III holoenzyme, which is poor at strand dis- glycerol; buffer B is 50 mM Tris–HCl (pH 7.5), 1 mM EDTA, 1 mM placement, would need to melt this region without assis- DTT, 10% glycerol; and buffer C is 20 mM Tris–HCl (pH 7.5), 0.1 tance from DnaB. mM EDTA, 5 mM DTT, 5 mM MgCl2, 10% glycerol. Replisome Assembly at oriC 551

M13mp18 ssDNA was phenol extracted from phage that were Mapping Initiation Sites of Bidirectional DNA Replication twice banded in CeCl density gradients as described (Turner and Replication of the pUC18oriC plasmid was allowed to proceed for O’Donnell, 1995). A pUC-derived plasmid containing the oriC se- 30 min at 37ЊC described above (using primase at 0–240 nM using quence, pUC18oriC (3132 bp), was constructed upon inserting the unlabeled nucleotides). DNA was purified by phenol/chloroform ex- SmaI/XhoI restriction fragment (465 bp) containing oriC from traction in the presence of 0.5% (w/v) SDS and 20 mM EDTA, fol- M13oriC26 RF (Kaguni et al., 1982) into the SmaI/SalI restriction lowed by filtration on a Sephadex G25 spin column and ethanol sites of pUC18. precipitation using 10 ␮g yeast tRNA as carrier. Primer extension was performed using DNA polymerase I Klenow fragment as de- DnaB ATP-Binding Site Mutants scribed previously (Frappier and O’Donnell, 1992) using as primers The DnaB expression plasmid, pHK-dnaB, which encodes DnaB either 5Ј-d[GATCCTTTCCAGGTTGTTG]-3Ј to anneal to newly syn- with a 23-residue N-terminal leader consisting of a cAMP-dependent thesized top strand DNA or 5Ј-d[GTCGGCTTGAGAAAGACCTG]-3Ј protein kinase motif and a six-residue His tag (Yuzhakov et al., 1996), to anneal to newly synthesized bottom strand DNA chains. Anneal- was modified at the ATP-binding site using oligonucleotide-directed ing to unreplicated starting template simply produces very long mutagenesis using the PCR-based overlap extension technique. primer extension products that migrate very high in the sequencing The Lys-236 codon was replaced with a codon encoding either gel (see control lane in Figure 5). Primer extension was stopped Arg or Ala to yield either DnaBPKK236R or DnaBPKK236A. Sequence upon addition of formamide and dye, and the samples were analyzed analysis of the PCR-produced expression plasmids confirmed that by electrophoresis through a 6% (w/v) polyacrylamide 50% urea only the desired mutations were introduced into the dnaB gene. gel. The gel was dried and exposed to either Phosphor storage screens (Molecular Dynamics) or to Kodak BioMax film. Proteins Subunits of DNA polymerase III holoenzyme were purified as pre- Assembly of DnaB onto ssDNA viously described (Yuzhakov et al., 1996). Pol III* (the holoenzyme Reactions contained 5 mM ATP, 2.2 pmol (as hexamer) of either lacking only ␤) was reconstituted from pure subunits and purified 32P-labeled DnaBPK or DnaBPKK236A, 280 pmol of M13mp18 ssDNA, from excess unassembled subunits (Yuzhakov et al., 1996). The and 10 pmol of DnaC (where added) in 100 ␮l of reaction buffer. following replication proteins were purified as described previously: After 10 min at 37ЊC, samples were analyzed by gel filtration through DnaA, gyrase AB (Fang, 1999), HU (Parada and Marians, 1991), 5 ml BioGel A-15m columns. DnaB, primase, SSB, DnaBPK, DnaBPKK236R, and DnaBPKK236A 3 3 3 (Yuzhakov et al., 1996). H-␪, H-␤, and H-DnaC were prepared by Assembly of DnaB onto oriC reductive methylation of the purified proteins (Yuzhakov et al., 1996). Reactions contained 4.4 pmol of (as hexamer) 32P-labeled DnaBPK- 3 3 Their specific activities were: H-␪, 15 cpm/fmol; H-␤, 67 cpm/fmol; K236A, 15 pmol of 3H-DnaC, 88 pmol of SSB, 18.4 pmol of DnaA, 3 3 and H-DnaC, 50 cpm/fmol. The H-labeled proteins retained at least 3.6 pmol of HU, and 252 fmol of either pUC18oriC or pUC18 in 100 90% activity in replication assays as compared to their unlabeled ␮l of reaction buffer containing 5 mM ATP. After 30 min incubation 3 3 counterparts. H-core was reconstituted from ␣, ⑀, and H-␪ and at 37ЊC, and a 30 min spin in a tabletop centrifuge at 4ЊC, reactions then was purified from excess unassembled subunits as described were analyzed by gel filtration through 5 ml BioGel A-15m columns (Stukenberg and O’Donnell, 1995); the specific activity was 15 cpm/ equilibrated with buffer C containing 100 mM NaCl at 25ЊC. fmol. PrimasePK contained the same terminal leader as DnaBPK. Pri- masePK and DnaBPK phosphorylated as previously described (Yuzha- kov et al., 1996). ATP Binding Assays Quantitative ATP binding assays were performed using nitrocellu- lose membrane circles (25 mm) as previously described (Hingorani Stoichiometry of Proteins at oriC and O’Donnell, 1998). The reactions contained a constant amount Five parallel experiments were performed that differed only in which of DnaB protein (2 ␮M) and increasing concentrations of [␣-32P]ATP radioactive protein (32P-DnaB, 3H-DnaC, 3H-Pol III*, 32P-primasePK, (0–120 ␮M) in a total volume of 15 ␮l of ATP binding buffer. or 3H-␤) was substituted for its unlabeled counterpart. Reactions contained 252 fmol of either pUC18oriC or pUC18, 88 pmol of SSB, 18 pmol of DnaA, 4.4 pmol of (as hexamer) DnaB, 20 pmol of DnaC, ATP Hydrolysis Activity 12 pmol of DnaG, 3.6 pmol of HU, 2 pmol of (as dimer) ␤, 1.5 pmol ATPase assays were performed in 25 ␮l of reaction buffer containing of Pol III*, 5 mM ATP, 0.5 mM each GTP, CTP, and UTP, 5 mM 5mM[␥-32P]ATP (3–6 ϫ 106 cpm) and 165 ng of M13mp18 ssDNA. creatine phosphate, and 2 ␮g of creatine kinase in 100 ␮l reaction DnaB (2 ␮g) was added to reactions on ice, then shifted to 37ЊC. buffer. After 30 min at 37ЊC, reactions were placed in a tabletop At the indicated times, aliquots of 3 ␮l were removed and quenched centrifuge for 30 min at 4ЊC to remove any proteins that had formed upon adding 3 ␮l of 40 mM EDTA and 1% SDS. Quenched reactions an aggregate, and then the reactions were analyzed by gel filtration were spotted (0.5 ␮l) onto a thin layer chromatography sheet coated on 5 ml BioGel A-15m columns equilibrated with buffer C containing with polyethyleneimine (PEI-Cellulose F, EM Science) and devel- 100 mM NaCl at 25ЊC. Fractions of 200 ␮l were collected, and 150 oped in 0.6 M potassium phosphate (pH 3.4). Free phosphate at ␮l of each fraction was analyzed in a liquid scintillation counter the solvent front and ATP at the origin were quantitated using a (Wallac). A parallel experiment using tritium-labeled plasmid and phosphorimager and the ImageQuant software (Molecular Dy- unlabeled proteins indicated a recovery of DNA of approximately namics). 90%. The amount of protein bound to oriC was calculated by de- termining the area under the peak, which was normalized to the DNA Oligonucleotide Displacement Activity amount of protein loaded on the column. Values of protein bound A partial duplex M13mp18 substrate was prepared upon annealing to DNA are not corrected for DNA recovery, nor are results obtained 30 pmol of a 5Ј-end 32P-labeled 30-mer oligonucleotide (complemen- using pUC18 subtracted from results using pUC18oriC. tary to map position 6817–6846) to 5 pmol of M13mp18 circular ssDNA in a total volume of 70 ␮l as described (Studwell and O’Don- oriC Replication Assays nell, 1990). The annealed mixture was gel filtered through a 5 ml Replication assays contained either 60 fmol of pUC18oriC or BioGel A-15m column equilibrated with 10 mM Tris–HCl (pH 7.5), 1 pBROTB, 22 pmol of SSB, 4.6 pmol of DnaA, 1.1 pmol of (as hexamer) mM EDTA, and 100 mM NaCl to separate the partial duplex (in the DnaB, 5 pmol of DnaC, 3 pmol of DnaG, 0.9 pmol of HU, 0.5 pmol void fraction) from unhybridized oligonucleotide (in the included of gyrase, 0.5 pmol of (as dimer) ␤, 370 fmol of Pol III*, 5 mM ATP, fractions). Helicase reactions were performed as described pre- 0.5 mM each GTP, CTP, and UTP, 40 ␮M each dATP, dGTP, and viously (Shrimankar et al., 1992) with the following modifications: dCTP, 40 ␮M[␣-32P]TTP (3000–6000 cpm/pmol), 5 mM creatine reactions contained approximately 40 fmol of substrate in 25 ␮lof phosphate, and 0.5 ␮g of creatine kinase in 25 ␮l of reaction buffer. reaction buffer containing 5 mM ATP; amounts of DnaB are indicated Additions were performed on ice and then shifted to 37ЊC for 30 in the figure legends. Reactions were incubated 10 min at 37ЊC, then min (unless otherwise noted). Replication products were quantitated quenched with 0.2% SDS and 20 mM EDTA (final concentration), and by spotting onto DE81 filters as described (Yuzhakov et al., 1996). analyzed on a 15% polyacrylamide gel in Tris borate buffer at room Molecular Cell 552

temperature. Results were visualized using a phosphorimager and Chen, D., Feng, J., Kruger, R., Urh, M., Inman, R.B., and Filutowicz, quantitated using ImageQuant software (Molecular Dynamics). M. (1998). Replication of R6K ␥ origin in vitro discrete start sites for DNA synthesis dependent of Pi and its copy-up variants. J. Mol. General Priming Assays Biol. 282, 775–787. Reactions contained 70 fmol M13mp18 ssDNA, 3 pmol primase, 2 Fang, L. (1999). Ph.D. thesis, Weill Graduate School of Medical Sci- pmol DnaB (wild-type or mutant, as indicated) in 25 ␮l of reaction ences of Cornell University, New York, NY. buffer containing 1 mM ATP and 10 ␮M each GTP, CTP, and [␣- Frappier, F., and O’Donnell, M. (1992). EBNA1 distorts oriP, the 32 P]UTP (3000–6000 cpm/pmol). Reactions were incubated at 37ЊC, Epstein-Barr virus latent replication origin. J. Virol. 66, 1786–1790. and 4 ␮l aliquots were quenched with 4 ␮l of 40 mM EDTA and 1% Fuller, R.S., Funnell, B.E., and Kornberg, A. (1984). The DnaA protein SDS after 0, 5, 10, 15, 20, and 30 min. RNA synthesis was quantitated complex with the E. coli chromosomal origin (oriC) and other sites. using DE81 filters as described (Yuzhakov et al., 1996). Cell 38, 889–900. Funnell, B.E., Baker, T.A., and Kornberg, A. (1987). In vitro assembly KMnO Modification 4 of a prepriming complex at the origin of the Escherichia coli chromo- Reactions contained 240 fmol of pUC18oriC and 5 mM ATP in 25 some. J. Biol. Chem. 262, 10327–10334. ␮l of reaction buffer lacking DTT. The indicated amounts of DnaA, DnaB, and/or DnaC were added, and reactions were incubated 30 Gille, H., and Messer, W. (1991). Localized DNA melting and structural perturbations in the origin of replication, oriC,ofEscherichia min at 37ЊC. KMnO4 was then added to 40 mM, and after a further 4 min at 37ЊC, the reaction was quenched with 1.3 M 2-mercaptoeth- coli in vitro and in vivo. EMBO J. 10, 1579–1584. anol. DNA was purified by phenol-chloroform extraction in the pres- Gillette, T.G., Lusky, M., and Borowiec, J.A. (1994). Induction of ence of 0.5% (w/v) SDS and 20 mM EDTA, then it was passed structural changes in the bovine papillomavirus type 1 origin of through a Sephadex G25 spin column in water followed by ethanol replication by the viral E1 and E2 proteins. Proc. Natl. Acad. Sci. precipitation using 10 ␮g yeast tRNA as carrier. Primer extension USA 91, 8846–8850. was performed as described above. Hay, R.T., and DePamphilis, M.L. (1982). Initiation of SV40 DNA replication in vivo: location and structure of 5Ј ends of DNA synthe- RNA Synthesis at oriC sized in the ori region. Cell 28, 767–779. The amount of RNA synthesized at oriC by primase was performed Hiasa, H., and Marians, K.J. (1994). Primase couples leading- and in 25 ␮l reactions containing 60 of fmol pUC18oriC as DNA template, lagging-strand DNA synthesis from oriC. J. Biol. Chem. 269, 6058– 22 of pmol SSB, 4.6 pmol of DnaA, 1.1 pmol of (as hexamer) DnaB, 6063. 5 pmol of DnaC, 3 pmol of DnaG, 0.9 pmol of HU protein, 1 mM Hiasa, H., Yousef, D.O., and Marians, K.J. (1996). DNA strand cleav- ATP, and 10 ␮M each GTP, CTP, and 32P-UTP (3000–6000 cpm/ age is required for replication fork arrest by a frozen topoisomerase- pmol) in reaction buffer. Reactions were incubated at 37ЊC, and quinolone-DNA ternary complex. J. Biol. Chem. 271, 26424–26429. aliquots of 4 ␮l were removed and quenched with 4 ␮lof40mM EDTA and 1% SDS at 0 (before 37ЊC incubation), 5, 10, 15, 20, and Hingorani, M.M., and O’Donnell, M. (1998). ATP binding to the Esche- 30 min of incubation at 37ЊC. RNA synthesis was quantitated upon richia coli clamp loader powers opening of the ring-shaped clamp spotting the reaction onto DE81 filters as described (Yuzhakov et of DNA polymerase III holoenzyme. J. Biol. Chem. 273, 24550–24563. al., 1996). Hirose, S., Hiraga, S., and Okazaki, T. (1983). Initiation site of deoxyri- bonucleotide polymerization at the replication origin of the Esche- Acknowledgments richia coli chromosome. Mol. Gen. Genet. 189, 422–431. Hwang, D.S., and Kornberg, A. (1992). Opening of the replication The authors are grateful to Dr. Kenneth J. Marians and Dr. Hiroshi origin of Escherichia coli by DnaA protein with HU or IHF. J. Biol. Hiasa for providing the pBROTB plasmid and Tus protein used in Chem. 267, 23083–23086. testing proper bidirectional DNA replication. This work was sup- Jezewska, M.J., Kim, U.S., and Bujalowski, W. (1996). Binding of ported by a grant from the National Institutes of Health (GM38839). Escherichia coli primary replicative helicase DnaB protein to single- stranded DNA. Long-range allosteric conformational changes within Received June 16, 1999; revised August 13, 1999. the protein hexamer. Biochemistry 36, 10320–10326. Kaguni, J.M., Fuller, R.S., and Kornberg, A. (1982). Enzymatic repli- References cation of E. coli chromosomal origin is bidirectional. Nature 296, 623–627. Allen, G.C., Dixon, N.E., and Kornberg, A. (1993). Strand switching Kelman, Z., and O’Donnell, M. (1995). DNA polymerase III holoen- of a replicative helicase promoted by the E. coli primosome. Cell zyme: structure and function of a chromosomal replicating machine. 74, 713–722. Annu. Rev. Biochem. 64, 171–200. Arai, K.-I., and Kornberg, A. (1979). A general priming system em- Kim, S., Dallmann, H.G., McHenry, C.S., and Marians, K.J. (1996). ploying only DnaB protein and primase for DNA replication. Proc. Coupling of a replicative polymerase and helicase: a tau-DnaB inter- Natl. Acad. Sci. USA 76, 4308–4312. action mediates rapid replication fork movement. Cell 84, 643–650. Baker, T.A., Funnell, B.E., and Kornberg, A. (1987). Helicase action Kitani, T., Yoda, K.-Y., Ogawa, T., and Okazaki, T. (1985). Evidence of DnaB protein during replication from the Escherichia coli chromo- that discontinuous DNA replication in Escherichia coli is primed by somal origin in vitro. J. Biol. Chem. 262, 6877–6885. approximately 10 to 12 residues of RNA starting with a purine. J. Bernander, R., Krabbe, M., and Nordstrom, K. (1992). Mapping of Mol. Biol. 184, 45–52. the in vivo start site for leading strand DNA synthesis in plasmid Kobori, J.A., and Kornberg, A. (1982). The Escherichia coli DnaC R1. EMBO J. 11, 4481–4487. product. II. Purification, physical properties, and role in replication. Bielinsky, A.-K., and Gerbi, S.A. (1998). Discrete start sites for DNA J. Biol. Chem. 257, 13763–13769. synthesis in the yeast ARS1 origin. Science 279, 95–98. Kohara, Y., Tohdoh, N., Jiang, X.-W., and Okazaki, T. (1985). The Borowiec, J.A., Dean, F.B., Bullock, P.A., and Hurwitz, J. (1990). distribution and properties of RNA primed initiation sites of DNA Binding and unwinding—how T antigen engages the SV40 origin of synthesis as the replication origin of Escherichia coli chromosome. DNA replication. Cell 60, 181–184. Nucleic Acids Res. 13, 6847–6866. Bramhill, D., and Kornberg, A. (1988). Duplex opening by DnaA pro- Konieczny, I., Doran, K.S., Helinski, D.R., and Blasina, A., (1997). tein at novel sequence in initiation of replication at the origin of the Role of TrfA and DnaA proteins in origin opening during initiation E. coli chromosome. Cell 52, 743–755. of DNA replication of the broad host range plasmid RK2. J. Biol. Bullock, P.A., and Denis, D. (1995). DNA synthesis generally initiates Chem. 272, 20173–20178. outside the simian virus 40 core origin in vitro. Mol. Cell. Biol. 15, Kornberg, A., and Baker, T.A. (1992). DNA Replication, Second Edi- 173–178. tion (New York: W.H. Freeman and Co.). Replisome Assembly at oriC 553

Lee, S.S.-K., and Lehman, I.R. (1997). Unwinding of the box I element of a herpes simplex virus type 1 origin by a complex of the viral origin binding protein, single-strand DNA binding protein, and single-stranded DNA. Proc. Natl. Acad. Sci. USA 94, 2838–2842. Lemon, K.P., and Grossman, A.D. (1998). Localization of bacterial DNA polymerase: evidence for a factory model of replication. Sci- ence 282, 1516–1519. Marians, K.J. (1992). Prokaryotic DNA replication. Annu. Rev. Bio- chem. 61, 673–719. Marszalek, J., and Kaguni, J.M. (1994). DnaA protein directs the binding of DnaB protein in initiation of DNA replication in Escherichia coli. J. Biol. Chem. 269, 4883–4890. Mukherjee, S., Patel, I., and Bastia, D., (1985). Conformational changes in a replication origin induced by an initiator protein. Cell 43, 189–197. Mukhopadhyay, G., and Chattoraj, D.K. (1993). Conformation of the origin of P1 plasmid replication: initiator protein induced wrapping and intrinsic unstacking. J. Mol. Biol. 231, 19–28. Ng, J.Y., and Marians, K.J. (1996). The ordered assembly of the ␪X174-type primosome. I. Isolation and identification of intermediate protein-DNA complexes. J. Biol. Chem. 271, 15642–15648. Parada, C.A., and Marians, K.J. (1991). Mechanism of DnaA protein- dependent pBR322 DNA replication. DnaA protein mediated trans- strand loading of the DnaB protein at the origin of pBR322 DNA replication. Biol. Chem. 266, 18895–18906. San Martin, M.D., Stamford, N.P.J., Dammerova, N., Dixon, N.E., and Carazo, J.M. (1995). A structural model for the Escherichia coli DnaB helicase based on electron microscopy data. J. Struct. Biol. 114, 167–176. Schnos, M., Zahn, K., Inman, R.B., and Blattner, F.R. (1988). Initiation protein induced helix destabilization at the origin: a prepriming step in DNA replication. Cell 52, 385–395. Shrimankar, P., Stordal, L., and Maurer, R. (1992). Purification and characterization of a mutant DnaB protein specifically defective in ATP hydrolysis. J. Bacteriol. 174, 7689–7696. Smelkova, N.V., and Borowiec, J.A. (1998). Synthetic DNA replication bubbles bound and unwound with twofold symmetry by a simian virus 40 T-antigen double hexamer. J. Virol. 72, 8676–8681. Studwell, P.S., and O’Donnell, M. (1990). Processive replication is contingent on exonuclease subunit of DNA polymerase subunit of DNA polymerase III holoenzyme. J. Biol. Chem. 265, 1175–1178. Stukenberg, P.T., and O’Donnell, M. (1995). Assembly of a chromosomal replication machine: two DNA polymerases, a clamp loader, and a sliding clamp in one holoenzyme particle. V. Four different polymerase-clamp complexes on DNA. J. Biol. Chem. 270, 13384– 13391. Tsurimoto, T., and Matsubara, K. (1984). Multiple initiation sites of DNA replication flanking the origin region of ␭dv genome. Proc. Natl. Acad. Sci. USA 81, 7402–7406. Turner, J., and O’Donnell, M. (1995). Cycling of E. coli DNA polymerase III from one sliding clamp to another: model for the lagging strand. Methods Enzymol. 262, 442–449. Wahle, E., Lasken, R.S., and Kornberg, A. (1989). The DnaB-DnaC replication protein complex of Escherichia coli. II. Role of the complex in mobilizing DnaB functions. J. Biol. Chem. 264, 2469–2475. Webb, C.D., Teleman, A., Gordon, S., Straight, A., Belmont, A., Lin, D.C.-H., Grossman, A.D., Wright, A., and Losick, R. (1997). Bipolar localization of the replication origin regions of chromosomes in veg- etative and sporulating cells of B. subtilis. Cell 88, 667–674. Yoda, K.-Y., Yasuda, H., Jiang, X.-W., and Okazaki, T. (1988). RNA- primed initiation sites of DNA replication in the origin region of bacteriophage ␭ genome. Nucleic Acids Res. 16, 6531–6546. Yu, X., Jezewska, M.J., Bujalowski, W., and Egelman, E.H. (1996). The hexameric E. coli DnaB helicase can exist in different quaternary states. J. Mol. Biol. 259, 7–14. Yuzhakov, A., Turner, J., and O’Donnell, M. (1996). Replisome assembly reveals the basis for asymmetric function in leading and lagging strand replication. Cell 86, 877–886.