Molecular Phylogenetics and Evolution 54 (2010) 583–593
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
The hidden diversity of Coleodactylus amazonicus (Sphaerodactylinae, Gekkota) revealed by molecular data
Silvia Rodrigues Geurgas *, Miguel Trefaut Rodrigues
Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, Cidade Universitaria, 05508-090 São Paulo, SP, Brazil article info abstract
Article history: Coleodactylus amazonicus, a small leaf-litter diurnal gecko widely distributed in Amazon Basin, has been Received 21 May 2009 considered a single species with no significant morphological differences between populations along its Revised 27 September 2009 range. A recent molecular study, however, detected large genetic differences between populations of cen- Accepted 2 October 2009 tral Amazonia and those in the easternmost part of the Amazon Basin, suggesting the presence of taxo- Available online 8 October 2009 nomically unrecognised diversity. In this study, DNA sequences of three mitochondrial (16S, cytb, and ND4) and two nuclear genes (RAG-1, c-mos) were used to investigate whether the species currently iden- Keywords: tified as C. amazonicus contains morphologically cryptic species lineages. The present phylogenetic anal- Coleodactylus ysis reveals further genetic subdivision including at least five potential species lineages, restricted to Sphaerodactylinae Cryptic species northeastern (lineage A), southeastern (lineage B), central-northern (lineage E) and central-southern (lin- Mitochondrial genes eages C and D) parts of Amazon Basin. All clades are characterized by exclusive groups of alleles for both RAG-1 nuclear genes and highly divergent mitochondrial haplotype clades, with corrected pairwise net c-mos sequence divergence between sister lineages ranging from 9.1% to 20.7% for the entire mtDNA dataset. Results of this study suggest that the real diversity of ‘‘C. amazonicus” has been underestimated due to its apparent cryptic diversification. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction ters a major challenge. This morphological homogeneity was ini- tially attributed to a recent diversification of the group during the The genus Coleodactylus (Sphaerodactylinae, Gekkota) com- Quaternary (Vanzolini, 1957, 1968a,b, 1980). However, a recent prises five species of small leaf-litter diurnal geckos of cis-andean study using molecular dating suggests that speciation within South America, occurring from central Amazonian Forest through the genus may have begun in the late Cretaceous with the split Cerrado and Caatinga in central Brazil to the Atlantic Forest, in of C. amazonicus from all other species included in the so-called habitats ranging from closed-canopy wet forests to more mesic meridionalis group (C. brachystoma, C. meridionalis, C. natalensis, open formations (Vanzolini, 1980; Ávila-Pires, 1995; Freire, and C. septentrionalis), whilst the remaining species diverged from 1999; Vitt et al., 2005). Although the broad geographic range of middle Eocene to Pleistocene (Geurgas et al., 2008). The ancient the genus renders it of considerable interest to the reconstruction diversification and subtle morphological variation among Coleo- of the biogeographical history of the Neotropical region, Coleo- dactylus species suggest that these similarities might be associ- dactylus remains a poorly known group. Until recently (Geurgas ated with morphological stasis due to shared lifestyles and/or to et al., 2008), the relationships among species were based exclu- slow rates of morphological evolution in the characters tradition- sively on pre-cladistic interpretations of shared plesiomorphic ally used to diagnose species (Avise et al., 1994), as seen in sala- character states and geographical distribution of species (Vanzo- manders (e.g., Good and Wake, 1992; Fu and Zeng, 2008). lini, 1957). This was partially due to the difficulties of working Morphological stasis is characterized by a slower rate of morpho- with lizards so small that character survey is a hard task. With logical change relative to the rate of molecular evolution. This the exception of the autapomorphic characters related to the dor- process may give rise to groups of cryptic species, which are, by sal scale type and number of ungual sheath scales displayed by C. definition, genetically distinct but hardly distinguishable amazonicus, only a few qualitative differences have been identi- morphologically. fied among species (Vanzolini, 1957; Freire, 1999), making the Despite the morphological resemblance among Coleodactylus recognition of phylogenetically informative morphological charac- species, a considerable variability is recorded in color pattern and meristic characters within species, such as number of scales around midbody, along the midventral line, supralabials, and infra- * Corresponding author. Fax: +55 11 3091 7553. labials (Vanzolini, 1957, 1980; Ávila-Pires, 1995; Freire, 1999). E-mail address: [email protected] (S.R. Geurgas). Nonetheless, species are taxonomically considered to represent
1055-7903/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2009.10.004 584 S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593 single evolutionary units due to the lack of geographical trends in 2. Materials and methods this variation. However, the possibility that Coleodactylus species can potentially include morphologically cryptic sibling species 2.1. Taxon sampling was suggested by deep phylogeographic subdivisions within spe- cies (Geurgas et al., 2008). Phylogenetic and phylogeographic anal- A total of 148 specimens from 27 localities distributed across yses of DNA sequence data have become an effective tool for most of the known distribution of C. amazonicus were used in this identifying cryptic taxa for their ability to detect patterns of phylo- study (Fig. 1; Appendix 1). Sampling included as many individuals genetic subdivisions that cannot be perceived by the analyses of as possible for each locality to test for coalescence of mitochondrial quantitative morphological traits (Avise, 2000; Bickford et al., haplotypes. Coleodactylus meridionalis and C. septentrionalis were 2007; Pfenninger and Schwenk, 2007). In the past few years, used as outgroups in the phylogenetic analyses. Voucher speci- molecular data have had a profound impact on the field of system- mens are deposited at the Museu de Zoologia, Universidade de atic herpetology by revealing extraordinary levels of cryptic diver- São Paulo (MZUSP), and Instituto Nacional de Pesquisas da Amazô- sity (Wiens, 2008). Several species of the Neotropical herpetofauna nia (INPA). A detailed list of specimens, including voucher num- have been suggested and/or described after application of DNA se- bers, haplotypes, alleles, GenBank accession numbers, and quence data (e.g., Morando et al., 2003; Kronauer et al., 2005; locality information is provided in Appendix 1. Elmer et al., 2007; Fouquet et al., 2007), and the general pattern found by these studies is that widely distributed taxa, especially 2.2. Laboratory methods those with restricted vagility, may comprise many undescribed species. Identification and delimitation of species boundaries Total genomic DNA was extracted from liver or tail tissues, based solely on a single DNA region, however, have been criticized stored either frozen or ethanol fixed, by the standard proteinase by some authors (e.g., Moritz and Cicero, 2004; see also Vogler and K protocol (Sambrook et al., 1989). Three mitochondrial DNA Monaghan, 2007), who argue that a phylogeny derived from a sin- (mtDNA) fragments—the 16S ribosomal RNA (16S), cytochrome b gle gene does not necessarily reflect the species tree due to the (cytb), and NADH dehydrogenase subunit 4 (ND4) genes—were se- effects of incomplete lineage sorting of ancestral polymorphisms, quenced for all individuals (n = 148). A subset of the samples, con- introgression, sensitivity to sex-biased dispersal and gene flow, sisting of one to four individuals per locality (n = 83), were or selection (Avise, 1994). A multilocus approach is especially subjected to DNA sequencing of the two nuclear genes, the oocyte important for continuously distributed taxa with low vagility, as maturation factor Mos (c-mos) and recombination activating gene is likely the case in Coleodactylus, in which deep phylogeographic 1 (RAG-1) to test for lineage congruence among the molecular breaks may arise by stochastic processes even in the absence of markers. Two regions of the RAG-1 gene were amplified indepen- barriers to gene flow, particularly in mitochondrial genes (e.g., dently, considering the differences of intragenic variation in rates Irwin, 2002; Kuo and Avise, 2005). It is unlikely, however, that of evolution: an initial fragment of 395 bp, representing the vari- trees derived from independent molecular markers would yield able amino-terminal region that codes for protein binding-sites, congruent topologies unless these genes have experienced the and a final fragment of 312 bp, corresponding to the highly con- same phylogenetic history. In this way, concordant genetic subdi- served carboxy-terminal region responsible for target-site recogni- visions across multiple gene trees can be interpreted as the result tion, DNA binding and nuclear targeting (Willett et al., 1997). The of a long-standing isolation and absence of gene flow among gene fragments were amplified and sequenced in both directions lineages (Avise and Ball, 1990; Baum and Shaw, 1995). with the primers presented in Table 1. Thermocycling conditions In the present study, we test the hypothesis that the species for amplification of mitochondrial genes consisted of an initial currently identified as Coleodactylus amazonicus contains morpho- denaturation step of 5 min at 94 °C, followed by 35 cycles of 40 s logically cryptic species. This species is broadly distributed across at 94 °C, 40 s at 49 °Cto51°C, 40 s at 72 °C, and a final 7 min central and eastern Amazonia, including southern Venezuela, extension step at 72 °C. Nuclear genes were amplified under the southern Guyana, Suriname, and French Guyana, where it occu- same conditions, excepting the temperatures of annealing (RAG- pies a wide variety of habitats, as long as leaf litter and a canopy 1, 51 °C; c-mos, 58 °C). All PCR products were enzymatically puri- dense enough are present to prevent soil heating (Ávila-Pires, fied with Exonuclease I and Shrimp Alkaline Phosphatase (USB or 1995; Vitt et al., 2005; Gardner et al., 2007). An extensive mor- Fermentas). Automated sequencing was performed using BigDye phological study of specimens from several localities across the Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), fol- range of C. amazonicus did not reveal any significant difference lowed by analysis on ABI Prism 3700 or 3100 Genetic Analyzer in meristic characters among groups of populations, and the intra Sequencers (Applied Biosystems) according to the manufacturer’s and interpopulational variation in color polymorphism were instructions. shared among geographically distant populations (Ávila-Pires, 1995). In contrast to the morphological data, molecular data from 2.3. Alignment, matrices, and preliminary sequence data analysis a mitochondrial and two nuclear genes recovered two deeply divergent geographic groupings of populations, one of them com- Sequences were analysed using Sequence Navigator (PE Applied prising populations from the easternmost Amazon Basin, and the Biosystems), Sequencher v. 4.1.2 (Gene Codes Corporation) or other comprising populations from central Amazonia (Geurgas MEGA4 (Tamura et al., 2007), and aligned using the default param- et al., 2008). This study expands the previous work by increasing eters of ClustalW (Thompson et al., 1994) implemented in MEGA4 the original sampling of localities to cover most of the known software (Tamura et al., 2007). Sequences of cytb and ND4 genes geographical distribution of the species. The provisional candidate were translated to amino acids to check for indels, stop codons species limits in C. amazonicus is inferred by the analysis of phy- and shifts in reading frame. The initial alignment of the 16S gene logeographic structure of both mitochondrial and nuclear loci, fol- was manually refined using as reference the secondary structure lowing the general lineage concept of species (GLC, de Queiroz, diagram proposed for Scincomorpha (Brown, 2005). The following 1998) and adopting genealogical congruence among the unlinked regions, for which the positional nucleotide homologies were con- molecular markers as the operational criterion to delimit phylo- sidered ambiguous within the ingroup and between the ingroup genetic species (Avise and Ball, 1990; revised in Sites and Mar- and outgroup taxa, were removed from the analyses: noninteract- shall, 2004). ing sites between G2 and G3, G3 (stem and terminal loop), most of S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593 585
FRENCH 250 km SURINAME GUIANA 1 24 GUYANA
2
Branco Branco E A Negro 3 Trombetas 4
21 Amazon Belém 25 27 26 22 8 5 Solimões Manaus 7 11 23 12
ATLANTIC OCEAN 10 VENEZUELA Xingu 13 B Tocantins COLOMBIA 15 20 C Tapajós
Purus 16 19 17 6 Madeira 18 BRAZIL D 14 PERU 9 BOLIVIA
Fig. 1. Sampling localities of Coleodactylus amazonicus across the Amazon Basin and the geographic distribution of the five main clades (A–E) identified in phylogenetic analyses of mitochondrial and nuclear genes. Clade names correspond to those in Figs. 2–4 and Tables 2, 4, and locality numbers correspond to those in Appendix 1. The cities of Manaus (Amazonas State) and Belém (Pará State) and major rivers are presented as reference points.
Table 1 Primers used for DNA amplification and sequencing of mitochondrial and nuclear genes in this study.
Gene Primer Sequence (50–30) Reference 16S 16Sar CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16Sbr CCGGTCTGAACTCAGATCACGT Palumbi et al. (1991) 16S F.1 TGTTTACCAAAAACATAGCCTTTAGC Whiting et al. (2003) 16S R.0 TAGATAGAAACCGACCTGGATT Whiting et al. (2003) cytb LGL765 GAAAAACCAYCGTTGTWATTCAACT Bickham et al. (1995) cytbL_Cld ATGACCCCWATWCGMAAAACCCACC This study H15149a TGCAGCCCCTCAGAATGATATTTGTCCTCA Kocher et al. (1989) ND4 ND4L CTACTATGCTTTGAAGGWATAAT Arévalo et al. (1994) Leu CATTACTTTTACTTGGATTTGCACCA Arévalo et al. (1994) ND4L_Eamz TTRAAGGCSMTYATCGCCTA This study ND4H_Eamz TTAARCCCMAAACTAATTATCTA This study ND4L_Wamz CTAAARKCYATTATYGCATACTCYTC This study ND4H_Wamz CACCCYAADYTRRTYATRTAA This study c-mos LSCH1 CTCTGGKGGCTTTGGKKCTGTSTACAAGG Godinho et al. (2005) LSCH2 GGTGATGGCAAARGAGTAGATGTCTGC Godinho et al. (2005) cmosL_amz AAGGCTACTTACCGAGGAGC This study cmosH_amz AAGAAGTTCAGGAGCTCGGT This study RAG-1 F94 TGGAARTTCAARCTGTTCAAAGT Townsend et al. (2004) F104 CAAAGTGAGATCNCTTGAAAA Townsend et al. (2004) R387 GTNTCATCATCTACTGGTCCA Townsend et al. (2004) R522 AAATTAGTTGGATGGATTGTGTCCA Geurgas et al. (2008)
a Reduced version.
the noninteracting sites between G8 and G13 and between G13 tive characters, with the null distributions generated by 100 repli- and G15, and the terminal G15 loop. cations, under a heuristic search with five random-addition The full dataset of 148 individuals sequenced for the three mito- sequences per replicate. As the ILD test did not reveal any signifi- chondrial genes was reduced to 49 individuals that presented non- cant conflict in the phylogenetic signal among mitochondrial genes redundant 16S edited haplotypes. These individuals were used to (P = 0.45), sequences of 16S, cytb and ND4 genes were combined in test for character congruence among the mitochondrial data set a single matrix with 100 individuals that presented unique haplo- with the incongruence length difference (ILD) test of Farris et al. types for the concatenated genes. (1994) implemented in PAUP* 4.0b10 (Swofford, 2003). Partition Sequences of the nuclear genes from this study were aligned homogeneity test was performed excluding parsimony-uninforma- against those obtained previously for Coleodactylus, and no indels 586 S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593 other than those already reported for C. meridionalis and C. septen- Table 2 trionalis (Geurgas et al., 2008) had to be incorporated into the Summary of character variation for mitochondrial and nuclear genes used in this study. The best-fit model of nucleotide evolution select for each-partition scheme is alignment. Heterozygotes were detected by double peaks in the indicated. V: number of variable sites; PI: number of parsimoniously informative electropherogram at the three sequenced nuclear regions. No indi- sites. vidual was heterozygous at more than one locus and/or site, and Gene Characters Model the identity of each allele could be directly inferred from the se- quence. Matrices were constructed for both nuclear genes with al- Total V PI (hLTR) leles treated as terminals. This approach permits detection of Mitochondrial concatenated 1239 623 529 GTR+I+G alleles that are restricted to single sampling localities or to popula- 16S 390 100 74 GTR+I+G tion lineages diagnosed using mtDNA haplotypes (e.g., Sota and Stems 237 72 52 GTR+I+G Loops 153 24 16 SYM+G Vogler, 2003; Edwards et al., 2008). As intragenic recombination cytb 377 217 194 GTR+I+G may produce misleading phylogenies by introducing homoplasies 1st pos 157 97 79 SYM+G resulting from recombination rather than back or parallel muta- 2nd pos 157 53 37 GTR+G tions, overestimating substitution-rate heterogeneity and blurring 3rd pos 158 156 151 GTR ND4 472 306 267 GTR+G phylogeographic patterns (Schierup and Hein, 2000; Hare, 2001; 1st pos 157 97 79 HKY+G Posada et al., 2002), nuclear gene matrices were tested for recom- 2nd pos 157 53 37 HKY+G bination with the Phi test (Bruen et al., 2006) implemented in 3rd pos 158 156 151 GTR+G SplitsTree4 (Huson and Bryant, 2006). This test can be used to de- c-mos 484 70 47 K80+G tect recombination in both closely and distantly related samples, 1st pos 157 97 79 JC 2nd pos 157 53 37 JC+G and it performs well in situations like exponential growth and pat- 3rd pos 158 156 151 K80 terns of substitution-rate correlation (Bruen et al., 2006). RAG-1 (initial) 395 75 49 HKY+G 1st pos 157 97 79 HKY 2.4. Phylogenetic analyses 2nd pos 157 53 37 HKY 3rd pos 158 156 151 HKY+G RAG-1 (final) 312 42 26 HKY+G Phylogenetic analyses were conducted using Maximum Parsi- 1st pos 157 97 79 K80 mony (MP) and Bayesian inferences (BA) implemented in PAUP* 2nd pos 157 53 37 K80 4.0b10 (Swofford, 2003) and MrBayes 3.1.2 (Ronquist and Huelsen- 3rd pos 158 156 151 K80 beck, 2003), respectively. The concatenated mitochondrial data (n = 100) and both nuclear genes (RAG-1, n = 17; c-mos, n = 14) were analysed separately to detect possible areas of incongruence set was selected by comparing Bayes factors (Table 3). These fac- among data sets by comparing topologies and nodal support de- tors (B10) were estimated as twice the difference in the ln-trans- rived from each reconstruction. Given the overall phylogenetic formed harmonic means of the posterior likelihoods from the congruence among nuclear markers, both genes were combined stationary phase between the competing strategies (Newton and into a single matrix containing all possible combinations of geno- Raftery, 1994; see also Brown and Lemmon, 2007), and interpreted types (n = 28). MP searches were conducted under the heuristic following Kass and Raftery (1995). Since both nuclear genes pre- search procedure with tree bisection reconnection (TBR) branch sented low levels of polymorphism within each major clade, phy- swapping with 100 random-addition replicates and five random- logenetic relationships among alleles were also represented by a addition sequence per replicate on an initial random starting tree, median-joining network (Bandelt et al., 1999) constructed with with equal character weighting, gaps treated as missing data, and the software Network 4.510 (available at http://www.fluxus-tech- all phylogenetically uninformative characters excluded from the nology.com/sharenet.htm), with all positions equally weighted and analysis. Nodal support was estimated using nonparametric excluding outgroup sequences. bootstrapping (Felsenstein, 1985) with 500 replicates with five Estimates of corrected net sequence divergence for the entire random-addition sequence replicates each and TBR branch swap- mtDNA dataset and for the cytb gene were computed for the mito- ping. Consensus trees were obtained following the 50% majority chondrial lineages recovered in the phylogenetic analyses using rule, and nodes with bootstrap P70% were considered strongly the appropriated best-fit evolutionary model (Table 2)(Nei and supported. Kumar, 2000, equations 12.64–12.67). The assumption of rate con- Bayesian analyses were performed with two replicate searches stancy of DNA substitution through time among taxon for the en- of 2 106 generations each with random starting trees, four Mar- tire mtDNA dataset and for the cytb gene was evaluated by kov chains and trees sampled every 100 generations to estimate comparing the log-likelihood scores from maximum-likelihood likelihood and sequence evolution parameters. Stationarity for each run was detected by plotting the likelihood scores of the trees against generation time, and the topology, posterior probability Table 3 values, and branch-length inferences were calculated after discard- Bayes factor results of comparisons among each partitioning strategy. Values of 2ln ing the burn-in samples. Nodes with posterior probability P95% on (B10) were interpretated following Kass and Raftery (1995): 2–6, positive evidence for a 50% majority-rule consensus tree derived from both runs were rejecting the null hypothesis; 6–10, strong support for rejecting the null hypothesis; >10 very strong support for rejecting the null hypothesis. considered significant support for a given clade. Two different par- tition strategies were tested for each nuclear gene (unpartitioned Partition Harmonic mean B10 2ln (B10) and partitioned by codon), and three partition schemes for the mt 1-part 11645.48 2.74 5.48 mitochondrial data: (1) one-partition, using a single model for mt 3-part 11630.03 the whole dataset; (2) three-partitions, using a separate model mt 1-part 11645.48 6.26 12.52 mt 8-part 11121.61 for each gene; and (3) eight-partitions, using a different model mt 3-part 11630.03 6.23 12.46 for stems and loops for the 16S gene and for each codon position mt 8-part 11121.61 of the cytb and ND4 genes (Table 2). The best-fit model of nucleo- cmos 1-part 1158.89 0.79 1.59 tide substitution for each partition was selected using the hierar- cmos 3-part 1161.10 chical likelihood ratio tests (hLTR) implemented in MrModeltest RAG-1-1 part 1763.07 1.88 3.77 RAG-1-6 part 1756.49 v.2.2 (Nylander, 2004), and the best partition strategy for each data S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593 587 trees constructed in PAUP* 4.0b10 (Swofford, 2003) with and with- graphically proximate localities were also phylogenetically closely out a molecular clock constraint (Felsenstein, 1981). Evolutionary related. Only for two groups of localities of clade C this trend was rate constancy was detected only for the cytb gene not observed: distant localities were clustered together with high
( LnH0 = 3897.1317; LnH1 = 3932.0881), and the corrected net se- values of nodal support (localities 9/12 and 13/14), rather than quence divergence were used to obtain rough estimates of the grouped with closer localities. divergence times among mitochondrial haplotype clades. Due to Applying the estimated evolutionary rate of 0.87% and 1.40% to the absence of fossil records to be used as calibration points for the mean net corrected sequence divergence yielded a time of the molecular clock within this group, we used the previous diver- divergence of 10.3 Myr and 6.4 Myr between haplotype clades A/ gence-time estimate between the eastern and central geographical B, 11.5 Myr and 7.1 Myr between haplotype clades D/E, and groupings of localities (28.4 million years ago; Geurgas et al., 2008) 14.8 Myr and 9.1 Myr between haplotype clades C and D/E (Ta- to infer a rate of 0.87% sequence divergence per million years (Myr) ble 5). MtDNA haplotype clades A–E likely correspond to five sep- for the cytb, which is within the range from 0.5% to 1.4%/Myr ob- arate species lineages genetically isolated from each other (sensu served for this gene in Squamata reptiles (e.g., Zamudio and Baker and Bradley, 2006). We therefore reference these groupings Greene, 1997; Gübitz et al., 2000). This maximum rate was also of localities as lineages A–E in further discussion. considered for divergence-time estimations (Table 5). 3.2. Phylogenetic analyses: nuclear genes
3. Results The alignment of nuclear genes consisted of 707 nucleotides for the RAG-1 gene, with 117 variable sites and 75 parsimoniously 3.1. Phylogenetic analyses: mitochondrial genes informative sites, and 484 nucleotides for the c-mos gene, with 70 variable sites, 47 of them parsimoniously informative (Table 2). The final alignment for 148 individuals consisted of 1239 nucle- The Phi test (Bruen et al., 2006) did not find statistically significant otides (16S, 390 bp; cytb, 377 bp; ND4, 472 bp). Forty-nine unique evidence for recombination in either gene (P = 1.00). A total of 17 haplotypes were obtained for 16S, 75 unique haplotypes for cytb, alleles were identified for RAG-1 and 14 for c-mos, and all hetero- and 87 unique haplotypes for ND4. Considering the three genes zygotes detected (9 for RAG-1 and 4 for c-mos) involved only clo- concatenated, 100 mitochondrial unique haplotypes were identi- sely related alleles (Fig. 3, Appendix 1). All alleles of both genes fied for C. amazonicus (Appendix 1), with a total of 623 variable were unique to one of the lineages A–E diagnosed by the mito- sites, 535 of them parsimoniously informative (Table 2). Parsimony chondrial data, and 12 alleles (6 for RAG-1 and 6 for c-mos) were analysis of the combined mitochondrial data set produced 2021 private to single localities. Most of these alleles occurred in low fre- equally most parsimonious trees (L = 2098; CI = 0.46; RI = 0.92), quencies, but three localities with N > 1 (localities 14, 22, and 24) with 75% of well-supported nodes in the consensus tree (data were fixed for a specific private allele (Appendix 1). not shown). Comparison of Bayes factors favoured the scheme par- Parsimony analysis of nuclear genes yielded only one parsimo- titioned by gene and codon or stem/loop (Table 3), and the result- nious tree for RAG-1 (L = 136; CI = 0.96; RI = 0.97), four equally ing tree presented a topology largely congruent with the MP most parsimonious trees for c-mos (L = 82; CI = 0.96; RI = 0.97), analysis, with 67% of the nodes well-supported (Fig. 2). Differences and 21 equally most parsimonious trees for the combined genes between consensus trees were restricted to relationships between (L = 221; CI = 0.95; RI = 0.98). Comparison of Bayes factors favoured some localities that presented low branch support for both the scheme partitioned by codon for RAG-1 and the unpartitioned methods. one for c-mos (Table 3), and consensus resulting trees presented Monophyly of C. amazonicus was highly supported, and sampled topologies congruent with the MP analysis but with higher values localities from eastern and central Amazonia were genetically dis- of node support (Fig. 4). Phylogenetic estimates of the nuclear tinct, following the pattern of subdivision already described else- genes were largely consistent with mitochondrial analysis, rein- where (Geurgas et al., 2008). Five well-supported haplotype forcing the primary split between eastern and central Amazonia clades (A–E) could be delineated within these major geographical and lineages A–E as diagnosed by mitochondrial haplotypes. Vari- groupings (Figs. 1 and 2). The eastern group comprises two haplo- ation in c-mos was unable to diagnose lineage B or to resolve phy- type clades consisting of localities geographically restricted to the logenetic relationships among lineages C–E, possibly because the left (clade A) and right (clade B) margins of the Amazon River. In low mutation rate of this gene yielded too few informative poly- central Amazonia, haplotype clades C and D were restricted to morphisms. However, as there is not a topological incongruence the right margin of the Madeira River whereas haplotype clade E among trees, this lack of resolution should not be considered gene- included all populations north of the Madeira River, including the alogical discordance (Dettman et al., 2003). population of the Anavilhanas Archipelago (locality 21). Although the geographical distribution of haplotype clade D is closest to that of haplotype clade C, the phylogenetic results consistently indi- 4. Discussion cated a sister-taxon relationship between clades D and E. Corrected mean net sequence divergence between haplotype An initial step in delimiting species is to diagnose lineages of clades within eastern or central Amazonia ranged from 9.1% to ancestor-descendant populations that are genetically isolated from 20.7% for the entire mtDNA dataset and from 8.9% to 15.2% for other such lineages (Baker and Bradley, 2006). In the traditional the cytb gene (Table 4). Variability within haplotype clades of east- morphology-based taxonomy, identification of these lineages re- ern lineage was much smaller than clades of the central Amazonia, lies, among other factors, on the number of characters analysed, ranging between 1.3% and 8.6% for the entire mtDNA dataset and on the interpretation of character polymorphism and consequently 1.9–11.1% for the cytb gene (Table 4). All localities but one (locality on the recognition of diagnostic synapomorphies supporting the 3, clade A; Fig. 2) were monophyletic and exclusive in relation to hypothesis of reproductive isolation between the putative taxa. the mitochondrial haplotypes. Relationships among localities ran- In evolutionarily conservative groups such as Coleodactylus, ged from unresolved to well-supported, with values of uncorrected however, external morphology provides limited information and mean sequence divergences between sister localities ranging from lineages are often not easily diagnosed. In C. amazonicus particu- shallow (0.5%, localities 19/20, clade D) to deep (6.3%, localities 22/ larly, as no correlation was found between geographic distribution 23, clade E) for the entire mtDNA dataset (Table 6). In general, geo- and variation in meristic characters or color pattern, only one 588 S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593
Fig. 2. Bayesian tree topology obtained from the mitochondrial data set combined (16S + cytb + ND4). Terminal branches correspond to haplotypes as designed in Appendix 1, and numbers in parentheses correspond to localities in Fig. 1. The 50% majority-rule consensus phylogram and posterior probabilities were estimated from 39,802 trees derived from analysis under the eight-partition model (see Table 2 for evolutionary models used). Stippled lines indicate branches not recovered in the 50% majority-rule consensus of 2021 equally maximum parsimonious trees (length: 2098; consistency index: 0.46, retention index: 0.92). The values assigned to the internodes indicate MP bootstrap and posterior probabilities values, respectively. Branches with bootstrap and posterior probabilities support values below 70% and 95% are not reported. species is admitted (Vanzolini, 1957; Ávila-Pires, 1995). However, (Baum and Shaw, 1995), molecular results from our wider geo- a previous molecular study found deep genetic divergence among graphic sampling indicate that ‘‘C. amazonicus” is a species complex geographical populations of C. amazonicus (Geurgas et al., 2008), containing at least five potential phylogenetic species, correspond- raising doubts about the taxonomic status of the species. ing to mitochondrial haplotype clades A–E recovered in phyloge- Assuming a genealogic congruence between mitochondrial and netic reconstructions (Figs. 1 and 2). All five lineages are deeply nuclear genes as an operational criteria for species delimitation divergent from one another and are characterized by exclusive S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593 589
Table 4 (reviewed in Moritz et al., 2000), and Rull, 2008). These divergence Corrected net sequence divergence (%) of the entire mtDNA dataset (below diagonal) time estimates are also compatible with the major paleogeo- and cytb sequences (above diagonal) within and among the five mitochondrial graphic and paleoenvironmental changes that occurred in South lineages recovered in phylogenetic analysis. America during the Neogene, such as marine incursions, the An- ABC D E dean orogeny, and the formation of the modern Amazon drainage Lineage A 8.9 27.4 32.7 30.6 system (e.g, Hoorn et al., 1995; Lovejoy et al., 1998; Lundberg et al., Lineage B 9.1 27.8 33.5 30.2 1998). Uncertainties about the estimated divergence times, the Lineage C 26.9 26.4 15.2 15.1 biological meaning of the high divergence among some localities Lineage D 26.6 26.1 18.9 10.0 Lineage E 28.9 27.5 20.7 16.4 (see Discussion below) and even the geographical range of these Within 1.3 2.1 8.6 4.6 8.1 phylogenetic species leave open many possible explanations about mtDNA (0.0–3.7) (0.0–5.5) (0.0–12.7) (0.0–7.7) (0.0–13.3) the diversification in the complex. As reported for other taxa (e.g., Within cytb 1.9 3.1 11.1 7.2 10.7 Aleixo, 2004; Aleixo and Rossetti, 2007; Santos et al., 2009), it is (0.0–5.9) (0.0–8.0) (0.0–16.3) (0.0–15.2) (0.0–20.6) likely that several events had played influential roles in diversifica- tion of ‘‘C. amazonicus” in different time scales. Nevertheless, although the contemporary allopatric distributions of sister lin- Table 5 eages suggests a main role of vicariant events in generating species Divergence-time (Myr) estimates for divergences among lineages within Coleodacty- diversity in the complex, sympatric (lineages C, D/E) and peripatric lus amazonicus (Fig. 2) based on cytb gene dataset. speciation (lineages D/E) cannot be ruled out (Schluter, 2001; Losos Divergence Net sequence 0.87%/Myra 1.40%/Myrb and Glor, 2003). between divergence (%) The divergence criterion followed here is conservative, and we Lineages A vs B 8.9 10.3 6.4 recognize as potential species only the deepest branches of the tree Lineages D vs E 10.0 11.5 7.1 corresponding to exclusive clades of haplotypes and alleles geo- Lineages C vs D, E 12.8 14.8 9.1 graphically coincident recovered with maximum support value in b Central vs east 24.6 28.4 17.6 the analysis (corresponding to the basal lineages of Wiens and a Rate based on the divergence-time estimate of central and east geographical Penkrot, 2002). One of the critics to the use of this criterion for groupings of localities (28.4 Myr**; Geurgas et al., 2008) defining species limits, however, is that species, mainly those re- b Maximum rate estimated for cytb in Squamata cent or incipient, are not necessarily exclusive in their gene pool due retention of ancestral polymorphisms or introgression (Neigel and Avise, 1986; Avise and Ball, 1990). The two nuclear genes ana- groups of alleles for both nuclear genes analised, suggesting a long lysed in this study are extremely conserved and used to recover evolutionary history of genetic isolation among them. This phylo- deep branches in phylogenetic trees (e.g., Townsend et al., 2004; genetic congruence is reinforced by the allopatric distributions of Gamble et al., 2008; Geurgas et al., 2008; but see Godinho et al., lineages A–E, restricted to northeastern (lineage A), southeastern 2006). Most alleles from both genes are shared among localities (lineage B), central-northern (lineage E) and central-southern (lin- belonging to the same lineage, but some geographically isolated eages C and D) parts of Amazon Basin. Even between lineages C and or distant localities (such as localities 1, 6, 14, 17 and 24) differed D, which are apparently parapatric with no major river that could slightly in their allelic composition, displaying private alleles either act as a barrier to gene flow, no intermediate genotypes (heterozy- fixed or in low frequencies for one of the nuclear genes. In a few gotes or recombinants) have been detected, reinforcing the instances, small groups of geographically close localities share pri- hypothesis of lack of interbreeding among lineages. vate alleles (localities 7/8, 15/16, and 25/26) or are clustered into Considering the range of evolutionary rates between 0.87% and subclades in the analyses of the nuclear genes combined (localities 1.40%/Myr, a rough estimate places the divergence among lineages 15/16, 21/22, and 25/26/27). While this pattern can be interpreted in the middle or late Miocene (Table 5), largely in agreement with as the result of an isolation by distance, with gene flow occurring the timing of diversification in several other South American taxa exclusively between adjacent localities, the alternative explanation
c02.A c01.A 277 502 237 r11.D* r16.E* r17.E* 236 c04.B c05.B 605 282 623 r14.E c03.B r15.E r13.E r10.D* 77, 116, 76, 39 r01.A 19, 100, 217, 251, 253 256, 395 340, 91 261, 290, 303, 462, 469 170 440 340, 440 c13.E* r12.D 150, 151, 1, 17, 34, 46, 47, 95, 99, 128, 336 c14.E* 299 159, 194, 260, 277, 352, 378, 380, 390, 399, 411, 428, 460, 151 r04.B* 470, 503, 557, 587, 617 281 477 352 280 r06.C c11.E c06.C 88 441 r02.B* 18 647 r08.C* c07.C 269 c12.E c08.D* r07.C r09.C r03.B * 3116,79 r05.C* 256,284 * 395 251 225 c09.D* c10.D*
Fig. 3. Median-joining network of c-mos and RAG-1 alleles. Circles represent individual alleles, with size proportional to the number of individuals analysed (see Appendix 1). Alleles with asterisks represent those found in heterozygotes, and black circles indicate missing intermediates. Mutational differences between alleles are indicated on lines, numbered according to their position in the sequence alignment of this study. 590 S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593
C. septentrionalis C. septentrionalis C. meridionalis C. meridionalis r01.A (1,2,3,4) 63/ 0.95 c01.A (1) r02.B (5,7) c02.A (1,2,3,4) 63/ 0.99 r03.B (6,7,8) c03.B (5,7) 62/ 0.99 r04.B (7,8) c04.B (6) r05.C (9,10,11,12,13,14) 66/ 0.99 r07.C (11,13) c05.B (7,8) r08.C (15,16) c06.C (9,10,11,12,13,15,16) r09.C (15) c07.C (14) r06.C (10,11,12,13) c08.D (17,18,19,20) r10.D (17,18,19,20) r11.D (18) c-mos c09.D (17) RAG-1 r12.D (19) c10.D (19) BS ≥ 95; PP ≥ 0.99 BS ≥ 95; PP ≥ 0.99 r13.E (21) c11.E (21,22,23,26,27) BS ≥ 70; PP ≥ 0.95 BS ≥ 70; PP ≥ 0.95 r14.E (22) c12.E (24) r15.E (23,24,25,26) 59/ 0.99 c13.E (25,26) r16.E (25,26,27) 61/ 0.99 r17.E (27) 64/ 0.99 0.1 c14.E (26) 0.1
C. septentrionalis C. meridionalis r01.A/c01.A (1) r01.A/c02.A (1,2,3,4) r02.B/c03.B (5) r02.B/c05.B (7) r03.B/c04.B (6) r03.B/c05.B (7,8) 64/ 0.98 r04.B/c05.B (7,8) r04.B/c03.B (7) r05.C/c06.C (9,10,11,12,13) 59/ 0.99 r05.C/c07.C (14) r07.C/c06.C (11,13) r08.C/c06.C (15,16) r09.C/c06.C (15) r06.C/c06.C (10,11,12,13) r10.D/c08.D (17,18,19,20) r10.D/c09.D (17) RAG-1 + c-mos r11.D/c08.D (18) r12.D/c08.D (19) BS ≥ 95; PP ≥ 0.99 63/ 0.99 r12.D/c10.D (19) r13.E/c11.E (21) r14.E/c11.E (22) r15.E/c11.E (23) r15.E/c12.E (24) 64/ 0.97 r15.E/c13.E (25) r16.E/c13.E (25,26) r16.E/c14.E (26) r16.E/c11.E (26,27) 0.1 r17.E/c11.E (27)
Fig. 4. Bayesian tree topologies obtained from separate and combined analyses of c-mos and RAG-1. Terminal branches correspond to alleles as designed in Appendix 1, and numbers in parentheses correspond to localities in Fig. 1. The 50% majority-rule consensus phylogram and posterior probabilities were estimated from 39,802 trees derived from each analysis under the unpartitioned model for c-mos and six-partition model for RAG-1 (see Table 2 for evolutionary models used). Stippled lines indicate branches not recovered in the 50% majority-rule consensus of the equally maximum parsimonious trees (c-mos: three trees, length: 62; consistency index: 0.95, retention index: 0.96; RAG-1: one tree, length: 101; consistency index: 0.95, retention index: 0.97; c-mos + RAG-1: 21 trees, length: 221; consistency index: 0.95, retention index:0.98). The values assigned to the internodes indicate MP bootstrap and posterior probabilities values, respectively. Branches with bootstrap and posterior probabilities support values above 70% and 95% are not reported. of persistence of ancestral polymorphism of the more slowly evolv- these groups or localities could be interpreted as 10 additional po- ing nuclear genes between recently derived species cannot be re- tential species. Refining the limits of putative species within clades jected. Conversely, mtDNA has a higher mutation rate than the based on the mitochondrial variability, however, represents a diffi- nuclear genes, and localities of ‘‘C. amazonicus” are characterized cult task. For some authors (e.g., Wiens and Penkrot, 2002; Hebert by high levels of genetic differentiation in mitochondrial data. No et al, 2004), the shorter coalescence time of mtDNA relative to nu- mtDNA haplotype is shared between any locality, and despite the clear genes is considered one of the most important properties in relatively low intrapopulational polymorphism, divergence among delimiting species, since they become phylogenetically distinct localities is generally high. In fact, small groups of them (localities for this marker well before they become distinct for nuclear genes 9/10/12; 15/16; 17/19/20; 22/23; 25/26/27) or even single locali- (Zink and Barrowclough, 2008). However, as mitochondrial haplo- ties (11, 13, 18, 21, 24) of lineages C, D and E constitute highly types are related by a strictly bifurcating genealogy due to their divergent genetic lineages, presenting uncorrected average dis- nonrecombining and matrilineal mode of inheritance, deeply tances that exceed intraspecific and even congeneric species values divergent mitochondrial lineages may be maintained in contiguous reported for reptiles (Hendry et al., 2000; Harris, 2002). Consider- populations even in the absence of any reproductive barrier, result- ing a threshold of 8.5% as the maximum intraspecific value for cytb, ing in a phylogeographic structure derived merely from the S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593 591
Table 6 Uncorrected mean net sequence divergence of mitochondrial dataset (below diagonal) and cytb sequences (above diagonal) within (diagonal, only for the entire dataset) and between sampled localities (corrected for within population polymorphism). Boxes enclose divergence values between localities belonging to the same major clade (A–E).
stochastic lineage sorting of ancestral polymorphisms. The popula- what is clear from the results is that the diversity of ‘‘C. amazonicus” tion structure is boosted in species with limited vagility in frag- has been underestimated. Although more data are needed prior mented habitats, in which populations can be partially isolated to formal recognition of lineages A–E as taxonomic species, this not only by distance alone but also by biotic and abiotic factors study provides a framework for future studies in this complex. that can act as barriers to dispersal on a fine geographic scale (Irwin, 2002; Kuo and Avise, 2005; Avise, 2009). In these cases, Acknowledgments DNA-based approaches might overestimate the number of poten- tial species (Sites and Marshall, 2004; Agapow et al., 2004), and We thank the Fundação de Amparo a Pesquisa do Estado de São complementary data sources, such as ecological niche modeling Paulo (FAPESP), Brazil, (Grants 00/13213, 03/10335, and fellowship (e.g., Raxworthy et al., 2007; Rissler and Apodaca, 2007; Leaché Grants 00/10092 and 05/54516 to S.R.G) for major funding for this et al., 2009) should be combined to help in species delimitation. project, and the Conselho Nacional de Desenvolvimento Científico Whether these nuclear and mitochondrial differentiation repre- e Tecnológico (CNPq) for financial support to M.T. Rodrigues. We are sents species boundaries remains to be investigated further, but thankful to C.M. Carvalho, F.C. Franco, A. Fouquet, M.B. de Oliveira 592 S.R. Geurgas, M.T. Rodrigues / Molecular Phylogenetics and Evolution 54 (2010) 583–593
Dixo, D. Pavan, J. M. Silva, G. Skuk, S.M de Souza, A. Torres, V.K. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the Verdade, R.C. Vogt, and V. Xavier for their help in field or providing bootstrap. Evolution 39, 783–791. Fouquet, A., Vences, M., Salducci, M., Meyer, A., Marty, C., Blanc, M., Gilles, A., 2007. tissues samples, and M. Conscistré and S. Baroni for their technical Revealing cryptic diversity using molecular phylogenetics and phylogeography support. In particular, S.R.G. is grateful to Y. Yonenaga-Yassuda for in frogs of the Scinax ruber and Rhinella margaritifera species groups. Mol. kindly providing office space and permitting use of the laboratory Phylogenet. Evol. 43, 567–582. Freire, E.M.X., 1999. Espécie nova de Coleodactylus Parker, 1926, das dunas de Natal, facilities during part of this project, and M.A. Van Sluys for allowing Rio Grande do Norte, Brasil, com notas sobre as relações de dicromatismo use of the automated sequencer of the Biologia Molecular de sexual no gênero (Squamata, Gekkonidae). Bol. Mus. Nac., N. S., Rio de Janeiro Plantas laboratory. The authors also thank the anonymous referee 399, 1–14. Fu, J., Zeng, X., 2008. How many species are in the genus Batrachuperus?A and the editor for their helpful comments to the earlier version of phylogeographical analysis of the stream salamanders (family Hynobiidae) this manuscript. Part of this work was carried out by using the from southwestern China. Mol. Ecol. 17, 1469–1488. resources of the Computational Biology Service Unit from Cornell Gamble, T., Bauer, A.M., Greenbaum, E., Jackman, T.R., 2008. Evidence for Gondwanan vicariance in an ancient clade of gecko lizards. J. Biogeogr. 35, University which is partially funded by Microsoft Corporation. 88–104. Gardner, T.A., Ribeiro-Júnior, M.A., Barlow, J., Ávila-Pires, T.C.S., Hoogmoed, M.S., Peres, C.A., 2007. The value of primary, secondary, and plantation forests for a Appendix A. Supplementary data neotropical herpetofauna. Conserv. Biol. 21, 775–787. Geurgas, S.R., Rodrigues, M.T., Moritz, C., 2008. The genus Coleodactylus Supplementary data associated with this article can be found, in (Sphaerodactylinae, Gekkota) revisited: a molecular phylogenetic perspective. Mol. Phylogenet. Evol. 49, 92–101. the online version, at doi:10.1016/j.ympev.2009.10.004. Godinho, R., Crespo, E.G., Ferrand, N., Harris, D.J., 2005. Phylogeny and evolution of the green lizards, Lacerta spp. (Squamata: Lacertidae) based on mitochondrial and nuclear DNA sequences. Amph. Rept. 26, 271–285. References Godinho, R., Domingues, V., Crespo, E.G., Ferrand, N., 2006. Extensive intraspecific polymorphism detected by SSCP at the nuclear Cmos gene in the endemic Iberian lizard Lacerta schreiberi. Mol. Ecol. 15, 731–738. Agapow, P.M., Bininda-Edmonds, O.R.P., Crandall, K.A., Gittleman, J.L., Mace, G.M., Good, D.A., Wake, D.B., 1992. Geographic variation and speciation in the torrent Marshall, J.C., Purvis, A., 2004. The impact of species concept on biodiversity. Q. salamanders of the genus Rhyacotriton (Caudata: Rhyacotritonidae). Univ. Calif. Rev. Biol. 79, 161–179. Pub. Zool. 126, 1–91. Aleixo, A., 2004. Historical diversification of a ‘‘terra-firme” forest bird superspecies: Gübitz, T., Thorpe, R.S., Malhotra, A., 2000. Phylogeography and natural selection in a phylogeographic perspective on the role of different hypotheses of Amazonian the Tenerife gecko Tarentola delalandii: testing historical and adaptive diversification. Evolution 58, 1303–1317. hypotheses. Mol. Ecol. 9, 1213–1221. Aleixo, A., Rossetti, D.F., 2007. Avian gene trees, landscape evolution, and geology: Hare, M.P., 2001. Prospects for nuclear gene phylogeography. Trends Ecol. Evol. 16, towards a modern synthesis of Amazonian historical biogeography? J. Ornithol. 700–706. 148, 443–453. Harris, D.J., 2002. Reassessment of comparative genetic distance in reptiles from the Arévalo, E.S., Davis, S.K., Sites Jr., J.W., 1994. Mitochondrial DNA sequence mitochondrial cytochrome b gene. Herpetol. J. 12, 85–87. divergence and phylogenetic relationships among eight chromosome races of Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., Francis, C.M., 2004. Identification of birds the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Syst. through DNA barcodes. PLoS Biol. 2, e312. Biol. 43, 387–418. Hendry, A.P., Vamosi, S.M., Latham, S.J., Heilbuth, J.C., Day, T., 2000. Questioning Ávila-Pires, T.C., 1995. Lizards of Brazilian Amazonia (Reptilia, Squamata). species realities. Cons. Genet. 1, 67. Zoologishe Verch., Leiden 299, 1–706. Hoorn, C., Guerrero, J., Sarmiento, G.A., Lorente, M.A., 1995. Andean tectonics as a Avise, J.C., 1994. Molecular Markers, Natural History and Evolution. Chapman & cause for changing drainage patterns in Miocene northern South America. Hall, New York. Geology 23, 237–240. Avise, J.C., 2000. Phylogeography: The History and Formation of Species. Harvard Huson, D.H., Bryant, D., 2006. Application of phylogenetic networks in evolutionary Univ. Press, Cambridge, MA. studies. Mol. Biol. Evol. 23, 254–267. Available from
Newton, M.A., Raftery, A.E., 1994. Approximate bayesian inference by the weighted Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary likelihood bootstrap (with discussion). J. R. Stat. Soc. B Met. 56, 3–48. Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W: improving the Evolutionary Biology Centre, Uppsala University. sensitivity of progressive multiple sequence alignment through sequence Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., 1991. weighting, position-specific gap penalties and weight matrix choice. Nucleic The simple fool’s guide to PCR. University of Hawaii Press, Honolulu, HI. Acids Res. 22, 4673–4680. Pfenninger, M., Schwenk, K., 2007. Cryptic animal species are homogeneously Townsend, T., Larson, A., Louis, E., Macey, J., 2004. Molecular phylogenetics of distributed among taxa and biogeographical regions. BMC Evol. Biol. 7, 121. Squamata: the position of snakes, amphisbaenians, and dibamids, and the root Posada, D., Crandall, K.A., Holmes, E.C., 2002. Recombination in evolutionary of the squamate tree. Syst. Biol. 53, 735–757. genomics. Annu. Rev. Genet. 36, 75–97. Vanzolini, P.E., 1957. O gênero Coleodactylus (Sauria, Gekkonidae). Pap. Avulsos Dep. Raxworthy, C.J., Ingram, C.M., Rabibisoa, N., Pearson, R.G., 2007. Applications of Zool. (São Paulo) 13, 1–17. ecological niche modeling for species delimitation: a review and empirical Vanzolini, P.E., 1968a. Lagartos brasileiros da família Gekkonidae (Sauria). Pap. evaluation using day geckos (Phelsuma) from Madagascar. Syst. Biol. 56, 907– Avulsos Dep. Zool. (São Paulo) 17, 1–84. 923. Vanzolini, P.E., 1968b. Geography of the South American Gekkonidae (Sauria). Arq. Rissler, L.J., Apodaca, J.J., 2007. Adding more ecology into species delimitation: Zool. (São Paulo) 17, 85–112. ecological niche models and phylogeography help define cryptic species in the Vanzolini, P.E., 1980. Coleodactylus septentrionalis, sp. N., with notes on distribution black salamander (Aneides flavipunctatus). Syst. Biol. 56, 924–942. of the genus (Sauria, Gekkonidae). Pap. Avulsos Zool. (São Paulo) 34, 1–9. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference Vitt, L.J., Sartorius, S.S., Ávila-Pires, T.C.S., Zani, P.A., Espósito, M.C., 2005. Small in a under mixed models. Bioinformatics 19, 1572–1574. big world: ecology of leaf-litter geckos in New World tropical forests. Herpetol. Rull, V., 2008. Speciation timing and neotropical biodiversity: the Tertiary– Monogr. 19, 137–152. Quaternary debate in the light of molecular phylogenetic evidence. Mol. Ecol. Vogler, A.P., Monaghan, M.T., 2007. Recent advances in DNA taxonomy. J. Zool. Syst. 17, 2722–2729. Evol. Res. 45, 1–10. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. Cold Spring Whiting, A.S., Bauer, A.M., Sites Jr., J.W., 2003. Phylogenetic relationships and limb Harbour Laboratory Press, A Laboratory Manual. Cold Spring Harbour. loss in sub-saharan African scincine lizards (Squamata: Scincidae). Mol. Santos, J.C., Coloma, L.A., Summers, K., Caldwell, J.P., Ree, R., Cannatella, D.C., 2009. Phylogenet. Evol. 29, 582–598. Amazonian amphibian diversity is primarily derived from Late Miocene Andean Wiens, J.J., 2008. Systematics and herpetology in the age of genomics. BioScience 58, lineages. PLoS Biol. 7 (3), e1000056. 297–307. Schierup, M.H., Hein, J., 2000. Consequences of recombination on traditional Wiens, J.J., Penkrot, T.A., 2002. Delimiting species using DNA and morphological phylogenetic analysis. Genetics 156, 879–891. variation and discordant species limits in spiny lizards (Sceloporus). Syst. Biol. Schluter, D., 2001. Ecology and the origin of species. Trends Ecol. Evol. 16, 372–380. 51, 69–91. Sites Jr., J.W., Marshall, J.C., 2004. Operational criteria for delimiting species. Annu. Willett, C.E., Cherry, J.J., Steiner, L.A., 1997. Characterization and expression of the Rev. Ecol. Evol. Syst. 35, 199–227. recombination activating genes (rag1 and rag2) of zebrafish. Immunogenetics Sota, T., Vogler, A.P., 2003. Reconstructing species phylogeny of the carabid beetles 45, 394–404. Ohomopterus using multiple nuclear DNA sequences: heterogenous information Zamudio, K.R., Greene, H.W., 1997. Phylogeography of the bushmaster (Lachesis content and the performance of simultaneous analyses. Mol. Phyl. Evol. 26, muta:Viperidae): implications for neotropical biogeography, systematics, and 139–154. conservation. Biol. J. Linn. Soc. 62, 421–442. Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony ( and other Zink, R.M., Barrowclough, G.F., 2008. Mitochondrial DNA under siege in avian methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachusetts. phylogeography. Mol. Ecol. 17, 2107–2121.