sign in sign up
<<
Home , Fatty acid synthase

Cloning and sequence analysis of putative type II from Arachis hypogaea L. 227

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

MENG-JUN LI, AI-QIN LI, HAN XIA, CHUAN-ZHI ZHAO, CHANG-SHENG LI, SHU-BO WAN, YU-PING BI and XING-JUN WANG* High-Tech Research Center, Shandong Academy of Agricultural Sciences, Key Laboratory for Genetic Improvement of Crop, and Poultry of Shandong Province, Key Laboratory of Crop Genetic Improvement and Biotechnology, Huanghuaihai, Ministry of Agriculture, Ji’nan 250100, China *Corresponding author (Email, [email protected])

The cultivated peanut is a valuable source of dietary oil and ranks fi fth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP synthase (I, II, III), β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

[Li M-J, Li A-Q, Xia H, Zhao C-Z, Li C-S, Wan S-B, Bi Y-P and Wang X-J 2009 Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.; J. Biosci. 34 227–238]

1. Introduction centres reside in discrete gene products. E. coli serves as the paradigm for the type II FAS system. Oils are glycerol triesters of fatty acids and are mainly (ACP) functions to sequester the growing acyl chain attached derived from plant sources. Peanut is widely grown and ranks to the prosthetic group from solvent as fi fth among the world oil crops (Moretzsohn et al. 2004). It it shuttles the intermediates between type II FAS enzymes is of great importance to study the fatty acid biosynthesis (Zhang et al. 2003b). The condensation of malonyl-ACP pathway for improving oil quality and increasing oil content with acyl-ACP to form β-ketoacyl-ACP is catalysed by small of peanut through biotechnology-based approaches. β-ketoacyl-ACP synthase (KAS) family enzymes. FabH Fatty acid biosynthesis is catalysed by two types of fatty (β-ketoacyl-ACP synthase III, KASIII) condenses acetyl- acid synthase (FAS). Type I FAS, as found in vertebrates, CoA with malonyl-ACP to form 4:0-ACP, FabB (KAS I) yeast and some bacteria, contains all the active sites on is responsible for the elongation of 4:0-ACP to 16:0-ACP, one or two multidomain polypeptides. In type II FAS of and FabF (KAS II) mediates the elongation of 16:0-ACP many bacteria, plant plastids and mitochondria, the active to 18:0-ACP. The formation of malonyl-ACP is catalysed

Keywords. Arachis hypogaea L.; EST sequencing; gene cloning; type II FAS

Abbreviations used: ACAT, acetyl CoA:ACP transacylase; ACP, acyl carrier protein; DAP, days after pegging; ENR, enoyl-ACP reductase; EST, expressed sequence tag; FAS, fatty acid synthase; HD, β-hydroxyacyl-ACP dehydrase; KAS, β-ketoacyl-ACP synthase; KR, β-ketoacyl-ACP reductase; MCAT, malonyl-CoA:ACP transacylase; NCBI, National Center for Biotechnology; ORF, open reading frame; PCR, polymerase chain reaction; RACE, rapid amplifi cation of cDNA ends; SNP, single-nucleotide polymorphism http://www.ias.ac.in/jbiosci J. Biosci. 34(2), June 2009, 227–238, © Indian AcademyJ. Biosci. of 34 Sciences(2), June 2009 227 228 Meng-Jun Li et al by acetyl-CoA carboxylase and FabD (malonyl-CoA:ACP is unclear because mitochondrial membrane fatty acids are transacylase, MCAT). The reduction of β-ketoacyl-ACP to believed to originate outside mitochondria (Wada et al. β-hydroxyacyl-ACP by FabG (β-ketoacyl-ACP reductase, 1997). KR) is the fi rst reductive step. Two isozymes, FabA and In this study, we report the cloning of A. hypogaea type FabZ (β-hydroxyacyl-ACP , HD), catalyse the II FAS genes in plastids and two ACPs in mitochondria dehydration of β-hydroxyacyl-ACP to trans-2-acyl-ACP. by expressed sequence tag (EST) sequencing of a full- FabA is a bifunctional involved in the introduction length cDNA library and homology-based cloning of a cis-double bond into the growing acyl chain (Heath and from immature peanut seeds. The primary structures of Rock 1996). The last reduction in each elongation cycle is plant type II FAS enzymes were analysed by sequence catalysed by FabI (enoyl-ACP reductase, ENR). alignments, and compared with that of E. coli. Furthermore, The isolation and cloning of cDNAs encoding plant homologues of each peanut type II gene in developing plastid type II FAS genes have been reported in Arabidopsis seeds were investigated by cloning and sequencing. The thaliana (Post-Beittenmiller et al. 1989; Lamppa and goal of our study was to provide a basis for elucidating the Jacks 1991; Hlousek-Radojcic et al. 1992; Tai et al. 1994; molecular mechanism of in peanut seed Carlsson et al. 2002), Brassica napus (Kater et al. 1991; development. Simon and Slabas 1998), Cuphea sp (Klein et al. 1992; Voetz et al. 1994; Slabaugh et al. 1995), Spinacia oleracea 2. Materials and methods (Scherer and Knauf 1987; Schmid and Ohlrogge 1990; Tai and Jaworski 1993), Hordeum vulgare (Hansen and von 2.1 RNA isolation and cDNA library construction Wettstein-Knowles 1991; Hansen and Kauppinen 1991), Coriandrum sativum (Mekhedov et al. 2001), and Allium Peanut (A. hypogaea cultivar luhua-14) was grown in ampeloprasum (Chen and Post-Beittenmiller 1996). The the farm and gynophores were labelled. The immature crystal structure determination of E. coli type II FAS peanut seeds from 20 to 60 days after pegging (DAP) were enzymes has been completed (White et al. 2005), but collected, frozen in liquid N2 immediately and stored in a only the crystal structure of B. napus KR and ENR has freezer at –80ºC. Total RNA was extracted from the seeds by been determined in higher plants (Rafferty et al. 1995; the RNAgent kit (Promega, Madison, WI, USA). Messenger Fisher et al. 2000). Most of the work with plant plastid RNA was isolated and purifi ed from total RNA (Promega). type II FAS is focused on ACP (Hlousek-Radojcic et al. Directional cDNA synthesis (using adapters of EcoRI, 1992; Kopka et al. 1993; Suh et al. 1999; Bonaventure XhoI restriction sites) and library construction followed and Ohlrogge 2002) and KAS (Clough et al. 1992; Olsen the protocol of Stratagene s pBluescript II cDNA library et al. 1999; Abbadi et al. 2000; Dehesh et al. 2001; Pidkowich construction kit. et al. 2007). Plant ACPs are encoded by a multigene family which expresses in a constitutive manner (Hlousek- Radojcic et al. 1992) or in a tissue-specifi c manner 2.2 Analysis of ESTs (Bonaventure and Ohlrogge 2002). The altered expression levels of KASII and KASIII lead to a change in oil content Each sequence obtained was edited using the Lasergene and qualities in A. thaliana (Abbadi et al. 2000; Dehesh SeqMan II Module (DNAStar) (http:/www.DNAStar.com). et al. 2001; Pidkowich et al. 2007). In contrast to the Comparison of peanut ESTs with non-redundant protein well-studied E. coli type II FAS system, plant type II FAS sequence databases (tBLASTx) at the National Center for enzymes located in plastids are largely uncharacterised Biotechnology (NCBI) was performed to determine the except in A. thaliana. open reading frame (ORF) of the cDNA and probably gene Plant mitochondrial fatty acid synthesis is also catalysed function. by the type II FAS system (Olsen et al. 2004), in which only ACP from Pisum sativum (Wada et al. 1997) and A. thaliana 2.3 Gene cloning (Shintani and Ohlrogge 1994), and KAS from A. thaliana (Yasuno et al. 2004) have been characterised. The crystal The full-length cDNAs of ACP, HD, ENR were identifi ed structure of mitochondrial KAS has been determined (Olsen from our EST contigs. The 3′-end MCAT was cloned by et al. 2004). Mitochondrial ACP functions as an essential 3′-rapid amplifi cation of cDNA ends (3′-RACE). The KR, in lipoic acid synthesis (Shintani and Ohlrogge KASI, KASII and KASIII genes were isolated by homology- 1994; Wada et al. 1997). Mitochondrial KAS with its broad based cloning. Primers were designed based on the homology chain length specifi city accomplishes all condensation steps of KAS sequences from the NCBI. Fragments of KAS genes in mitochondrial fatty acid synthesis (Yasuno et al. 2004). were amplifi ed by polymerase chain reaction (PCR) using The role of the mitochondrial fatty acid synthetic pathway One-Shot LA PCRTM Mix (TaKaRa, Dalian, China). The

J. Biosci. 34(2), June 2009 Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. 229

5′-RACE and 3′-RACE (5′/3′ RACE Kit, 2nd Generation, group forms a thioester bond with fatty acids resulting in Roche) primers were constructed based on known sequences activation of the carboxyl carbon of the acyl group (Suh et of KAS genes. PCR products were cloned into the pMD18-T al. 1999). Helix II was the most conserved in plant ACP 4 vector (TaKaRa). α helices. Helix II plays a dominant role in the interaction with type II FAS partner enzymes in plastids and has been termed the ‘recognition helix’ of ACP (Zhang et al. 2003a). 2.4 Homologue analysis of type II FAS genes Three other α helices, helix I, helix III and helix IV, were the main distinguishing features of plant ACPs in plastids and Total RNA was isolated at six different seed development mitochondria (fi gure 1). stages (stage 1, 15 DAP; stage 2, 20 DAP; stage 3, 25 DAP; A CT-rich sequence and the motif CTCCGCC and its stage 4, 35 DAP; stage 5, 45 DAP; stage 6, 70 DAP) using derivative are conserved in the 5′-leader region of 18 plastid RNAiso Reagent (TaKaRa) as described by the manufacturer. ACP cDNA (Bonaventure and Ohlrogge 2002). Site-directed Five microgram of RNA was reverse transcribed using a mutagenesis of the CT-rich sequence, TTCTCTCTCCT, PrimerScriptTM 1st Strand cDNA Synthesis Kit (TaKaRa) resulted in a three-fold reduction in transcription of the with oligo (dT) as the primer according to the protocol AtpC::uidA gene fusion (Bolle et al. 1996). The motif provided by the supplier. The resulting cDNA was mixed CTCCGTC and two CT-rich sequences were identifi ed in and diluted 10-fold and 1 μl was used as a template for the 5′-leader region of AhACP1 but not in AhACP2 and PCR amplifi cation using 2×pfu PCR MasterMix (Tiangen AhACP3 (table 1). Lack of these two motifs may lead to Biotech, Beijing, China) with the specifi c primers of each a difference in expression between AhACP1 and AhACP2, type II FAS gene. The PCR products were cloned into the AhACP3 in developing peanut seeds. pMD18-T vector (TaKaRa). Primers applied in homologue analysis are available in supplementary materials. Plasmid DNA was prepared using the EZNA Plasmid 3.2 Cloning and sequence analysis of AhMCAT Minipreps DNA Purifi cation System (Omega Bio-Tek, USA). Purifi ed plasmid DNA was sequenced to obtain In Sreptomyces coelicolor, MCAT is a key enzyme in both the 5′- and 3′-end with BigDyeR Terminator v3.1 Cycle fatty acid and polyketide synthesis (Keatinge-Clay et al. Sequencing Kit (ABI) on an ABI 3730XL DNA Analyzer. 2003). A MCAT cDNA clone was obtained from the peanut Nucleotide sequence assembly and homology searches cDNA library. AhMCAT contained a 1158 bp ORF, encoding were performed using the tBLASTx tool online. Sequence a protein of 385 amino acids with a predicted molecular reassembly and coding region prediction were performed weight of 40.9 kD and a pI of 7.793. The deduced AhMCAT using the Lasergene SeqMan II Module (DNAStar) (http: sequence shared 32.7% sequence identity with E. coli FabD //www.DNAStar.com). Multiple sequence alignments (Serre et al. 1995). were analysed using the ClustalW1.83 software (http: In EcFabD, the , Ser92, is hydrogen-bonded //www.ch.embnet.org/software/ClustalW.html). Sequences to His201. Gln250 serves as an H-bond acceptor during were shaded using the BoxShade program (http:// interaction with His201. Arg117 might play a role in binding www.ch.embnet.org/software/BOX_form.html). the free carboxyl group. Gln11 can serve as an H-bond donor (Serre et al. 1995). The residues of AhMCAT, Gln89, Ser174, Arg199, His287 and Gln336, equivalent to EcFabD 3. Results Gln11, Ser92, Arg117, His201 and Gln250, were strictly conserved in higher plants (fi gure 2). The GLSLGEY motif 3.1 Cloning and sequence analysis of AhACP containing the catalytic residue (serine174 in AhMCAT) was completely conserved in higher plants, compared with Forty-three ACP cDNA clones were identifi ed from ESTs the E. coli GHSLGEY motif (fi gure 2). The G(H/L)SLG derived from the full-length cDNA library; these could be pentapeptide belongs to the GXSXG motif (where x is any divided into three groups: AhACP1 (36 clones), AhACP2 residue) prevalent in α/β (Keatinge-Clay et al. (6 clones) and AhACP3 (1clone) based on their amino acid 2003), which is conserved in all bacterial species (Simon similarity. Twenty-seven ACPs from 6 plant species revealed and Slabas 1998). primary structure conservation among plant ACPs (fi gure 1). Plant ACPs can clearly be divided into two types, which are located in plastids (fi gure 1A) and mitochondria (fi gure 1B). 3.3 Cloning and sequence analysis of AhKAS The central region encompassing the phosphopantetheine attachment site consists of a serine residue within a DSL In higher plants, fi ve types of KAS have been reported; motif recognised by members of the phosphopantetheinyl namely, KASI, KASII, KASIII, KASIV and mitochondrial family (Mofi d et al. 2002). The prosthetic KAS, but there were no KAS ESTs in our peanut full-length

J. Biosci. 34(2), June 2009 230 Meng-Jun Li et al

Figure 1. Multiple sequence alignment of selected acyl carrier protein (ACP) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm and shaded using BoxShade. Identical and conserved residues are shaded black and grey, respectively. The 4 α helices are indicated. Plant ACP Ser, corresponding to E. coli prosthetic group attachment site (Ser36), is marked with a triangle. GenBank accession numbers are as follows : Ah1, EE127470; Ah2, EG373603; Ah3, EU823319; At1, NP_187153; At2, NP_175860; At3, NP_564663; At4, NP_194235; At5, NP_198072; At6, NM_130026; At7, NP_176708; At8, NP_199574; Cl1, CAA54714; Cl2, CAA54715; Cl3, CAA54716; Cl4, CAA64542; So1, CAA36288; So2, P07854; Os1, NP_001050125; Os2, NP_001051948; Os3, NP_ 001055387; Os4, NP_001059204; Os5, NP_001062441; Os6, NP_001066930; Os7, NP_001067983; Hv1, AAA32920; Hv2, AAA32921 Hv3, AAA32922; Ec, AAB27925. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Cl, Cuphea lanceolata; So, S. oleracea; Os, Oryza sativa; Hv, Hordeum vulgare; Ec, E. coli.

Table 1. Proximal upstream sequence of acyl carrier protein (ACP) genes in peanut ACP isoform Sequence* AhACP1 gcattctcattaccacaaacactcttctcgtgctCTCCGTCcaaatctcagatctctctctctgtgaaa atg AhACP2 gagctaaagagagaagaactgagaagtgagaaccgagaatagagaagaagcaaagaagggttttaggtttttgtgtagatcgattttgca atg AhACP3 gacactcactcattcattcttcaaagaagaagaa atg *The motif CTCCGTC is indicated in upper case. The CT-rich sequences are underlined. The ATG start codon is separated by one space at the right end of the sequences. cDNA library. We cloned three members of the KAS family bp, 1647 bp and 1206 bp ORF, encoding for a protein of 470, by a homology-based approach using KAS sequences of 548 and 401 amino acids with a predicted molecular mass Glycine, Medicago and peanut ESTs in GenBank. The of 50.0, 58.7, 42.5 kDa and a pI of 8.192, 8.090 and 6.940, peanut AhKASI, AhKASII and AhKASIII contained a 1413 respectively. AhKASI shared 51.5% sequence identity with

J. Biosci. 34(2), June 2009 Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. 231

Figure 2. Multiple sequence alignment of selected malonyl-CoA:ACP transacylase (MCAT) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm. The fi ve conserved residues of A. hypogaea MCAT corresponding to E.coli FabD Gln11, Ser92, Arg117, His201 and Gln250 are shaded black and position numbers are indicated. The motif G(L/H)SLG is boxed. GenBank accession numbers are as follows: Ah, EU823322; Gm, ABB85235; At1, AAM14913; At2, AAM64515; Bn, CAB45522; Pf, AAG43518; Ca, ACF17665; Os, ABF95452, Ec, 1MLA. Abbreviations: Ah, A. hypogaea; Gm, Glycine max; At, A. thaliana; Bn, B. napus; Pf, Perilla frutescens; Ca, Capsicum annuum; Os, O. sativa; Ec, E. coli.

AhKASII and only 6.5% with AhKASIII. EcFabF shared (GenBank accession no. EG029580, ES715710) and the 43.8% and 45.3% identity with AhKASI and AhKASII, two sequences were used for primer design. The cDNAs of whereas EcFabB shared 33.7% and 31.8% identity, which AhKR were cloned, which contained a 972 bp ORF encoding is consistent with results in Arabidopsis (von Wettstein- a protein of 323 amino acids with a predicted molecular Knowles et al. 2000). EcFabF was more closely related to mass of 33.8 kDa and a pI of 9.004. The deduced amino peanut plastid KASI and KASII than EcFabB. acid sequence of AhKR was 69.7% and 49.6% identical to The active site triads, Cys22–His36–His397 of AhKASI B. napus KR (Fisher et al. 2000) and E. coli FabG (Price et and Cys299–His439–His475 of AhKAS II, were revealed al. 2001). by sequence alignments. The Cys–His–His active site triad On comparing BnKR with EcFabG, three active was strictly conserved in KASI and KASII of higher plants site residues – Ser217, Tyr230 and Lys234 of AhKR (fi gure 3). – corresponding to Ser138, Tyr151 and Lys155 of EcFabG, The greatest distinction between the active-site were found. The Ser–Tyr–Lys was completely architecture of KASI, KASII and KASIII is the presence of conserved in higher plants (fi gure 5). The tyrosine and two histidines in KASI and KASII and a histidine plus an lysine residues are involved in actual , whereas asparagine in KASIII (von Wettstein-Knowles et al. 2000). serine participates in binding and alignment AhKASIII shared 41% sequence identity with EcFabH and (Price et al. 2001). Lys208 (Arg in BnKR) and Arg251 of also had a Cys–His–Asn active site triad (Cys177, His327, AhKR, corresponding to Arg129 and Arg172 of EcFabG, Asn357), corresponding to EcFabH Cys112, His244, made a signifi cant contribution to ACP docking and were Asn274 (Qiu et al. 1999). The Cys–His–Asn active site triad strictly conserved in higher plants (Zhang et al. 2003b). The and the motif GNTSAAS were strictly conserved in higher catalytic YX3K motif conserved in FabG was also highly plants with the exception of Elaeis oleifera KASIII (Cys→ conserved in higher plants. Tyr) (fi gure 4). Deletion of the tetrapeptide of GNTS led to a change in secondary structure and complete loss of AtKASIII 3.5 Cloning and sequence analysis of AhHD condensing activity. The motif GNTSAAS was proposed to be responsible for the binding of acyl-ACPs (Abbadi et al. One full-length cDNA of HD was identifi ed in the peanut 2000). The Arg332 of AhKASIII, corresponding to Arg249 cDNA library, which contained a 663 bp ORF encoding a of EcFabH, a critical residue in the interaction between protein of 220 amino acids with a predicted molecular mass EcFabH and ACP (Zhang et al. 2001), was also strictly of 24.0 kDa and a pI of 9.069. The deduced amino acid conserved in higher plants (fi gure4). sequence shared 43.1% and 13.4% identity with EcFabZ and EcFabA, respectively. 3.4 Cloning and sequence analysis of AhKR The two genes, FabA and FabZ, encoding β-hydroxyacyl- ACP dehydratases have been well studied in E. coli. The No KR clone was identifi ed in our sequenced ESTs. By catalytically important active site residues are His70 and searching public databases, we found two AhKR ESTs Asp84′ in EcFabA (Leesong et al. 1996) and His54 and

J. Biosci. 34(2), June 2009 232 Meng-Jun Li et al

Figure 3. Multiple sequence alignment of selected β-ketoacyl-ACP synthase I (KASI) (A) and KASII (B) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm. (A) The three conserved residues of A. hypogaea KASI corresponding to E.coli FabB Cys163, His298 and His333 are shaded black and position numbers are indicated. GenBank accession numbers are as follows: Ah1, EU823325; Gm11, AAF61730; Gm12, AAF61731; At11, AAC49118; At12, AAM65396; Pf1, AAC04691; Rc1, AAA33873; Jc1, ABJ90468; Os1, BAD35225; Hv1, AAA32968; Ec1, AAC67304. (B) The three conserved residues of A. hypogaea KASII corresponding to E. coli FabF Cys164, His304 and His341 are shaded black and position numbers are indicated. GenBank accession numbers are as follows: Ah2, EU823327; Gm21, AAW88762; Gm22, AAW88763; Gm23, AAF61737; At21, AAK69603; At22, AAL91174; Pf2, AAC04692; Rc2, AAA33872; Jc2, ABJ90469; Os2, BAC79989; Hv21, CAA84022; Hv22, CAA84023; Ec2, CAA84431. Abbreviations: Ah, A. hypogaea; Gm, G. max; At, A. thaliana; Pf, P. frutescens; Rc, Ricinus communis; Jc, Jatropha curcas; Os, O. sativa; Hv, H. vulgare; Ec, E. coli.

Glu68′ in EcFabZ (Kimber et al. 2004). In AhHD, the showed 29.0% identity with EcFabI and 84.3% identity with His/Glu catalytic dyad, His121 and Glu135′, and the motif BnFabI (Rafferty et al. 1995). AhFabI had 15.5% sequence LPHRFPFLLVDRV were completely conserved in plant HD identity with AhKR, similar to that of BnFabI and BnKR and EcFabZ (fi gure 6), which suggested that plant HD may (Fisher et al. 2000). function, like EcFabZ, in the of both saturated The Tyr–Tyr–Lys active site triad is characteristic of FabI and unsaturated long chain acyl-ACPs (Kimber et al. 2004). homologues. The fi rst tyrosine hydroxyl is directly involved in catalysis (Rafi et al. 2006). The second tyrosine might 3.6 Cloning and sequence analysis of AhENR donate a proton to the enolate anion and lysine might act to stabilise the negatively charged transition state (Rafferty One ENR homologue was isolated from the peanut cDNA et al. 1995). In AhENR, the catalytic triad Tyr260–Tyr270– library. It contained a 1170 bp ORF encoding a protein of Lys278 and the motif YGGGMSSAK, corresponding to the

389 amino acids with a predicted molecular mass of 41.4 YX6K motif in EcFabI, were completely conserved in higher kDa and a pI of 8.571. The predicted protein sequence plants (fi gure 7).

J. Biosci. 34(2), June 2009 Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. 233

Figure 4. Multiple sequence alignment of selected β-ketoacyl-ACP synthase III (KASIII) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm. The four conserved residues of A. hypogaea KASIII corresponding to E. coli FabH Cys112, His244, Arg249 and Asn274 are shaded black and position numbers are indicated. The motif GNTSAAS is boxed. GenBank accession numbers are as follows: Ah, EU823328; Gm, AAF70509; At1, AAA61348; At2, CAA72385; Ca1, ACF17661; Ca2, ACF17662; Cw1, AAA97533; Cw2, AAA97534; Ch1, AAF61398; Ch2, AAF61399; Pf1, AAC04693; Pf2, AAC04694; Aa, AAB61310; Ps, CAC08184; Rc, ABR12417; Jc, ABJ90470; So, CAA80452; Ha, ABP93352; Eg, ABE73469; Eo, ABE73470; Ec, AAA23749. Abbreviations: Ah, A. hypogaea; Gm, G. max; At, A. thaliana; Ca, C. annuum; Cw, C. wrightii; Ch, C. hookeriana; Pf, P. frutescens; Aa, A. ampeloprasum; Ps, Pisum sativum; Rc, R. communis; Jc, J. curcas; So, S. oleracea; Ha, Helianthus annuus; Eg, Elaeis guineensis; Eo, E. oleifera; Ec, E. coli.

Figure 5. Multiple sequence alignment of selected β-ketoacyl-ACP reductase (KR) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm. The fi ve conserved residues of A. hypogaea KR corresponding to E. coli FabG Arg129, Ser138, Tyr151,

Lys155 and Arg172 are shaded black and position numbers are indicated. The motif YX3K is boxed. GenBank accession numbers are as follows: Ah, EU823329; At1, AAG40337; At2, CAA45794; Bn1, CAC41362; Bn2, CAC41363; Bn3, CAC41364; Bn4, CAC41365; Bn5, CAC41370; Ca, ACF17653; Cl, CAA45866; Os1, ABA97197; Os2, BAD22913; Ec, ACF17653. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn, B. napus; Ca, C. annuum; Cl, C. lanceolata; Os, O. sativa; Ec, E. coli.

J. Biosci. 34(2), June 2009 234 Meng-Jun Li et al

Figure 6. Multiple sequence alignment of selected β-hydroxyacyl-ACP dehydrase (HD) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm. The catalytic dyad of A. hypogaea HD corresponding to E. coli FabZ His54, Glu68 and E. coli FabA His70, Asp84 is shaded black and position numbers are indicated. The conserved domain in HD is boxed. GenBank accession numbers are as follows: Ah, EU823332; At1, AAD23619; At2, AAM64548; At3, AAO24548; Bn, AAK60545; Ca, ACF17652; Os, AAT58880; Pm1, ABA25920; Pm2, ABA25921; Ec1, AAC36917; Ec2, 1MKB_A. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn, B. napus; Ca, C. annuum; Os, O. sativa; Pm, Picea mariana; Ec, E. coli.

Figure 7. Multiple sequence alignment of selected enoyl-ACP reductase (ENR) homologues. Protein sequences were aligned using the CLUSTALW alignment algorithm. The three conserved residues of A. hypogaea ENR corresponding to E. coli FabI Tyr146, Tyr156 and Lys163 are shaded black and position numbers are indicated. GenBank accession numbers are as follows: Ah, EU823333; At1, AAF37208; At2, AAM45010; At3, CAA74175; Bn1, AAB20114; Bn2, CAA64729; Bn3, CAC41366; Bn4, CAC41367; Bn5, CAC41368; Bn6, CAC41369; Oe, AAL93621; Ca1, ACF17650; Ca2, ACF17651; Nt1, CAA74176; Nt2, CAA74177; Os1, BAD03622; Os2, BAD26009; Os3, CAA05816; Ec, P29132. Abbreviations: Ah, A. hypogaea; At, A. thaliana; Bn, B. napus; Oe, Olea europaea; Ca, C. annuum; Nt, Nicotiana tabacum; Os, O. sativa; Ec, E. coli.

3.7 Homologue of type II FAS genes and subcellular gene-specifi c primers. More than six clones of each gene were target prediction picked randomly and sequenced. Homologue numbers of each type II FAS gene expressing in peanut seed development Homologues of type II FAS genes were cloned by RT-PCR varied from 5 in ENR to only 1 in KASII, KASIII and HD. using total RNA from a peanut immature seed mixture by The number of single-nucleotide polymorphisms (SNPs) was

J. Biosci. 34(2), June 2009 Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. 235

Table 2. Homologues of each type II FAS gene in peanut Gene Accession number Clone numbers Protein ORF (bp) SNP InDel ACP1 EG374024* 0 ACP1-1 423 4 0 EE127470 4 ACP1-2 423 EE124662 2 ACP1-2 423 EU823318 1 ACP1-2 423 ACP2 EE127527 3 ACP2-1 393 4 0 EG373603 3 ACP2-2 393 ACP3 EU823319 2 ACP3-1 375 3 0 EU823320 1 ACP3-2 375 EU823321 4 ACP3-3 375 MCAT EU823322 1 MCAT1 1158 7 1 EU823323 4 MCAT2 1158 EU823324 3 MCAT3 1161 KASI EU823325 4 KASI-1 1413 20 0 EU823326 2 KASI-2 1413 KASII EU823327 10 KASII 1647 0 0 KASIII EU823328 7 KASIII 1206 0 0 KR EU823329 4 KR1 972 3 0 EU823330 3 KR2 972 EU823331 1 KR3 972 HD EU823332 7 HD-1 663 0 0 ENR EU823333 1 ENR1 1170 18 0 EU823334 3 ENR2 1170 EU823335 2 ENR3 1170 EU823336 1 ENR3 1170 EU823337 1 ENR3 1170 * EG374024 was found in the peanut full-length cDNA library but we did not fi nd it on PCR-based homologue searching. quite different in each gene. The most were identifi ed in KASI The crystal structural determination of E. coli FAS enzymes and ENR, while no SNP was identifi ed in KASII, KASIII, HD. has been completed (White et al. 2005). Here, we report the Indel was only found in MCAT (table 2). The percentage of cloning of type II FAS genes from A. hypogaea for the fi rst transition was more than that of transversion in the identifi ed time including MCAT, KASI, KASII, KASIII, KR, HD, ENR SNPs. The results indicated that most type II FAS genes had and ACP. more than two homologues expressing in developing peanut FabF has acetyl CoA:ACP transacylase (ACAT) seeds. activity and seems able to initiate fatty acid synthesis, but To clarify the possible subcellular compartment of peanut it may not play this role when FabH is functional (Lai and type II FAS genes, amino acid sequences were used for Cronan 2003). The ACAT activities of E. coli, spinach and targeting prediction by the TargetP1.1 Server. Results clearly Streptomyces glaucescens FabH are approximately 0.5%, indicated that ACP1, MCAT, KASI, KASII, KASIII, KR, 1% and 12% of the KAS activities (Tsay et al. 1992; Olsen HD and ENR all targeted chloroplast, while ACP2 and ACP3 et al. 1999; Han et al. 1998). In avocado, KAS III and ACAT were confi dently predicted to target mitochondria (table 3). activities have been separated from each other and the native molecular mass of KAS III is 69 kDa and that of ACAT is 18.5 kDa (Gulliver and Slabas 1994), which indicates that 4. Discussion there is a separate ACAT enzyme in avocado. However, in higher plants, it is still uncertain whether ACAT is a separate Fatty acid biosynthesis in higher plants is carried out by type enzyme or a partial reaction of a condensing enzyme. No II FAS, which has been most extensively studied in E. coli. ACAT cDNA has been reported in E. coli and higher plants.

J. Biosci. 34(2), June 2009 236 Meng-Jun Li et al

Table 3. Subcellular compartment of peanut type II FAS enzymes predicted by the TargetP1.1 Server Protein Accession Len cTP mTP Localisation RC TPlen ACP1 EE127470 140 0.938 0.016 Chloroplast 1 55 ACP2 EE127527 130 0.109 0.878 Mitochondria 2 40 ACP3 EU823319 124 0.082 0.923 Mitochondria 1 36 MCAT EU823322 385 0.968 0.080 Chloroplast 1 60 KI EU823325 470 0.910 0.104 Chloroplast 1 48 KII EU823327 548 0.624 0.007 Chloroplast 3 39 KIII EU823328 401 0.527 0.071 Chloroplast 5 72 KR EU823329 323 0.618 0.022 Chloroplast 3 73 HD EU823332 220 0.917 0.050 Chloroplast 1 41 ENR EU823333 389 0.937 0.143 Chloroplast 2 70 *Len, sequence length; cTP, chloroplast transit ; mTP, mitochondrial targeting peptide; RC, reliability class, from 1 to 5, where 1 indicates the strongest prediction; TPlen, presequence length

Sequence comparisons revealed that the primary structure Acknowledgements of plant plastid type II FAS enzymes was strictly conserved, especially the catalytic residues, which suggested that This work was supported by grants from the National High these enzymes may have similar functions in higher Technology Research and Development Program of China plants as those in E. coli. The helix II of plant ACPs (2006AA10A114), Shandong Academy of Agricultural was highly conserved, but plastid ACP and mitochondrial Sciences Foundation (2006YCX030), (2007YCX001) ACP can be distinguished by three other α helices. E. coli and Postdoctoral Foundation of Shandong Province FabB and FabF shared 35.2%, 49.9% identity with A. (200701004). thaliana mitochondrial KAS, and 33.7%, 46.0% with plastid KASI, KASII, respectively. These observations suggested References that two type II FAS systems in higher plants originated from E. coli type II FAS. Plant type II FAS in mitochondria Abbadi A, Brummel M and Spener F 2000 Knockout of the was more closely related to E. coli type II FAS than that in regulatory site of 3-ketoacyl-ACP synthase III enhances short- plastids. and medium-chain acyl-ACP synthesis; Plant J. 24 1–9 Homologue numbers of each type II FAS gene expressing Bolle C, Herrmann R G and Oelmuller R 1996 Different sequences in developing peanut seeds varied from 5 to 1. The number for 5′-untranslated leaders of nuclear genes for plastid of SNPs was also quite different in each gene. The result affect the expression of the beta-glucuronidase gene; Plant Mol. was consistent with that in peanut acyl-ACP Biol. 32 861–868 (GenBank accession no, EF117305-EF117309). We cloned Bonaventure G and Ohlrogge J B 2002 Differential regulation of genomic DNAs of peanut ACP1, ACP2 and ACP3 by mRNA levels of acyl carrier protein isoforms in Arabidopsis; Plant Physiol. 128 223–235 PCR using gene-specifi c primers (data not shown). Carlsson A S, LaBrie S T, Kinney A J, von Wettstein-Knowles P and More cDNAs of ACP1 and ACP3 could be deduced Browse J 2002 A KAS2 cDNA complements the phenotypes of from genomic DNA clones. The cDNAs not identifi ed the Arabidopsis fab1 mutant that differs in a single residue in developing seeds may be silent or may be expressed bordering the substrate binding pocket; Plant J. 29 761–770 in other tissues. More than two types of the 5′-terminal Chen J and Post-Beittenmiller D 1996 Molecular cloning of a of KAS cDNA were cloned by 5′-RACE. Based on these cDNA encoding 3-ketoacyl-acyl carrier protein synthase III results, we have reason to propose that more than two from leek; Gene 182 45–52 homologues of most type II FAS genes exist in the peanut Clough R C, Matthis A L, Barnum S R and Jaworski J G 1992 genome although RT-PCR has its disadvantages in gene Purifi cation and characterization of 3-ketoacyl-acyl carrier protein cloning. Gene redundancy was widespread in the peanut synthase III from spinach; J. Biol. Chem. 267 20992–20998 Dehesh K, Tai H, Edwards P, Byrne J and Jaworski J G 2001 fatty acid synthesis pathway, which made this process more Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs sophisticated. The fi ndings obtained in this study provide the in plants reduces the rate of synthesis; Plant Physiol. 125 basis for future investigation of peanut FAS genes in terms 1103–1114 of regulation, expression pattern analysis, evolution and Fisher M, Kroon J T M, Martindale W, Stuitje A R, Slabas A R and gene engineering study. Rafferty J B 2000 The X-ray structure of Brassica napus β-keto

J. Biosci. 34(2), June 2009 Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. 237

acyl carrier protein reductase and its implications for substrate nonribosomal peptide synthetase modules by the 4'-phos- binding and catalysis; Structure 8 339–347 phopan tetheinyl AcpS and Sfp; J. Biol. Chem. 277 Gulliver B S and Slabas A R 1994 Acetoacyl-acyl carrier protein 17023–17031 synthase from avocado: its purifi cation, characterisation and Moretzsohn M C, Hopkins M S, Mitchell S E, Kresovich S, Valls J clear resolution from acetyl CoA:ACP transacylase; Plant Mol. F M and Ferreira M E 2004 Genetic diversity of peanut (Arachis Biol. 25 179–191 hypogaea L.) and its wild relatives based on the analysis of Han L, Lobo S and Reynold K A 1998 Characterization of β- hypervariable regions of the genome; BMC Plant Biol. 4 11 ketoacyl-acyl carrier protein synthase III from Streptomyces Olsen J G, Kadziola A, von Wettstein-Knowles P, Siggaard- glaucescens and its role in initiation of fatty acid biosynthesis; Andersen M, Lindquist Y and Larsen S 1999 The X-ray crystal J. Bacteriol. 180 4481–4486 structure of beta-ketoacyl [acyl carrier protein] synthase I; Hansen L and Kauppinen S 1991 Barley acyl carrier protein II: FEBS Lett. 460 46–52 nucleotide sequence of cDNA clones and chromosomal location Olsen J G, Rasmussen A V, von Wettstein-Knowles P and of the Acl2 gene; Plant Physiol. 97 472–474 Henriksen A 2004 Structure of the mitochondrial beta-ketoacyl- Hansen and, von Wettstein-Knowles P 1991 The barley genes Acl1 [acyl carrier protein] synthase from Arabidopsis and its role in and Acl3 encoding acyl carrier proteins I and III are located on fatty acid synthesis; FEBS Lett. 577 170–174 different ; Mol. Gen. Genet. 229 467–478 Pidkowich M S, Nguyen H T, Heilmann I, Ischebeck T and Heath R J and Rock C O 1996 Roles of the FabA and FabZ β- Shanklin J 2007 Modulating seed beta-ketoacyl-acyl carrier hydroxyacyl-acyl carrier protein dehydratases in Escherichia protein synthase II level converts the composition of a temperate coli fatty acid biosynthesis; J. Biol. Chem. 271 27795–27801 seed oil to that of a palm-like tropical oil;. Proc. Natl. Acad. Sci Hlousek-Radojcic A, Post-Beittenmiller D and Ohlrogge JB 1992 USA 104 4742–4747 Expression of constitutive and tissue-specifi c acyl carrier Post-Beittenmiller M A, Hlousek-Radojcic A and Ohlrogge protein isoforms in Arabidopsis; Plant Physiol. 98 206–214 J B 1989 DNA sequence of a genomic clone encoding an Kater M M, Koningstein G M, Nijkamp H J and Stuitje A R 1991 Arabidopsis acyl carrier protein (ACP); Nucleic Acids Res. 17 cDNA cloning and expression of Brassica napus enoyl-acyl 1777 carrier protein reductase in Escherichia coli; Plant Mol. Biol. Price A C, Zhang Y M, Rock C O and White S W 2001 Structure 17 895–909 of β-ketoacyl-[acyl carrier protein] reductase from Escherichia Keatinge-Clay A T, Shelat A A, Savage D F, Tsai S C, Miercke L coli: negative and its structural basis; Biochemistry J, O’Connell J D, Khosla C and Stroud R M 2003 Catalysis, 40 12772–12781 specifi city, and ACP docking site of Streptomyces coelicolor Qiu X, Janson C A, Konstantinidis A K, Nwagwu S, Silverman malonyl-CoA:ACP transacylase; Structure 11 147–154 C, Smith W W, Khandekar S, Lonsdale J and Abdel-Meguid Kimber M S, Martin F, Lu Y J, Houston S, Vedadi M, S S 1999 Crystal structure of beta-ketoacyl-acyl carrier protein Dharamsi A, Fiebig K M, Schmid M and Rock C O 2004 The synthase III. A key condensing enzyme in bacterial fatty acid structure of (3R)-hydroxyacyl-acyl carrier protein biosynthesis; J. Biol. Chem. 274 36465–36471 (FabZ) from Pseudomonas aeruginosa; J. Biol. Chem. 2792 Rafferty J B, Simon J W, Baldock C, Artymiuk P J, Baker P J, 52593–52602 Stuitje A R, Slabas A R and Rice D W 1995 Common themes in Klein B, Pawlowski K, Horicke-Grandpierre C, Schell J and Topfer redox chemistry emerge from the X-ray structure of oilseed rape R 1992 Isolation and characterization of a cDNA from Cuphea (Brassica napus) enoyl acyl carrier protein reductase; Structure lanceolata encoding a beta-ketoacyl-ACP reductase; Mol. Gen. 3 927–938 Genet. 233 122–128 Rafi S, Novichenok P, Kolappan S, Zhang X, Stratton C F, Rawat Kopka J, Robers M, Schuch R and Spener F 1993 Acyl carrier R, Kisker C, Simmerling C and Tonge P J 2006 Structure of acyl proteins from developing seeds of Cuphea lanceolata Ait; carrier protein bound to FabI, the FASII enoyl reductase from Planta 191 102–111 Escherichia coli; J. Biol. Chem. 281 39285–39293 Lai C Y and Cronan J E 2003 β-ketoacyl-acyl carrier protein Scherer D E and Knauf V C 1987 Isolation of a cDNA clone for the synthase III (FabH) is essential for bacterial fatty acid synthesis; acyl carrier protein-I of spinach; Plant Mol. Biol. 9 127–134 J. Biol. Chem. 278 51494–51503 Schmid K M and Ohlrogge J B 1990 A root acyl carrier protein-II Lamppa G and Jacks C 1991 Analysis of two linked genes coding from spinach is also expressed in leaves and seeds; Plant Mol. for the acyl carrier protein (ACP) from Arabidopsis thaliana Biol. 15 765–778 (columbia); Plant Mol. Biol. 16 469–474 Serre L, Verbree E C, Dauter Z, Stuitje A R and Derewenda Z S Leesong M, Henderson B S, Gillig J R, Schwab J M and Smith J 1995 The Escherichia coli malonyl-CoA:acyl carrier protein L 1996 Structure of a dehydratase- from the bacterial transacylase at 1.5-A resolution. Crystal structure of a fatty acid pathway for biosynthesis of unsaturated fatty acids: two catalytic synthase component; J. Biol. Chem. 270 12961–12964 activities in one active site; Structure 4 253–264 Shintani D K and Ohlrogge J B 1994 The characterization of Mekhedov S, Cahoon E B and Ohlrogge J 2001 An unusual a mitochondrial acyl carrier protein isoform isolated from seed-specifi c 3-ketoacyl-ACP synthase associated with the Arabidopsis thaliana; Plant Physiol. 104 1221–1229 biosynthesis of petroselinic acid in coriander; Plant Mol. Biol. Simon J W and Slabas A R 1998 cDNA cloning of Brassica 47 507–518 napus malonyl-CoA:ACP transacylase (MCAT) (fabD) and Mofi d M R, Finking R and Marahiel M A 2002 Recognition complementation of an E. coli MCAT mutant; FEBS Lett. 435 of hybrid peptidyl carrier proteins/acyl carrier proteins in 204–206

J. Biosci. 34(2), June 2009 238 Meng-Jun Li et al

Slabaugh M B, Tai H, Jaworski J and Knapp S J 1995 cDNA clones Wada H, Shintani D K and Ohlrogge J B 1997 Why do mitochondria encoding beta-ketoacyl-acyl carrier protein synthase III from synthesize fatty acids? Evidence for involvement in lipoic acid Cuphea wrightii; Plant Physiol. 108 443–444 production; Proc. Natl. Acad. Sci. USA 94 1591–1596 Suh M C, Schultz D J and Ohlrogge J B 1999 Isoforms of acyl White S W, Zheng J, Zhang Y M and Rock C O 2005 The structural carrier protein involved in seed-specifi c fatty acid synthesis; biology of type II fatty acid biosynthesis; Annu. Rev. Biochem. Plant J. 17 679–688 74 791–831 Tai H and Jaworski J G 1993 3-Ketoacyl-acyl carrier protein Yasuno R, von Wettstein-Knowles P and Wada H 2004 Iden- synthase III from spinach (Spinacia oleracea) is not similar to tifi cation and molecular characterization of the beta-ketoacyl- other condensing enzymes of fatty acid synthase; Plant Physiol. [acyl carrier protein] synthase component of the Arabidopsis 103 1361–1367 mitochondrial fatty acid synthase; J. Biol. Chem. 279 Tai H, Post-Beittenmiller D and Jaworski J G 1994 Cloning of a 8242–8251 cDNA encoding 3-ketoacyl-acyl carrier protein synthase III Zhang Y M, Marrakchi H, White S W and Rock C O 2003a The from Arabidopsis; Plant Physiol. 106 801–802 application of computational methods to explore the diversity Tsay J T, Oh W, Larson T J, Jackowski S and Rock C O 1992 and structure of bacterial fatty acid synthase; J. Lipid Res. 44 Isolation and characterization of the β-ketoacyl-acyl carrier 1–10 protein synthase III gene (fabH) from Escherichia coli K-12; J. Zhang Y M, Rao M S, Heath R J, Price A C, Olson A J, Rock C Biol. Chem. 267 6807–6814 O and White S W 2001 Identifi cation and analysis of the acyl Voetz M, Klein B, Schell J and Topfer R 1994 Three different carrier protein (ACP) docking site on β-ketoacyl-ACP synthase cDNAs encoding acyl carrier proteins from Cuphea lanceolata; III; J. Biol. Chem. 276 8231–8238 Plant Physiol. 106 785–786 Zhang Y M, Wu B, Zheng J and Rock C O 2003b Key residues von Wettstein-Knowles P, Olsen J G, McGuire K A and Larsen S responsible for acyl carrier protein and β-ketoacyl-acyl carrier 2000 Molecular aspects of β-ketoacyl synthase (KAS) catalysis; protein reductase (FabG) interaction; J. Biol. Chem. 278 Biochem. Soc. Trans. 28 601–607 52935–52943

MS received 30 September 2008; accepted 2 February 2009 ePublication: 21 March 2009

Corresponding editor: VIDYANAND NANJUNDIAH

J. Biosci. 34(2), June 2009