Kinetic Analysis of Genomewide Gene Expression Reveals Molecule Circuitries That Control T Cell Activation and Th1͞2 Differentiation
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
(12) Patent Application Publication (10) Pub. No.: US 2012/0070450 A1 Ishikawa Et Al
US 20120070450A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0070450 A1 Ishikawa et al. (43) Pub. Date: Mar. 22, 2012 (54) LEUKEMA STEM CELLMARKERS Publication Classification (51) Int. Cl. A 6LX 39/395 (2006.01) (75) Inventors: Fumihiko Ishikawa, Kanagawa CI2O I/68 (2006.01) (JP): Osamu Ohara, Kanagawa GOIN 2L/64 (2006.01) (JP); Yoriko Saito, Kanagawa (JP); A6IP35/02 (2006.01) Hiroshi Kitamura, Kanagawa (JP); C40B 30/04 (2006.01) Atsushi Hijikata, Kanagawa (JP); A63L/7088 (2006.01) Hidetoshi Ozawa, Kanagawa (JP); C07K 6/8 (2006.01) Leonard D. Shultz, Bar Harbor, C7H 2L/00 (2006.01) A6II 35/12 (2006.01) ME (US) CI2N 5/078 (2010.01) (52) U.S. Cl. .................. 424/173.1; 424/178.1; 424/93.7: (73) Assignee: RIKEN, Wako-shi (JP) 435/6.14; 435/723; 435/375; 506/9: 514/44 A: 530/389.6; 530/391.7:536/24.5 (57) ABSTRACT (21) Appl. No.: 13/258,993 The invention provides a test method for predicting the initial onset or a recurrence of acute myeloid leukemia (AML) com PCT Fled: prising (1) measuring the expression level of human leukemic (22) Mar. 24, 2010 stem cell (LSC) marker genes in a biological sample collected from a Subject for a transcription product or translation prod uct of the gene as an analyte and (2) comparing the expression (86) PCT NO.: PCT/UP2010/0551.31 level with a reference value; an LSC-targeting therapeutic agent for AML capable of Suppressing the expression of a S371 (c)(1), gene selected from among LSC marker genes or a Substance (2), (4) Date: Dec. -
1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins ............................................................................................................. -
Iron Depletion Reduces Abce1 Transcripts While Inducing The
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 22 October 2019 doi:10.20944/preprints201910.0252.v1 1 Research Article 2 Iron depletion Reduces Abce1 Transcripts While 3 Inducing the Mitophagy Factors Pink1 and Parkin 4 Jana Key 1,2, Nesli Ece Sen 1, Aleksandar Arsovic 1, Stella Krämer 1, Robert Hülse 1, Suzana 5 Gispert-Sanchez 1 and Georg Auburger 1,* 6 1 Experimental Neurology, Goethe University Medical School, 60590 Frankfurt am Main; 7 2 Faculty of Biosciences, Goethe-University Frankfurt am Main, Germany 8 * Correspondence: [email protected] 9 10 Abstract: Lifespan extension was recently achieved in Caenorhabditis elegans nematodes by 11 mitochondrial stress and mitophagy, triggered via iron depletion. Conversely in man, deficient 12 mitophagy due to Pink1/Parkin mutations triggers iron accumulation in patient brain and limits 13 survival. We now aimed to identify murine fibroblast factors, which adapt their mRNA expression 14 to acute iron manipulation, relate to mitochondrial dysfunction and may influence survival. After 15 iron depletion, expression of the plasma membrane receptor Tfrc with its activator Ireb2, the 16 mitochondrial membrane transporter Abcb10, the heme-release factor Pgrmc1, the heme- 17 degradation enzyme Hmox1, the heme-binding cholesterol metabolizer Cyp46a1, as well as the 18 mitophagy regulators Pink1 and Parkin showed a negative correlation to iron levels. After iron 19 overload, these factors did not change expression. Conversely, a positive correlation of mRNA levels 20 with both conditions of iron availability was observed for the endosomal factors Slc11a2 and Steap2, 21 as well as for the iron-sulfur-cluster (ISC)-containing factors Ppat, Bdh2 and Nthl1. -
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Farnesol-Induced Apoptosis in Human Lung Carcinoma Cells Is Coupled to the Endoplasmic Reticulum Stress Response
Research Article Farnesol-Induced Apoptosis in Human Lung Carcinoma Cells Is Coupled to the Endoplasmic Reticulum Stress Response Joung Hyuck Joo,1 Grace Liao,1 Jennifer B. Collins,2 Sherry F. Grissom,2 and Anton M. Jetten1 1Cell Biology Section, LRB, and 2Microarray Group, Division of Intramural Research, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, North Carolina Abstract range of fruits and vegetables (9, 10). Each isoprenoid has been Farnesol (FOH) and other isoprenoid alcohols induce apopto- shown to inhibit proliferation and induce apoptosis in a number of sis in various carcinoma cells and inhibit tumorigenesis in neoplastic cell lines from different origins (4, 11–14). In addition, in vivo these isoprenoids have been reported to be effective in chemo- several models. However, the mechanisms by which in vivo they mediate their effects are not yet fully understood. In this prevention and chemotherapy in various cancer models study, we show that FOH is an effective inducer of apoptosis in (10, 12, 15, 16). FOH has been reported to exhibit chemopreventive several lung carcinoma cells, including H460. This induction is effects in colon and pancreas carcinogenesis in rats (9, 17) whereas associated with activation of several caspases and cleavage of phase I and II clinical trials have indicated therapeutic potential poly(ADP-ribose) polymerase (PARP). To obtain insight into for POH (16, 18). The mechanisms by which these isoprenoids induce these effects are not yet fully understood. Isoprenoids have the mechanism involved in FOH-induced apoptosis, we compared the gene expression profiles of FOH-treated and been reported to inhibit posttranslational protein prenylation (19) control H460 cells by microarray analysis. -
Supplementary Text and Figures.Pdf
Supplemental Figure S2. PRIM1 immunoblots (20-75 kDa). (A) Corresponds to Figure 2D, with additional bands seen in P2 at 75 kDa and 25 kDa. (B) Independent experiment with cell lysates from C and P2 in which additional bands at 25 kDa not evident. (C) Corresponds to Figure 2D. No additional band visible at 25 kDa. (D) Validation of monoclonal antibody (8G10) with siRNA to PRIM1 in HeLa cells. siLUC, luciferase negative control. siPRIM1, siRNA targeting PRIM1 transcript. Vinculin used as a loading control. Supplemental Figure S3: Predicted destabilisation of PRIM1 by the C301R substitution. (A) Cysteine 301 lies in a buried hydrophobic region in PRIM1. DNA primase dimer crystal structure (PDB: 4BPU). PRIM1 residues shaded according to solvent accessibility. Cysteine 301, substituted to arginine in P5, lies in a buried hydrophobic region. (B) Cys301 is evolutionarily conserved in vertebrates. Neither arginine or other large or charged amino acids are observed at this position in other species. (C) The C301R substitution observed in P5 is predicted to lead to destabilisation of all available PRIM1 crystal structures. In contrast, substitution with leucine or threonine, as observed in some orthologous proteins, is not predicted to lead to destabilisation. Data points, predicted changes in free-energy (ΔΔG) from FoldX plotted for each of 14 available crystal structures. (D) Immunoblotting of RPE1 cells transfected with dual reporter constructs (as described in Figure 3B and Materials and Methods) confirms production of PRIM1-GFP and FLAG-SR at expected molecular weights and shows reduced protein levels for the C301R variant. n=2 experiments shown. C301R protein levels relative to WT after normalization to actin loading control indicated underneath the blot.