DOCSLIB.ORG

Bromination of Deoxycytidine by Eosinophil Peroxidase: a Mechanism for Mutagenesis by Oxidative Damage of Nucleotide Precursors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bromination of Deoxycytidine by Eosinophil Peroxidase: a Mechanism for Mutagenesis by Oxidative Damage of Nucleotide Precursors Bromination of deoxycytidine by eosinophil peroxidase: A mechanism for mutagenesis by oxidative damage of nucleotide precursors Jeffrey P. Henderson*, Jaeman Byun*, Michelle V. Williams*, Michael L. McCormick†, William C. Parks‡, Lisa A. Ridnour§, and Jay W. Heinecke*¶ʈ *Departments of Medicine, ‡Pediatrics, §Radiology, and ¶Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, MO 63110; and †Research Service, Veterans Administration Medical Center and Department of Internal Medicine, University of Iowa, Iowa City, IA 52241 Edited by Bernard M. Babior, The Scripps Research Institute, La Jolla, CA, and approved December 19, 2000 (received for review April 3, 2000) Oxidants generated by eosinophils during chronic inflammation eggs of which trigger an intense eosinophilic granulomatous may lead to mutagenesis in adjacent epithelial cells. Eosinophil reaction. Many lines of evidence implicate Schistosoma, which is peroxidase, a heme enzyme released by eosinophils, generates distributed widely in Africa, the Middle East, and Asia in the hypobromous acid that damages tissue in inflammatory condi- genesis of bladder cancer, liver cancer, and colon cancer (21). tions. We show that human eosinophils use eosinophil peroxidase Thus, oxidants generated by eosinophils during a chronic in- to produce 5-bromodeoxycytidine. Flow cytometric, immunohisto- flammatory response may lead to mutagenesis in adjacent chemical, and mass spectrometric analyses all demonstrated that epithelial cells. 5-bromodeoxycytidine generated by eosinophil peroxidase was Oxidative damage of DNA has been implicated in carcino- taken up by cultured cells and incorporated into genomic DNA as genesis (2, 3, 6, 22, 23). In vitro studies have identified numerous 5-bromodeoxyuridine. Although previous studies have focused on modified nucleic acids as products of phagocytic oxidative reactions. For example, activated phagocytes generate the mu- oxidation of chromosomal DNA, our observations suggest another tagenic nucleobase 8-oxoguanine by pathways that may involve mechanism for oxidative damage of DNA. In this scenario, perox- hydroxyl radical or singlet oxygen (24). Nitric oxide, or its idase-catalyzed halogenation of nucleotide precursors yields prod- degradation products, deaminate nucleobases in vitro and en- ucts that subsequently can be incorporated into DNA. Because the hance mutagenesis in cultured cells (25, 26). Human neutrophils thymine analog 5-BrUra mispairs with guanine in DNA, generation produce 8-nitrodeoxyguanosine by a pathway involving myelo- of brominated pyrimidines by eosinophils might constitute a mech- peroxidase, nitrite, and H2O2 (27). Moreover, we showed re- anism for cytotoxicity and mutagenesis at sites of inflammation. cently that myeloperoxidase will also convert deoxycytidine (dC) to 5-chlorodeoxycytidine (28). nder normal conditions, eosinophils are a minor component Most studies have focused on oxidative damage of chromo- Uof circulating phagocytic white blood cells. However, they somal DNA, but we reasoned that potentially mutagenic adducts become much more abundant in blood and tissues in a variety of might be generated in the abundant cellular pools of ribo- and inflammatory disorders, including chronic allergic conditions, deoxyribonucleoside precursors. In the current studies, we used deoxynucleosides to determine whether the brominating inter- helminthic infections, and cancer (1). Moreover, eosinophils are mediates generated by eosinophil peroxidase can modify nucleic implicated in tissue damage associated with asthma, dermatitis, acid bases. Through MS and NMR spectroscopy, we identified vasculitis, and the hypereosinophilia syndromes. These granu- 5-bromodeoxycytidine (BrdC) as a product at physiologically locytes also may play important roles in host defenses against plausible BrϪ and ClϪ concentrations. Activated eosinophils microbial parasites and tumor cells. One potential mechanism of generated BrdC in a reaction that was inhibited by catalase, eosinophil-mediated damage and defense involves their produc- implicating a peroxidase in the cellular pathway. Cultured cells CELL BIOLOGY tion of oxidizing intermediates. incorporated the BrdC into genomic DNA as BrdUrd, a well Chronic inflammation is associated with an increased risk of established mutagen. Our observations indicate that brominat- cancer, raising the possibility that reactive intermediates gener- ing intermediates generated by eosinophil peroxidase represent ated by eosinophils, neutrophils, monocytes, and macrophages one potential pathway for modifying nucleic acids at sites of might damage nucleic acids and compromise the integrity of the inflammation in vivo. They also suggest a mechanism for the genome (2–6). Activated eosinophils generate such intermedi- oxidative damage of DNA by phagocytes. In this scenario, ates by first producing superoxide using a membrane-associated reactive species halogenate nucleotides and nucleotide precur- NADPH oxidase (7, 8). Superoxide then dismutates to hydrogen sors that subsequently are incorporated into DNA, in which they can exert cytotoxic and mutagenic effects. peroxide (H2O2), which is the oxidizing substrate for eosinophil peroxidase, a granule enzyme. Reactive intermediates generated Experimental Procedures by eosinophil peroxidase may represent one pathway for tissue damage by eosinophils (9–14). At plasma concentrations of Peroxidase Activity Assay. Porcine eosinophil peroxidase (ExOx- halide ion (ClϪ Ϸ 100 mM, BrϪ 20–100 ␮M, IϪ Ͻ1 ␮M; refs. 15 Emis, Little Rock, AR) yielded a single band of active material as assessed by nondenaturing PAGE (29, 30). and 16), the major product of eosinophil peroxidase is thought to be hypobromous acid (HOBr; refs. 9, 11, and 13). Ϫ ϩ ϩ ϩ 3 ϩ This paper was submitted directly (Track II) to the PNAS office. Br H2O2 H HOBr H2O [1] Abbreviations: dC, deoxycytidine; BrdC, 5-bromodeoxycytidine. The pseudohalide thiocyanate also has been proposed to be a ʈTo whom reprint requests should be addressed at: Division of Atherosclerosis, Nutrition major substrate (17). Recent studies provide compelling evi- and Lipid Research, Campus Box 8046, 660 South Euclid Avenue, St. Louis, MO 63110. E-mail: [email protected]. dence that HOBr generated by activated eosinophils is one The publication costs of this article were defrayed in part by page charge payment. This pathway for tissue damage in asthma (18). article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. A striking example in which inflammation-mediated DNA §1734 solely to indicate this fact. damage may lead to a carcinogenic insult is schistosomiasis (19, Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073͞pnas.041146998. 20). This disease is caused by the blood fluke Schistosoma, the Article and publication date are at www.pnas.org͞cgi͞doi͞10.1073͞pnas.041146998 PNAS ͉ February 13, 2001 ͉ vol. 98 ͉ no. 4 ͉ 1631–1636 Downloaded by guest on September 27, 2021 Hypobromous Acid. Bromide-free HOBr was prepared by addition of silver nitrate to Ϸ80 mM bromine water (1.5:1, mol͞mol) and vacuum distillation (31). Reagent taurine monobromamine was prepared by adding HOBr to a 100-fold mole excess of taurine. Oxidation of dC. Reactions were performed in gas-tight vials and initiated by adding oxidant from a gas-tight syringe through the septum while vortexing the sample. Reactions were terminated by adding L-methionine to a final concentration of 6 mM. HOBr ␧ ϭ Ϫ1⅐ Ϫ1 ␧ and taurine bromamine ( 240 43.6 M cm ), and H2O2 ( 288 ϭ 430 MϪ1⅐cmϪ1) concentrations were determined spectropho- tometrically (13, 32). The pH dependence of product formation was determined as described (28). Human Eosinophils. Human polymorphonuclear cells were pre- pared from blood by density-gradient centrifugation (33). Neu- Fig. 1. Reverse-phase HPLC analyses of dC oxidized by the eosinophil perox- trophils were removed by passage over beads coupled to anti- Ϫ Ͼ idase-H2O2-Br system. dC (1 mM) was incubated with 3 nM eosinophil per- CD16 antibody (R & D Systems). Cells ( 95% eosinophils and oxidase (EPO), 100 ␮MH2O2, and 100 ␮M NaBr in buffer A (50 mM sodium Ͻ5% lymphocytes) were suspended in PBS (100 mM NaCl͞10 phosphate͞100 mM sodium chloride͞100 ␮M diethylenetriaminepentaacetic ͞ Ϫ mM sodium phosphate supplemented with 2 mM dextrose 1.4 acid, pH 4.5) for 60 min at 37°C (EPO͞H2O2͞Br ). Where indicated, eosinophil ͞ ͞ ͞ ␮ ͞ ␮ ͞ Ϫ mM CaCl2 1.4 mM MgCl2 1mMdC100 M NaBr 100 M peroxidase was omitted from the reaction mixture (H2O2 Br ). Also shown is diethylenetriaminepentaacetic acid), incubated at 37°C for 60 a chromatogram of 20 ␮M authentic BrdC. Reactions were initiated by adding min, and maintained in suspension with intermittent inversion. H2O2 and terminated with 6 mM L-methionine. The reaction was terminated by addition of 6 mM methionine and removal of cells by centrifugation. antibromodeoxyuridine monoclonal antibody (Becton-Dickin- son Immunocytometry Systems) and FITC-conjugated goat Reverse-Phase HPLC. Reaction mixtures were analyzed by reverse- ␮ ϫ anti-mouse IgG (Sigma). Flow-cytometric analysis was carried phase HPLC with a C18 column (Porasil, 5- m resin, 4.6 250 mm; Beckman–Altex) at a flow of 1 ml͞min with UV detection at 295 out on a Becton-Dickinson FACS 440 equipped with an I-90–5 nm (28). For NMR analysis, concentrated reaction mixtures were UV laser (Coherent Radiation, Palo Alto, CA). Data from at least 20,000 nuclei were collected. For immunohistochemistry, fractionated
Load more

Recommended publications
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • GRAS Notice 665, Lactoperoxidase System
    GRAS Notice (GRN) No. 665 http://www.fda.gov/Food/IngredientsPackagingLabeling/GRAS/NoticeInventory/default.htm ORIGINAL SUBMISSION 000001 Mo•·gan Lewis Gf<N Ob()&h5 [R1~~~~~~[Q) Gary L. Yingling Senior Counsel JUL 1 8 2016 + 1.202. 739 .5610 gary.yingling@morganlewis .com OFFICE OF FOO~ ADDITIVE SAFETY July 15, 2016 VIA FEDERAL EXPRESS Dr. Antonia Mattia Director Division of Biotechnology and GRAS Notice Review Office of Food Additive Safety (HFS-200) Center for Food Safety and Applied Nutrition Food and Drug Administration 5100 Paint Branch Parkway College Park, MD 20740-3835 Re: GRAS Notification for the Lactoperoxidase System Dear Dr. Mattia: On behalf of Taradon Laboratory C'Taradon"), we are submitting under cover of this letter three paper copies and one eCopy of DSM's generally recognized as safe ("GRAS'') notification for its lactoperoxidase system (''LPS''). The electronic copy is provided on a virus-free CD, and is an exact copy of the paper submission. Taradon has determined through scientific procedures that its lactoperoxidase system preparation is GRAS for use as a microbial control adjunct to standard dairy processing procedures such as maintaining appropriate temperatures, pasteurization, or other antimicrobial treatments to extend the shelf life of the products. In many parts of the world, the LPS has been used to protect dairy products, particularly in remote areas where farmers are not in close proximity to the market. In the US, the LPS is intended to be used as a processing aid to extend the shelf life of avariety of dairy products, specifically fresh cheese including mozzarella and cottage cheeses, frozen dairy desserts, fermented milk, flavored milk drinks, and yogurt.
    [Show full text]
  • Genomic Evidence of Reactive Oxygen Species Elevation in Papillary Thyroid Carcinoma with Hashimoto Thyroiditis
    Endocrine Journal 2015, 62 (10), 857-877 Original Genomic evidence of reactive oxygen species elevation in papillary thyroid carcinoma with Hashimoto thyroiditis Jin Wook Yi1), 2), Ji Yeon Park1), Ji-Youn Sung1), 3), Sang Hyuk Kwak1), 4), Jihan Yu1), 5), Ji Hyun Chang1), 6), Jo-Heon Kim1), 7), Sang Yun Ha1), 8), Eun Kyung Paik1), 9), Woo Seung Lee1), Su-Jin Kim2), Kyu Eun Lee2)* and Ju Han Kim1)* 1) Division of Biomedical Informatics, Seoul National University College of Medicine, Seoul, Korea 2) Department of Surgery, Seoul National University Hospital and College of Medicine, Seoul, Korea 3) Department of Pathology, Kyung Hee University Hospital, Kyung Hee University School of Medicine, Seoul, Korea 4) Kwak Clinic, Okcheon-gun, Chungbuk, Korea 5) Department of Internal Medicine, Uijeongbu St. Mary’s Hospital, Uijeongbu, Korea 6) Department of Radiation Oncology, Seoul St. Mary’s Hospital, Seoul, Korea 7) Department of Pathology, Chonnam National University Hospital, Kwang-Ju, Korea 8) Department of Pathology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea 9) Department of Radiation Oncology, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, Seoul, Korea Abstract. Elevated levels of reactive oxygen species (ROS) have been proposed as a risk factor for the development of papillary thyroid carcinoma (PTC) in patients with Hashimoto thyroiditis (HT). However, it has yet to be proven that the total levels of ROS are sufficiently increased to contribute to carcinogenesis. We hypothesized that if the ROS levels were increased in HT, ROS-related genes would also be differently expressed in PTC with HT. To find differentially expressed genes (DEGs) we analyzed data from the Cancer Genomic Atlas, gene expression data from RNA sequencing: 33 from normal thyroid tissue, 232 from PTC without HT, and 60 from PTC with HT.
    [Show full text]
  • Peroxidasin-Mediated Bromine Enrichment of Basement Membranes
    Peroxidasin-mediated bromine enrichment of basement membranes Cuiwen Hea,1, Wenxin Songa,1, Thomas A. Westona, Caitlyn Trana, Ira Kurtza, Jonathan E. Zuckermanb, Paul Guagliardoc, Jeffrey H. Minerd, Sergey V. Ivanove,f, Jeremy Bougourec, Billy G. Hudsone,f,g,h, Selene Colone,f,h,i, Paul A. Voziyane,f, Gautam Bhavee,f,i,j, Loren G. Fonga, Stephen G. Younga,k,2,3, and Haibo Jiangl,m,2,3 aDepartment of Medicine, University of California, Los Angeles, CA 90095; bDepartment of Pathology and Laboratory Medicine, University of California, Los Angeles, CA 90095; cCentre for Microscopy, Characterisation and Analysis, University of Western Australia, 6009 Perth, Australia; dDivision of Nephrology, Washington University School of Medicine, St. Louis, MO 63110; eVanderbilt Center for Matrix Biology, Vanderbilt University Medical Center, Nashville, TN 37212; fDivision of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232; gVanderbilt Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232; hVanderbilt Institute of Chemical Biology, Vanderbilt University, Nashville, TN 37232; iDepartment of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37212; jCenter for Kidney Disease, Vanderbilt University Medical Center, Nashville, TN 37232; kDepartment of Human Genetics, University of California, Los Angeles, CA 90095; lSchool of Molecular Sciences, University of Western Australia, 6009 Perth, Australia; and mDepartment of Chemistry, The University of Hong Kong, Hong Kong, China Contributed by Stephen G. Young, May 25, 2020 (sent for review April 22, 2020; reviewed by Douglas Gould and Martin R. Pollak) Bromine and peroxidasin (an extracellular peroxidase) are essen- methionine and a spatially adjacent hydroxylysine residue (lysine- tial for generating sulfilimine cross-links between a methionine 1689) in a partner collagen IV trimer (1, 4).
    [Show full text]
  • Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase
    Jpn. J. Infect. Dis., 57, 2004 Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase, Eosinophil Peroxidase and Myeloperoxidase Paul Georg Furtmüller, Walter Jantschko, Martina Zederbauer, Christa Jakopitsch, Jürgen Arnhold1 and Christian Obinger* Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, BOKU-University of Natural Resources and Applied Life Sciences, 1Institute of Medical Physics and Biophysics, School of Medicine, University of Leipzig, Leipzig, Germany SUMMARY: Myeloperoxidase, eosinophil peroxidase and lactoperoxidase are heme-containing oxidoreductases, which undergo a series of redox reactions. Though sharing functional and structural homology, reflecting their phylogenetic origin, differences are observed regarding their spectral features, substrate specificities, redox properties and kinetics of interconversion of the relevant redox intermediates ferric and ferrous peroxidase, compound I, compound II and compound III. Depending on substrate availability, these heme enzymes path through the halogenation cycle and/or the peroxidase cycle and/or act as poor (pseudo-) catalases. Today - based on sequence homologies, tertiary structure and the halide ions is the following: I– > Br– > Cl–. All peroxidases can nature of the heme group - two heme peroxidase superfamilies are oxidize iodide. At neutral pH, only MPO is capable to oxidize distinguished, namely the superfamily containing enzymes from chloride at a reasonable rate (4), and it is assumed that chloride and archaea, bacteria, fungi and plants (1) and the superfamily of thiocyanate are competing substrates in vivo. EPO can oxidize mammalian enzymes (2), which contains myeloperoxidase (MPO), chloride only at acidic pH (5), and at normal plasma concentrations, eosinophil peroxidase (EPO), lactoperoxidase (LPO) and thyroid bromide and thiocyanate function as substrates, whereas for LPO peroxidase (TPO).
    [Show full text]
  • Activation of Human Eosinophils in Vitro by Respiratory Syncytial Virus'
    0031-3998/92/3202-0160$03.00/0 PEDIATRIC RESEARCH Vol. 32, No.2, 1992 Copyright © 1992 International Pediatric Research Foundation, Inc. Printed in U.S.A. Activation of Human Eosinophils In Vitro by Respiratory Syncytial Virus' JAN L. L. KIMPEN, ROBERTO GAROFALO,2 ROBERT C. WELLIVER, AND PEARAY L. OGRA2 School ofMedicine, State University ofNew York at Buffalo, Departments ofPediatrics and Microbiology, and Division ofInfectious Diseases, The Children's Hospital, Buffalo, New York 14222 ABSTRACT. To determine the nature of the interaction RSV is the leading cause of pneumonia and bronchiolitis between viruses and eosinophils, normodense eosinophils during infancy (1). It has been speculated that RSV infection in were separated from the blood of healthy volunteers and infancy plays a role in the development of hyperreactive airway incubated in vitro with respiratory syncytial virus (RSV). disease in later life (2). The pathogenesis ofthe inflammation of After incubation for 2 h with the virus, 29.5 ± 15.8% of the airways during acute RSV infection and the mechanisms the eosinophils demonstrated specific binding of the virus underlying the possible development of subsequent airway hy­ to the cell membrane, as detected by fluorescent staining perreactivityare not completely understood. with an anti-RSV MAb. Superoxide production and leu­ Recent evidence suggests an important role for eosinophils in kotriene C4 release were measured as determinants of cell a variety of inflammatory states (3). Although the role of eosin­ activation. Using a cytochrome c reduction assay, super­ ophils in natural RSV infection is unclear, reports offield studies oxide could be detected in the supernatant 30 min after with a formalin-inactivated RSV vaccine carried out in the late exposure to RSV.
    [Show full text]
  • Peroxidase Activity of Human Hemoproteins: Keeping the Fire Under Control
    molecules Review Peroxidase Activity of Human Hemoproteins: Keeping the Fire under Control Irina I. Vlasova 1,2 1 Federal Research and Clinical Center of Physical-Chemical Medicine, Department of Biophysics, Malaya Pirogovskaya, 1a, Moscow 119435, Russia; [email protected]; Tel./Fax: +7-985-771-1657 2 Institute for Regenerative Medicine, Laboratory of Navigational Redox Lipidomics, Sechenov University, 8-2 Trubetskaya St., Moscow 119991, Russia Received: 28 August 2018; Accepted: 1 October 2018; Published: 8 October 2018 Abstract: The heme in the active center of peroxidases reacts with hydrogen peroxide to form highly reactive intermediates, which then oxidize simple substances called peroxidase substrates. Human peroxidases can be divided into two groups: (1) True peroxidases are enzymes whose main function is to generate free radicals in the peroxidase cycle and (pseudo)hypohalous acids in the halogenation cycle. The major true peroxidases are myeloperoxidase, eosinophil peroxidase and lactoperoxidase. (2) Pseudo-peroxidases perform various important functions in the body, but under the influence of external conditions they can display peroxidase-like activity. As oxidative intermediates, these peroxidases produce not only active heme compounds, but also protein-based tyrosyl radicals. Hemoglobin, myoglobin, cytochrome c/cardiolipin complexes and cytoglobin are considered as pseudo-peroxidases. Peroxidases play an important role in innate immunity and in a number of physiologically important processes like apoptosis and cell signaling. Unfavorable excessive peroxidase activity is implicated in oxidative damage of cells and tissues, thereby initiating the variety of human diseases. Hence, regulation of peroxidase activity is of considerable importance. Since peroxidases differ in structure, properties and location, the mechanisms controlling peroxidase activity and the biological effects of peroxidase products are specific for each hemoprotein.
    [Show full text]
  • Omalizumab Restores Response to Corticosteroids in Patients with Eosinophilic Chronic Rhinosinusitis and Severe Asthma
    biomedicines Article Omalizumab Restores Response to Corticosteroids in Patients with Eosinophilic Chronic Rhinosinusitis and Severe Asthma Yoshiki Kobayashi 1,2,* , Akira Kanda 1,2 , Dan Van Bui 1, Yasutaka Yun 1 , Linh Manh Nguyen 1, Hanh Hong Chu 1, Akitoshi Mitani 1, Kensuke Suzuki 1 , Mikiya Asako 1,2 and Hiroshi Iwai 1 1 Airway Disease Section, Department of Otorhinolaryngology, Kansai Medical University, Hirakata, Osaka 573-1010, Japan; [email protected] (A.K.); [email protected] (D.V.B.); [email protected] (Y.Y.); [email protected] (L.M.N.); [email protected] (H.H.C.); [email protected] (A.M.); [email protected] (K.S.); [email protected] (M.A.); [email protected] (H.I.) 2 Allergy Center, Kansai Medical University Hospital, Hirakata, Osaka 573-1010, Japan * Correspondence: [email protected]; Tel.: +81-72-804-2463 Abstract: Eosinophilic chronic rhinosinusitis (ECRS), which is a subgroup of chronic rhinosinusitis with nasal polyps, is characterized by eosinophilic airway inflammation extending across both the upper and lower airways. Some severe cases are refractory even after endoscopic sinus surgery, likely because of local steroid insensitivity. Although real-life studies indicate that treatment with omalizumab for severe allergic asthma improves the outcome of coexistent ECRS, the underlying mechanisms of omalizumab in eosinophilic airway inflammation have not been fully elucidated. Twenty-five patients with ECRS and severe asthma who were refractory to conventional treatments Citation: Kobayashi, Y.; Kanda, A.; and who received omalizumab were evaluated.
    [Show full text]
  • Leukocyte Myeloperoxidase Deficiency and Disseminated Candidiasis: the Role of Myeloperoxidase in Resistance to Candida Infection
    Leukocyte myeloperoxidase deficiency and disseminated candidiasis: the role of myeloperoxidase in resistance to Candida infection Robert I. Lehrer, Martin J. Cline J Clin Invest. 1969;48(8):1478-1488. https://doi.org/10.1172/JCI106114. Research Article The neutrophils and monocytes of a patient with disseminated candidiasis were found to lack detectable levels of the lysosomal enzyme myeloperoxidase (MPO), although they had normal levels of other granule-associated enzymes. Leukocytes from one of the patient's sisters also lacked detectable MPO; leukocytes from his four sons contained approximately one-third of mean normal peroxidase levels. Neither the patient nor his affected relatives had experienced frequent or unusual bacterial infections. The phagocytic activity of the patient's MPO-deficient neutrophils was intact, and the cells displayed normal morphologic and metabolic responses to phagocytosis. In contrast to normal leukocytes which killed 30.5±7.3% of ingested Candida albicans in 1 hr, however, the patient's neutrophils killed virtually none. His leukocytes also failed to kill the strain oCf . albicans recovered from his lesions, as well as other Candida species. These MPO-deficient neutrophils killed Serratia marcescens and Staphylococens aureus 502A at an abnormally slow rate, requiring 3-4 hr to achieve the bactericidal effect attained by normal leukocytes after 45 min. No other abnormalities in his cellular or humoral immune responses were demonstrated. These findings suggest that hereditary MPO deficiency is transmitted as an autosomal recessive characteristic, that the homozygous state conveys enhanced susceptibility to disseminated candidiasis, and that MPO is necessary for candidacidal activity in human neutrophils. Although lending support to the suggested bactericidal role of MPO […] Find the latest version: https://jci.me/106114/pdf Leukocyte Myeloperoxidase Deficiency and Disseminated Candidiasis: the Role of Myeloperoxidase in Resistance to Candida Infection ROBERT I.
    [Show full text]
  • Supplementary Materials: Chronic Low Dose Oral Exposure to Microcystin-LR Exacerbates Hepatic Injury in a Murine Model of Non-Alcoholic Fatty Liver Disease
    Toxins 2019, 11, 486; doi: 10.3390/toxins11090486 S1 of S23 Supplementary materials: Chronic Low Dose Oral Exposure to Microcystin-LR Exacerbates Hepatic Injury in a Murine Model of Non-Alcoholic Fatty Liver Disease Apurva Lad, Robin C. Su, Joshua D. Breidenbach, Paul M. Stemmer, Nicholas J. Carruthers, Nayeli K. Sanchez, Fatimah K. Khalaf MBChB, Shungang Zhang, Andrew L. Kleinhenz, Prabhatchandra Dube, Chrysan J. Mohammed, Judy A. Westrick, Erin L. Crawford, Dilrukshika Palagama, David Baliu-Rodriguez, Dragan Isailovic, Bruce Levison, Nikolai Modyanov, Amira F. Gohara, Deepak Malhotra, Steven T. Haller and David J. Kennedy Figure S1. Effect of MC-LR on survival and gross liver morphology in both healthy (C57Bl/6J) and NAFLD (Leprdb/J) mice. (A) Kaplan-Meier analysis of the survival period of the C57Bl/6J (WT) and LepRdb/J (db) Toxins 2019, 11, 486; doi: 10.3390/toxins11090486 S2 of S23 mice showed a non-significant (log-rank p = 0.0702) decrease in survival in mice receiving 50 μg/kg (n = 17, 94% survival) and 100 μg/kg MC-LR (n = 17, 82% survival) versus db/Vehicle (n = 15) (100% survival), no deaths were observed in the WT/Vehicle (n = 5) or WT/100 μg/kg MC-LR exposure (n = 5) C57Bl/6J mice; Representative images showing the gross morphology of the livers of Leprdb/J mice that were exposed to (B) Vehicle; (C) 50 μg/kg MC-LR or (D) 100 μg/kg MC-LR. In each case the animals died overnight and there was no observed acute trauma (e.g. tracheal rupture resulting in immediate death) or other signs of improper gavage technique such as visible signs of discomfort or bloating in the time preceding death.
    [Show full text]
  • Biochemical and Pathological Studies on Peroxidases –An Updated Review
    Global Journal of Health Science; Vol. 6, No. 5; 2014 ISSN 1916-9736 E-ISSN 1916-9744 Published by Canadian Center of Science and Education Biochemical and Pathological Studies on Peroxidases –An Updated Review Amjad A. Khan1, Arshad H. Rahmani2, Yousef H. Aldebasi3 & Salah M. Aly2,4 1 Department of Basic Health Sciences, College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 2 Department of Medical Laboratories, College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 3 Department of Optometry College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 4 Department of Pathology, Faculty of Veterinary Medicine, Suez Canal University, Ismalia, Egypt Correspondence: Amjad Ali Khan, Department of Basic Health Sciences, College of Applied Medical Sciences, Qassim University, Qassim, Kingdom of Saudi Arabia. Tel: 966-16-380-1266, Fax: 966-16-380-1628. E-mail: [email protected], [email protected] Received: April 4, 2014 Accepted: April 27, 2014 Online Published: May 13, 2014 doi:10.5539/gjhs.v6n5p87 URL: http://dx.doi.org/10.5539/gjhs.v6n5p87 Abstract Peroxidases represent a family of isoenzymes actively involved in oxidizing reactive oxygen species, innate immunity, hormone biosynthesis and pathogenesis of several diseases. Different types of peroxidases have organ, tissues, cellular and sub-cellular level of specificities in their function. Different diseases lead to varied expressions of peroxidases based on several mechanisms proposed. Several researches are going on to understand its deficiency, over-expression and malfunction in relation with different diseases. Some common diseases of mankind like cancer, cardiovascular diseases and diabetes directly or indirectly involve the role of peroxidases.
    [Show full text]