(Sphaerodactylinae, Gekkota) Revisited: a Molecular Phylogenetic Perspective

Molecular Phylogenetics and Evolution 49 (2008) 92–101

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

The genus Coleodactylus (Sphaerodactylinae, Gekkota) revisited: A molecular phylogenetic perspective

Silvia Rodrigues Geurgas a,*, Miguel Trefaut Rodrigues a, Craig Moritz b a Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, 05508-090, São Paulo, SP, Brazil b Museum of Vertebrate Zoology, 3101 Valley Life Sciences Building #3160, UC Berkeley, CA 94720, USA article info abstract

Article history: Nucleotide sequence data from a mitochondrial gene (16S) and two nuclear genes (c-mos, RAG-1) were Received 31 January 2008 used to evaluate the monophyly of the genus Coleodactylus, to provide the first phylogenetic hypothesis Revised 28 May 2008 of relationships among its species in a cladistic framework, and to estimate the relative timing of species Accepted 30 May 2008 divergences. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the combined data Available online 7 June 2008 sets retrieved Coleodactylus as a monophyletic genus, although weakly supported. Species were recovered as two genetically and morphological distinct clades, with C. amazonicus populations forming the sister Keywords: taxon to the meridionalis group (C. brachystoma, C. meridionalis, C. natalensis, and C. septentrionalis). Within Coleodactylus this group, C. septentrionalis was placed as the sister taxon to a clade comprising the rest of the species, Sphaerodactylinae Phylogeny C. meridionalis was recovered as the sister species to C. brachystoma, and C. natalensis was found nested Pleistocene refuges within C. meridionalis. Divergence time estimates based on penalized likelihood and Bayesian dating 16S methods do not support the previous hypothesis based on the Quaternary rain forest fragmentation RAG-1 model proposed to explain the diversification of the genus. The basal cladogenic event between major c-mos lineages of Coleodactylus was estimated to have occurred in the late Cretaceous (72.6 ± 1.77 Mya), approximately at the same point in time than the other genera of Sphaerodactylinae diverged from each other. Within the meridionalis group, the split between C. septentrionalis and C. brachystoma + C. meridionalis was placed in the Eocene (46.4 ± 4.22 Mya), and the divergence between C. brachystoma and C. meridionalis was estimated to have occurred in the Oligocene (29.3 ± 4.33 Mya). Most intraspecific cladogenesis occurred through Miocene to Pliocene, and only for two conspecific samples and for C. natalensis could a Quaternary differentiation be assumed (1.9 ± 1.3 Mya). Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction tral Amazonian Forest, and through southern Venezuela to southern Guyana (Ávila-Pires, 1995); C. meridionalis is associated The New World Sphaerodactylinae includes five genera of diur- mainly with the Atlantic Forest, but also occurs in fragments of for- nal geckos found in forested areas in West Indies, Central and ests in Caatinga and Cerrado (Vanzolini, 1980; Freire, 1999; Colli northern South America: Coleodactylus, Gonatodes, Lepidobepharis, et al., 2002), and C. brachystoma occurs in forested enclaves in Pseudogonatodes, and Sphaerodactylus (Underwood, 1954; Kluge, the Cerrado of Central Brazil (Vanzolini, 1968a,b, 1970; Colli 1967, 1987, 1995; Gamble et al., 2008a). Monophyly of sphaero- et al., 2002). The other two species have a more restricted distribu- dactyls is well supported by both morphological (Noble, 1921; tion: C. septentrionalis occurs from eastern Venezuela to western Kluge, 1987, 1995) and molecular data (Gamble et al., 2008a). Ex- Suriname and northern Roraima, (Ávila-Pires, 1995) and C. natalen- cept for Gonatodes, genera present claws enclosed in an ungual sis is confined to forested areas between dunes at the Parque Nac- sheath, one of the characters long recognized as diagnostic as diag- ional das Dunas, Rio Grande do Norte (Freire, 1999). Although all nostic of the family (Noble, 1921; Kluge, 1967, 1995). Accounting species are restricted to the leaf litter (Vanzolini, 1980; Ávila-Pires, for only five of the about 150 species described for the subfamily, 1995), C. amazonicus is basically found in shaded forest environ- Coleodactylus is the most widespread genus in Brazil, extending ments (Vitt et al., 2005), whereas the other species can occur in its distribution from eastern Amazonian Forest, through Cerrado habitats ranging from closed-canopy wet forests to more mesic and Caatinga in central Brazil to the Atlantic Forest. Three species open formations (Vanzolini, 1980; Ávila-Pires, 1995; Freire, 1999; are widely distributed: C. amazonicus is found in eastern and cen- Vitt et al., 2005). The most remarkable biogeographic characteristic of * Corresponding author. Fax: +55 11 3091 7553. Coleodactylus is the broad disjunct distribution of C. meridionalis E-mail address: [email protected] (S.R. Geurgas). and C. septentrionalis. These species are inferred to be closely

1055-7903/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2008.05.043 S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 93 related (Vanzolini, 1980), but are separated by the Amazon ba- provide the first phylogenetic hypothesis of relationships among sin, which is occupied by the congener, C. amazonicus. The at- its species in a cladistic framework, and (3) estimate the relative tempt to explain this pattern of distribution was fundamental timing of species divergences. The results were compared with for the development of the diversification model of South Amer- the previous hypothesis based on the Quaternary rain forest frag- ican biota based on recent and rapid cycles of forest expansion mentation model proposed to explain the diversification of the and retraction caused by climatic alterations proposed by Vanz- genus. olini and Williams (1970) for the Anolis nitens (formely Anolis chrysolepis; Ávila-Pires, 1995) species group (Vanzolini, 1980). 1.1. Systematic background Considering the Amazon basin as the putative center of Coleo- dactylus diversification and the limited dispersal capacity of Barbour (1921), in his review of the genus Sphaerodactylus, these leaf litter geckos, the disjunct distribution was interpreted noticed that the species described as S. meridionalis Boulenger, as evidence of speciation by geographical isolation caused by 1888, collected on the northeastern region of the Atlantic successive disruptions of a formerly continuous forest (Vanzolini, coast, and S. amazonicus Andersson, 1918, collected in the 1957, 1968b, 1970, 1980; Vanzolini and Williams, 1970). Accord- Amazon Basin near Manaus, although having an asymmetrical ing to Vanzolini’s (1957, 1968b, 1970, 1980) hypothesis, a first ungual sheath, did not present the supraciliary spine character- episode of forest fragmentation would have led to the differenti- istic of all species of Sphaerodactylus, and suggested that they ation of the widespread ancestral stock in C. brachystoma in a should not belong to the genus. Parker (1926) erected the southern refuge and C. meridionalis in a northern refuge. The lat- genus Coleodactylus for S. meridionalis, based on the lack of ter species expanded its range through a continuous forest the supraciliary spine, clavicle not perforated and differences across the Amazon basin and Atlantic Forest during the subse- in composition and asymmetry of the five scales enclosing quent wetter period. A second fragmentation episode would the claws. Subsequently, Wettstein (1928) described a new have separated eastern and western populations of C. meridional- species, C. zernyi, from the lower Tapajós River in Amazon ba- is, giving rise to C. septentrionalis and promoting the speciation sin, which was distinguishable from C. meridionalis by having of C. amazonicus in a non-specified refuge. Competitive exclusion keeled dorsal scales and one post-nasal, and from S. amazoni- with C. amazonicus (Vanzolini, 1968b, 1970) or ecological adapta- cus by the number of post-nasals and absence of a pattern tions of C. meridionalis and C. septentrionalis to drier formations of longitudinal bands on the head. The differences in number, could have precluded these species from recolonizing the Ama- shape, and asymmetry of the ungual sheath scales in relation zon Basin (Vanzolini, 1980). to that of C. meridionalis were described. Despite of the lack Despite studies focused on intraspecific morphological varia- of the supraciliary spine, the justification for incorporing the tion (Vanzolini, 1957; Ávila-Pires, 1995; Freire, 1999), ecology new species into the genus Coleodactylus instead of in Sphaero- (Ramos, 1981; Vitt et al., 2005), and karyotype description (San- dactylus was the absence of a second outer scale on the ungual tos et al., 2003), the knowledge about Coleodactylus is extremely sheath. limited, and even the monophyly of the genus has yet to be In the only review of the genus Coleodactylus, Vanzolini established. Since the species were intuitively grouped based on (1957) synonymized S. amazonicus and C. zernyi within C. the overall conservative morphology and structure and asymme- amazonicus and placed Homonota brachystoma Amaral, 1935, try of the ungual sheath (Vanzolini, 1957), the monophyly of and S. pfrimeri Miranda-Ribeiro, 1937, in the synonymy of C. Coleodactylus have been accepted, yet so far not rigorously tested. brachystoma. A new species, C. guimaraesi, was described from Although having an asymmetrical digit, C. amazonicus has four the upper Madeira River in Amazon Basin, differing from C. scales forming the ungual sheath instead of the five scales de- amazonicus in having smooth dorsal scales and presenting some scribed for the other species of the genus. The biological meaning differences on the ungual sheath, based on a scheme of putative of this variation is unknown, but since the relevance of terminal fusions of different scales (Vanzolini, 1968a). Additionally, the toe pad scalation in delimiting sphaerodactyl genera has long author confirmed the disjunct distribution of over 2000 km be- been recognized (Noble, 1921; Parker, 1926), this issue deserves tween populations of C. meridionalis from northwestern Amazo- a further investigation. nia and northeastern Brazil, already related by Parker (1935). In addition, the diversification hypothesis proposed by Vanz- Based on general morphological features and geographical distri- olini (1957, 1968b, 1970, 1980) rests on some other premises bution in relation to the Amazon basin, Vanzolini (1957) identi- that also remain untested, one of them concerning the assumed fied three evolutionary branches in Coleodactylus, represented by close relationship between species displaying the disjunction. No C. amazonicus, C. meridionalis, and C. brachystoma + C. guimaraesi, formal phylogenetic analysis had been done for the genus, and in a pre-cladist scheme that can be considered the first phyloge- the affinity between C. meridionalis and C. septentrionalis was netic hypotheses for the genus. No sister-group relationships based entirely on external morphological similarities (Vanzolini, among branches were explicitly indicated, and apparently all 1980). Therefore, phylogenetic relationships among species re- lineages were considered to be derived directly from the ances- main unknown, making any biogeographic interpretation specu- tral stock. lative. Finally, for the diversification of Coleodactylus to be A more careful evaluation led Vanzolini (1968a,b) to correct the consistent with the scenario of recent speciation proposed, spe- description of dorsal scales of C. guimaraesi from smooth to keeled, cies should exhibit a divergence time frame roughly correspond- and to reinterpret relationships among species in a pre-cladistic ing to the Pleistocene. A recent molecular phylogenetic study, evaluation of shared plesiomorphic (smooth dorsal scales and less however, indicated a late Cretaceous origin for the New World asymmetrical digits) and apomorfic (keeled dorsal scales and more sphaerodactyl genera, and placed the divergence between C. bra- asymmetrical digits) character states. The author mentioned chystoma and C. septentrionalis during Oligocene (Gamble et al., (1968a) that Coleodactylus might be represented by two pairs of 2008a), suggesting a much deeper history for Coleodactylus subspecies, C. meridionalis + C. brachystoma and C. amazonicus + diversification. C. guimaraesi, but admitting that the last two species could be syn- In order to improve the understanding about the evolutionary onyms (which was later formally stated by Ávila-Pires, 1995). No history of Coleodactylus, nucleotide sequence data from a mito- direct ancestor-descendant relationship between pairs of subspe- chondrial gene, 16S rRNA, and two nuclear genes, c-mos and cies was stated, and the possibility of potential subspecies was RAG-1, were used to (1) evaluate the monophyly of the genus, (2) never mentioned again. 94 S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101

In 1980, the northwestern populations of C. meridionalis were lower number of post-rostrals and higher number of toe lamellae raised to species status, C. septentrionalis, based on the lower (Freire, 1999). number of ventral scales but mainly on the presence of dorsal paired dark bordered light spots (Vanzolini, 1980). Freire (1999) recognized a close relationship between C. natalensis 2. Materials and methods and the former two species, but no explicit suggestion regarding its phylogenetic placement was given. C. natalensis (Freire, 1999), 2.1. Taxon sampling resembles C. septentrionalis in presenting a similar pattern of dorsal light spots, but differs from it by the number of ventral The ﬁve currently recognized species of Coleodactylus were rep- and mid-body scales, and is distinguished from C. meridionalis, resented by 41 individuals corresponding to 21 localities, chosen to its geographically closest species, by the color pattern, body size, cover as much of the distribution of the species as possible (Table

Table 1 List of taxa used in this study

Family Species Locality Voucher GenBank 16S c-mos RAG-1 Sphaerodactylidae Coleodactylus amazonicus Acajatuba, AM (1) MTR10278 DQ110455 EU435219 EU435174 MTR10280 DQ104109 EU435220 EU435175 Altér do Chão, PA (2) MTR09744 DQ110418 EU435221 EU435176 MTR09746 DQ104102 EU435222 EU435177 Apiaú, RR (3) MTR09818 EU435266 EU435223 EU435178 MTR09819 EU435267 EU435224 EU435179 igarapé Camaipí, AP (4) JM104 DQ110435 EU435225 EU435180 MTR6247 DQ104104 EU435226 EU435181 Rio Preto da Eva, AM (5) MTR09898 EU435264 EU435227 EU435182 MTR09899 EU435265 EU435228 EU435183 São José das Pombas, AM (6) MTR10182 DQ110485 EU435229 EU435184 MTR10199 DQ104110 EU435230 EU435185 Serra do Kukoinhokren, PA (7) MTR36308 DQ104103 EU435231 EU435186 C. brachystoma Serra da Mesa, GO (8) MTRCB200 DQ104113 EU435232 EU435187 MTR09756 DQ110556 EU435233 EU435188 Uruçuí-Una, PI (9) MTR5225 DQ110558 EU435234 EU435189 MTR1701 DQ104116 EU435235 EU435190 Paranã, TO (10) MTR4318 DQ104115 EU435236 EU435191 MTR4129 DQ110563 EU435237 EU435192 Serra do Amolar, MS (11) IAH020 EU435268 EU435238 EU435193 IAH637 EU435269 EU435239 EU435194 C. meridionalis Carolina, MA (12) ESTR0973 EU435274 EU435240 EU435195 ESTR0112 DQ104126 EU435241 EU435196 Central, BA (13) MTR10360 EU435272 EU435242 EU435197 MTR09882 EU435273 EU435243 EU435198 Mamanguape, PB (14) MTR09762 DQ104118 EU435244 EU435199 MTR09768 DQ110493 EU435245 EU435200 Murici, AL (15) MTR10368 EU435270 EU435246 EU435201 MTR10369 EU435271 EU435247 EU435202 Pacoti, CE (16) MTR094 DQ110491 EU435248 EU435203 MTR4538 DQ104117 EU435249 EU435204 Una, BA (17) MD1721 DQ104121 EU435250 EU435205 MD2613 DQ110505 EU435251 EU435206 C. natalensis Natal, RN (18) MTR09906 DQ104127 EU435252 EU435207 MTR09907 DQ110564 EU435253 EU435208 C. septentrionalis Boa Vista, RR (19) MTR09795 DQ104131 EU435254 EU435209 MTR09796 DQ110548 EU435255 EU435210 Maracá Island, RR (20) MTR09782 DQ110542 EU435256 EU435211 MTR09789 DQ104130 EU435257 EU435212 Maú River, RR (21) MTR09808 DQ104129 EU435258 EU435213 MTR09809 DQ110516 EU435259 EU435214 Gonatodes humeralis Aripuanã, MT LG1177 EU435278 EU435263 EU435218 Lepidoblepharis xanthostigma Costa Rica no voucher EU435277 EU435262 EU435217 Pseudogonatodes guianensis Rio Preto da Eva, AM MTR09893 EU435275 EU435260 EU435215 MTR09894 EU435276 EU435261 EU435216 Sphaerodactylus leucaster X86056 S. shrevei AY662570 AY662623 Teratoscincus keyserlingii AY753545 T. przewalskii AY662569 AY662624 Gekkonidae Gekko gecko AY282753 AY172929 AY662625 Eublepharidae Eublepharis macularius AB028762 AF039470 E. turcmenicus AY662622 Diplodactylidae Pseudothecadactylus lindneri AF215247 AF090846 AY662626

Locality numbers correspond to those in Figs. 1–3. Brazilian States abbreviations (under ‘‘Localitiy”) are as follows: AM, Amazonas; AL, Alagoas; BA, Bahia; CE, Ceará; GO, Goiás; MA, Maranhão; MT, Mato Grosso; MS, Mato Grosso do Sul; PA. Pará; PB, Pernambuco; PI, Piauí; RN, Rio Grande do Norte; RR, Roraima; TO, Tocantins. S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 95

with Exonuclease I and Shrimp Alkaline Phosphatase (USB or Fer- 500 km C. amazonicus mentas). Automated sequencing was performed using BigDye Ter- C. brachystoma minator v3.1 Cycle Sequencing kit (Applied Biosystems), followed Savannah C. meridionalis by analysis on ABI Prism 310, 3700 or 3170 Genetic Analyzer

C. natalensis Sequencers (Applied Biosystems) according to the manufacturer’s 21 20 C. septentrionalis instructions. 19 3 Sequences were edited in Sequence Navigator (PE Applied Bio- Amazon 4 Forest systems) or Sequencher v. 4.1.2 (Gene Codes Corporation) and ini- 5 16 tially aligned using the default parameters of ClustalW (Thompson 1 2 et al., 1994). Primary homology between bases (sensu de Pinna,

18 1991) of the 16S gene were then hypothesized by comparison with Caatinga the secondary structure model proposed for mammals (Burk et al., 7 6 9 14 12 2002). The absence of well-conserved motifs into the length-vari- 15 13 able loops regions between stems 40/41 and 42/45 prevented the Atlantic Forest establishment of provisional homology between bases or positions, 10 and these segments were excluded from analyses. Indels of nuclear 8 genes were inserted based on conservation of the amino acid read- 17 11 Cerrado ing frame, and those sharing 50 and 30 termini could be confiden- tially considered homologous (Simmons and Ochoterena, 2000). Fig. 1. Sampling localities of Coleodactylus. Locality numbers correspond to Table 1, Sequences of the nuclear gene c-mos obtained in this study have Figs. 2 and 3. been combined with previously published data, and only 369 bp were used in the phylogenetic analyses. GenBank accession numbers for all sequences are indicated in Table 1. 1, Fig. 1). Ingroup taxa also included members of Gonatodes, Pseudogonatodes, Lepidoblepharis, and Sphaerodactylus, so that the monophyly of Coleodactylus in relation to the New World sphaero- 2.3. Phylogenetic analyses dactyls could be assessed. In the absence of the closest genera of Sphaerodactylini (Gamble et al., 2008a), monophyly of the group Prior to the phylogenetic analyses, each gene was separately was established by including Gekko and Teratoscincus as outgroup tested for homogeneity of base composition among taxa using taxa. Phylogenies were rooted with members of Eublepharinae the base frequencies option implemented in PAUP 4.0b10 (Swof- and Diplodactylinae, in accordance with previous molecular phylo- ford, 2003), in order to avoid the potential effects that nucleotide genetic analyses (Townsend et al., 2004; Gamble et al., 2008a). composition differences among sequences could cause in the Voucher specimens from which sequence data were obtained in resulting tree topologies and nodal support recovered (e.g., Harris, this study are deposited at the Museu de Zoologia, Universidade 2003; Gruber et al., 2007). The effect of multiple substitutions in de São Paulo (MZUSP) and Coleção Zoológica do Departamento each dataset was also evaluated by plotting uncorrected de Biologia e Zoologia da Universidade Federal de Mato Grosso codon-based (RAG-1 and c-mos) and total (16S) transition and (UFMT), Brazil. transversion distances against the corresponding corrected pairwise distances using the appropriate model of evolution iden- 2.2. Laboratory procedures tified by MrModeltest v.2.2 (Nylander, 2004). In addition, congruence between different gene partitions was tested between all Total genomic DNA was extracted from liver or tail tissues, pairwise combinations of partitions using the incongruence length stored either frozen or ethanol fixed, by the standard proteinase difference test (ILD; Farris et al., 1994), with the null distributions K protocol (Sambrook et al., 1989). Approximately 500 bp of 16S, generated by 1000 replications, under a heuristic search with 20 572 bp of RAG-1 and 528 bp of c-mos genes were amplified and random addition sequences per replicate. Although a high proba- sequenced in both directions with the primers and conditions pre- bility of type I error had been detected in different simulations sented in Table 2. All PCR products were enzymatically purified (Dolphin et al., 2000; Barker and Lutzoni, 2002; Darlu and Lecoin-

Table 2 List of primer sequences used in this study

Gene Primer Sequence (50-30) PCR conditions

16S 16S F.1a TGTTTACCAAAAACATAGCCTTTAGC 94 °C (40 s), 45 to 51 °C (40 s), 72 °C (40 s) 35 16SF.st310d AGGTAACGCCTGCCCAGTGA 94 °C (40 s), 50 °C (40 s), 72 °C (40 s) 35 16S R.0a TAGATAGAAACCGACCTGGATT c-mos LSCH1b CTCTGGKGGCTTTGGKKCTGTSTACAAGG 94 °C (40 s), 50 to 55 °C (40 s), 72 °C (40 s) 35 LSCH2b GGTGATGGCAAARGAGTAGATGTCTGC RAG-1 F94c TGGAARTTCAARCTGTTCAAAGT 94 °C (40 s), 49 to 51 °C (40 s), 72 °C (40 s) 35 F104c CAAAGTGAGATCNCTTGAAAA 94 °C (40 s), 49 to 51 °C (40 s), 72 °C (40 s) 35 R387c GTNTCATCATCTACTGGTCCA R522d AAATTAGTTGGATGGATTGTGTCCA F2568ac GGATGAATGGRAATTTTGCCAGA 94 °C (40 s), 48 to 52 °C (40 s), 72 °C (40 s) 35 F2568 bc GGATGAATGGAAAYTTTGCTMGA 94 °C (40 s), 48 to 52 °C (40 s), 72 °C (40 s) 35 R2876c TTTGTTCCCAGATTCATTTCC R2901d TTTATTTCCGGACTCATTTCC

PCR cycles included a initial denaturation step of 94 °C for 5 min, and a final elongation step of 72 °C for 7 min. a Whiting et al., 2003 . b Godinho et al., 2005. c Townsend et al., 2004. d This study. 96 S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 tre, 2002; Dowton and Austin, 2002), the ILD is the best understood 0.25% of the initial trees of each run as burn-in samples. Nodes test of phylogenetic incongruence of all tests available and can be with posterior probability P95% on a 50% majority rule consensus considered as a conservative first test for identifying potential tree from both runs were considered significant support for a given incongruence among data partitions (Hipp et al., 2004; Planet, clade. 2006). In the absence of conflicting results, data were combined to perform phylogenetic analyses using Maximum Parsimony 2.4. Comparing alternative topologies (MP) and Maximum Likelihood (ML) implemented in PAUP 4.0b10 (Swofford, 2003) and Bayesian analysis (BA) implemented A recent molecular phylogeny based on five nuclear genes in MrBayes 3.0b4 (Ronquist and Huelsenbeck, 2003). (Gamble et al., 2008a) had suggested that Sphaerodactylus, Pseudo- MP searches were conducted with equal character weighting gonatodes, and Coleodactylus constitute a monophyletic sister and gaps treated as missing data under the heuristic search with group to Gonatodes + Lepidoblepharis. In that study, C. brachystom- tree bisection reconnection (TBR) branch swapping and 1000 ran- a + C. septentrionalis were placed as the sister genus of Pseudogon- dom-addition sequence replicates. To investigate the contribution atodes, in agreement with the relationship based on morphology of the indels to the phylogenetic reconstruction, an additional par- proposed by Kluge (1995). These studies, however, were not simony analysis was performed coding gaps of the nuclear genes as designed to test the monophyly of Coleodactylus, and the genus a presence/absence characters matrix (Simmons and Ochoterena, was implicitly assumed to be monophyletic. In order to evaluate 2000). Nodal support was estimated using non-parametric boot- the previous hypothesis relative to the phylogenetic position of strapping (Felsenstein, 1985) with 10,000 replicates with five ran- Coleodactylus within Sphaerodactylinii against the topology ob- dom addition sequence replicates each and TBR branch swapping. tained here and to explore the possibility of nonmonophyly of Consensus trees were obtained following the 50% majority rule, the genus, two different approaches were used to test the follow- and nodes with bootstrap P70% were considered strongly sup- ing alternative topologies: (H1) Coleodactylus constrained to be a ported. The ML tree was obtained using a heuristic search, with five monophyletic sister genus of Pseudogonadotes; and (H2) C. brachys- random-addition sequence replicates and TBR branch swapping toma + C. meridionalis + C. natalensis + C. septentrionalis constrained using GTR + I + C nucleotide substitution model selected by to be the sister group of Pseudogonadotes and C. amazonicus as the MrModeltest v2.2 (Nylander, 2004). Nodal support was estimated sister clade of all Sphaerodactilini. In the first approach, likelihood using non-parametric bootstrapping (Felsenstein, 1985) with 100 scores of unconstrained and constrained topologies were com- replicates with one random addition sequence replicate and TBR pared using the non-parametric Shimodaira–Hasegawa test (Shi- branch swapping. modaira and Hasegawa, 1999) implemented in PAUP 4.0b10 For Bayesian analyses, the best-fit model of nucleotide substitu- (Swofford, 2003), using RELL bootstrapping (1000 replicates) and tion for each data partition was selected using the hierarchical like- the same likelihood parameters used in the ML analyses. In the lihood ratio (hLRT) criterion implemented in MrModeltest v.2.2 second approach, the presence of the alternative topologies was (Nylander, 2004). Because genes sampled evolve at different rates, detected within the set of topologies contained in the 95% credible and base frequencies and substitution rates may vary with codon set of Bayesian trees from both runs of the ten-partitions scheme, positions, three different partition schemes were used for phyloge- sampled after burn-in using the option ‘‘filter” in PAUP4.0b10 netic analyses: (1) one-partition, using a single model for the (Swofford, 2003). Alternative topologies were considered statisti- whole dataset (GTR + I + C); (2) four-partitions, using a separate cally reject if they were absent in credible set of trees (Fessler model for each gene, considering the two regions of RAG-1 sepa- and Westneat, 2007; Zaldivar-Riverón et al., 2007). rately; and (3) ten-partitions, using a different model for each codon position of the three protein coding fragments and for the 2.5. Divergence times mitochondrial gene (Table 3). Two independent Bayesian analyses were performed for each partition, with a random starting tree, The topology obtained from the Bayesian analyses under the four incrementally heated Markov chains, and 4,000,000 genera- ten-partition scheme was used to estimate the branch lengths tions, with trees sampled every 100 generations to estimate likeli- under a GTR + I + C model of evolution in a maximum likelihood hood and sequence evolution parameters. Stationarity for each run approach (PAUP 4.0b10), and the assumption of rate constancy was detected by plotting the likelihood scores of the trees against of DNA substitution through time among taxon was tested by com- generation time, and the topology, posterior probability values, paring the log-likelihood scores from trees constructed with and and branch lengths inferences were estimated after discarding without a molecular clock constraint (Felsenstein, 1981). As the

Table 3 Summary of character variation for nuclear protein coding genes and mitochondrial ribosomal gene used in this study

Gene Characters Nucleotide Composition (%) hLRT Model Total V PI A C G T {2 P RAG-1 (1) 281 152 78 0.37 0.20 0.20 0.23 14.06 1.00 HKY 1st positon 94 43 28 0.33 0.23 0.29 0.15 12.69 1.00 HKY 2nd position 94 44 22 0.43 0.19 0.15 0.23 10.28 1.00 HKY 3rd position 93 62 29 0.32 0.19 0.16 0.33 12.05 1.00 HKY RAG-1 (2) 302 77 49 0.34 0.20 0.22 0.24 8.15 1.00 K80+C 1st position 100 16 10 0.29 0.21 0.29 0.21 1.57 1.00 K80 2nd position 101 8 3 0.36 0.20 0.19 0.25 1.62 1.00 JC 3rd position 101 53 36 0.36 0.19 0.19 0.26 18.50 1.00 K80+C c-mos 369 136 90 0.28 0.21 0.23 0.28 9.34 1.00 HKY+I 1st position 123 39 24 0.29 0.21 0.30 0.20 5.65 1.00 K80+ C 2nd position 123 28 17 0.29 0.20 0.21 0.30 3.94 1.00 SYM+C 3rd position 123 69 49 0.25 0.21 0.18 0.36 16.12 1.00 HKY 16S 371 127 93 0.31 0.25 0.22 0.22 18.24 1.00 GTR+I+C

The best-fit model of nucleotide evolution used in Bayesian analyses under four-partition and ten-partition schemes are indicated. V: number of variable sites; PI: number of parsimoniously informative sites. S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 97 null hypothesis of clocklike evolution was rejected by a Chi square 50 region vs. RAG-1, 30 region: P = 0.87; RAG-1, 50 region vs. c-mos: 0 likelihood ratio test (LnH0 = 6851.68426; LnH1 = 6882.58311), P = 0.30; RAG-1, 3 region vs. c-mos: P = 0.64), and all analyses were divergence times were estimated using the penalized likelihood based on the combined data. method (Sanderson, 2002) with the TN algorithm and optimal va- The equally weighted parsimony analysis of the concatenated lue of smoothing determined by cross-validation as implemented sequences yielded six equally parsimonious trees, the consensus in r8s (Sanderson, 2003). Outgroups were excluded using the of which contained 87% well-supported nodes (Fig. 2; TL = 959 ‘‘prune” command. Since the fossil record for the New World sph- steps, CI = 0.64, RI = 0.78). Inclusion of nuclear indels as a pres- aerodactyls is scarce and restricted to some fossils of Sphaerodacty- ence/absence matrix in the phylogenetic analysis also yielded six lus (Böhme, 1984; Grimaldi, 1995), two secondary calibration equally parsimonious trees (not shown, TL = 963 steps, CI = 0.65, points derived from analysis of independent molecular data were RI = 0.79). Although not improving the topology or bootstrap val- used to estimate absolute divergence times within Coleodactylus. ues of the consensus tree recovered, the congruent phylogenetic Based on the estimates of Gamble et al. (2008a), the origin of the signal between codon indels and base substitutions gives addi- New World sphaerodactyl lineages was fixed to 75.5 Mya, and tional support to the resulting phylogenetic hypothesis. The ML the divergence of Gonatodes and Lepidoblepharis at 68.2 Mya. Stan- analysis produced a single most likely tree (Ln = 6851.33963), dard deviations of divergence times were estimated using the with 82% well-supported nodes (Fig. 2). The consensus trees from ‘‘profile” command in r8s (Sanderson and Doyle 2001) from a sub- concatenated, four-partioned and ten-partioned Bayesian analyses set of 718 phylograms with identical topology screened among the were derived from 79802 sample trees each, after discarding the last 1,000,000 trees from the ten-partition Bayesian analysis. first 10,000 generations from each analysis as burn-in. In general, topology and estimated nodal posterior probabilities from the partitioned analyses were very similar to those derived from the 3. Results unpartitioned analyses, with 72% well-supported nodes. The dis- crepancy observed among Bayesian trees involved one weakly sup- 3.1. Nuclear indels ported clade recovered only by the ten-partition scheme (Fig. 2).

In addition to the 4-codon deletion already described for the 5’ Pseudothecadactylus region of the gene RAG-1 in the Eublepharinae/Sphaerodactylinae/ Eublepharis Gekkoninae group (Townsend et al., 2004), a total of three addi- Gekko tional deletions were evident in sequences of C. brachystoma, C. Teratoscincus meridionalis, C. natalensis and C. septentrionalis. Two deletions, cor- 0.51/0.96 Gonatodes responding to six and 18 nucleotides, were shared by these four Lepidoblepharis species, and a third deletion, corresponding to six nucleotides, 0.90 Pseudogonatodes was observed only in C. septentrionalis. A single codon deletion * 0.51 Sphaerodactylus was shared by C. brachystoma, C. meridionalis, and C. natalensis at 71/ 97/ 0.98 the 30 end of c-mos gene. The indel events in both genes were also C. amazonicus 4 detected by Gamble et al. (2008a,b) for C. brachystoma, but were C. amazonicus 2 not reported for C. septentrionalis. 86/ 92/ 1.0 C. amazonicus 7 C. amazonicus 6 81/ 82/ 1.0 3.2. Properties of the dataset C. amazonicus 3 C. amazonicus 1 79/ 62/ 0.75 The final dataset consisted of a total of 1323 base pairs (bp), C. amazonicus 5 0 being 371 nucleotides from 16S gene, 281 and 302 from the 5 C. brachystoma 10 one-third and 30 two-thirds of RAG-1, respectively, and 369 from C. brachystoma 9 c-mos. Of these, 493 were variable and 311 were parsimoniously c-mos indel 51/ 50/ 0.51 C. brachystoma 8 informative (Table 3). No evidence for differences in base composi- (3 pb) 69/ 79/ 1.0 C. brachystoma 11 tion among taxa was observed for all genes, although the average nucleotide frequencies among sites showed some variation. The C. meridionalis 17 mitochondrial gene had a slight bias in adenine frequency, and C. meridionalis 15 the nuclear genes showed a greater content of adenine and thy- C. meridionalis 16 mine. Only the first positions of codons were characterized by C. meridionalis 14 higher frequencies of adenine and guanine, in agreement with that RAG-1 85/ 65/ 0.97 C. meridionalis 12 reported for Squamata (Harris, 2003; Townsend et al., 2004). indel C. natalensis 18 0 (6 pb) Among the nuclear genes, the 5 region of RAG-1 was the most var- RAG-1 indels 62/ 66/ 0.57 C. meridionalis 13 (6 and 18 bp) iable data, with 54% of variable sites, of which 51% were parsi- C. septentrionalis 21 0 mony-informative. The 3 region of RAG-1 and c-mos had similar C. septentrionalis 20 percentages of variable (25% and 37%, respectively) and informa- 0.1 substitutions/site C. septentrionalis 19 tive sites (64% and 66%), indicating similar overall rates of evolution. The relationship between uncorrected p-distances and Fig. 2. Bayesian tree topology obtained from the molecular data set combined (16S, corrected distances appeared to be linear for the 16S gene and all c-mos, RAG-1). The 50% majority-rule consensus phylogram and posterior proba- codon positions of the nuclear genes, suggesting that substitutions bilities were estimated from 79802 trees derived from analyses under the ten- partition model (see Table 3 for model definition). Stippled lines indicate branches have not reached saturation. not recovered in the 50% majority-rule consensus of six equally maximum parsimonious trees (length: 959; consistency index: 0.64, retention index: 0.78), 3.3. Phylogenetic analyses the triangle indicates branch recovered by the ML and Bayesian analysis, and the asterisk indicates branch not recovered in ML tree and Bayesian analysis using one- partition and four-partition schemes. Nodes labelled by open circles were highly The partition homogeneity test was not significant for any pair- supported by all three methods of phylogenetic inference (bootstrap P 95% and 0 wise combination of datasets (16S vs. RAG-1, 5 region: P = 0.19; posterior probability P0.99), The values assigned to the internodes indicate MP 16S vs. RAG-1, 30 region: P = 0.79; 16S vs. c-mos: P = 0.21; RAG-1, bootstrap, ML boostrap and posterior probabilities values, respectively. 98 S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101

The topologies recovered by MP, ML and BA were highly con- Central Brazil to the closer ones of coastal region. C. septentrionalis gruent, and all resolved nodes that received moderate to high boot- also showed a subdivision among populations of northern vs. strap support (BS P 70%) had also received high posterior southern regions of Roraima state. The exception is C. brachystoma, probabilities (PP P 0.95). Consensus trees differed from each other for which no obvious geographical trend could be detected for the only in the degree of resolution of relationships among sphaero- signiﬁcantly differentiated clades of populations. dactylini genera. Maximum parsimony analysis identiﬁed these relationships as an unresolved polytomy, and maximum likelihood 3.4. Comparison of alternative topologies analysis supported only a sister relationship between Gonatodes and Lepidoblepharis. Bayesian trees favored, even though weakly The relationships among Sphaerodactylini genera presented in supported, a sister group relationship between Coleodactylus and Fig. 2 were also retrieved by Gamble et al. (2008a), excepting the a clade that includes all other genera of Sphaerodactylini. Within position of Coleodactylus, which they recovered as the sister genus this group, Gonatodes was weakly (concatenated and four-parti- of Pseudogonatodes. Among the topologies tested, the uncon- tioned schemes) to strongly (ten-partitioned scheme) supported strained one (H0) yielded the best tree (LnH0 = 6851.33963), in as the sister taxon of Lepidoblepharis, with this clade forming a tri- which Coleodatylus was recovered in 42% of the ML bootstrap rep- chotomy with Pseudogonatodes and Sphaerodactylus (concatenated licates as the sister group of all Sphaerodactylini. The alternative and four-partitioned schemes) or weakly supported as the sister topology placing Coleodactylus as a monophyletic genus sister to group to Pseudogonatodes + Sphaerodactylus (ten-partitioned Pseudogonatodes (LnH1 = 6853.24352) was recovered in 28% of scheme). the bootstrap replicates, and the topology considering only the Coleodactylus was recovered as a monophyletic genus, although meridionalis group as the sister group to Pseudogonatodes weakly supported regardless of reconstruction method used. C. (LnH2 = 6855.12393) was not detected in any of the 100 bootstrap amazonicus was placed as a highly divergent sister taxon of a large replicates. Nevertheless, alternative topologies were statistically clade comprising C. brachystoma + C. meridionalis + C. natalensis + C. indistinguishable from one another at P 6 0.05 in the Shimoda- septentrionalis, hereafter called the meridionalis group. Within the ira–Hasegawa test. Similarly, alternative topologies could not be meridionalis group, C. meridionalis is more closely related to C. bra- rejected by the Bayesian approach since they were observed within chystoma than to C. septentrionalis, and C. natalensis was recovered the combined 95% credible set of both runs derived from the ten- nested in C. meridionalis, rendering to this last species paraphyletic. partition scheme. From a total of 75718 trees, the unconstrained All other species were strongly supported as monophyletic, and topology (H0) corresponded to 21,606 trees (28.53%), alternative with the exception of C. natalensis, were themselves composed of topology H1 corresponded to 41 trees (0.05%), and alternative highly distinctive clades, which can be structured to geographical topology H2 corresponded to 587 trees (0.77%). subgroups into some extent (Fig. 1). The most evident case is the subdivision between samples of C. amazonicus from the western 3.5. Divergence Times and eastern Amazonian Forest, a pattern already described for other vertebrate groups (e.g., da Silva and Patton, 1993; Ávila-Pires, The result of the molecular dating analysis is shown in Fig. 3. 1995; Symula et al., 2003; Gamble et al., 2008b). A geographical Assuming the New World sphaerodactyls to have last shared the structuring seems possible for C. meridionalis populations, for most recent common ancestor at 75.5 Mya and the divergence of which the geographical distributions of successive branches of Gonatodes and Lepidoblepharis to have occurred at 68.2 Mya (Gam- the tree are roughly placed increasingly northwards along the ble et al., 2008a), the basal cladogenic event between major lin- Atlantic coast. Interestingly, C. natalensis groups with C. meridional- eages of Coleodactylus was estimated to have occurred in the late is populations from Caatinga (Central) and Cerrado (Carolina) in Cretaceous (72.6 ± 1.77 Mya), approximately at the same point in 20 19 21 11 10 8 9 2 7 4 5 1 6 16 14 13 12 15 17 3 18 Mya

Gonatodes Lepidoblepharis Pseudogonatode Sphaerodactylus C. amazonicus C. amazonicus C. amazonicus C. amazonicus C. amazonicus C. amazonicus C. amazonicus C. brachystoma C. brachystoma C. brachystoma C. brachystoma C. meridionalis C. meridionalis C. natalensis C. meridionalis C. meridionalis C. meridionalis C. meridionalis C. septentrionalis C. septentrionalis C. septentrionalis Pleistocene 1.8 Node Age SD Min Max 16 5.3 Pliocene 13 12 15 14 10 1 71.7 1.1 68.5 74.6 8 9 1.9 ± 1.3 11 7 (0.3 - 7.3) Miocene 2 69.4 1.6 65.9 72.6 3 28.4 3.7 19.4 40.1 23.0 6 5 4 4 23.1 5.2 8.7 38.6 Oligocene 3 5 22.1 4.2 11.5 37.9 29.3 ± 4.3 33.9 (17.8 - 44.4) 6 21.4 4.1 13.0 37.8 7 9.9 2.9 4.1 23.9 Eocene 8 9.7 2.6 4.4 19.3 46.4 ± 4.2 9 8.9 2.7 3.7 19.4 (31.8 - 58.0) 55.8 10 8.5 2.6 2.5 18.0 11 7.9 2.5 3.0 18.4 Paleocene 65.5 12 4.1 1.8 0.9 13.0 13 3.7 1.4 0.9 11.3 68.2 2 1 Late 14 3.5 1.9 0.5 12.1 72.6 ± 1.8 Cretaceous 75.5 (64.2 - 75.2) 15 2.9 1.6 0.7 12.5

Fig. 3. Chronogram based on penalized likelihood transformation of the ten-partition Bayesian consensus tree (Fig. 2). Divergence time estimates (in million years) and node profile information were obtained from the r8s molecular dating analyses of a subset of 718 phylograms with identical topology screened among the the last 1000000 trees from the ten-partition Bayesian analysis. Black circles represent fixed age nodes, and open circles represent speciation events in Coleodactylus. Locality numbers correspond to Table 1 and Figs. 1 and 2. S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 99 time than the other genera diverged from each other. Within the Recently, a close relationship between ((C. brachystoma, C. septen- meridionalis group, the split between C. septentrionalis and C. bra- trionalis)+Pseudogonatodes) was supported by molecular data, in chystoma + C. meridionalis was placed in the Eocene agreement with the morphological (Gamble et al., 2008a). In the (46.4 ± 4.22 Mya), and the divergence between C. brachystoma current study, excepting the sister taxa relationship between Gon- and C. meridionalis was estimated to have occurred in the Oligo- atodes and Lepidoblepharis already recovered by previous molecu- cene (29.3 ± 4.33 Mya). Most intraspecific cladogenesis occurred lar data analysis (Gamble et al., 2008a), generic relationships through Miocene to Pliocene, and only for two conspecific samples were poorly defined. Coleodactylus was not specifically related to and for C. natalensis could a Quaternary differentiation be assumed any other genera, being, instead, placed as sister group of all other (1.9 ± 1.3 Mya). sphaerodactyls by Bayesian analysis. Some caution, however, must be used in interpreting the results concerning the monophyly of Coleodactylus or the phylogenetic position of the genus within Sph- 4. Discussion aerodactylini. Molecular data did not find strong support for the null hypothesis, but also did not falsify the alternative hypotheses. 4.1. Phylogeny of Coleodactylus This difficulty to recover deep phylogenetic relationships with strong branch support and to statistically reject alternative The results of phylogenetic analyses of sequence data from one hypotheses is a characteristic of topologies with weakly supported mitochondrial and two nuclear genes presented here retrieved short interior branches leading to long terminal branches (Weis- Coleodactylus as a monophyletic group composed of two geneti- rock et al., 2005), as the molecular phylogeny obtained here (Fig. cally distinct and well supported clades, one represented by C. 3). This result might be intepreted as a ‘‘soft” polytomy (Maddison, amazonicus populations, and one comprising C. brachystoma, C. 1989), related to the restrict ability of the available data to resolve meridionalis, C. natalensis and C. septentrionalis, referred here as dicotomic relationships due to a limited set of synapomorphies the meridionalis group (Fig. 2). These clades correlate with the accumulated during the short period of time corresponding to variation of the morphological characteristics concerning to dor- the internal branches and the loss of signal due to multiple substi- sal scales and ungual sheath included by Vanzolini (1957) in tutions along the terminal branches (Weisrock et al., 2005). An the original diagnosis of the genus (Parker, 1935) to accommo- alternative explanation for this result is the simultaneous or nearly date C. amazonicus. Species of the meridionalis group are charac- simultaneous diversification of multiple lineages, characterizing a terized by having claws enclosed by an ungual sheath ‘‘hard” polytomy (Weisrock et al., 2005). Thus, further analyses composed of five asymmetrical scales and smooth dorsal scales, incorporating additional molecular data and inclusion of more rep- whereas C. amazonicus presents four asymmetrical scales in the resentative taxa from sphaerodactyls is required in order to appro- ungual sheath and keeled dorsal scales. These differences were priately ascertain the monophyly of Coleodactylus and to determine used by Vanzolini (1957, 1968b, 1970, 1980) as an evidence to the placement of the genus within Sphaerodactylini. recognize C. amazonicus as a separate branch derived directly Nevertheless, irrespective of the monophyly of the genus or its from the ancestral stock of Coleodactylus, and to suggest a close phylogenetic placement, the molecular data have also evidenced relationship among species of the meridionalis group. Within this that the previous morphological studies tended to be conservative group, the more explicit statement was the suggestion of Vanzo- and to underestimate the diversity of Coleodactylus species. Several lini (1980) that C. septentrionalis would have originated from C. recent studies have revealed deep genetic divisions and/or cryptic meridionalis populations from the northwestern Amazonia, iso- species within widespread neotropical reptiles (e.g., Glor et al., lated after an episode of forest contraction. The molecular analy- 2001; Pellegrino et al., 2005; Kronauer et al., 2005; Gamble et al., sis contradict this hypothesis and placed C. septentrionalis as the 2008b). In the present case, it is possible that species might actu- sister taxon to a clade comprising the rest of the meridionalis ally represent complexes of species, which could explain the ab- group. C. meridionalis was recovered as the sister species to the sence of a clear geographical component in the wide range of parapatrically distributed C. brachystoma, and C. natalensis was variation reported for meristic characters and color pattern found nested within C. meridionalis. (Ávila-Pires, 1995; Freire, 1999). For instance, the phylogenetic In addition to the morphological autapomorphies, the major grouping of C. natalensis with C. meridionalis populations from clades of Coleodactylus can also be distinguished by the two dele- Caatinga and Cerrado in Central Brazil rather than geographically tions of 18 and 6 pb in the RAG-1 gene shared by species from closer samples from the Atlantic Forest might indicate that C. the meridionalis group. Within the group, phylogenetic relation- meridionalis is a single highly structured species with a history of ships among species were corroborated by two additional indels: episodes of expansion/colonization, and that C. natalensis origi- a 3 pb deletion in c-mos is shared by C. brachystoma, C. meridionalis, nated as a peripheral isolate during one of these events. However, and C. natalensis, whereas a 6 pb deletion in RAG-1 is observed only there is the possibility that each clade of C. meridionalis represents in C. septentrionalis. Indels in protein-coding DNA sequences are a much more widespread species, which might have overlapping considered rare (Rokas and Holland, 2000), and the value of these distributions. Although incomplete lineage sorting can be hypoth- mutational events as independent phylogenetic markers to diag- esized as a possible cause of the observed paraphyly, imperfect nose clades and to resolve phylogenetic relationships have been taxonomy has been identified as the main cause of paraphyly in demonstrated for various groups of organisms (e.g., Venkatesh et poorly known and undersampled species (e.g., Funk and Omland, al, 2001; Vidal and Hedges, 2002; de Jong et al., 2003; Townsend 2003; Morando et al., 2003; Avila et al., 2006). Given the broad et al., 2004; van Rheede et al., 2006). The congruence between geographical distribution of species, a denser sampling, including molecular and morphological data is remarkable, and the results populations from areas not sampled in this study, will probably in- indicate that C. amazonicus is unequivocally distinct from the spe- crease the number of possible clades. The taxonomic status of cies of the meridionalis group, Considering, however, that Coleo- these clades is currently the focus of an ongoing phylogeographical dactylus was recovered as monophyletic genus in all three analysis. analysis, even though with a weak support, the taxonomic significance of the variation of the ungual sheath for the genus do not 4.2. Evolutionary history extend beyond the species level. The dataset also did not provide enough resolution regarding Some important outcomes related to the proposed evolutionary the phylogenetic position of the genus within Sphaerodactylini. history of Coleodactylus can be drawn from the phylogenetic recon- 100 S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 struction and molecular dating. The first one is related to the idea to any particular paleogeographic events. Nevertheless, the esti- of the Amazon basin as the center of diversification of the genus. mated diversification of Coleodactylus species broadly coincides This assumption was proposed by comparing the distribution of with other studies that found evidence for a diversification of the Coleodactylus and Gonatodes (Vanzolini, 1968b). Both genera are South American fauna related to the major climatic variations ecologically dependent on forests and are found throughout the associated to sea level changes, Andean orogeny, and major envi- Amazon Basin, but only Coleodactylus is present in the Atlantic For- ronmental and biotic modifications that occurred through the Ter- est. Vanzolini concluded that Gonatodes species differentiated in tiary (e.g., Moritz et al., 2000; Nahum et al., 2003; Delsuc et al., the northwest arc, defined as the extra-Amazonian region extend- 2004; Kronauer et al., 2005; Poux et al., 2006; Giugliano et al., ing from the Guianas to Ecuador and considered the putative cen- 2007; Gamble et al., 2008b). ter of origin of Sphaerodactylini, and then invaded the Amazon Basin, whereas the speciation in Coleodactylus occurred after an Acknowledgments invasion from the northwest arc to the Amazon Basin (Vanzolini, 1968b). The results presented here, however, strongly support We thank the Fundação de Amparo a Pesquisa do Estado de São the recognition that the two major lineages recovered for Coleo- Paulo (FAPESP), Brazil, (grants 00/13213, 03/10335, and fellowship dactylus have long distinct evolutionary histories. In fact, both lin- grants 00/10092 and 05/54516 to S.R.G) for major funding for this eages can be considered early offshoots from Sphaerodactylini, project, and the Conselho Nacional de Desenvolvimento Científico apparently becoming evolutionarily independent from each other e Tecnológico (CNPq) for financial support to M.T. Rodrigues. A during the Late Cretaceous (Fig. 3). If a northwest arc origin is as- grant from the Museum of Vertebrate Zoology, UC Berkeley, pro- sumed for all Sphaerodactylini, it is possible that both lineages of vided additional support for laboratory work to S.R.G. We are Coleodactylus initially differentiated in this region, followed by an thankful to D. Pavan, F.C. Franco, V.K. Verdade, R.C. Amaro-Ghilardi, invasion of the Amazon Basin by C. amazonicus and the occupation E.M.X. Freire, L.S. Rodrigues, C. Lisboa, M.B. de Oliveira Dixo, P. Ilha, of the extra-Amazonian region by the members of the meridionalis and L. Centofante for their help in collecting specimens or provid- group. This dispersal may have been favoured by the advance of ing tissues samples, and M. Fávero and M. Concistré for technical forested habitats as a result of the progressive increase of temper- assistance. In particular, S.R.G. is grateful to Y.Yonenaga-Yassuda ature and humidity towards the Brazilian Shield during the Early for kindly providing office space and permitting use of the labora- Tertiary (Parrish, 1993; Romero, 1993). tory facilities during part of this project, and M.A. Van Sluys for The second outcome is that the hypothesis that the disjunct dis- allowing use of the automated sequencer of the Biologia Molecular tribution between C. meridionalis and C. septentrionalis is somehow de Plantas laboratory. We also thank K.C.M. Pellegrino, M.J.J. Silva, related to vicariant events associated with Pleistocenic climatic R.V. Vilela, and V.K. Verdade for many valuable comments and dis- changes or the newly formed species C. amazonicus (Vanzolini, cussion. The authors would also like to thank two anonymous ref- 1957, 1968a, b, 1980) is not supported. As indicated by the phylo- erees and the editor for their helpful comments to the earlier genetic analyses (Fig. 3), C. amazonicus lineage originated long be- version of this manuscript. Part of this work was carried out by fore the divergence of C. septentrionalis from C. meridionalis + C. using the resources of the Computational Biology Service Unit from brachystoma, which was estimated to have occurred during the Eo- Cornell University which is partially funded by Microsoft cene (46.4 ± 4.2 Mya), a period characterized by the maximum glo- Corporation. bal temperatures during the Cenozoic (Parrish, 1993; Flynn and Wyss, 1998). The cause of disjunction between C. septentrionalis References and the other species of the meridionalis group, however, remains unknown. Given the lack of fossil record to provide some informa- Avila, L.J., Morando, M., Sites Jr., J.W., 2006. Congeneric phylogeography: tion about the ancestral range of these taxa, the pattern can be ex- hypothesizing species limits and evolutionary processes in Patagonian lizards plained either by a range fragmentation of a widespread ancestor, of the Liolaemus boulengeri group (Squamata: Liolaemini). Biol. J. Linn. Soc. 89, 241–275. or by a long-distance dispersal event of the common ancestor of C. Ávila-Pires, T.C., 1995. Lizards of Brazilian Amazonia (Reptilia Squamata). brachystoma, C. meridionalis, and C. natalensis from the northwest Zoologishe Verch., Leiden. 299, 1-706. arc. The next cladogenic events observed were the diversification Barbour, T., 1921. Sphaerodactylus. Mem. Mus. Comp. Zool. (Harvard) 47, 215–282. Barker, F.K., Lutzoni, F.M., 2002. The utility of the incongruence length difference of C. amazonicus in eastern/western subclades and the split be- test. Syst. Biol. 51, 625–637. tween C. brachystoma and C. meridionalis, estimated to have oc- Böhme, W., 1984. Erstfund eines fossilen Kugelfingergeckos (Sauria: Gekkonidae: curred at approximately 28.4 ± 3.7 and 29.3 ± 4.3 Mya, Sphaerodactylinae) aus Dominikanischen Bernstein (Oligozän von Hispaniola, Antillen). Salamandra 20, 212–220. respectively (Fig. 3), broadly consistent with the change from trop- Burk, A., Douzery, E.J.P., Springer, M.S., 2002. The secondary structure of ical-temperate forest environments to more dryer habitats domi- mammalian mitochondrial 16S rRNA molecules: refinements based on a nated by savannas and grasslands as a result of the Oligocene comparative phylogenetic approach. J. Mammalian Evol. 9, 225–252. Colli, G., Bastos, R., Araujo, A., 2002. The character and dynamics of the Cerrado glaciations (Flynn and Wyss, 1998). The east/west biogeographic herpetofauna. In: Oliveira, P., Marquis, R. (Eds.), The Cerrados of Brazil: Ecology pattern recovered for C. amazonicus was also identified for other and Natural History of a Neotropical Savanna. Columbia University, New York, taxa of Amazonian herpetofauna (e.g., Ávila-Pires, 1995; Ron, pp. 223–241. 2000; Glor et al., 2001; Kronauer et al., 2005; Funk et al., 2007; da Silva, M.N.F., Patton, J.L., 1993. Amazonian phylogeography: mtDNA sequence variation in arboreal echimyid rodents (Caviomorpha). Mol. Phylogenet. Evol. 2, Gamble et al., 2008b). Despite the overall similarity of the pattern, 243–255. the results of the molecular dating in some of the studies showed de Jong, W.W., van Dijk, M.A.M., Poux, C., Kappe, G., van Rheede, T., Madsena, O., ages of divergencies ranging from the middle Oligocene to the 2003. Indels in protein-coding sequences of Euarchontoglires constrain the rooting of the eutherian tree. Mol. Phylogenet. Evol. 28, 328–340. Pleistocene, indicating that asynchronical processes were responsi- de Pinna, M.C.C., 1991. Concepts and tests of homology in the cladistic paradigm. ble for given rise to this pattern. Cladistics 7, 367–394. Finally, although the Quaternary climatic fluctuations cannot be Darlu, P., Lecointre, G., 2002. When does the incongruence length difference test fail? Mol. Biol. Evol. 19, 432–437. ruled out as factors of diversification in Coleodactylus, as suggested Delsuc, F., Vizcaíno, S.F., Douzery, E.J.P., 2004. Influence of Tertiary by the split between C. natalensis and Central Brazil populations of paleoenvironmental changes on the diversification of South American C. meridionalis, most estimates for intraspecific diversification oc- mammals: a relaxed molecular clock study within xenarthrans. BMC Evol. Biol. 4, 11. curred in the range from the late Oligocene to the late Pliocene Dolphin, K., Belshaw, R., Orme, C.D., Quicke, D.L.J., 2000. Noise and incongruence: (Fig. 3). Given the uncertainty associated with the molecular dat- interpreting results of the incongruence length difference test. Mol. Phyl. Evol. ing, no attempt was made to correlate populational divergences 17, 401–406. S.R. Geurgas et al. / Molecular Phylogenetics and Evolution 49 (2008) 92–101 101

Dowton, M., Austin, A.D., 2002. Increased congruence does not necessarily indicate darwinii complex (Gekkonidae, Squamata): genetic structure coincides with increased phylogenetic accuracy – The behavior of the incongruence length river systems in the Brazilian Atlantic Forest. Biol. J. Linn. Soc. 85, 13–26. difference test in mixed-model analyses. Syst. Biol. 51, 19–31. Planet, P.J., 2006. Tree disagreement: measuring and testing incongruence in Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1994. Testing significance of phylogenies. J. Biomed. Inform. 39, 86–102. incongruence. Cladistics 10, 315–319. Poux, C., Chevret, P., Huchon, D., de Jong, W.W., Douzery, E.J.P., 2006. Arrival and Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum Diversification of Caviomorph Rodents and Platyrrhine Primates in South likelihood approach. J. Mol. Evol. 17, 368–376. America. Syst. Biol. 55, 228–244. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the Ramos, A.R., 1981. Aspectos do nicho alimentar de Coleodactylus amazonicus (Sauria, bootstrap. Evolution 39, 783–791. Gekkonidae). Acta Amazon. 11, 511–526. Fessler, J.L., Westneat, M.W., 2007. Molecular phylogenetics of the butterflyfishes Rokas, A., Holland, W.H.P., 2000. Rare genomic changes as a tool for phylogenetics. (Chaetodontidae): taxonomy and biogeography of a global coral reef fish family. Trends Ecol. Evol. 15, 454–459. Mol. Phylogenet. Evol. 45, 50–68. Romero, E.J., 1993. South American paleofloras. In: Goldblatt, P. (Ed.), Biological Freire, E.M.X., 1999. Espécie nova de Coleodactylus Parker, 1926, das dunas de Natal, Relationships between Africa and South America. Yale University Press, New Rio Grande do Norte, Brasil, com notas sobre as relações de dicromatismo Haven and London, pp. 62–85. sexual no gênero (Squamata, Gekkonidae). Bol. Mus. Nac., N. S., Rio de Janeiro Ron, S.R., 2000. Biogeographic area relationships of lowland neotropical rainforest 399, 1–14. based on raw distributions of vertebrate groups. Biol. J. Linn. Soc. 71, 379–402. Funk, D.J., Omland, K.E., 2003. Species-level paraphyly and polyphyly: frequency, Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference causes, and consequences, with insights from animal mitochondrial DNA. Annu. under mixed models. Bioinformatics 19, 1572–1574. Rev. Ecol. Evol. Syst. 34, 397–423. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Funk, W.C., Caldwell, J.P., Peden, C.E., Padial, J.M., de la Riva, I., Cannatella, D.C., 2007. Manual. Cold Spring Harbour: Cold Spring Harbour Laboratory Press. Tests of biogeographic hypotheses for diversification in the Amazonian forest Sanderson, M.J., 2002. Estimating absolute rates of molecular evolution and frog, Physalaemus petersi. Mol. Phylogenet. Evol. 44, 825–837. divergence times: A penalized likelihood approach. Mol. Biol. Evol. 19, 101–109. Flynn, J.J., Wyss, A.R., 1998. Recent advances in South American mammalian Sanderson, M.J., 2003. r8s: inferring absolute rates of molecular evolution and paleontology. Trends Ecol. Evol. 13, 449–454. divergence times in the absence of a molecular clock. Bioinformatics 19, 301– Gamble, T., Bauer, A.M., Greenbaum, E., Jackman, T.R., 2008a. Evidence for 302. Gondwanan vicariance in an ancient clade of gecko lizards. J. Biogeogr. 35, Sanderson, M.J., Doyle, J.A., 2001. Sources of error and confidence intervals in 88–104. estimating the age of angiosperms from rbcL and 18S rDNA data. Am. J. Bot. 88, Gamble, T., Simons, A.M., Colli, G.R., Vitt, L.J., 2008b. Tertiary climate change and the 1499–1516. diversification of the Amazonian gecko genus Gonatodes (Sphaerodactylidae, Santos, R.M.L., Bertolotto, C.E.V., Pellegrino, K.C.M., Rodrigues, M.T., Yonenaga- Squamata). Mol. Phylogenet. Evol. 46, 269–277. Yassuda, Y., 2003. Chromosomal studies on sphaerodactyl lizards of genera Giugliano, L.G., Collevatti, R.G., Colli, G.R., 2007. Molecular dating and phylogenetic Gonatodes and Coleodactylus (Squamata, Gekkonidae) using differential staining relationships among Teiidae (Squamata) inferred by molecular and and fragile sites analyses. Cyt. Gen. Res. 103, 128–134. morphological data. Mol. Phylogenet. Evol. 45, 168–179. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with Glor, R.E., Vitt, L.J., Larson, A., 2001. A molecular phylogenetic analysis of applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. diversification in Amazonian Anolis lizards. Mol. Ecol. 10, 2661–2668. Simmons, M.P., Ochoterena, H., 2000. Gaps as characters in sequence-based Godinho, R., Crespo, E.G., Ferrand, N., Harris, D.J., 2005. Phylogeny and evolution of phylogenetic analyses. Syst. Biol. 49, 369–381. the green lizards, Lacerta spp. (Squamata: Lacertidae) based on mitochondrial Swofford, D.L., 2003. PAUP. Phylogenetic analysis using parsimony (and other and nuclear DNA sequences. Amph. Rept. 26, 271–285. methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachusetts. Grimaldi, D., 1995. On the age of Dominican amber. In: Anderson, K.B., Crelling, J.C. Symula, R., Schulte, R., Summers, K., 2003. Molecular systematics and (Eds.), Amber, Resinite, and Fossil Resins. American Chemical Society, phylogeography of Amazonian poison frogs of the genus Dendrobates. Mol. Washington DC, USA, pp. 203–217. Phylogenet. Evol. 26, 452–475. Gruber, K.F., Voss, R.S., Jansa, S.A., 2007. Base-compositional heterogeneity in the Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal W: improving the RAG1 locus among didelphid marsupials: implications for phylogenetic sensitivity of progressive multiple sequence alignment through sequence inference and the evolution of GC content. Syst. Biol. 56, 83–96. weighting, position-specific gap penalties and weight matrix choice. Nucleic Harris, D.J., 2003. Codon bias variation in C-mos between squamate families might Acids Res. 22, 4673–4680. distort phylogenetic inferences. Mol. Phylogenet. Evol. 27, 540–544. Townsend, T., Larson, A., Louis, E., Macey, J., 2004. Molecular phylogenetics of Hipp, A.L., Hall, J.C., Sytsma, K.J., 2004. Congruence versus phylogenetic accuracy: Squamata: the position of snakes, amphisbaenians, and dibamids, and the root revisiting the incongruence length difference test. Syst. Biol. 53, 81–89. of the squamate tree. Syst. Biol. 53, 735–757. Kluge, A.G., 1967. Higher taxonomic categories of gekkonid lizards and their Underwood, G., 1954. On the classification and evolution of geckos. Proc. Zool. Soc. evolution. Bull. Amer. Mus. Natur. Hist. 135, 1–59. London 124, 469–492. Kluge, A.G., 1987. Cladistic relationships in the Gekkonoidea (Squamata, Sauria). van Rheede, T., Bastiaans, T., Boone, D.N., Hedges, S.B., de Jong, W.W., Madsen, O., Misc. Publ. Mus. Zool. Univ. Michigan 173, 1–54. 2006. The Platypus is in its place: nuclear genes and indels confirm the sister Kluge, A.G., 1995. Cladistic relationships of sphaerodactyl lizards. Am. Mus. group relation of Monotremes and Therians. Mol. Biol. Evol. 23, 587–597. Novitates 3139, 1–23. Vanzolini, P.E., 1957. O gênero Coleodactylus (Sauria, Gekkonidae). Pap. Avulsos Dep. Kronauer, D.J.C., Bergmann, P.J., Mercera, J.M., Russell, A.P., 2005. A Zool. (São Paulo) 13, 1–17. phylogeographically distinct and deep divergence in the widespread Vanzolini, P.E., 1968a. Lagartos brasileiros da família Gekkonidae (Sauria). Pap. Neotropical turnip-tailed gecko, Thecadactylus rapicauda. Mol. Phylogenet. Avulsos Dep. Zool. (São Paulo) 17, 1–84. Evol. 34, 431–437. Vanzolini, P.E., 1968b. Geography of the South American Gekkonidae (Sauria). Arq. Maddison, W., 1989. Reconstructing character evolution on polytomous Zool. (São Paulo) 17, 85–112. cladograms. Cladistics 5, 365–377. Vanzolini, P.E., 1970. Zoologia Sistemática, geografia e a origem das espécies. Inst. Morando, M., Avila, L.J., Sites Jr., J.W., 2003. Sampling strategies for delimiting Geog. S. Paulo Teses e Monog. 3, pp. 1–56. species: genes, individuals, and populations in the Liolaemus elongatus-kriegi Vanzolini, P.E., 1980. Coleodactylus septentrionalis, sp. n., with notes on distribution complex (Squamata: Liolaemidae) in Andean-Patagonian South America. Syst. of the genus (Sauria, Gekkonidae). Pap. Avulsos Zool. (São Paulo) 34, 1–9. Biol. 52, 159–185. Vanzolini, P.E., Williams, E.E., 1970. South American anoles: the geographic Moritz, C., Patton, J.L., Schneider, C.J., Smith, T.B., 2000. Diversification of rainforest differentiation and evolution of the Anolis chrysolepis species group (Sauria, faunas: an integrated molecular approach. Annu. Rev. Ecol. Syst. 31, 533–563. Iguanidae). Arq. Zool. (São Paulo) 19, 1–298. Nahum, L.A., Pereira, S.L., Fernandes, F.M.C., Matioli, S.R., Wajntal, A., 2003. Venkatesh, B., Erdmann, M.V., Brenner, S., 2001. Molecular synapomorphies resolve Diversification of Ramphastinae (Aves, Ramphastidae) prior to the evolutionary relationships of extant jawed vertebrates. Proc. Natl. Acad. Sci. Cretaceous/Tertiary boundary as shown by molecular clock of mtDNA USA 98, 11382–11387. sequences. Genet. Mol. Biol. 26, 411–418. Vidal, N., Hedges, S.B., 2002. Higher-level relationships of snakes inferred from four Noble, G.K., 1921. T. In: he bony structure and phyletic relations of Sphaerodactylus nuclear and mitochondrial genes. Comptes rendus. Biologies 325, 977–985. and allied lacertilian genera, with the description of a new genus. Am. Mus. Vitt, L.J., Sartorius, S.S., Ávila-Pires, T.C.S., Zani, P.A., Espósito, M.C., 2005. Small in a Novitates 4, 1–16. big world: ecology of leaf-litter geckos in New World tropical forests. Herpetol. Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author. Monogr. 19, 137–152. Evolutionary Biology Centre, Uppsala University. Weisrock, D.W., Harmon, L.J., Larson, A., 2005. Resolving deep phylogenetic Parker, H.W., 1926. The Neotropical lizards of the genera Lepidoblepharis, relationships in salamanders: analyses of mitochondrial and nuclear genomic Pseudogonatodes, Lathrogecko, and Sphaerodactylus, with the description of a data. Syst. Biol. 54, 758–777. new genus. Ann. Mag. Nat. Hist. 17, 291–301. Wettstein, O., 1928. Coleodactylus zernyi nov. spec., ein neuer Gecko aus Brasilien. Parker, H.W., 1935. The frogs, lizards, and snakes of British Guiana. Proc. Zool. Soc. Zool. Anz. 76, 110–112. London 3, 505–530. Whiting, A.S., Bauer, A.M., Sites Jr., J.W., 2003. Phylogenetic relationships and limb Parrish, J.T., 1993. Palaeoclimatic history of the opening South Atlantic. In: George, loss in sub-Saharan African scincine lizards (Squamata: Scincidae). Mol. W., Lavocat, R. (Eds.), The Africa-South America Connection. Clarendon Press, Phylogenet. Evol. 29, 582–598. Oxford, pp. 28–43. Zaldivar-Riverón, A., Belokobylskij, S.A., León-Regagnon, V., Martínez, J.J., Briceño, Pellegrino, K.C.M., Rodrigues, M.T., Waite, A.N., Morando, M., Yonenaga-Yassuda, Y., R., Quicke, D.L.J., 2007. A single origin of gall association in a group of parasitic Sites Jr., J.W., 2005. Phylogeography and species limits in the Gymnodactylus wasps with disparate morphologies. Mol. Phylogenet. Evol. 44, 981–992.