Genetic screening of LCA in Belgium: predominance of CEP290 and identification of potential modifier alleles in AHI1 of CEP290-related phenotypes Frauke Coppieters, Ingele Casteels, Françoise Meire, Sarah de Jaegere, Sally Hooghe, Nicole van Regemorter, Hilde van Esch, Aušra Matulevičienė, Luis Nunes, Valérie Meersschaut, et al.

To cite this version:

Frauke Coppieters, Ingele Casteels, Françoise Meire, Sarah de Jaegere, Sally Hooghe, et al.. Ge- netic screening of LCA in Belgium: predominance of CEP290 and identification of potential mod- ifier alleles in AHI1 of CEP290-related phenotypes. Human Mutation, Wiley, 2010, 31(10), ￿10.1002/humu.21336￿. ￿hal-00613751￿

HAL Id: hal-00613751 https://hal.archives-ouvertes.fr/hal-00613751 Submitted on 6 Aug 2011

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Human Mutation

Genetic screening of LCA in Belgium: predominance of CEP290 and identification of potential modifier alleles in AHI1 of CEP290 -related phenotypes For Peer Review

Journal: Human Mutation

Manuscript ID: humu20100042.R1

Wiley Manuscript type: Mutation in Brief

Date Submitted by the 18Jun2010

John Wiley & Sons, Inc. Page 1 of 63 Human Mutation

1 2 3 4 Complete List of Authors: Coppieters, Frauke; Ghent University Hospital, Center for Medical 5 Genetics Casteels, Ingele; Leuven University Hospitals, Department of 6 Ophthalmology 7 Meire, Françoise; Hôpital Des Enfants Reine Fabiola, Ophthalmology 8 De Jaegere, Sarah; Ghent University Hospital, Center for Medical 9 Genetics 10 Hooghe, Sally; Ghent University Hospital, Center for Medical 11 Genetics 12 Van Regemorter, Nicole; Free University of Brussels, Centre de 13 Génétique de Bruxelles van Esch, Hilde; University Hospital Leuven, Centre for Human 14 Genetics 15 Matulevičien÷, Aušra; Vilnius University, Department of Human and 16 Medical Genetics 17 Nunes, Luis; Hospital Dona Estefânia Rua Jacinta Marto, Service of 18 ForMedical Peer Genetics Review 19 Meersschaut, Valérie; Ghent University Hospital, Department of 20 Radiology 21 Walraedt, Sophie; Ghent University Hospital, Department of Ophthalmology 22 Standaert, Lieve; Revalidation Center Spermalie 23 Coucke, Paul; Ghent University Hospital, Dpt. Medical Genetics 24 Head Collagen Lab 25 Hoeben, Heidi; Middelheim Hospital, Department of Nephrology 26 Kroes, Hester; University Medical Center, Department of Biomedical 27 Genetics 28 Vande Walle, Johan; Ghent University Hospital, Department of Pediatrics 29 de Ravel, Thomy 30 Leroy, Bart; Ghent University Hospital, Department of 31 Ophthalmology 32 De Baere, Elfride; Ghent University Hospital, Center for Medical 33 Genetics 34 35 Key Words: LCA, CEP290, genotypephenotype correlation, modifiers, AHI1 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 2 of 63

HUMAN MUTATION M utation in B rief #____ ( 20 XX) O nline 1 2 3 MUTATION IN BRIEF HUMAN MUTATION 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Received ; accepted revised manuscript . 46 47 48 49 © 2010 WILEY-LISS, INC. 50 51

52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 3 of 63 Human Mutation

HUMAN MUTATION M utation in B rief #____ ( 20 XX) O nline 1 2 3 MUTATION IN BRIEF HUMAN MUTATION 4 OFFICIAL JOURNAL 5 Genetic screening of LCA in Belgium: predominance 6 CEP290 7 of and identification of potential modifier 8 alleles in AHI1 of CEP290 -related phenotypes www.hgvs.org 9 10 11 Frauke Coppieters 1, Ingele Casteels 2, Françoise Meire 3, Sarah De Jaegere 1, Sally Hooghe 1, Nicole van 12 Regemorter 4, Hilde Van Esch 5, Aušra Matulevi čien ÷6, Luis Nunes 7, Valérie Meersschaut 8, Sophie Walraedt 9,10 , 13 Lieve Standaert 10 , Paul Coucke 1, Heidi Hoeben 11 , Hester Y. Kroes 12 , Johan Vande Walle 13 , Thomy de Ravel 5, Bart 14 P. Leroy 1,9, ＃, Elfride De Baere 1, ＃ 15 1Center for Medical Genetics Ghent, Ghent University Hospital, Ghent, Belgium; 2Department of Ophthalmology, Leuven 16 University Hospitals, Leuven, Belgium; 3Hôpital Des Enfants Reine Fabiola, Brussels, Belgium; 4Centre de Génétique de 17 Bruxelles, Free University of Brussels, Brussels, Belgium; 5Centre for Human Genetics, Leuven University Hospitals, Leuven, Belgium; 6Department of Human and Medical Genetics, Faculty of Medicine, Vilnius University, Vilnius, Lithuania; 7Service of 18 Medical Genetics, Hospital Dona EstefâniaFor Rua Jacinta Marto,Peer Lisboa, Portugal; 8DepartmentReview of Radiology, Ghent University 19 Hospital, Ghent, Belgium; 9Department of Ophthalmology, Ghent University Hospital, Ghent, Belgium; 10 Revalidation Center Spermalie, Bruges, Belgium; 11 Department of Nephrology, Middelheim Hospital, Antwerp, Belgium; 12 Department of Medical 20 Genetics, University Medical Center Utrecht, Utrecht, The Netherlands; 13 Department of Pediatrics, Ghent University Hospital, 21 Ghent, Belgium; ＃Equal contribution 22 23 *Correspondence to E. De Baere, MD, PhD, Phone: +32-9-3325186. Fax: +32-9-3326549. Email: [email protected]

24 Contract grant sponsor: Research Foundation – Flanders (KAN 1.5.174.09, 01F01206, 3F001206, OZP 3G004306); Bijzonder 25 Onderzoeksfonds (BOF06_Asp_FC UGent); Fund for Research in Ophthalmology . 26 27 Communicated by 28

29 30 ABSTRACT : Leber Congenital Amaurosis (LCA), the most severe inherited retinal dystroph y, is Deleted : earliest form of all 31 genetically heterogeneous, with 14 genes accounting for 70% of patients. Here, 91 LCA probands underwent LCA chip analysis and subsequent sequencing of 6 genes ( CEP290, CRB1, RPE65, Deleted : ies 32 GUCY2D, AIPL1 and CRX ), revealing mutations in 69% of the cohort, with major involvement of 33 CEP290 (30%). In addition, 11 patients with early-onset retinal dystrophy (EORD) and 13 patients 34 with Senior-Loken syndrome (SLS), LCA-Joubert syndrome (LCA-JS) or cerebello-oculo-renal syndrome (CORS) were included. Exhaustive re-inspection of the overall phenotypes in our LCA 35 cohort revealed novel insights mainly regarding the CEP290 -related phenotype. The AHI1 gene 36 was screened as a candidate modifier gene in three patients with the same CEP290 genotype but different neurological involvement. Interestingly, a heterozygous novel AHI1 mutation, 37 p.Asn811Lys, was found in the most severely affected patient. Moreover, AHI1 screening in five 38 other patients with CEP290 -related disease and neurological involvement revealed a second novel 39 missense variant, p.His758Pro, in one LCA patient with mild mental retardation and autism. These two AHI1 mutations might thus represent neurological modifiers of CEP290 -related disease. ©2010 40 Wiley-Liss, Inc. 41 42 KEY WORDS: LCA, CEP290 , AHI1 , modifier, genotype-phenotype correlation 43 44 45 Received ; accepted revised manuscript . 46 47 48 49 © 2010 WILEY-LISS, INC. 50 51

52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 4 of 63

Genetic screening of LCA in Belgium 3

1 2 3 4 5 INTRODUCTION 6 Leber Congenital Amaurosis (LCA, MIM[204000]) was first described as a congenital type of retinitis 7 pigmentosa (RP). Approximately 20% of all blind children are thought to suffer from this disease. Phenotypic 8 features include a congenital onset, severely reduced or absent electroretinogram (ERG), nystagmus, the oculo- Deleted : after birth 9 digital sign and a fundus aspect varying from normal to severely atrophic . Two main types of LCA have been Deleted : s 10 reported, based on the presence or absence of photophobia, night blindness, hyperopia, macular/peripheral retinal abnormalities and measurable visual acuity (Hanein et al., 2004; Hanein et al., 2006). LCA displays variable Deleted : normal to pigmented 11 expression, and seems to represent the extreme and severe end of a spectrum of inherited retinal disease. Deleted : severe 12 LCA is predominantly inherited in an autosomal recessive manner. So far, one locus - LCA9 (Keen et al., 2003) Deleted : in the large majority of cases 13 - and the following 1 4 genes have been identified: GUCY2D (Perrault et al., 1996), RPE65 (Marlhens et al., 1997), 14 CRX (Freund et al., 1998), AIPL1 (Sohocki et al., 2000a), RPGRIP1 (Dryja et al., 2001), CRB1 (den Hollander et Deleted : 1 15 al., 2001), RDH12 (Perrault et al., 2004), IMPDH1 (Bowne et al., 2006), CEP290 (den Hollander et al., 2006), Deleted : 5 16 RD3 (Friedman et al., 2006), LCA5 (den Hollander et al., 2007) and SPATA7 (Wang et al., 2009), with the Deleted : loci involvement of TULP1 (Hagstrom et al., 1998) and LRAT (Thompson et al., 2001) under debate. Mutations in 17 Deleted : (14 genes) were these genes account for ~70% of all LCA cases. Several of them are also implicated in other retinal dystrophies: 18 Deleted : , LCA9 (Keen, et al., 2003) CRB1 , RPE65 , RDH12 and SPATA7For are associated Peer with both LCA and Review early-onset retinal dystrophy (EORD) , 19 which often overlap (Gu et al., 1997; den Hollander et al., 1999; Janecke et al., 2004; Wang et al., 2009). Deleted : in the identified 20 Several subtypes of LCA can be considered part of the ciliopathies, as four disease genes – TULP1 , RPGRIP1 , Deleted : approximately 21 CEP290 and LCA5 – encode ciliary proteins. Since cilia are present throughout the whole body, mutations in these Deleted : these genes 22 genes may cause a broad phenotypic spectrum. One of the best examples is CEP290 , the most frequently mutated Deleted : RP 23 gene in the western European LCA population. In addition to LCA, CEP290 is associated with Joubert syndrome 24 (JS, MIM[213300]), Senior-Loken syndrome (SLS, MIM[266900]), Meckel-Grüber syndrome (MKS, Deleted : The involvement MIM[249000]) and Bardet-Biedl syndrome (BBS, MIM[209900]); a range of clinically and genetically 25 Deleted : of TULP1 , RPGRIP1 , heterogeneous ciliopathies (Sayer et al., 2006; Valente et al., 2006b; Baala et al., 2007; Brancati et al., 2007; Helou CEP290 and LCA5 in 26 et al., 2007; Leitch et al., 2008). Recent studies suggest that modifiers may play a role in the pathogenesis of Deleted : the pathogenesis of 27 ciliopathies (Leitch et al., 2008; Khanna et al., 2009; Louie et al. , 2010 ). Deleted : LCA suggests that LCA is one 28 Establishing a molecular diagnosis for LCA is not only important in the context of genetic counselling and of the ciliopathies, an emerging group of 29 clinical prognosis, but is also essential in view of future gene therapy. Recent Phase I clinical trials for RPE65 disorders gene replacement therapy provide hopeful prospects for the treatment of inherited retinal dystrophies (Bainbridge 30 Deleted : caused by mutations in 31 et al., 2008; Hauswirth et al., 2008; Maguire et al., 2008; Cideciyan et al., 2009; Maguire et al., 2009). As such therapies are likely to be gene-specific, the development of robust clinical testing and efforts toward gene Deleted : associated with genes encoding ciliary proteins. 32 identification are of utmost importance. 33 Current diagnostic testing for LCA generally involves chip analysis that contains known mutations in the Deleted : perspectives 34 known LCA and EORD genes (Asper Ophthalmics, Estonia). Depending on the population, causal mutations are Deleted : early-onset RP 35 found in approximately 55% of all cases (Yzer et al., 2006). Only a limited number of laboratories subsequently 36 screen an additional number of genes (Stone, 2007; den Hollander et al., 2008). Deleted : 6 This study includes an extensive genetic survey in order to identify the molecular cause in 91 LCA probands 37 Deleted : ( 38 mainly of Belgian origin, using LCA chip analysis for 8 to 13 genes and subsequent sequencing of the following genes : CEP290 (MIM[610142]) , CRB1 (MIM[604210]) , RPE65 (MIM[180069]) , GUCY2D (MIM[600179]) , Deleted : ) 39 AIPL1 (MIM[604392]) and CRX (MIM[602225]) . In addition, exhaustive phenotyping was performed in all Deleted : Thus, gene-specific 40 patients carrying mutation(s), and the AHI1 gene was screened for modifier alleles of CEP290 -related disease. contributions to LCA in the population 41 under study were established, and 26 novel mutations were identified. In 42 MATERIALS AND METHODS addition, exhaustive phenotyping led to 43 novel insights mainly into the natural history of retinal and extra-ocular features 44 Patients of CEP290-related LCA. Finally, 45 potential modifiers of neurological Ninety-one consenting subjects initially diagnosed with LCA were referred for molecular testing by an involvement in CEP290-related disease 46 ophthalmologist and/or geneticist , mainly associated with the University Hospitals of Ghent, Leuven or Brussels. were identified. 47 Eleven probands are born from a consanguineous marriage. The inclusion criteria for LCA were bilateral visual Deleted : families 48 loss before the age of 6 months accompanied by nystagmus and an undetectable or significantly reduced ERG. Deleted : and 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 5 of 63 Human Mutation

4 Coppieters et al. 1 2 Twelve patients presented with additional mental retardation and/or autistic behaviour. For 18 patients with an Deleted : of the LCA 3 available Magnetic Resonance Imaging (MRI), the absence of a molar tooth sign (MTS) excluded the diagnosis of Deleted : all 4 JS. In addition, genotyping was performed on 11 probands with EORD (disease diagnosed beyond the first six 5 months of life but before the age of three) and 13 with a retinal dystrophy in the context of JS (LCA-JS), SLS or Deleted : early -onset retinal dystrophy ( 6 cerebello-oculo-renal syndrome (CORS). These patients were not included during calculations of gene-specific Deleted : , 7 contributions in isolated LCA. Genomic DNA and RNA were extracted from leukocytes using the Puregene DNA 8 isolation kit (Gentra, Minneapolis, USA) and the RNeasy Mini kit (Qiagen) respectively, followed by cDNA synthesis with the iScript cDNA Synthesis kit (Bio-Rad). If available, parents and/or siblings were also genotyped. 9 Seven of the patients were reported previously (Yzer et al., 2006; Brancati et al., 2007; Perrault et al., 2007). Deleted : (Table 1) 10 Patient notation was performed according to their clinical diagnosis (prefixes LCA, SLS, LCA-JS, CORS and 11 EORD), with consecutive numbering in the order of the genes involved. 12 13 Genotyping 14 As a pre-screening method, all patients with either isolated LCA or EORD were analysed with a microarray 15 containing 344 to 641 mutations in 8 ( GUCY2D , CRX , RPE65 , CRB1 , RPGRIP1 , AIPL1 , LRAT and MERTK ) to 13 16 (addition of TULP1 , LCA5 , RDH12 , CEP290 and SPATA7 ) LCA and EORD genes (LCA chip Versions 2004- Deleted : early-onset RP 2009; Asper Ophthalmics, Estonia) (http://www.asperbio.com)(Zernant et al., 2005). Each of the mutations found 17 by the LCA chip was subsequently confirmed through Sanger sequencing. In case of a heterozygous mutation, the Deleted : sequencing was performed of 18 coding exons and intron-exon boundariesFor of the involved Peer gene were sequenced Review. Deleted : whole 19 Patients in whom no mutations were identified after LCA chip analysis were analysed through sequencing of all 20 coding exons and intron-exon boundaries of CEP290 , CRB1 , RPE65 , GUCY2D , AIPL1 and CRX , the first five Deleted : region 21 genes being the most frequently mutated in LCA . At the time the LCA chip did not yet include CEP290 variants, Deleted : Sanger 22 stepwise targeted mutation analysis was performed prior to sequencing of the total coding region. We initially Deleted : the following genes: screened for the frequent c.2991+1655A>G mutation followed by four additional mutations: c.4723A>T 23 Deleted : . (p.Lys1575X), c.5587-1G>C (splice site), c.5163del (p.Thr1722GlnfsX2) and c.3310-1_3310delinsAA (splice 24 site). The first three mutations occurred multiple times in a previous study (Perrault et al., 2007); the latter was Deleted : T 25 found in three patients with a heterozygous c.2991+1655A>G mutation in our population. CEP290 was also Deleted : are 26 screened at cDNA level in patients with only a single mutation in CEP290 . To this end, cDNA screening using 16 Deleted : genes 27 overlapping primer sets was optimized . Four patients with CEP290-related LCA who presented with mental Deleted : CRX 28 retardation, two patients with SLS , one patient with CORS and one patient with LCA-JS underwent sequencing of 29 the AHI1 gene. For 13 patients with SLS/LCA-JS/CORS, molecular testing of CEP290 was requested. Supp . Table Deleted : who 30 S1 includes all primer sequences used in this study. Deleted : carried Deleted : was analyzed 31 Mutation nomenclature 32 Deleted : Five Mutation nomenclature uses numbering with the A of the initiation codon ATG as +1 33 (www.hgvs.org/mutnomen), based on the following RefSeqs: NM_201253 .1 ( CRB1 ), NM_000329 .2 ( RPE65 ), Deleted : and 34 NM_000180 .3 ( GUCY2D ), NM_014336 .3 ( AIPL1 ), NM_000554 .4 ( CRX ), NM_025114 .3 ( CEP290 ), Deleted : Sanger 35 NM_152443 .2 ( RDH12 ), NM_020366 .3 ( RPGRIP1 ) and NM_001134831 .1 ( AHI1 ) Deleted : 12 (http://www.ncbi.nlm.nih.gov/nuccore). All mutations and variants found in CEP290 were submitted to the Locus- 36 Deleted : All primer sequences used in 37 Specific Mutation Database CEP290 base (http://medgen.ugent.be/cep290base) (Coppieters et al., 2010). this study are available on request. 38 39 Evaluation of sequence changes 40 The presence of all mutations was confirmed on a second PCR product. Segregation analysis of disease alleles was performed if possible. Genomic DNA obtained from > 340 unrelated ethnically matched healthy individuals 41 Deleted : 170 was used as a control panel. Thorough bio-informatic evaluation of novel variants was done using Alamut software 42 (v.1.5). Variants were designated as “unclassified variant (UV)” if no consensus was seen in all prediction 43 programs used. The Alamut output for missense changes was listed in Supp. Table S2. Deleted : (Table 1) 44 45 Clinical evaluation of patients 46 After identification of the molecular cause, the clinical records were revisited, based on a clinical checklist Deleted : identifying 47 comprising data on visual function, retinal appearance and associated (extra-) ocular features. When possible, 48 ERG, fundus pictures, autofluorescence (AF) images and optical coherence tomography (OCT) were obtained. In 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 6 of 63

Genetic screening of LCA in Belgium 5

1 2 case of CEP290 -related LCA, neurological (MRI) and nephrological data (kidney ultrasound [US], urinary and 3 blood parameters) were obtained and evaluated. 4 5 RESULTS 6 7 Mutation screening strategy of known LCA genes 8 As a first step, 102 probands were subjected to LCA chip analysis (91 LCA and 11 EORD). In total, 30 9 sequence changes assigned as mutations by Asper Ophthalmics were identified in 47 individuals. Homozygous and Deleted : distinct 10 compound heterozygous variants in one gene were each found in 13 patients; a single heterozygous variant was Deleted : ,…In three of them, two 11 identified in 17 individuals. In addition, variants within two distinct genes were found in four patients. The heterozygous variants were detected in 12 zygosity of p.Glu1330X (CRB1 ) could not be determined in LCA-36. Confirmation of each mutation through two genes, respectively. The other one direct sequencing identified two inconsistencies. At first, LCA-58 was genotyped heterozygously for the AIPL1 carried a homozygous variant in one gene 13 together with a heterozygous variant in mutation p.Trp278X by chip , while she was in fact homozygous. Secondly, a heterozygous p.Arg38AlafsX3 another gene. ... [1] 14 mutation in AIPL1 (LCA chip version 2006) could not be confirmed in LCA-23. Instead, a heterozygous c.111C>T 15 Deleted : For one patient, t…the (p.=) variant was identified on the same nucleotide position. This miscall has previously been described mutation ... [2] 16 (Henderson et al., 2007). In addition, subsequent sequencing of GUCY2D in LCA-51 revealed a heterozygous Deleted : on the LCA chip 17 c.389del mutation that was not detected on the LCA chip. The variants c.2101C>T (p.Pro701Ser) ( GUCY2D ), 18 c.3341A>G (p.Asp1114Gly) ( RPGRIP1 ) (Vallespin et al., 2007a), c.286G>A p.Val96Ile ( AIPL1 ) (Yzer et al., Deleted : (…, CRB1 p.Glu1330X)… of For Peer Review the LCA chip ... [3] 19 2006) and c.1301C>T (p.Ala434Val) ( RPE65 ) (Morimura et al., 1998) have already been reported as Deleted : on the LCA chip…direct... [4] 20 polymorphisms and were therefore discarded as mutations. Moreover, identification of the GUCY2D p.Pro701Ser variant in a homozygous state in both healthy parents from an LCA patient further supported its non-pathogenic Deleted : considered … using LCA chip 21 nature. After the exclusion of these polymorphisms, variants were assigned to be mutations in 45 patients (39 LCA analysis ... [5] 22 and 6 EORD). 23 Secondly , all patients with a heterozygous mutation identified through chip analysis were subjected to screening Deleted : As a second step…complete 24 of the relevant gene. In addition, all patients with negative chip results underwent sequencing of 6 LCA genes. In a …analysis …Sanger ... [6] 25 the following sections, the molecular results are discussed in detail for each of the genes. 26 27 CEP290 . CEP290 was found to be the most frequently mutated gene in our cohort, accounting for 30% (27/91) Deleted : LCA …all … in the entire of cases with isolated LCA (Table 1). Since the LCA chip did not contain CEP290 variants at the onset of this LCA cohort…identified in CEP290 - 28 study, only a fraction of currently known mutations were detected using this technique. The c.2991+1655A>G, related LCA ... [7] 29 c.4723A>T (p.Lys1575X) and c.3310-1_3310delinsAA mutations were the most recurrent, with gene-specific 30 allele frequencies of 49%, 11% and 6%, respectively. Similar to previous studies, most of the mutations are either 31 nonsense, frameshift or splice site mutations. Only two missense variants were identified, of which the pathogenic Deleted : , to a lesser extent, effect is currently uncertain (p.Ala1566Pro and p.Leu1694Pro) ( Supp. Table S2 ). Overall, 13 novel CEP290 32 Deleted : ,…LCA-25 …, LCA-26 ... [8] 33 mutations were identified to cause LCA. The complex allele c.3310-1_3310delinsAA has a predicted effect on Deleted : Table 2…that ... [9] 34 splicing, which was confirmed by cDNA analysis (data not shown). The silent c.1824G>A change affects the last nucleotide of exon 18 and was also predicted to alter splicing (data not shown) . Deleted : : six frameshift mutations, 35 Since CEP290 mutations may cause a phenotypic spectrum ranging from isolated LCA to more complex three nonsense mutations, four splice site mutations and the two novel missense 36 disorders, we analysed 13 additional probands suffering from LCA-JS, SLS or CORS. CEP290 harbored mutations variants 37 in seven of them ( Table 1 ). Six probands carried known mutations, whereas a novel p.Thr2457AlafsX27 mutation Deleted : several …three SLS, three 38 segregated in family LCA-JS-2. LCA-JS and one CORS…Five 39 Sequencing of the entire coding region did not reveal a second mutation in LCA-27, while the pathogenic effect harboured …in one family, …with the disease …(…) 40 of one variant was uncertain in LCA-25 and LCA-26. Subsequent cDNA screening in LCA-25 and LCA-27 was ... [10] 41 normal, thereby making deep intronic splice site mutations or large exon deletions/duplications very unlikely. No Deleted : In two patients, s…(… and RNA was available for LCA-26. LCA-JS-3)…in two other patients, (…)… …three of these patients 42 ... [11] 43 CRB1. Mutations in CRB1 were found in 15 families with LCA (16%) and 5 families with EORD (Table 1). 44 The LCA chip allowed the identification of a homozygous or compound heterozygous CRB1 mutation in 15 45 probands (12 LCA and 3 EORD), and a heterozygous CRB1 mutation in 3 patients. Sequencing of the whole 46 coding region of CRB1 in the latter revealed a known and novel mutation , respectively (LCA-29, p.Gln362X and 47 LCA-34, c.4006-1G>T) , and a novel unclassified variant (EORD-3, p.Asp491Val) on the second allele ( Supp. Deleted : ), a novel mutation (…Table 2…whole 48 Table S2 ). Sequencing of the total coding region identified compound heterozygous mutations in two additional ... [12] 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 7 of 63 Human Mutation

6 Coppieters et al. 1 2 probands. In one of them, CRB1 screening was exceptionally performed without prior LCA chip analysis, given 3 clear clinical indications for a CRB1 -related phenotype (EORD-2). Indeed, this patient was compound 4 heterozygous for the known p. Cys948Tyr mutation, and the novel p.Cys310Tyr variant, which is predicted to Deleted : Cys948Trp 5 disrupt a disulfide bridge ( Supp. Table S2 ). In addition, two sisters with LCA carried two novel frameshift Deleted : Table 2 6 mutations (LCA-41). As previously described, the p.Lys801X and p.Cys948Tyr mutations were most frequent, 7 showing gene-specific allele frequencies in the LCA cohort of 27% and 23%, respectively. 8 RPE65. Eight cases with LCA showed mutations in RPE65 (9%) (Table 1). LCA chip analysis identified a 9 homozygous RPE65 mutation in LCA-43 and LCA-47 and two compound heterozygous mutations in LCA-49. In Deleted : two probands ( 10 addition, a heterozygous mutation was detected in four patients through LCA chip analysis. Sequencing of RPE65 Deleted : ) 11 in these individuals identified three novel mutations and the known p.Phe530LeufsX40 mutation which was not 12 yet present on the LCA chip at the time (LCA-48). Although the evidence for a pathogenic nature of the novel Deleted : one patient ( 13 mutation p.Trp331dup is not conclusive, segregation in patient LCA45a, her affected aunt LCA45b and her Deleted : ) 14 (healthy) parents sustains a causal role. The two other novel mutations result in a frameshift (LCA-46 and LCA- Deleted : the whole coding region 50). Following sequencing of the total coding region, one additional proband was found to be homozygous for the 15 Deleted : both healthy novel RPE65 mutation p.Pro181Leu (LCA-44) ( Supp. Table S2 ). Interestingly, segregation analysis of the 16 mutations found in LCA-46 could only confirm segregation of p.Leu341Ser in the mother, suggesting that Deleted : of LCA45a strongly suggests 17 p.Ser121LeufsX6 occurred de novo (paternity confirmed). Deleted : whole 18 For Peer Review Deleted : Table 2 19 GUCY2D. Mutations in GUCY2D were found in seven probands with LCA (8%) (Table 1). Five of them were Deleted : Patients LCA-47 and LCA-49 20 identified with GUCY2D mutations using the LCA chip. One was homozygous for p.Phe565Ser (LCA-52), while were included in a recent Phase I gene 21 three others carried p.Arg768Trp. One of the latter was homozygous (LCA-53); the other two were compound therapy clinical trial (Maguire, et al., 2009). 22 heterozygous for p.Phe565Ser (LCA-54) and the novel missense change p.Lys866Asn (LCA-55), respectively (Supp. Table S2 ). In addition, LCA-57 was heterozygous for the p.Pro575Leu variant that was previously Deleted : 23 mutation identified in the mother of an LCA patient (Koenekoop et al., 2002). However, no second mutation was found. Deleted : was 24 LCA-56 was compound heterozygous for the novel missense changes p.Glu196Val and p.Pro711Leu ( Supp. Table 25 S2 ). In addition, a novel splice site mutation was identified in LCA-51 (c.2577-2A>C). Deleted : of them 26 Deleted : the 27 AIPL1. Only two distinct AIPL1 variants were detected through LCA chip analysis in five LCA patients (5%) Deleted : mutation (Table 1). The p.Trp278X mutation occurred homozygously in four probands (LCA-58 to LCA-61). In addition, a 28 Deleted : Table 2 29 heterozygous p.Thr114Ile variant was found in proband LCA-62. Direct sequencing of the AIPL1 gene identified the known variant p.Pro376Ser (missing signal on LCA chip). Segregation analysis in the parents, however, Deleted : a 30 revealed a cis -allelic inheritance from the mother. No further mutations were detected following additional Deleted : not 31 sequencing of AIPL1 in other patients. Deleted : Patient 32 Deleted : following 33 CRX. LCA chip analysis identified 2 CRX missense variants in two LCA patients (Table 1). The p.Tyr142Cys 34 variant was previously described as a mutation (Vallespin et al., 2007a). Stone and colleagues, however, Deleted : : 35 considered this variant as a polymorphism based on the estimate of pathogenic probability and the identification of Deleted : Table 2 36 this variant in a patient with two disease-causing alleles in another LCA gene (Stone, 2007) (LCA-63). The Deleted : in the AIPL1 gene pathogenicity of the second variant p.Val242Met also remains unclear (LCA-64) (Swain et al., 1997; Rivolta et al., Deleted : 37 2001; Chen et al., 2002). Given their uncertain pathogenic potential, both variants were discarded as mutations for with LCA 38 further calculations. Deleted : properly segregating 39 40 RDH12. Mutation screening of RDH12 was performed downstream of LCA chip results involving this gene . A Deleted : in the context 41 heterozygous p.Ala269GlyfsX2 mutation was identified in two probands with EORD. Subsequent sequencing Deleted : analysis RDH12 identified an additional novel missense change in both patients, p.Val233Asp (EORD-6) and p.Ser175Leu 42 Deleted : direct 43 (EORD-7) respectively ( Supp. Table S2 ). According to UniProt, the Ser175 residue might be a substrate binding site (http://www.uniprot.org/uniprot/Q96NR8). A known mutation located in the same codon, p.Ser175Pro, lacks Deleted : of the total coding region 44 the ability to catalyze the reduction of retinaldehyde to retinol in vitro (Lee et al., 2007). In addition, a Deleted : Table 2 45 homozygous p.Ala269GlyfsX2 mutation was identified in patient EORD-8, for which RDH12 sequencing was 46 performed prior to LCA-chip analysis (upon request ). Deleted : exceptionally 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 8 of 63

Genetic screening of LCA in Belgium 7

1 2 RPGRIP1. Similarly, screening of RPGRIP1 was performed in the context of LCA chip analysis. In one LCA Deleted : As for RDH12 , mutation 3 patient, a heterozygous mutation was identified. Sequencing of RPGRIP1 , however, did not identify a second Deleted : (1%) 4 mutation (LCA-65). 5 Deleted : the total coding region 6 Mutations in multiple LCA genes. For the assessment of the potential involvement of a second gene in LCA, 7 only variants with significant pathogenic potential were taken into account (see above). Two patients with Deleted : considered 8 CEP290 -related LCA displayed a heterozygous mutation in another LCA gene: LCA-16 was heterozygous for the known p.Arg85Cys mutation in RPE65 , while LCA-20 carried the common p.Lys801X mutation in CRB1 . 9 10 Identification of potential modifier alleles in the AHI1 gene 11 The AHI1 gene was sequenced as a candidate modifier gene in eight patients with CEP290 -related LCA who 12 presented with mental retardation. Four of them were diagnosed with LCA (LCA-3, LCA-20, LCA-23 and LCA- 13 24); two patients also suffered from NPHP (SLS-2 and SLS-3) and in two other cases, the LCA phenotype was 14 part of a JS diagnosis (CORS-1 and LCA-JS-3). A MTS was absent on brain imaging in two isolated patients with 15 LCA (no data were available for LCA-20, LCA-24, SLS-2 and SLS-3). 16 A heterozygous novel AHI1 p.Asn811Lys mutation was found in the most severely affected patient CORS-1, out of three patients with the same CEP290 genotype but different neurological involvement (SLS-2, SLS-3 and 17 CORS-1). Moreover, AHI1 screening in the five remaining patients revealed a second heterozygous missense 18 variant, p.His758Pro, in LCA-3. ConservationFor and inPeer silico predictions forReview both changes suggest a possible effect 19 on protein structure/function (Supp. Table S2). Interestingly, exonic splicing enhancer (ESE) predictions point to a 20 change in ESEs for both variants (data not shown). Moreover, both changes are located in a conserved WD-40 21 repeat (http://www.uniprot.org/uniprot/Q8N157) and were absent in > 340 Belgian control individuals. Deleted : 170 22 In addition, SLS-2 was found to be heterozygous for the known p.Ser1123Phe change. Although it concerns a 23 potentially pathogenic variant that affects a phosphorylation site and is located in a highly conserved region (Dephoure et al., 2008), this change was considered a polymorphism because of its high frequency in the Dutch 24 population and the observation that this change did not segregate in a family with JS (Valente et al., 2006a; Kroes 25 et al., 2008). 26 27 28 Table 1: Mutations identified in 80 unrelated patients with LCA, using LCA chip analysis and direct Deleted: a series of 29 sequencing of CEP290 , CRB1 , RPE65 , AIPL1 , GUCY2D and CRX . Allele 1 Allele 2 Reference 30 Par Pati ent Origin Segr Intron/ Nucleotide Amino acid Intron/ Nucleotide Amino acid Deleted: ë 31 cons exon change change exon change change 32 CEP290 33 (den Hollander et al., LCA-1 Belgium - X I26 c.2991+1655A>G* p.Cys998X* I26 c.2991+1655A>G* p.Cys998X* 34 2006) (den Hollander et al., LCA-2 Belgium - X I26 c.2991+1655A>G p.Cys998X I26 c.2991+1655A>G p.Cys998X 35 2006) 36 (den Hollander et al., LCA-3+ Belgium - X I26 c.2991+1655A>G* p.Cys998X* E6 c.322C>T p.Arg108X 37 2006) (den Hollander et al., LCA-4 Belgium - NA I26 c.2991+1655A>G p.Cys998X E25 c.2695C>T p.Gln899X 38 2006) 39 (den Hollander et al., LCA-5 Belgium - NA I26 c.2991+1655A>G p.Cys998X E34 c.4393C>T p.Arg1465X 2006) , (Brancati et al., 40 2007) (CORS) 41 (den Hollander et al., 2006) , (Brancati et al., LCA-6 Belgium - X I26 c.2991+1655A>G p.Cys998X E36 c.4723A>T p.Lys1575X 42 2007; Perrault et al., 43 2007) (den Hollander et al., 44 2006) , (Brancati et al., LCA-7F Belgium - NA I26 c.2991+1655A>G p.Cys998X E36 c.4723A>T p.Lys1575X 45 2007; Perrault et al., 46 2007) (den Hollander et al., 47LCA-8 Belgium - NA I26 c.2991+1655A>G p.Cys998X E36 c.4723A>T p.Lys1575X 2006) , (Brancati et al., 48 2007; Perrault et al., 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 9 of 63 Human Mutation

8 Coppieters et al. 1 2 Allele 1 Allele 2 Reference 3 Par Pati ent Origin Segr Intron/ Nucleotide Amino acid Intron/ Nucleotide Amino acid Deleted: ë cons 4 exon change change exon change change 5 2007) (den Hollander et al., 6 LCA-9 Belgium - X I26 c.2991+1655A>G p.Cys998X E39 c.5344C>T p.Arg1782X 2006) 7 (den Hollander et al., LCA-10 Lithuania - X I26 c.2991+1655A>G p.Cys998X E6 c.384_385del p.Asp128GlufsX17 8 2006) (den Hollander et al., 9 LCA-11 Belgium - X I26 c.2991+1655A>G p.Cys998X E6 c.437del p.Glu146GlyfsX17 2006) 10 The (den Hollander et al., 11LCA-12 Netherlan - NA I26 c.2991+1655A>G* p.Cys998X* E19 c.1859_1862del p.Arg621IlefsX2 2006) , (Perrault et al., ds 2007) 12 (den Hollander et al., LCA-13 Belgium - NA I26 c.2991+1655A>G p.Cys998X E29 c.3422dup p.Leu1141PhefsX5 13 2006) Belgium/ (den Hollander et al., LCA-14 - X I26 c.2991+1655A>G* p.Cys998X* E31 c.4001del p.Thr1334IlefsX2 14 Morocco 2006) 15LCA-15 (den Hollander et al., (Perrault et Belgium - NA I26 c.2991+1655A>G p.Cys998X E37 c.4962_4963del p.Glu1656AsnfsX3 2006) , (Perrault et al., 16al., 2007) 2007) 17 (den Hollander et al., Belgium/ 2006) , (Brancati et al., 18LCA-16 + - X I26 c.2991+1655A>G p.Cys998X E40 c.5493del p.Ala1832ProfsX19 Greece For Peer Review 2007; Frank et al., 19 2008) (CORS) (den Hollander et al., 20LCA-17 Belgium - X I26 c.2991+1655A>G p.Cys998X E40 c.5519_5537del p.Lys1840ArgfsX5 2006) 21 c.5865_5867delins (den Hollander et al., LCA-18 Belgium - X I26 c.2991+1655A>G p.Cys998X E43 p.Glu1956GlyfsX9 22 GG 2006) (den Hollander et al., LCA-19 Belgium - X I26 c.2991+1655A>G p.Cys998X I13 c.1189+1G>A Donor Splice defect 23 2006) LCA-20 + 24 Acceptor Splice (den Hollander et al., (Yzer et al., Belgium - NA I26 c.2991+1655A>G p.Cys998X I21 c.2218-2A>C defect 2006) 252006) 26 c.3310- Acceptor splice (den Hollander et al., LCA-21 Belgium - X I26 c.2991+1655A>G p.Cys998X I28-E29 27 1_3310delinsAA defect 2006) c.3310- Acceptor splice (den Hollander et al., LCA-22 Belgium - NA I26 c.2991+1655A>G p.Cys998X I28-E29 28 1_3310delinsAA defect 2006) c.3310- Acceptor splice (den Hollander et al., 29LCA-23 Belgium - NA I26 c.2991+1655A>G p.Cys998X I28-E29 1_3310delinsAA defect 2006) 30LCA-24 Belgium - NA E36 c.4723A>T p.Lys1575X E36 c.4723A>T p.Lys1575X (Perrault et al., 2007) 31LCA-25 F Belgium - X E36 c.4723A>T p.Lys1575X E35 c.4696G>C p.Ala1566Pro UV (Perrault et al., 2007) 32LCA-26 Belgium X E18 c.1824G>A p.=, splice site E38 c.5081T>C p.Leu1694Pro UV 33 (den Hollander et al., LCA-27 Belgium - NA I26 c.2991+1655A>G p.Cys998X ? ? ? 34 2006) (Valente et al., 2006b) SLS-1 Pakistan FC X E2 c.21G>T p.Trp7Cys E2 c.21G>T p.Trp7Cys 35 (CORS) 36 (Perrault et al., 2007) , SLS-2 Belgium - NA E36 c.4723A>T p.Lys1575X E34 c.4393C>T p.Arg1465X (Brancati et al., 2007) 37 (CORS) 38 (Perrault et al., 2007) , SLS-3 Belgium - NA E36 c.4723A>T p.Lys1575X E34 c.4393C>T p.Arg1465X (Brancati et al., 2007) 39 (CORS) 40CORS-1+ (Perrault et al., 2007) , (Brancati et Belgium SD NA E36 c.4723A>T p.Lys1575X E34 c.4393C>T p.Arg1465X (Brancati et al., 2007) 41al., 2007) (CORS) 42 Acceptor Splice (Perrault 2007), (Baala LCA-JS-1 Belgium - X I40 c.5587-1G>C E31 c.3793C>T p.Gln1265X 43 defect et al., 2007) (ML) LCA-JS-2 II- E54 c.7366_7369del p.Thr2457AlafsX27 E54 c.7366_7369del p.Thr2457AlafsX27 441 ND + X LCA-JS-2 II- 45 E54 c.7366_7369del p.Thr2457AlafsX27 E54 c.7366_7369del p.Thr2457AlafsX27 2 46 c.3310- Acceptor splice LCA-JS-3 Belgium - NA I28-E29 E54 c.7341dup p.Leu2448ThrfsX8 (Sayer et al., 2006) 47 1_3310delinsAA defect 48CRB1 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 10 of 63

Genetic screening of LCA in Belgium 9

1 2 Allele 1 Allele 2 Reference 3 Par Pati ent Origin Segr Intron/ Nucleotide Amino acid Intron/ Nucleotide Amino acid Deleted: ë cons 4 exon change change exon change change (den Hollander et al., 5 LCA-28 Belgium - NA E7 c.2401A>T* p.Lys801X* E7 c.2401A>T* p.Lys801X* 6 2001) LCA-29 (den Hollander et al., 7 (Yzer et al., Belgium - NA E7 c.2401A>T* p.Lys801X* E5 c.1084C>T p.Gln362X 2001) , (Yzer et al., 8 2006) 2006) (den Hollander et al., LCA-30 9 Belgium - X E7 c.2401A>T* p.Lys801X* E7 c.2290C>T* p.Arg764Cys* 2001) , (Lotery et al.,

10 2001) LCA-31 (den Hollander et al., 11(Yzer et al., Belgium - X E7 c.2401A>T* p.Lys801X* E8 c.2688T>A* p.Cys896X* 2001) , (Hanein et al., 122006) 2004) LCA-32 (den Hollander et al., 13(Yzer et al., Belgium - NA E7 c.2401A>T* p.Lys801X* E8 c.2688T>A* p.Cys896X* 2001) , (Hanein et al., 142006) 2004) (den Hollander et al., 15LCA-33 Belgium - NA E7 c.2401A>T* p.Lys801X* E9 c.2843G>A* p.Cys948Tyr* 2001) , (Lotery et al., 16 2001) Acceptor splice (den Hollander et al., 17LCA-34 Belgium - X E7 c.2401A>T* p.Lys801X* I11 c.4006-1G>T defect 2001) 18 LCA-35 Belgium + NA E9 c.2843G>A*For p.Cys948Tyr* Peer E9 c.2843G>A*Review p.Cys948Tyr* (Lotery et al., 2001) 19 (Lotery et al., 2001) , LCA-36 ND - NA E9 c.2843G>A* p.Cys948Tyr* E11 c.3988G>T* p.Glu1330X* 20 (LCA chip) (Lotery et al., 2001) , 21LCA-37 Belgium - X E9 c.2843G>A* p.Cys948Tyr* I8 c.2842+5G>A* Splice defect* (den Hollander et al., 22 1999) (Lotery et al., 2001) , 23LCA-38 Belgium - X E9 c.2843G>A* p.Cys948Tyr* I8 c.2842+5G>A* Splice defect* (den Hollander et al., 24 1999) (Lotery et al., 2001) , 25LCA-39a E9 c.2843G>A* p.Cys948Tyr* I8 c.2842+5G>A* Splice defect* (den Hollander et al., 1999) 26 Belgium - X (Hanein et al., 2004) , 27LCA-39b I11 c.4005+1G>A Splice defect I8 c.2842+5G>A Splice defect (den Hollander et al., 28 1999) 29 (Hanein et al., 2004) , LCA-40 Belgium - NA I11 c.4005+1G>A* Splice defect* I8 c.2842+5G>A* Splice defect* (den Hollander et al., 30 1999) LCA-41 II-1 E7 c.2441_2442del p.Leu814ArgfsX23 E9 c.3713_3716dup p.Cys1240ProfsX24 31 Belgium - X Deleted: LCA-41 II-2 E7 c.2441_2442del p.Leu814ArgfsX23 E9 c.3713_3716dup p.Cys1240ProfsX24 32 Deleted: 33LCA-42 ND + NA E11 c.3879G>A* p.Trp1293X* E11 c.3879G>A* p.Trp1293X* (Hanein et al., 2004) (Lotery et al., 2001)Deleted, : 34EORD-1 II-1 E9 c.2843G>A* p.Cys948Tyr* E7 c.2401A>T* p.Lys801X* (den Hollander et al., 2001) 35 Belgium - X (Lotery et al., 2001) , 36EORD-1 II-2 E9 c.2843G>A p.Cys948Tyr E7 c.2401A>T p.Lys801X (den Hollander et al., 37 2001) 38EORD-2 Belgium NA E9 c.2843G>A p.Cys948Tyr E4 c.929G>A p.Cys310Tyr (Lotery et al., 2001) 39EORD-3 Belgium - X E9 c.2843G>A* p.Cys948Tyr* E6 c.1472A>T p.Asp491Val UV (Lotery et al., 2001) 40EORD-4 Belgium NA E5 c.1084C>T* p.Gln362X* E5 c.1084C>T* p.Gln362X* (Yzer et al., 2006) 41EORD-5 Belgium - NA E7 c.2290C>T* p.Arg764Cys* E7 c.2290C>T* p.Arg764Cys* (Lotery et al., 2001) 42RPE65 LCA-43 Turkey FC X E3 c.131G>A* p.Arg44Gln* E3 c.131G>A* p.Arg44Gln* (Simovich et al., 2001) 43 LCA-44 Turkey FC X E6 c.542C>T p.Pro181Leu E6 c.542C>T p.Pro181Leu 44LCA-45a E7 c.700C>T* p.Arg234X* E9 c.991_993dup p.Trp331dup (Marlhens et al., 1997) Belgium - X 45LCA-45b E9 c.991_993dup p.Trp331dup E9 c.991_993dup p.Trp331dup 46 X (c.10 p.Ser121LeufsX6 (Morimura et al., 47LCA-46 Portugal E10 c.1022T>C* p.Leu341Ser* E5 c.361delT 22T> de novo 1998) (ARRP) 48 C) 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 11 of 63 Human Mutation

10 Coppieters et al. 1 2 Allele 1 Allele 2 Reference 3 Par Pati ent Origin Segr Intron/ Nucleotide Amino acid Intron/ Nucleotide Amino acid Deleted: ë cons 4 exon change change exon change change 5 LCA-47 Belgium - X E14 c.1590del* p.Phe530LeufsX40* E14 c.1590del* p.Phe530LeufsX40* (Yzer et al., 2006) 6 (Yzer et al., 2006) , LCA-48 Belgium - X E14 c.1590del p.Phe530LeufsX40 E5 c.370C>T* p.Arg124X* (Morimura et al., 7 1998) (Yzer et al., 2006) , 8 LCA-49 Belgium - X E14 c.1590del* p.Phe530LeufsX40* I1 c.11+5G>A* Splice defect* 9 (Gu et al., 1997) Belgium 10LCA-50 /Russia - X E9 c.886dupA p.Arg296LysfsX7 I1 c.11+5G>A* Splice defect* (Gu et al., 1997) 11 (mother) 12GUCY2D Morocco/ LCA-51 - NA E2 c.389del p.Pro130LeufsX36 I13 c.2577-2A>C Splice defect (Perrault et al., 1996) 13 Belgium 14LCA-52 Turkey TC NA E8 c.1694T>C* p.Phe565Ser* E8 c.1694T>C* p.Phe565Ser* (Perrault et al., 1996) 15LCA-53 Belgium NA E12 c.2302C>T* p.Arg768Trp* E12 c.2302C>T* p.Arg768Trp* (Lotery et al., 2000) Morocco/ (Lotery et al., 2000) , LCA-54 - X E12 c.2302C>T* p.Arg768Trp* E8 c.1694T>C* p.Phe565Ser* 16 Belgium (Perrault et al., 1996) 17LCA-55 Belgium - X E12 c.2302C>T* p.Arg768Trp* E14 c.2598G>C p.Lys866Asn (Lotery et al., 2000) 18 Belgium/ LCA-56 - X E2 c.587A>TFor p.Glu196Val Peer UV E11 c.2132C>TReview p.Pro711Leu UV 19 France (Koenekoop et al., LCA-57 Africa - NA E8 c.1724C>T* p.Pro575Leu* UV ? ? ? 20 2002) 21AIPL1 22LCA-58 (Yzer et al., Belgium - X E6 c.834G>A* p.Trp278X* E6 c.834G>A p.Trp278X (Sohocki et al., 2000a) 232006) 24LCA-59 Belgium - NA E6 c.834G>A* p.Trp278X* E6 c.834G>A* p.Trp278X* (Sohocki et al., 2000a) 25LCA-60 Belgium NA E6 c.834G>A* p.Trp278X* E6 c.834G>A* p.Trp278X* (Sohocki et al., 2000a) 26LCA-61 Belgium - X E6 c.834G>A* p.Trp278X* E6 c.834G>A* p.Trp278X* (Sohocki et al., 2000a) E3 c.341C>T* UV p.Thr114Ile* UV LCA-62 Africa - in cis ? ? ? (Sohocki et al., 2000b) 27 E6 c.1126C>T UV p.Pro376Ser UV 28CRX (Vallespin et al., 29LCA-63 Belgium SC NA E4 c.425A>G* p.Tyr142Cys* UV ? ? ? 30 2007a) LCA-64 Ruanda NA E3 c.724G>A* p.Val242Met* UV ? ? ? (Swain et al., 1997) 31RDH12 32 (Janecke et al., 2004) , https://www.carverlab. 33EORD-6 Belgium - X E6 c.806_810del* p.Ala269GlyfsX2* E8 c.698T>A p.Val233Asp org/carver-mutation- 34 database 35EORD-7 Belgium + X E6 c.806_810del* p.Ala269GlyfsX2* E7 c.524C>T p.Ser175Leu (Janecke et al., 2004) 36EORD-8 Belgium E6 c.806_810del p.Ala269GlyfsX2 E6 c.806_810del p.Ala269GlyfsX2 (Janecke et al., 2004) 37RPGRIP1 38LCA-65 Belgium E16 c.2668C>T* p.Arg890X* ? ? ? (Gerber et al., 2001) 39 + 40 Novel mutations are indicated in bold. : patients carrying a heterozygous mutation in an additional gene: LCA-3 ( AHI1 , 41 c.2273A>C, p.His758Pro), LCA-16 ( RPE65 , c.253C>T, p.Arg85Cys) (Stone, 2007), LCA-20 ( CRB1 , c.2401A>T, p.Lys801X) (den Hollander et al., 2001) and CORS-1 ( AHI1 , c.2433T>G, p.Asn811Lys). *: identified through LCA chip analysis. F: LCA-7 42 and LCA-25 are distantly related. X: segregation analysis performed and segregation confirmed. NA: no material available of 43 family members. Reference: first publication describing the mutation in patients with LCA or EORD . In case of CEP290 , these Deleted : (early -onset) RP 44 references may also refer to papers dealing with other phenotypes (phenotype mentioned between brackets). Seven patients 45 were already described (corresponding reference is indicated in the first column). Abbreviations used: par cons: parental 46 consanguinity; segr: segregation; FC: first cousins; SC: second cousins; TC: third cousins; SD: second degree; ND: no data; 47 UV, unclassified variant; LCA, Leber Congenital Amaurosis; SLS, Senior-Loken syndrome; JS, joubert syndrome; ARRP, 48 autosomal recessive retinitis pigmentosa; CORS, cerebello-oculo-renal syndrome; ML, Meckel-like syndrome. Deleted : CRD, cone-rod dystrophy; 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 12 of 63

Genetic screening of LCA in Belgium 11

1 2 Deleted : ¶ 3 Deleted : ¶ 4 Clinical findings 5 Extensive ophthalmological data (best corrected visual acuity [BCVA], refraction, ERG, visual fields, color 6 vision testing , fundus aspect both with white light and autofluorescence imaging and the presence of nystagmus, 7 night blindness, photophobia and additional features) as well as associated manifestations in patients with CRB1 , 8 RPE65 , GUCY2D , AIPL1 , CRX , RPGRIP1 and RDH12 mutations are summarized in detail in Supp. Table S3. In Deleted : Supplementary addition, Figure 1 depicts several representative fundi from patients with an established molecular diagnosis. An 9 Deleted : 1 MTS due to midbrain abnormalities with cerebellar vermis aplasia was demonstrated in five patients with JS- 10 LCA/CORS and CEP290 mutations (Figure 2). 11 Special attention was paid to the CEP290 -related ocular phenotype, since this has been described in only a few 12 LCA studies so far. It appeared that this phenotype displays only limited fundus alterations in the first few years of Deleted : subtype 13 life. In a small subset of patients, no fundus abnormalities were obvious early on , while in the majority a Deleted : early 14 marbleized fundus and/or salt and pepper aspect was seen during the first decade. This aspect further evolved from 15 young adulthood into progressive outer retinal atrophy in the midperiphery with relative sparing of the central 16 macula. Abnormalities of the central macula were absent in our patient cohort, despite the impression that CEP290 -related disease is probably of a cone-rod type (based on ERG findings and the occurrence of 17 photophobia). Of note is the presence of a hyperautofluorescent ring around the central macula on AF imaging, 18 observed in four patients starting fromFor the age of Peersix (LCA-2, LCA-3, Review LCA-7 and LCA-25). Mild intraretinal 19 spicular pigment migration occurred in three patients at an age between 7 and 33 years old (LCA-JS-1, LCA-6 and 20 LCA-7). This aspect became even more pronounced at the age of 49 in patient LCA-7, where a predominant 21 spicular pigmentation was mixed with less frequent intraretinal pigment migration with a nummular aspect. Visual 22 acuity of this group was mostly limited to light perception. In the few patients with better preserved central vision, 23 basic color vision was present and visual fields varied from severely concentrically constricted (LCA-8) to sparing of the central 30° at an age of 49 (LCA-7) ( Supp. Table S3 ). Deleted : 24 Supplementary Deleted : 1 25 26 27 28 29 30 31 32 33 34 35 36 37 Figure 2: Magnetic resonance imaging (MRI) showing characteristic molar tooth sign (MTS) in five patients with 38 Joubert syndrome /cerebello-oculo-renal syndrome due to mutations in CEP290 (all are axial sections through 39 midbrain). Images organized from left to right; arrows indicate MTS of midbrain present in all due to midbrain malformation with 40 hypoplastic cerebellar vermis and midline cleft (all images are T1 weighted except for panel D which is T2 weighted). A) Deleted : C 41 CORS-1 at age 5 years; B) LCA-JS-1 at age 7 years; C) LCA-JS-2 II-1 at age 14 years; D) LCA-JS-2 II-2 at age 17 years and 42 E) LCA-JS-3 at age 2 years. 43 44 45 46

47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 13 of 63 Human Mutation

12 Coppieters et al. 1 2 3 Deleted : ¶ 4 5 6 7 8 9 10 11 12 Deleted : (Images organized clockwise 13 from top left).¶ 14 Deleted : phenotype 15 Deleted : ¶ 16 17 Deleted : female patient 18 For Peer Review Deleted : e 19 Deleted : ¶ C 20 21 Deleted : male patient 22 Deleted : ¶ 23 Deleted : male patient 24 Deleted : ¶ 25 Deleted : phenotype 26 Deleted : ¶ 27 Deleted : female patient 28 Deleted : intreretinal 29 Figure 1: Clinical characteristics of eight LCA patients with an established molecular diagnosis, illustrating Deleted : ¶ 30 characteristic phenotypic features associated with different genotypes. 31 CEP290 . A & B: Early and later stage phenotype in right eye (RE) in LCA-3 at age 3 and 18 years respectively; note Deleted : phenotype marbleized aspect of midperiphery at age 3, evolving towards atrophy later; macula stays well-preserved throughout evolution. Deleted : ¶ 32 C & D : Fundus and autofluorescence (AF) image of RE of LCA-25 at age eight years; note concentric hyperautofluorescent Deleted : male patient 33 ring around macula suggesting a watershed zone between better and more affected retina with probably central area the better; 34 midperipheral retina shows diffuse mottled hyperautofluorescence suggesting widespread outer retinal disease. E & F : Fundus Deleted : ¶ 35 image of RE and infrared image of left eye (LE) of LCA-7 at age 33 and 49 years respectively; note pigment epithelium Deleted : phenotype alterations in the mid- and far periphery of retina but no intraretinal pigmentation, and with fair preservation of macular area at 36 Deleted : ¶ age 33; at age 49 macula is still fairly well-preserved, but outer retinal atrophy and spicular intraretinal pigmentation is now 37 Deleted : male patient 38 prominent. CRB1 .G: Fundus of RE of LCA-39a at age 16, showing typical yellowish discoloration of atrophic macula, surrounded by nummular type of intraretinal pigmentation; mild pseudopapilledema and prepapillary paravascular fibrosis also Deleted : he 39 visible, as is peripheral greyish hue of outer retinal atrophy with fine white flecks and nummular pigmentation. GUCY2D . H & Deleted : at same age 40 I: Fundus and AF image of RE of LCA-55 at age 9 years; fundus is essentially quite normal with only mild pigment epithelium Deleted : ¶ 41 alterations in the retinal periphery; however, AF image shows hyperautofluorescence in central macular area. RPE65 . J: Fundus 42 of LE of LCA-49 at age 10 who subsequently underwent gene therapy with AAV2-hRPE65v2 in RE (Maguire et al. 2009) ; Deleted : phenotype 43 apart from some discrete pigment epithelium alterations fundus is essentially normal; autofluorescence imaging could not be Deleted : ¶ 44 obtained due to lack of lipofuscin accumulation in retinal pigment epithelium (RPE) typical of this type of LCA. AIPL1 . K & Deleted : female patient L: Fundus and AF image of RE of LCA-61 at age 19 years; central macular atrophy with yellowish hue is surrounded by area 45 Deleted : ¶ of better preserved peripheral macula; outer retinal atrophy with spicular intraretinal pigmentation visible in periphery; AF 46 shows black area of atrophic central macula, but is typically not surrounded by hyperautofluorescent ring. RDH12 . M & N : Deleted : phenotype 47 Fundus of EORD-7 at age 5 and 19 years respectively; note mild macular RPE changes which become more prominent with Deleted : ¶ 48 Deleted : male patient 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 14 of 63

Genetic screening of LCA in Belgium 13

1 2 age; mild predominantly spicular intraretinal pigmentation also increases with age; however, preservation of patches of normal 3 peripheral retina are most striking feature; these patches remain over time. 4 5 DISCUSSION 6 7 Genotypes of the Belgian LCA population 8 In a cohort of 91 unrelated LCA patients, mainly originating from Belgium, a total of 61 different mutations 9 (including 9 UVs) were found in 7 genes. Homozygous or compound heterozygous mutations were detected in Deleted : nine …seven …, 26 of which 10 65% (59/91) of probands, whereas only one heterozygous mutation could be identified in 4% (4/91) of probands. were novel ... [13] 11 In addition to isolated LCA, this study also identified mutations in eight probands with EORD and seven probands Deleted : . with syndromic LCA (SLS, LCA-JS and CORS) (Table 1). 12 Deleted : Mutations were identified in LCA chip analysis proved to be a powerful initial tool as mutations were found in 41% (3 7/91) of patients with 13 69% (63/91) of probands, with an LCA. Subsequent sequencing of 6 genes ( CEP290 , CRB1 , RPE65 , GUCY2D , AIPL1 and CRX ) enabled us to established diagnosis - two mutations 14 identify mutations in an additional 2 8% of cases. Of note, the majority of mutations found in the latter probands found - in 65% (59/91). …,…five of which were novel mutations 15 are now included in the LCA chip, increasing its detection rate to 65 % if our cohort would have been analyzed ... [14] 16 using the latest version (v8, 641 variants). Deleted : 43…9…6…all patients of this study 17 Segregation of disease alleles was demonstrated in 41 out of 43 families available , with two exception s. The ... [15] 18 first one is LCA-62, in which the AIPL1 variants p.Thr114Ile and p.Pro376Ser were located in cis on the maternal Deleted : could be…in which testing For Peer Review was possible…the … of two probands... [16] chromosome. This finding challenges a previous study proposing this genotype as causal in a n LCA patient 19 Deleted : one concerns patient 20 (Sohocki et al., 2000b). In the second case, only one of two mutations identified in LCA-46 was found in the mother but not in father, suggesting that the other mutation arose de novo (p.Ser121LeufsX6, non-paternity Deleted : missense …in AIPL1 21 excluded) (Table 1). Of note, two different mutations in CEP290 were identified in CORS-1, originating from a describing ... [17] 22 consanguineous marriage, which illustrates that assuming homozygosity in offspring from a consanguinous mating Deleted : the observation of Sohocki 23 can be a potential pitfall for the identification of the causal defect (Table 1). and colleagues, who previously described 24 Our data demonstrate a key role for CEP290 in the Belgian LCA population, as CEP290 mutations were Deleted : these …changes …mutations 25 identified in 27 probands (30%). Although the prevalence of CEP290 mutations is not this high worldwide with LCA …both ... [18] 26 (Simonelli et al., 2007; Vallespin et al., 2007b; Seong et al., 2008; Li et al., 2009; Sundaresan et al., 2009), this Deleted : patient study corroborates the importance of CEP290 in the Northwestern European population (den Hollander et al., 27 Deleted : compound heterozygous…an 2006; Perrault et al., 2007). The second most frequently mutated gene in our LCA population was CRB1 (16%), individual …all …CORS-1, ... [19] 28 followed by RPE65 (9%), GUCY2D (8%) and AIPL1 (5%), which is in agreement with previous data (den Deleted : the …gene …in CE P290 29 Hollander et al., 2008). The RPGRIP1 gene – in this study only investigated with the LCA chip – accounted for ... [20] 30 less than 1% of the LCA population. Deleted : ,… and RPGRIP1 (1%) ... [21] 31 In total, 30 novel mutations /variants were identified in this study (Table 1, Supp. Table S2 ). Interestingly, 5 out Deleted : through… analysis …The two of 16 novel mutations in CEP290 are located nearby known changes: c.384_385del (c.384_387del, variants identified in CRX had an 32 uncertain pathogenic potential and were 33 c.381_382delinsT) (Baala et al., 2007; Perrault et al., 2007), c.2218-2A>C (c.2218-4_2222del and c.2218- therefore not included in these 34 15_2220del) (Sayer et al., 2006; Stone, 2007), c.3310-1_3310delinsAA (c.3310-1G>C) (Tory et al., 2007), calculations. ... [22] c.5519_5537del (c.5515_5518del) (Sayer et al., 2006) and c.5865_5867delinsGG (c.5866G>T) (den Hollander et 35 Deleted : 31 …variants/…patients with al., 2006). A similar observation was made for RDH12 , in which the novel mutation p.Ser175Leu affects the same LCA, EORD, SLS, LCA-JS or CORS…. 36 codon as the known mutation p.Ser175Pro (Perrault et al., 2004). Overall, these regions/codons might be more Segregation and thorough bioinformatic 37 evaluation allowed interpretation of these prone to mutational events. variants …Table 2 38 For several genes, a limited number of recurrent mutations made up the majority of mutated alleles. This was ... [23] 39 certainly the case for CEP290 , in which c.2991+1655A>G was found in 89% of all LCA patients with CEP290 - 40 related pathology. Together with p.Lys1575X and c.3310-1_3310delinsAA, a significant fraction of mutated 41 alleles was identified in the LCA population (35/53 alleles). So far, p.Lys1575X has only been found in patients originating from northern France (Perrault et al., 2007) or Belgium (Brancati et al., 2007). This potential founder Deleted : the 42 effect is supported by our study, since all patients who carry p.Lys1575X live in Flanders (northern part of 43 Belgium). A similar regional prevalence was seen for p.Ala1832ProfsX19, which was inherited from the Greek 44 father of LCA-16. The same mutation occurred in an Italian patient with CORS (Brancati et al., 2007) and in two Deleted : the …in ... [24] 45 consanguineous families of Kosovar-Albanian and Kosovar origin with MKS, sharing a common haplotype (Frank Deleted : which et al., 2008). For the other genes, the following mutations presented with a gene-specific allele-frequency of at 46 Deleted : showing 47 least 20% in the LCA population: p.Lys801X ( CRB1 , 27%), p.Cys948Tyr ( CRB1 , 23%), p.Phe530LeufsX40 Deleted : was demonstrated 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 15 of 63 Human Mutation

14 Coppieters et al. 1 2 (RPE65 , 25%), p.Arg768Trp ( GUCY2D , 31%), p.Phe565Ser ( GUCY2D , 23%) and p.Trp278X ( AIPL1 , 89%). The 3 presence of all but one of these mutations on the LCA chip significantly contributed to its high detection rate. 4 In six LCA patients, only one mutation was found after sequencing of the gene apparently involved following Deleted : direct 5 chip testing. Notably, we might have failed to detect deep intronic and regulatory mutations or multi-exon Deleted : of the total coding region 6 deletions, as were recently demonstrated in CEP290 (Travaglini et al., 2009). In addition, it cannot be excluded 7 that the phenotype is caused by mutations in a different gene, as was the case for LCA-20. Furthermore, new Deleted : is mutations in the other known genes cannot be ruled out here. Their contribution is expected to be limited however, 8 Deleted : in this study taking into account the high detection rate obtained using the current strategy. Finally, these patients may carry 9 mutations in as yet unknown genes. Deleted : excluded since a selection of 10 six genes was sequenced 11 Phenotypes of the Belgian LCA population 12 In addition, the phenotypes of patients with a molecular diagnosis were extensively studied. For all genes, 13 nystagmus and hypermetropia were recurrent features. The oculodigital sign (plus enophthalmos) was often seen in Deleted : con sequent 14 all but RPE65 -related LCA patients. A relatively higher incidence of both keratoconus and cataract was seen in the 15 CRB1 -related group, which may reflect secondary effects of a more severe retinal dystrophy compared to other 16 genes. Indeed, several retinal abnormalities such as macular atrophy and intraretinal pigment migration already became apparent in the first decade of life in patients with CRB1 -related disease, being earlier than generally seen Deleted : which is 17 for the other genes. In addition, a yellowish discoloration of the central macula was often observed. However, this 18 feature is not entirely gene-specific,For since it also occurred Peer in a patient carrying Review RDH12 mutations (EORD-7). This 19 feature may be due to more severe outer retinal atrophy in the macula in CRB1 - and RDH12 -related disease, which 20 may cause more intense scleral light reflection due to less absorption by the atrophic retinal pigment epithelium, 21 with consequent highlighting of the macular luteal pigment. 22 The RPE65 -related phenotype proved to be typically associated with a fundus appearance which is essentially 23 normal during first years and displays only later on fundus alterations which are initially mild. Visual acuity is generally somewhat better than that seen in CRB1 -related LCA. However, it seems to be the relatively slow 24 evolution of the phenotype which makes it particularly suitable for therapeutic intervention (Bainbridge et al., 25 2008; Hauswirth et al., 2008; Maguire et al., 2008). For two patients from our cohort (LCA-47 and LCA-49) , 26 RPE65 gene-replacement therapy resulted in better visual function (Maguire et al., 2009). In addition, two patients 27 with RPE65 mutations reported a period of increased visual function, possibly reflecting postnatal physiological 28 cone maturation (LCA-44 and LCA-47) (Koenekoop et al., 2007). Hanein et al. classified both CRB1 - and RPE65 - 29 related LCA as rod-cone dystrophies because of a predominant occurrence of night blindness (Hanein et al., 2004). 30 All RPE65 -related phenotypes in this study correspond to this classification. In the CRB1 -group, however, six patients with LCA and two with EORD also suffered from photophobia, even before the onset of night blindness in 31 EORD-3. 32 Similarly, the GUCY2D -related phenotype was found to have only limited fundus abnormalities. Although this 33 phenotype was previously categorized as cone-rod dystrophy, one patient in our cohort had severe night blindness 34 before photophobia became apparent (LCA-54). 35 In the patients with AIPL1 mutations, an RP-like phenotype emerged by their teenage years at the latest, and a 36 maculopathy with (partial) outer retinal atrophy was typically present in the majority of cases (Dharmaraj et al., 37 2004). 38 A unique feature of RDH12 -related early-onset dystrophy was the occurrence of areas with complete preservation of the chorioretina in the retinal periphery, alternating with regions of total atrophy (EORD-7). 39 Notably, our study is one of the first reporting on the ocular phenotype of a larger group of LCA patients with Deleted : ¶ 40 CEP290 mutations ( Supp. Table S3 ). In keeping with previously reported findings (Perrault et al., 2007), it Deleted : Supplementary Table 2 41 appeared to be that of a severe cone-rod type retinal dystrophy. Visual acuity was mostly limited to light 42 perception, as recently described (Walia et al. , 2010 ). Interestingly, a limited subset of patients displayed no Deleted : 1 43 obvious retinal abnormalities in the first years of life. In general, the fundus contained either small white dots or, 44 more frequently, a marbleized or salt and pepper aspect in the first to second decade. In two patients aged 18 and 45 49, predominant spicular pigment migration was observed (LCA-6 and LCA-7), in contrast to the reported nummular pigmentation in one patient in the fourth decade (den Hollander et al., 2006). In one patient, nummular 46 pigmentation was described in the first decade (LCA-10). Interestingly, a more severe phenotype was seen in Deleted : reported 47 LCA-20, who carried a heterozygous CRB1 null allele on top of two mutations in CEP290 . 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 16 of 63

Genetic screening of LCA in Belgium 15

1 2 3 4 Extra-ocular features of CEP290 -related LCA and potential modifier alleles in AHI1 Deleted : Supplementary Table 2 5 Several patients with CEP290 -related retinal dystrophy showed additional systemic features. Two patients with Deleted : 1 6 isolated LCA had several symptoms suggestive of renal dysfunction (LCA-3 and LCA-23, Supp. Table S3 ). LCA- 7 3 suffer ed from growth retardation, polydipsia, enuresis nocturna and diurnal incontinence. Kidney US at the age Deleted : Patient 8 of seven, however, was normal. In LCA-23, kidney US at the age of three revealed increased echogenicity and Deleted : s kidneys without clear cortico-medullar differentiation. Despite this observation, no clinical nephrological 9 Deleted : patient manifestations were present at the age of 17. Since the age of onset of end-stage renal disease caused by CEP290 10 Deleted : are mutations may exceed the age of 20 (Helou et al., 2007; Tory et al., 2007), a close nephrological follow-up of 11 these patients is required. Interestingly, both of these patients carry the recurrent c.2991+1655A>G mutation, Deleted : limited number 12 which so far has only been reported in LCA patients without any other associated pathology. Of note, kidney US Deleted : 1 13 was available for only a subset of patients, and in general performed very early in life, when developing kidney Deleted : of which 14 disease might be difficult to detect. Deleted : Supplementary Table 2 15 In addition, four patients suffered from recurrent otitis media (OM) (LCA-5, SLS-1, SLS-3 and CORS-1, 16 Supplementary Table 2). Although this is common in childhood, it is worth mentioning that it is also a clinical Deleted : 1 manifestation often seen in primary ciliary dyskinesia (PCD), a genetically heterogeneous disorder of motile cilia 17 Deleted : occurred (Leigh et al., 2009). In a few cases, PCD with OM was associated with X-linked RP, caused by mutations in RPGR Deleted : ¶ 18 (Shu et al., 2007). Notably, RPGRFor is a centrosomal Peer protein that interacts Review with CEP290 (Chang et al., 2006). 19 Moreover, loss-of-function experiments of CEP290 in zebrafish caused developmental abnormalities of the otic Deleted : who suffers from SLS and is 20 cavity (Sayer et al., 2006). Deleted : the missense mutation 21 Strikingly, 33% of patients with CEP290 -related isolated LCA presented with mental retardation and/or autism, Deleted : a Pakistani boy in contrast to only 8% of patients with mutations in the other genes. Subtle brain abnormalities such as broadened 22 Deleted : involvement 23 lateral ventricles were seen on MRI in some patients. Of note, brain imaging was not available for a subset of patients. Additional neurological manifestations included movement abnormalities (LCA-21), and dyspraxia and Deleted : Diagnosis of renal disease in 24 both patients was based on kidney US balance/coordination problems (LCA-18), the latter of which was also evident in two patients with syndromic 25 (hyperdensity) and blood tests, and was CEP290 -related LCA (SLS-2 and CORS-1) ( Supp. Table S3 ). established at the age of 13 and 6 years, 26 Taken together, these extra-ocular manifestations fit well into the broad clinical spectrum of CEP290 mutations, respectively. SLS-3 receives peritoneal 27 varying from isolated LCA to the lethal MKS. In addition, the CEP290 allelic spectrum is highly complex. dialysis since the age of 17, and is awaiting kidney transplantation. CORS-1 28 Mutations associated with isolated LCA in this study were previously reported in other ciliopathies (Table 1), deceased at an age of 16 as a 29 albeit always in compound heterozygosity with a different mutation in the distinct phenotypes. Moreover, identical consequence of renal failure. 30 CEP290 genotypes can display interfamilial variable expressivity and intrafamilial variation of the neurological Deleted : detected phenotype was observed in several families with CEP290 -related pathology (Coppieters et al., 2010). The 31 Deleted : Supplementary Table 2 complexity of CEP290 -related disease is further illustrated by two cases from this study. 32 The first one is SLS-1, homozygous for p.Trp7Cys. Valente and coworkers identified the same mutation in Deleted : , following complaints of nausea and weight loss 33 patient with CORS , also of Pakistani origin (COR22, II:1). Despite a similar ocular and renal phenotype, both 34 patients significantly differ in their neurological phenotype . A second and even more pronounced example is the Deleted : Haemodialysis and subsequent peritoneal dialysis started at the age of 34 35 variability in both nephrological and neurological involvement in three unrelated patients with the same and the patient received kidney transplant 36 p.Lys1575X/p.Arg1465X genotype (SLS-2, SLS-3 and CORS-1). Patients SLS-3 and CORS-1 displayed a similar six months later. clinical course of renal disease, with renal failure at the age of 16 and 14 years, respectively. In contrast, renal 37 Deleted : The n 38 insufficiency in patient SLS-2 was not substantiated until the age of 30 ( Supp. Table S3 ). Neurological signs of these three patients ranged from a mild mental handicap (SLS-2) over severe autism in combination with moderate Deleted : n 39 mental retardation (SLS-3) to severe mental retardation associated with ataxia and a MTS (CORS-1). An MRI was Deleted : on MRI 40 not available for the other two patients, however. Deleted : other 41 The AHI1 gene was screened as a candidate modifier gene in these three patients. Strikingly, CORS-1, with the Deleted : that encodes 42 most severe nephrologic and neurologic phenotype, carries a heterozygous novel p.Asn811Lys mutation in AHI1 , which was absent in the two other patients. Upon screening of AHI1 in five additional patients with CEP290 - Deleted : Most of the mutations are null 43 alleles with a few missense mutations 44 related disease and neurological involvement, a novel missense variant, p.His758Pro, was identified in LCA-3. mainly clustering within the predicted 45 Mutations in AHI1 encoding Jouberin are responsible for JS, with retinal involvement in 75% and renal WD40-repeat, a domain conserved across involvement in less than 10% of all AHI1 -associated patients (Kroes et al., 2008). Interestingly, both p.Asn811Lys all eukaryotes, which mediates functions 46 such as vesicular trafficking (Li and and p.His758Pro affect conserved residues and are located in the predicted WD40-repeat, a domain conserved Roberts, 2001) . 47 across all eukaryotes, mediating functions such as vesicular trafficking (Li and Roberts, 2001). Since AHI1 and 48 Deleted : this domain and affect CEP290 appear to be in the same pathway through their interaction with rab8a, mutations in one of both genes conserved residues 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 17 of 63 Human Mutation

16 Coppieters et al. 1 2 may modify a phenotype caused by the other (Kim et al., 2008; Tsang et al., 2008; Hsiao et al., 2009). Tory and 3 colleagues already suggested a similar potential epistatic effect of CEP290 and AHI1 mutations on phenotypes 4 related to NPHP1 , encoding another interactor of AHI1 (Tory et al., 2007; Eley et al., 2008). Strikingly, one of the 5 AHI1 variants they described as a potential modifier for neurological involvement in patients with NPHP1 6 mutations, p.Arg830Trp, was recently identified as a modifier allele for retinal degeneration in patients with 7 NPHP, independent of a primary NPHP1 mutation (Louie et al. , 2010 ). Of note, four out of seven patients in the 8 study from Tory and coworkers carrying p.Arg830Trp displayed visual impairment, with one blind individual (Tory et al., 2007). The p.Arg830Trp variant might affect AHI1 complex stability/formation (Louie et al. , 2010 ). Deleted : probably 9 The variants identified here , assumed to represent a neurological modifier in patients with LCA, might disrupt Deleted : s 10 interactions with other proteins, thereby influencing AHI1 function in other organ systems. 11 Overall, a molecular diagnosis of CEP290 mutations might have considerable consequences towards the Deleted : that are 12 clinical prognosis of an individual . Given the potential involvement of ciliary modifiers and the presence of cilia 13 throughout the whole body , the development of various additional clinical manifestations should be taken into Deleted : one should be very cautious 14 account . As for LCA, both children and (young) adults should have a long-term close clinical neurological and for 15 nephrological follow-up, since some features have a later onset. Deleted : that can have a wide variety, reflecting the overall presence of cilia 16 In conclusion, molecular testing identified mutations in 69% of our LCA cohort, with a major involvement of throughout the whole body 17 CEP290 . Detailed phenotyping of all patients with a molecular diagnosis revealed novel insights, mainly into the Deleted : exhaustive genetic 18 CEP290 -related retinal phenotype, For which is well documentePeerd for the firstReview time in a larger patient group. The 19 variable age-of-onset of the extra-ocular features emphasizes the importance of long-term clinical follow-up of 20 LCA patients with CEP290 mutations. Moreover, the identification of potential modifiers of CEP290 -related 21 disease might contribute to a refined prognosis based on a molecular diagnosis. Finally, our findings fit with 22 previous observations suggesting that the phenotype of ciliopathies is most likely determined by the synergistic effect of all variants occurring in the ciliary proteome. 23 24 25 REFERENCES 26 Baala L, Audollent S, Martinovic J, Ozilou C, Babron MC, Sivanandamoorthy S, Saunier S, Salomon R, Gonzales M, 27 Rattenberry E, Esculpavit C, Toutain A, Moraine C, Parent P, Marcorelles P, Dauge MC, Roume J, Le Merrer M, 28 Meiner V, Meir K, Menez F, Beaufrere AM, Francannet C, Tantau J, Sinico M, Dumez Y, MacDonald F, Munnich A, Lyonnet S, Gubler MC, Genin E, Johnson CA, Vekemans M, Encha-Razavi F, Attie-Bitach T. 2007. Pleiotropic 29 effects of CEP290 (NPHP6) mutations extend to Meckel syndrome. Am J Hum Genet 81(1):170-9. 30 Bainbridge JW, Smith AJ, Barker SS, Robbie S, Henderson R, Balaggan K, Viswanathan A, Holder GE, Stockman A, Tyler N, 31 Petersen-Jones S, Bhattacharya SS, Thrasher AJ, Fitzke FW, Carter BJ, Rubin GS, Moore AT, Ali RR. 2008. Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med 358(21):2231-9. 32 Bowne SJ, Sullivan LS, Mortimer SE, Hedstrom L, Zhu J, Spellicy CJ, Gire AI, Hughbanks-Wheaton D, Birch DG, Lewis RA, 33 Heckenlively JR, Daiger SP. 2006. Spectrum and frequency of mutations in IMPDH1 associated with autosomal 34 dominant retinitis pigmentosa and leber congenital amaurosis. Invest Ophthalmol Vis Sci 47(1):34-42. Brancati F, Barrano G, Silhavy JL, Marsh SE, Travaglini L, Bielas SL, Amorini M, Zablocka D, Kayserili H, Al-Gazali L, 35 Bertini E, Boltshauser E, D'Hooghe M, Fazzi E, Fenerci EY, Hennekam RC, Kiss A, Lees MM, Marco E, Phadke SR, 36 Rigoli L, Romano S, Salpietro CD, Sherr EH, Signorini S, Stromme P, Stuart B, Sztriha L, Viskochil DH, Yuksel A, 37 Dallapiccola B, Valente EM, Gleeson JG. 2007. CEP290 mutations are frequently identified in the oculo-renal form of Joubert syndrome-related disorders. Am J Hum Genet 81(1):104-13. 38 Chang B, Khanna H, Hawes N, Jimeno D, He S, Lillo C, Parapuram SK, Cheng H, Scott A, Hurd RE, Sayer JA, Otto EA, 39 Attanasio M, O'Toole JF, Jin G, Shou C, Hildebrandt F, Williams DS, Heckenlively JR, Swaroop A. 2006. In-frame 40 deletion in a novel centrosomal/ciliary protein CEP290/NPHP6 perturbs its interaction with RPGR and results in early-onset retinal degeneration in the rd16 mouse. Hum Mol Genet 15(11):1847-57. 41 Chen S, Wang QL, Xu S, Liu I, Li LY, Wang Y, Zack DJ. 2002. Functional analysis of cone-rod homeobox (CRX) mutations 42 associated with retinal dystrophy. Hum Mol Genet 11(8):873-84. 43 Cideciyan AV, Hauswirth WW, Aleman TS, Kaushal S, Schwartz SB, Boye SL, Windsor EA, Conlon TJ, Sumaroka A, Pang JJ, Roman AJ, Byrne BJ, Jacobson SG. 2009. Human RPE65 gene therapy for Leber congenital amaurosis: 44 persistence of early visual improvements and safety at 1 year. Hum Gene Ther 20(9):999-1004. 45 Coppieters F, Lefever S, Vandesompele J, Leroy BP, De Baere E. 2010. CEP290, a gene with many faces: mutation overview 46 and presentation of CEP290base . Under review . Deleted : Submitted den Hollander AI, Heckenlively JR, van den Born LI, de Kok YJ, van der Velde-Visser SD, Kellner U, Jurklies B, van 47 Schooneveld MJ, Blankenagel A, Rohrschneider K, Wissinger B, Cruysberg JR, Deutman AF, Brunner HG, 48 Apfelstedt-Sylla E, Hoyng CB, Cremers FP. 2001. Leber congenital amaurosis and retinitis pigmentosa with Coats- 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 18 of 63

Genetic screening of LCA in Belgium 17

1 2 like exudative vasculopathy are associated with mutations in the crumbs homologue 1 (CRB1) gene. Am J Hum 3 Genet 69(1):198-203. 4 den Hollander AI, Koenekoop RK, Mohamed MD, Arts HH, Boldt K, Towns KV, Sedmak T, Beer M, Nagel-Wolfrum K, McKibbin M, Dharmaraj S, Lopez I, Ivings L, Williams GA, Springell K, Woods CG, Jafri H, Rashid Y, Strom TM, 5 van der Zwaag B, Gosens I, Kersten FF, van Wijk E, Veltman JA, Zonneveld MN, van Beersum SE, Maumenee IH, 6 Wolfrum U, Cheetham ME, Ueffing M, Cremers FP, Inglehearn CF, Roepman R. 2007. Mutations in LCA5, 7 encoding the ciliary protein lebercilin, cause Leber congenital amaurosis. Nat Genet 39(7):889-95. den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, Zonneveld MN, Strom TM, Meitinger T, 8 Brunner HG, Hoyng CB, van den Born LI, Rohrschneider K, Cremers FP. 2006. Mutations in the CEP290 (NPHP6) 9 gene are a frequent cause of Leber congenital amaurosis. Am J Hum Genet 79(3):556-61. 10 den Hollander AI, Roepman R, Koenekoop RK, Cremers FP. 2008. Leber congenital amaurosis: genes, proteins and disease mechanisms. Prog Retin Eye Res 27(4):391-419. 11 den Hollander AI, ten Brink JB, de Kok YJ, van Soest S, van den Born LI, van Driel MA, van de Pol DJ, Payne AM, 12 Bhattacharya SS, Kellner U, Hoyng CB, Westerveld A, Brunner HG, Bleeker-Wagemakers EM, Deutman AF, 13 Heckenlively JR, Cremers FP, Bergen AA. 1999. Mutations in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12). Nat Genet 23(2):217-21. 14 Dephoure N, Zhou C, Villen J, Beausoleil SA, Bakalarski CE, Elledge SJ, Gygi SP. 2008. A quantitative atlas of mitotic 15 phosphorylation. Proc Natl Acad Sci U S A 105(31):10762-7. 16 Dharmaraj S, Leroy BP, Sohocki MM, Koenekoop RK, Perrault I, Anwar K, Khaliq S, Devi RS, Birch DG, De Pool E, Izquierdo N, Van Maldergem L, Ismail M, Payne AM, Holder GE, Bhattacharya SS, Bird AC, Kaplan J, Maumenee 17 IH. 2004. The phenotype of Leber congenital amaurosis in patients with AIPL1 mutations. Arch Ophthalmol 18 122(7):1029-37. For Peer Review 19 Dryja TP, Adams SM, Grimsby JL, McGee TL, Hong DH, Li T, Andreasson S, Berson EL. 2001. Null RPGRIP1 alleles in patients with Leber congenital amaurosis. Am J Hum Genet 68(5):1295-8. 20 Eley L, Gabrielides C, Adams M, Johnson CA, Hildebrandt F, Sayer JA. 2008. Jouberin localizes to collecting ducts and 21 interacts with nephrocystin-1. Kidney Int 74(9):1139-49. 22 Frank V, den Hollander AI, Bruchle NO, Zonneveld MN, Nurnberg G, Becker C, Du Bois G, Kendziorra H, Roosing S, 23 Senderek J, Nurnberg P, Cremers FP, Zerres K, Bergmann C. 2008. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome. Hum Mutat 29(1):45-52. 24 Freund CL, Wang QL, Chen S, Muskat BL, Wiles CD, Sheffield VC, Jacobson SG, McInnes RR, Zack DJ, Stone EM. 1998. 25 De novo mutations in the CRX homeobox gene associated with Leber congenital amaurosis. Nat Genet 18(4):311-2. 26 Friedman JS, Chang B, Kannabiran C, Chakarova C, Singh HP, Jalali S, Hawes NL, Branham K, Othman M, Filippova E, Thompson DA, Webster AR, Andreasson S, Jacobson SG, Bhattacharya SS, Heckenlively JR, Swaroop A. 2006. 27 Premature truncation of a novel protein, RD3, exhibiting subnuclear localization is associated with retinal 28 degeneration. Am J Hum Genet 79(6):1059-70. 29 Gerber S, Perrault I, Hanein S, Barbet F, Ducroq D, Ghazi I, Martin-Coignard D, Leowski C, Homfray T, Dufier JL, Munnich A, Kaplan J, Rozet JM. 2001. Complete exon-intron structure of the RPGR-interacting protein (RPGRIP1) gene 30 allows the identification of mutations underlying Leber congenital amaurosis. Eur J Hum Genet 9(8):561-71. 31 Gu SM, Thompson DA, Srikumari CR, Lorenz B, Finckh U, Nicoletti A, Murthy KR, Rathmann M, Kumaramanickavel G, 32 Denton MJ, Gal A. 1997. Mutations in RPE65 cause autosomal recessive childhood-onset severe retinal dystrophy. Nat Genet 17(2):194-7. 33 Hagstrom SA, North MA, Nishina PL, Berson EL, Dryja TP. 1998. Recessive mutations in the gene encoding the tubby-like 34 protein TULP1 in patients with retinitis pigmentosa. Nat Genet 18(2):174-6. 35 Hanein S, Perrault I, Gerber S, Tanguy G, Barbet F, Ducroq D, Calvas P, Dollfus H, Hamel C, Lopponen T, Munier F, Santos L, Shalev S, Zafeiriou D, Dufier JL, Munnich A, Rozet JM, Kaplan J. 2004. Leber congenital amaurosis: 36 comprehensive survey of the genetic heterogeneity, refinement of the clinical definition, and genotype-phenotype 37 correlations as a strategy for molecular diagnosis. Hum Mutat 23(4):306-17. 38 Hanein S, Perrault I, Gerber S, Tanguy G, Rozet JM, Kaplan J. 2006. Leber congenital amaurosis: survey of the genetic heterogeneity, refinement of the clinical definition and phenotype-genotype correlations as a strategy for molecular 39 diagnosis. Clinical and molecular survey in LCA. Adv Exp Med Biol 572:15-20. 40 Hauswirth WW, Aleman TS, Kaushal S, Cideciyan AV, Schwartz SB, Wang L, Conlon TJ, Boye SL, Flotte TR, Byrne BJ, 41 Jacobson SG. 2008. Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: short-term results of a phase I trial. Hum Gene Ther 19(10):979-90. 42 Helou J, Otto EA, Attanasio M, Allen SJ, Parisi MA, Glass I, Utsch B, Hashmi S, Fazzi E, Omran H, O'Toole JF, Sayer JA, 43 Hildebrandt F. 2007. Mutation analysis of NPHP6/CEP290 in patients with Joubert syndrome and Senior-Loken 44 syndrome. J Med Genet 44(10):657-63. Henderson RH, Waseem N, Searle R, van der Spuy J, Russell-Eggitt I, Bhattacharya SS, Thompson DA, Holder GE, Cheetham 45 ME, Webster AR, Moore AT. 2007. An assessment of the apex microarray technology in genotyping patients with 46 Leber congenital amaurosis and early-onset severe retinal dystrophy. Invest Ophthalmol Vis Sci 48(12):5684-9. 47 Hsiao YC, Tong ZJ, Westfall JE, Ault JG, Page-McCaw PS, Ferland RJ. 2009. Ahi1, whose human ortholog is mutated in Joubert syndrome, is required for Rab8a localization, ciliogenesis and vesicle trafficking. Hum Mol Genet 48 18(20):3926-41. 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 19 of 63 Human Mutation

18 Coppieters et al. 1 2 Janecke AR, Thompson DA, Utermann G, Becker C, Hubner CA, Schmid E, McHenry CL, Nair AR, Ruschendorf F, 3 Heckenlively J, Wissinger B, Nurnberg P, Gal A. 2004. Mutations in RDH12 encoding a photoreceptor cell retinol 4 dehydrogenase cause childhood-onset severe retinal dystrophy. Nat Genet 36(8):850-4. Keen TJ, Mohamed MD, McKibbin M, Rashid Y, Jafri H, Maumenee IH, Inglehearn CF. 2003. Identification of a locus 5 (LCA9) for Leber's congenital amaurosis on chromosome 1p36. Eur J Hum Genet 11(5):420-3. 6 Khanna H, Davis EE, Murga-Zamalloa CA, Estrada-Cuzcano A, Lopez I, den Hollander AI, Zonneveld MN, Othman MI, 7 Waseem N, Chakarova CF, Maubaret C, Diaz-Font A, Macdonald I, Muzny DM, Wheeler DA, Morgan M, Lewis LR, Logan CV, Tan PL, Beer MA, Inglehearn CF, Lewis RA, Jacobson SG, Bergmann C, Beales PL, Attie-Bitach T, 8 Johnson CA, Otto EA, Bhattacharya SS, Hildebrandt F, Gibbs RA, Koenekoop RK, Swaroop A, Katsanis N. 2009. A 9 common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies. Nat Genet. 10 Kim J, Krishnaswami SR, Gleeson JG. 2008. CEP290 interacts with the centriolar satellite component PCM-1 and is required for Rab8 localization to the primary cilium. Hum Mol Genet 17(23):3796-805. 11 Koenekoop RK, Fishman GA, Iannaccone A, Ezzeldin H, Ciccarelli ML, Baldi A, Sunness JS, Lotery AJ, Jablonski MM, 12 Pittler SJ, Maumenee I. 2002. Electroretinographic abnormalities in parents of patients with Leber congenital 13 amaurosis who have heterozygous GUCY2D mutations. Arch Ophthalmol 120(10):1325-30. Koenekoop RK, Lopez I, den Hollander AI, Allikmets R, Cremers FP. 2007. Genetic testing for retinal dystrophies and 14 dysfunctions: benefits, dilemmas and solutions. Clin Experiment Ophthalmol 35(5):473-85. 15 Kroes HY, van Zon PH, Fransen van de Putte D, Nelen MR, Nievelstein RJ, Wittebol-Post D, van Nieuwenhuizen O, Mancini 16 GM, van der Knaap MS, Kwee ML, Maas SM, Cobben JM, De Nef JE, Lindhout D, Sinke RJ. 2008. DNA analysis of AHI1, NPHP1 and CYCLIN D1 in Joubert syndrome patients from the Netherlands. Eur J Med Genet 51(1):24-34. 17 Lee SA, Belyaeva OV, Popov IK, Kedishvili NY. 2007. Overproduction of bioactive retinoic acid in cells expressing disease- 18 associated mutants of retinol dehydrogenaseFor 12. PeerJ Biol Chem 282(49):35621-8. Review 19 Leigh MW, Pittman JE, Carson JL, Ferkol TW, Dell SD, Davis SD, Knowles MR, Zariwala MA. 2009. Clinical and genetic aspects of primary ciliary dyskinesia/Kartagener syndrome. Genet Med 11(7):473-87. 20 Leitch CC, Zaghloul NA, Davis EE, Stoetzel C, Diaz-Font A, Rix S, Al-Fadhel M, Lewis RA, Eyaid W, Banin E, Dollfus H, 21 Beales PL, Badano JL, Katsanis N. 2008. Hypomorphic mutations in syndromic encephalocele genes are associated 22 with Bardet-Biedl syndrome. Nat Genet 40(4):443-8. 23 Li D, Roberts R. 2001. WD-repeat proteins: structure characteristics, biological function, and their involvement in human diseases. Cell Mol Life Sci 58(14):2085-97. 24 Li Y, Wang H, Peng J, Gibbs RA, Lewis RA, Lupski JR, Mardon G, Chen R. 2009. Mutation survey of known LCA genes and 25 loci in the Saudi Arabian population. Invest Ophthalmol Vis Sci 50(3):1336-43. 26 Lotery AJ, Jacobson SG, Fishman GA, Weleber RG, Fulton AB, Namperumalsamy P, Heon E, Levin AV, Grover S, Rosenow JR, Kopp KK, Sheffield VC, Stone EM. 2001. Mutations in the CRB1 gene cause Leber congenital amaurosis. Arch 27 Ophthalmol 119(3):415-20. 28 Lotery AJ, Namperumalsamy P, Jacobson SG, Weleber RG, Fishman GA, Musarella MA, Hoyt CS, Heon E, Levin A, Jan J, 29 Lam B, Carr RE, Franklin A, Radha S, Andorf JL, Sheffield VC, Stone EM. 2000. Mutation analysis of 3 genes in patients with Leber congenital amaurosis. Arch Ophthalmol 118(4):538-43. 30 Louie CM, Caridi G, Lopes VS, Brancati F, Kispert A, Lancaster MA, Schlossman AM, Otto EA, Leitges M, Grone HJ, Lopez 31 I, Gudiseva HV, O'Toole JF, Vallespin E, Ayyagari R, Ayuso C, Cremers FP, den Hollander AI, Koenekoop RK, 32 Dallapiccola B, Ghiggeri GM, Hildebrandt F, Valente EM, Williams DS, Gleeson JG. 2010. AHI1 is required for photoreceptor outer segment development and is a modifier for retinal degeneration in nephronophthisis. Nat Genet Deleted : . 33 42(2):175-80. 34 Maguire AM, High KA, Auricchio A, Wright JF, Pierce EA, Testa F, Mingozzi F, Bennicelli JL, Ying GS, Rossi S, Fulton A, 35 Marshall KA, Banfi S, Chung DC, Morgan JI, Hauck B, Zelenaia O, Zhu X, Raffini L, Coppieters F, De Baere E, Shindler KS, Volpe NJ, Surace EM, Acerra C, Lyubarsky A, Redmond TM, Stone E, Sun J, McDonnell JW, Leroy 36 BP, Simonelli F, Gauderman JB. 2009. Age-dependent effects of RPE65 gene therapy for Leber's congenital 37 amaurosis: a phase 1 dose-escalation trial. Lancet 374(9701):1597-605. Deleted : . 38 Maguire AM, Simonelli F, Pierce EA, Pugh EN, Jr., Mingozzi F, Bennicelli J, Banfi S, Marshall KA, Testa F, Surace EM, Rossi S, Lyubarsky A, Arruda VR, Konkle B, Stone E, Sun J, Jacobs J, Dell'Osso L, Hertle R, Ma JX, Redmond TM, 39 Zhu X, Hauck B, Zelenaia O, Shindler KS, Maguire MG, Wright JF, Volpe NJ, McDonnell JW, Auricchio A, High 40 KA, Bennett J. 2008. Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med 41 358(21):2240-8. Marlhens F, Bareil C, Griffoin JM, Zrenner E, Amalric P, Eliaou C, Liu SY, Harris E, Redmond TM, Arnaud B, Claustres M, 42 Hamel CP. 1997. Mutations in RPE65 cause Leber's congenital amaurosis. Nat Genet 17(2):139-41. 43 Morimura H, Fishman GA, Grover SA, Fulton AB, Berson EL, Dryja TP. 1998. Mutations in the RPE65 gene in patients with 44 autosomal recessive retinitis pigmentosa or leber congenital amaurosis. Proc Natl Acad Sci U S A 95(6):3088-93. Perrault I, Delphin N, Hanein S, Gerber S, Dufier JL, Roche O, Defoort-Dhellemmes S, Dollfus H, Fazzi E, Munnich A, 45 Kaplan J, Rozet JM. 2007. Spectrum of NPHP6/CEP290 mutations in Leber congenital amaurosis and delineation of 46 the associated phenotype. Hum Mutat 28(4):416. 47 Perrault I, Hanein S, Gerber S, Barbet F, Ducroq D, Dollfus H, Hamel C, Dufier JL, Munnich A, Kaplan J, Rozet JM. 2004. 48 Retinal dehydrogenase 12 (RDH12) mutations in leber congenital amaurosis. Am J Hum Genet 75(4):639-46. 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 20 of 63

Genetic screening of LCA in Belgium 19

1 2 Perrault I, Rozet JM, Calvas P, Gerber S, Camuzat A, Dollfus H, Chatelin S, Souied E, Ghazi I, Leowski C, Bonnemaison M, 3 Le Paslier D, Frezal J, Dufier JL, Pittler S, Munnich A, Kaplan J. 1996. Retinal-specific guanylate cyclase gene 4 mutations in Leber's congenital amaurosis. Nat Genet 14(4):461-4. Rivolta C, Peck NE, Fulton AB, Fishman GA, Berson EL, Dryja TP. 2001. Novel frameshift mutations in CRX associated with 5 Leber congenital amaurosis. Hum Mutat 18(6):550-1. 6 Sayer JA, Otto EA, O'Toole JF, Nurnberg G, Kennedy MA, Becker C, Hennies HC, Helou J, Attanasio M, Fausett BV, Utsch 7 B, Khanna H, Liu Y, Drummond I, Kawakami I, Kusakabe T, Tsuda M, Ma L, Lee H, Larson RG, Allen SJ, Wilkinson CJ, Nigg EA, Shou C, Lillo C, Williams DS, Hoppe B, Kemper MJ, Neuhaus T, Parisi MA, Glass IA, 8 Petry M, Kispert A, Gloy J, Ganner A, Walz G, Zhu X, Goldman D, Nurnberg P, Swaroop A, Leroux MR, 9 Hildebrandt F. 2006. The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates 10 transcription factor ATF4. Nat Genet 38(6):674-81. Seong MW, Kim SY, Yu YS, Hwang JM, Kim JY, Park SS. 2008. Molecular characterization of Leber congenital amaurosis in 11 Koreans. Mol Vis 14:1429-36. 12 Shu X, Black GC, Rice JM, Hart-Holden N, Jones A, O'Grady A, Ramsden S, Wright AF. 2007. RPGR mutation analysis and 13 disease: an update. Hum Mutat 28(4):322-8. Simonelli F, Ziviello C, Testa F, Rossi S, Fazzi E, Bianchi PE, Fossarello M, Signorini S, Bertone C, Galantuomo S, Brancati 14 F, Valente EM, Ciccodicola A, Rinaldi E, Auricchio A, Banfi S. 2007. Clinical and molecular genetics of Leber's 15 congenital amaurosis: a multicenter study of Italian patients. Invest Ophthalmol Vis Sci 48(9):4284-90. 16 Simovich MJ, Miller B, Ezzeldin H, Kirkland BT, McLeod G, Fulmer C, Nathans J, Jacobson SG, Pittler SJ. 2001. Four novel mutations in the RPE65 gene in patients with Leber congenital amaurosis. Hum Mutat 18(2):164. 17 Sohocki MM, Bowne SJ, Sullivan LS, Blackshaw S, Cepko CL, Payne AM, Bhattacharya SS, Khaliq S, Qasim Mehdi S, Birch 18 DG, Harrison WR, Elder FF, ForHeckenlively JR, PeerDaiger SP. 2000a. Mutations Review in a new photoreceptor-pineal gene on 19 17p cause Leber congenital amaurosis. Nat Genet 24(1):79-83. Sohocki MM, Perrault I, Leroy BP, Payne AM, Dharmaraj S, Bhattacharya SS, Kaplan J, Maumenee IH, Koenekoop R, Meire 20 FM, Birch DG, Heckenlively JR, Daiger SP. 2000b. Prevalence of AIPL1 mutations in inherited retinal degenerative 21 disease. Mol Genet Metab 70(2):142-50. 22 Stone EM. 2007. Leber congenital amaurosis - a model for efficient genetic testing of heterogeneous disorders: LXIV Edward 23 Jackson Memorial Lecture. Am J Ophthalmol 144(6):791-811. Sundaresan P, Vijayalakshmi P, Thompson S, Ko AC, Fingert JH, Stone EM. 2009. Mutations that are a common cause of 24 Leber congenital amaurosis in northern America are rare in Southern India. Mol Vis 15:1781-7. 25 Swain PK, Chen S, Wang QL, Affatigato LM, Coats CL, Brady KD, Fishman GA, Jacobson SG, Swaroop A, Stone E, Sieving 26 PA, Zack DJ. 1997. Mutations in the cone-rod homeobox gene are associated with the cone-rod dystrophy photoreceptor degeneration. Neuron 19(6):1329-36. 27 Thompson DA, Li Y, McHenry CL, Carlson TJ, Ding X, Sieving PA, Apfelstedt-Sylla E, Gal A. 2001. Mutations in the gene 28 encoding lecithin retinol acyltransferase are associated with early-onset severe retinal dystrophy. Nat Genet 29 28(2):123-4. Tory K, Lacoste T, Burglen L, Moriniere V, Boddaert N, Macher MA, Llanas B, Nivet H, Bensman A, Niaudet P, Antignac C, 30 Salomon R, Saunier S. 2007. High NPHP1 and NPHP6 mutation rate in patients with Joubert syndrome and 31 nephronophthisis: potential epistatic effect of NPHP6 and AHI1 mutations in patients with NPHP1 mutations. J Am 32 Soc Nephrol 18(5):1566-75. Travaglini L, Brancati F, Attie-Bitach T, Audollent S, Bertini E, Kaplan J, Perrault I, Iannicelli M, Mancuso B, Rigoli L, Rozet 33 JM, Swistun D, Tolentino J, Dallapiccola B, Gleeson JG, Valente EM, Zankl A, Leventer R, Grattan-Smith P, 34 Janecke A, D'Hooghe M, Sznajer Y, Van Coster R, Demerleir L, Dias K, Moco C, Moreira A, Kim CA, Maegawa G, 35 Petkovic D, Abdel-Salam GM, Abdel-Aleem A, Zaki MS, Marti I, Quijano-Roy S, Sigaudy S, de Lonlay P, Romano S, Touraine R, Koenig M, Lagier-Tourenne C, Messer J, Collignon P, Wolf N, Philippi H, Kitsiou Tzeli S, 36 Halldorsson S, Johannsdottir J, Ludvigsson P, Phadke SR, Udani V, Stuart B, Magee A, Lev D, Michelson M, Ben- 37 Zeev B, Fischetto R, Benedicenti F, Stanzial F, Borgatti R, Accorsi P, Battaglia S, Fazzi E, Giordano L, Pinelli L, 38 Boccone L, Bigoni S, Ferlini A, Donati MA, Caridi G, Divizia MT, Faravelli F, Ghiggeri G, Pessagno A, Briguglio M, Briuglia S, Salpietro CD, Tortorella G, Adami A, Castorina P, Lalatta F, Marra G, Riva D, Scelsa B, Spaccini L, 39 Uziel G, Del Giudice E, Laverda AM, Ludwig K, Permunian A, Suppiej A, Signorini S, Uggetti C, Battini R, Di 40 Giacomo M, Cilio MR, Di Sabato ML, Leuzzi V, Parisi P, Pollazzon M, Silengo M, De Vescovi R, Greco D, 41 Romano C, Cazzagon M, Simonati A, Al-Tawari AA, Bastaki L, Megarbane A, Sabolic Avramovska V, de Jong MM, Stromme P, Koul R, Rajab A, Azam M, Barbot C, Martorell Sampol L, Rodriguez B, Pascual-Castroviejo I, 42 Teber S, Anlar B, Comu S, Karaca E, Kayserili H, Yuksel A, Akcakus M, Al Gazali L, Sztriha L, Nicholl D, Woods 43 CG, Bennett C, Hurst J, Sheridan E, Barnicoat A, Hennekam R, Lees M, Blair E, Bernes S, Sanchez H, Clark AE, 44 DeMarco E, Donahue C, Sherr E, Hahn J, Sanger TD, Gallager TE, Dobyns WB, Daugherty C, Krishnamoorthy KS, Sarco D, Walsh CA, McKanna T, Milisa J, Chung WK, De Vivo DC, Raynes H, Schubert R, Seward A, Brooks DG, 45 Goldstein A, Caldwell J, Finsecke E, Maria BL, Holden K, Cruse RP, Swoboda KJ, Viskochil D. 2009. Expanding 46 CEP290 mutational spectrum in ciliopathies. Am J Med Genet A 149A(10):2173-80. 47 Tsang WY, Bossard C, Khanna H, Peranen J, Swaroop A, Malhotra V, Dynlacht BD. 2008. CP110 suppresses primary cilia 48 formation through its interaction with CEP290, a protein deficient in human ciliary disease. Dev Cell 15(2):187-97. 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 21 of 63 Human Mutation

20 Coppieters et al. 1 2 Valente EM, Brancati F, Silhavy JL, Castori M, Marsh SE, Barrano G, Bertini E, Boltshauser E, Zaki MS, Abdel-Aleem A, 3 Abdel-Salam GM, Bellacchio E, Battini R, Cruse RP, Dobyns WB, Krishnamoorthy KS, Lagier-Tourenne C, Magee 4 A, Pascual-Castroviejo I, Salpietro CD, Sarco D, Dallapiccola B, Gleeson JG. 2006a. AHI1 gene mutations cause specific forms of Joubert syndrome-related disorders. Ann Neurol 59(3):527-34. 5 Valente EM, Silhavy JL, Brancati F, Barrano G, Krishnaswami SR, Castori M, Lancaster MA, Boltshauser E, Boccone L, Al- 6 Gazali L, Fazzi E, Signorini S, Louie CM, Bellacchio E, Bertini E, Dallapiccola B, Gleeson JG. 2006b. Mutations in 7 CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome. Nat Genet 38(6):623-5. Vallespin E, Cantalapiedra D, Riveiro-Alvarez R, Wilke R, Aguirre-Lamban J, Avila-Fernandez A, Lopez-Martinez MA, 8 Gimenez A, Trujillo-Tiebas MJ, Ramos C, Ayuso C. 2007a. Mutation screening of 299 Spanish families with retinal 9 dystrophies by Leber congenital amaurosis genotyping microarray. Invest Ophthalmol Vis Sci 48(12):5653-61. 10 Vallespin E, Lopez-Martinez MA, Cantalapiedra D, Riveiro-Alvarez R, Aguirre-Lamban J, Avila-Fernandez A, Villaverde C, Trujillo-Tiebas MJ, Ayuso C. 2007b. Frequency of CEP290 c.2991_1655A>G mutation in 175 Spanish families 11 affected with Leber congenital amaurosis and early-onset retinitis pigmentosa. Mol Vis 13:2160-2. 12 Walia S, Fishman GA, Jacobson SG, Aleman TS, Koenekoop RK, Traboulsi EI, Weleber RG, Pennesi ME, Heon E, Drack A, 13 Lam BL, Allikmets R, Stone EM. 2010. Visual Acuity in Patients with Leber's Congenital Amaurosis and Early Childhood-Onset Retinitis Pigmentosa. Ophthalmology 117(6):1190-8. Deleted : . 14 Wang H, den Hollander AI, Moayedi Y, Abulimiti A, Li Y, Collin RW, Hoyng CB, Lopez I, Bray M, Lewis RA, Lupski JR, 15 Mardon G, Koenekoop RK, Chen R. 2009. Mutations in SPATA7 cause Leber congenital amaurosis and juvenile 16 retinitis pigmentosa. Am J Hum Genet 84(3):380-7. Yzer S, Leroy BP, De Baere E, de Ravel TJ, Zonneveld MN, Voesenek K, Kellner U, Ciriano JP, de Faber JT, Rohrschneider 17 K, Roepman R, den Hollander AI, Cruysberg JR, Meire F, Casteels I, van Moll-Ramirez NG, Allikmets R, van den 18 Born LI, Cremers FP. 2006. ForMicroarray-based Peermutation detection and Review phenotypic characterization of patients with 19 Leber congenital amaurosis. Invest Ophthalmol Vis Sci 47(3):1167-76. Zernant J, Kulm M, Dharmaraj S, den Hollander AI, Perrault I, Preising MN, Lorenz B, Kaplan J, Cremers FP, Maumenee I, 20 Koenekoop RK, Allikmets R. 2005. Genotyping microarray (disease chip) for Leber congenital amaurosis: detection 21 of modifier alleles. Invest Ophthalmol Vis Sci 46(9):3052-9. 22 23

24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 22 of 63

Genetic screening of LCA in Belgium 21

1 2 SUPPLEMENTARY MATERIAL 3 Supplementary Table S1 4 5 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 6 7 CEP290 Exon 2 tttgtggcccaattgtctg ccacctaagtaaacagaaaagcaac 8 9 Exon 3 ccaaggtgcttaattggtca tttcccctacacaccctttt 10 11 Exon 4 tttactgaacgtctccatgtgc tggcagatccataaaataggag 12 Exon 5 ttctagactcctattttatggatctgc ttcacaaccatatgctcagtcc 13 14 Exon 6 atctgcactgaagtataatgc tggtgatgacaaaatgaaca 15 16 Exon 7 ggtgggagaattgcttgaac acccgcatagacctgagatg 17 18 Exon 8 For ttggttctactgagccaaataatg Peer Review tctgaaggtaaccaaacacaaca 19 Exon 9 ggtgaggctttaagtgtggtg cttaatgaccaagacaggcaaa 20 21 Exon 10 tggtcaatgccaattagtaaagg gtgaggtgattggagaaacaca 22 23 Exon 11 ttccaggatgacttcaatgataaa aactcattgatgtgaaagaggtca 24 25 Exon 12 cagagattatgccagtagttgctc ttgggaccaggtggtagaag 26 27 Exon 13 aaaaggcatacttgtacccaca tccatcatttacaaatgtaagcac 28 Exon 14 aatggcataccacttttcttgc tggcaaaaagtaaatgctcaaag 29 30 Exon 15 gcatatgtacattttcctttagac actccaaccccataaaatct 31 32 Exon 16 tcacagaaagttacctcattcttc cctctttcttgagccatttg 33 34 Exon 17 tgtaggccttgaaccaaagac ttcaggactgaacccactgac 35 Exon 18 ggatcacgaggtcagaagat aaatgagaagcttgtattggct 36 37 Exon 19 gggattaagatcaccatctgc acagcaaggcaaatcaactg 38 39 Exon 20 aactcaactattcacgttggattt ttgaaagcagctcaagaaaaac 40 41 Exon 21 tatcatgcttggcaatgaa tcttataaggcacttattttccac 42 Exon 22 ggcatttctaagcagaaactgaa atctgcatgctttggtgatg 43 44 Exon 23 tgtgttgcttacagatttggtga caggataatcccaggcttaatg 45 46 Exon 24 tgataactttgttgccttgcat tccgaatccatctgaagagc 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 23 of 63 Human Mutation

22 Coppieters et al. 1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 25 gatcaagtccaacaagatgc cagaagaagcaattatgacaaa 5 6 Exon 26 tgcatgtttttcttacatgg aaatgcaggcaaactttaat 7 cattagaaagtcctaggcaagagacat 8 Intron 26 agtaaggaggatgtaagactggagatagag 9 c 10 Exon 27 ggacacagccaaaccatatc caggattattcatctgcctaagtt 11 12 Exon 28 tccatggaactataatgctttc tctgctttccttttaaacaattc 13 14 Exon 29 tttaccctccttcagtctgttc ttaaccctgttaaaaccgatct 15 16 Exon 30 gcaaacatgataacctctgatgg ctgggcaacagaatgagacc 17 Exon 31_1 agttccagctatgtttgcac ctcgtttggagggaagaaac 18 For Peer Review 19 Exon 31_2 ccaagggtaaagctccacta ttgtagatctcatgtgccact 20 21 Exon 32 caggagaatggcatgaacc atcattatcatcaatggaggaatgt 22 23 Exon 33 tcacctctctgagtttgtatt cagttgcagcattgagagtaa 24 Exon 34 atcttgtttgttactctgtagcat tggctattagaaacattataggag 25 26 Exon 35_1 aagcatgcaaataactgctgtc accttgcttgcatgtttgc 27 28 Exon 35_2 aatcaatgaactgaggcttcg ggtgtaatccaatcacatgcaa 29 30 Exon 36 gaggggacatgcataccagt cggtgagctacaggaggaag 31 32 Exon 37 tttgatcatttgaggaaccaaa ccagcagtcctgaggataaa 33 Exon 38 gttgcagtcagccgagattg actttttattacaacacggagat 34 35 Exon 39 ttcaatgtggaaagaattgagtg tgtctagccaccaacagtgc 36 37 Exon 40_1 tcctcaaggtagacttgacatgaa ttgccttttcagttcatcattc 38 39 Exon 40_2 ctactacctctatattgtaaatcagaca ttgtgggtgtttgttgaaga 40 Exon 41 aaaatgcagaagcagctacca ttcaatactgcttatagtcctcaa 41 42 Exon 42 tcaacctgtatagcaaaatgaaca cgagatcacaggaaaatcca 43 44 Exon 43 tggattttcctgtgatctcg tcaattcacatgggaaaagaaa 45 46 Exon 44 catttaaaggaggccttcagtg tgagaaagatgtaatgcttttgg 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 24 of 63

Genetic screening of LCA in Belgium 23

1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 45 ggctttcaccagaacactcc ggccttcaacaaataaatgct 5 6 Exon 46 tgcatcaggcaataatgtgg cagatgcagaataaacactgaaa 7 8 Exon 47_1 gctgcatgattttaggaatgtc caatttttcattttcctgctca 9 Exon 47_2 tggtagaagtggaaagacaatcc cccttagccttgcctctcat 10 11 Exon 48 aacgttgggaacttcgttct tggtggaatgtgatgacagc 12 13 Exon 49 aggaagaaaccaggttatcca ttgaatacactgaatctatgagaaca 14 15 Exon 50 ttgccaccactttttaatgc ggggtgcccttcagttagat 16 17 Exon 51 tgcttgtctctagttgtagca ctaggacaatgccagttatgc 18 Exon 52 For cgtgaaggcttttgtattcca Peer Review aagacccaaagcttatcaggaa 19 20 Exon 53 ggagggaggcagcattaagt tgttaggaatagtcagatgaaca 21 22 Exon 54 tgcctttattgctgtatttgacc tcggagaactgcttatttcca 23 24 CRB1 Exon 1 atgaatccaatccagcctga tgactgttcacattgactgg 25 Exon 2_1 gttgaggcagcacaaaggtc gctcctttctcctggggtg 26 27 Exon 2_2 caatccctgtcaaggaagtg ggagtaaccatcaattccatc 28 29 Exon 2_3 gagtgtgcttccagcccttg gagctaactacaccatctgtg 30 31 Exon 3 ctctggtaaacaaagcattgtc cagggagttctaagccaatc 32 33 Exon 4 agtaagatgatgccatgggt tcatttgctataagcgatatgtgt 34 Exon 5 gacttagcagcttctctgaatt gtcaagtcatatcccatctcc 35 36 Exon 6_1 cctgagctattcatgcacttc gaagtgagggatgcatgttcc 37 38 Exon 6_2 gatattctcctgggctgtacc gaagagccattggctgaacag 39 40 Exon 6_3 ggctcagtttgtaacatagcc ggagtcgtcgattaaggtaag 41 Exon 6_4 ccagcgatggagagtggca ctacaaacgaaggtgtggatg 42 43 Exon 6_5 ggtgttgctctgcttaacttc ctgctctgctctgaggcatg 44 45 Exon 7_1 gtcttccatcccttctgtct tttgggagagtttggagtca 46 47 Exon 7_2 agatttggccaggatgactc aggccaccaatgtagatgac 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 25 of 63 Human Mutation

24 Coppieters et al. 1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 7_3 gactgaacttaatggtggattc ggtgggtcagtaacatcatc 5 6 Exon 8 cagatatgtggtttcaccgtc gtcgcaacttaactggtgag 7 8 Exon 9_1 caatgatcattactattaataacgg gtgccatcattcactgactgc 9 Exon 9_2 tcaattgcaaagtggcaaca ttaactgcaaacagccagtg 10 11 Exon 9_3 caatataaagggcctgcaagg ctgcaactctgtcagagcag 12 13 Exon 9_4 cactgtgaactcaacatcgatg cagtgatgcagagtatagcttc 14 15 Exon 10 gaacaagatgaacagctgtgg gctcagaattctcttccagaag 16 17 Exon 11 ccaatgtattcaacagggacc caactggctcgtcattcatac 18 Exon 12 For cctttgctatagaattcgcatc Peer Review gtacagtcatcacattcacag 19 20 Exon 1 ctcaagactgcttccaaacc tcccaaagccataactcctt 21 22 Exon 2 ctatctctgcggactttgag ggaagccagagaagagagac 23 24 Exon 3 cccaaggcagggataagaag ctaggccctactttgaggag 25 Exon 4 ttgtcagtaacctctactcctc atggccattctaagctcca 26 27 Exon 5 ggcttgaaaattactggactg ctgaacatcacctagcactg 28 29 Exon 6 cctagggacaaaggtataatg cacaatacagtaactttctcac 30 31 Exon 7 gtatcaaaggtaggcaaagca cgtttccaaatctgctgcta 32 RPE65 33 Exon 8 gtggcttgagaatcagccct catcttcttcagaatcacaaac 34 Exon 9 caagtttgtgattctgaagaag ccgtaatttccaggaacaatg 35 36 Exon 10 cattgcctgtgctcatgtttg cctgagagagatgaaacattc 37 38 Exon 11 gaattctttcctgctcactgag gagcacatgcttaggaaaactc 39 40 Exon 12 caaagatgggttctgatggg cctcgtcaaggtgagatga 41 Exon 13 acgaactaacatacagaactgc tcactttgttccagatagggt 42 43 Exon 14 gacattcaatctatagcttggg gcagacctgaagctgattttc 44 45 GUCY2D Exon 2_1 catgggttactcgggcttg gagaagatggggtcgcaag 46 47 Exon 2_2 atcatcccatgggttactcg gcgatcccggcttctt 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 26 of 63

Genetic screening of LCA in Belgium 25

1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 2_3 tcgtgggtccggtgaa gtagtggatcgtgtcgaagg 5 6 Exon 3 ggacggcgccgcgagccaag tcccctctcccttgccttct 7 8 Exon 4 gtgggctgtgaccccgacc tggtccatggcgattgtctc 9 Exon 5 ctatcattcccagcctctcc ttgctgcagacttccatttc 10 11 Exon 6 gacggaacttggtgcccttgg ggaaggaaccaaatttacgga 12 13 Exon 7 ctcagcctgacctcaaccca tcctcctgagagtgcgcctc 14 15 Exon 8 gcattctgggacagtgagcc agaaaccgatggccacctag 16 17 Exon 9 ccccacattgccctgggcaga cctgcccccaggacgtcacc 18 Exon 10 For agcaggctgaggctgcctct Peer Review cccggtggatcctcgtctgc 19 20 Exon 11 ctttctctgagatggctcct tttagaggaaagagtgaggct 21 22 Exon 12 caggccagggtcagaggcagc ctcaggttgctgacaagcat 23 24 Exon 13 cagctttaccagcttccttc gcaggcagtgaggtcacctg 25 Exon 14 gaccggctgcttacaca gctggaggctggtgaag 26 27 Exon 15 ggcaatcgcttcgtgtactc gatgggctggagcctgggaa 28 29 Exon 16 ccccgaggccctacctaggt acctccccgtcttgtccccg 30 31 Exon 17 gcatctccacaggtccat agggtgagctgaggtttg 32 33 Exon 18 caaacctcagctcaccctt tctaagtcagaaagggatcgg 34 Exon 19 gatgacgtgggccctgccctccc cttgggtgggacgttctgcag 35 36 Exon 1 gcacacctggaatgttgaa aaaggtggatgggataggag 37 38 Exon 2 gggccttgaacagtgtgtct tttcccgaaacacagcagc 39 40 Exon 3 agtgagggagcaggattc tgcccatgatgcccgctgtc AIPL1 41 Exon 4 ctcctgcccagggaga gggagatgtgccacagg 42 43 Exon 5 aaagtccaggaaggctatgg taaggaacctgcagaccaag 44 45 Exon 6 ctgggaagggagctgtag aaaagtgacaccacgatcc 46 47 CRX Exon 2 gtgcacgtcaccccatggtgagtaac cagaggtcctccaagagatgaggcc 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 27 of 63 Human Mutation

26 Coppieters et al. 1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 3 gtagaagggcagggaatgt ctcctcccatcactctttgt 5 6 Exon 4_1 gctggatgcaaagtagacag ccatgggagaaaggtaggg 7 8 Exon 4_2 tctccgagctcctatttcag gatctaaactgcagggaagc 9 Exon 3 ggagaggagcagagaagcag gcttccagtgcaggtctttg 10 11 Exon 4 tcttagtgtgagctcgtgaagg ttctagtcagagcccccaag 12 13 Exon 5 cccagtcccaagctcactta tagtggggtggatgatggtt 14 15 RDH12 Exon 6 gggcaattatgcaggtctgt ccctggacattctccacatt 16 17 Exon 7 aattggttcacacccagaaga tgacttcccaagttgctgtg 18 Exon 8 For tcctgagtccctccttctca Peer Review tcatcaggcacaaactcagc 19 20 Exon 9 gggaccataaagatttccaga ctttagggttggccttctcc 21 22 RPGRIP1 Exon 1 tgctgagaaattcctgctacaa tctgtgaaggccagcaagat 23 24 Exon 2 tgagacatctaaagggttcaaaaa cagtctatcgacatgtttggc 25 Exon 3 tgtactggggacagaaggcta aaacgtggctggcacatc 26 27 Exon 4 cagcccttcatgttccagtt ttccctgatcatgctgaaaa 28 29 Exon 5 ccaaggttactgattcacttaatttc cctctgagatggaggaaagg 30 31 Exon 6 cgtgatgagaaatgggagaaa cgagttgtgaggcttggatt 32 33 Exon 7 agtgtgctaagtaacagtacct atttgctccagcaataggc 34 Exon 8 caaagtcattctttgtgacatctg ggagcttcgtttttgtcattt 35 36 Exon 9 ggaaaatcctcattaatcccaat attgagtaccaatttccccata 37 38 Exon 10 aggtccaggagatgctgaaa ggatcaagtgaggggattaaa 39 40 Exon 11 ttttgttttcggagtgcaag gttttctaatctcatcatcttccc 41 Exon 12 agtttctgctgctggcattt ggacagccattgtgtgtttg 42 43 Exon 13 gggtctgcaaggaaatcaaa atgagaggcacccttcttga 44 45 Exon 14 cacaacttggacttccacca ggggaatacagatggtgtgg 46 47 Exon 15 agcaccaatgcagaatttcc gatgtagctcgctccaaagg 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 28 of 63

Genetic screening of LCA in Belgium 27

1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 16 gctcttcctcaccacagatcc tctgctctgttgctcttgaca 5 6 Exon 17 ggtgctgacaaatgctcact cacatgacactcacagaggga 7 8 Exon 18 tcccaaatccctttcttgtg tgtctgcttctgcttctgct 9 Exon 19 aaagaaggcaggaaggaagg cttgaaagcctgatctcgtg 10 11 Exon 20 tgaccagacagtggattgga tgcattttccatcagcttca 12 13 Exon 21 tgggttaattggatggcgta attcaccccacaaaaatcca 14 15 Exon 22 ccatgaataccactaatgaaagtct catcagcacaaaaccaaactc 16 17 Exon 23 aaatggaggcaagggaaaag gggataagatttcaatccactttg 18 Exon 24 For cattcatttagcatccccagt Peer Review ggtactggagaaaaatgcctttag 19 20 AHI1 Exon 1_1 agggcactgtcatgatctcc ggtaaacatgtcccgctgtg 21 22 Exon 1_2 tcagtgccatcagaacagact ggctggactggcaacaatg 23 24 Exon 1_3 cacagcgggacatgtttacc ggcaggagaattgcttgacc 25 Exon 1_4 ggaacattgttgccagtcca cgtggcctttgagttcagtt 26 27 Exon 1_5 tctgggcatagcatcacaca atgctaacaatgtttgagaggca 28 29 Exon 2 tttgtccttgctgaccatgc ggccctagatcaaagcctca 30 31 Exon 3 tgggtgacacagcaagactc tggtcacatacctgaaagctga 32 33 Exon 4 actttgggtccttgtcccat agcaggtccctggtaaatgt 34 Exon 5 aactgtgcatgaggcaggt agcaaaccttgagacagcct 35 36 Exon 6 agagaaatgaagcataatggcct acacatcttgcgctattgct 37 38 Exon 7 tttgccctttaatgggatgtga tgacctatcatgtgtcctggt 39 40 Exon 8 tggtgcattccagttctttgg tgccatttgtttgggcaagt 41 Exon 9 aggtgtggtcatctggttca cccatcccagtttacatggc 42 43 Exon 10 aattgcggacacgaaagaca gaggagggtcagtggaatgt 44 45 Exon 11 tgtgttagcctccattaaacgc aaactccctgggctcttgg 46 47 Exon 12 actgccagatgttccttggt cagccctaaactgacgttactc 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 29 of 63 Human Mutation

28 Coppieters et al. 1 2 Gene Exon Forward primer (5’-3’) Reverse primer (5’-3’) 3 4 Exon 13 atgccacagtgcaaatggg acacatgtactgagaggctcat 5 6 Exon 14 gcccggccaccatattattc ggttcattggctgtgttggt 7 8 Exon 15 gcaccactggattctaccct tgtgctgcaaatgtctttggt 9 Exon 16 gctatcaactagccacattggac tggcagtgatggctttagagt 10 11 Exon 17 ggcctccagaactgtgagaa ggtgaagaagcagaaacaaagga 12 13 Exon 18 tcaactcctgctttaaatcaacctt gttcagcgtgaaatctggca 14 15 Exon 19 ggcatggctgtttgtgtctt atggaccctccctaactgaatg 16 Exon 20 cgtctcacttgattccacagc 17 tcatgttacccaggctggtc 18 Exon 21 For tgaggcagtagaatcgcttga Peer Review ggtttgctgttgtctggctt 19 20 Exon 22 gagatcgtgccactgcattc catttacttggcagcagggt 21 22 Exon 23 ggcagatgcccttaaatgtc tcttccactcttttggcaat 23 24 Exon 24 agcacaatgaaggaaagcca tcatcttgtagcaccgaatgtt 25 Exon 25 cctgtaggacagcactcaaga acaggctaggcacaccttag 26 27 Exon 26 ccttgtccatctgagtcccaa tcactgtgagtgtgctaccc 28 29 Exon 27 ggaatgctaaacgcagcaca gctgatagcgtagtgaccga 30 31 Exon 28 cgtcggtcactacgctatca tttccctgcgctagctacaa 32 33 Supplementary Table S1: Exon-flanking primers for the amplification of the human CEP290 , CRB1 , 34 RPE65 , GUCY2D , AIPL1 , CRX , RDH12 , RPGRIP1 and AHI1 genes and for the c.2991+1655A>G mutation 35 in CEP290 . 36 37 38

39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 30 of 63

HUMAN MUTATION M utation in B rief #____ ( 20 XX) O nline 1 2 MUTATION IN BRIEF 3 HUMAN MUTATION 4 Supplementary Table S2 5 6 PolyPhen SIFT Nucleotide Amino acid Domain/ PSIC Median Grantham Nucleotide Amino acid 7 Gene Remarks change change Region Prediction score Prediction Score sequence score conservation conservation 8 difference conservation 9 Moderately Affect Weakly p.Leu1694Pro Possibly conserved 10 CEP290 c.5081T>C Coiled coil 1.995 protein 0.00* 3.44 98 conserved UV damaging (considering function (score: 0.0) 11 12 species) 12 Highly Highly conserved, 13 p.Ala1566Pro Possibly CEP290 c.4696G>C Coiled coil For1.638 Peer Tolerated 0.10 Review 3.44 27 conserved up to Frog 14 UV damaging (score: 1.0) (considering 15 12 species) 16 Highly Disruption of EGF-like 8, Affect Highly conserved, annotated 17 Probably CRB1 c.929G>A p.Cys310Tyr extracellular 3.761 protein 0.00* 3.96 194 conserved up to Cow bond 18 damaging domain function (score: 1.0) (considering formation site 19 8 species) (PolyPhen) Laminin G- Weakly 20 Affect Highly p.Asp491Val like 1, conserved 21 CRB1 c.1472A>T Benign 1.410 protein 0.01* 3.96 152 conserved UV extracellular (considering function (score: 1.0) 22 domain 8 species) 23 Moderately Highly Probably conserved 24 RPE65 c.253C>T p.Arg85Cys 2.476 Tolerated 0.05 2.90 180 conserved damaging (considering 25 (score: 1.0) 18 species) 26 Highly Located next Affect Highly conserved, 27 Probably to metal ion RPE65 c.542C>T p.Pro181Leu 2.956 protein 0.04 2.90 98 conserved up to Fruitfly 28 damaging binding site function (score: 1.0) (considering (UniProtKB) 29 18 species) 30 Highly conserved, 31 Affect Weakly p.Glu196Val Extracellular Possibly up to 32 GUCY2D c.587A>T 1.650 protein 0.00* 4.32 121 conserved UV domain damaging Opossum function (score: 0.3) 33 (considering 34 10 species) 35 GUCY2D c.1724C>T p.Pro575Leu Cytoplasmic Benign 1.433 Affect 0.00* 4.32 98 Weakly Highly rs28743021 36 37 38 Received ; accepted revised manuscript . 39 40 41 42 © 2010 WILEY-LISS, INC. 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 31 of 63 Human Mutation

30 Coppieters et al. 1 2 PolyPhen SIFT Nucleotide Amino acid Domain/ PSIC Median Grantham Nucleotide Amino acid 3 Gene Remarks change change Region Prediction score Prediction Score sequence score conservation conservation 4 difference conservation 5 UV domain protein conserved conserved, 6 function (score: 0.0) up to 7 Opossum (considering 8 10 species) 9 Highly Protein conserved, 10 Affect Highly p.Pro711Leu kinase, Probably up to GUCY2D c.2132C>T 3.140 protein 0.00* 4.32 98 conserved 11 UV Cytoplasmic damaging Opossum function (score: 1.0) 12 domain (considering 13 10 species) For Peer Review Highly 14 conserved, Affect Highly 15 Cytoplasmic Probably up to GUCY2D c.2598G>C p.Lys866Asn 2.236 protein 0.00* 4.32 94 conserved domain damaging Opossum 16 function (score: 1.0) 17 (considering 10 species) 18 Moderately Weakly 19 p.Thr114Ile PPIase conserved AIPL1 c.341C>T Benign 0.179 Tolerated 0.13 3.34 89 conserved rs8069375 UV FKBP-type (considering 20 (score: 0.0) 21 12 species) Weakly Weakly 22 p.Pro376Ser conserved AIPL1 c.1126C>T Benign ? Tolerated 0.48 4.32 74 conserved 23 UV (considering (score: 0.0) 24 12 species) Highly 25 conserved, Affect Highly 26 p.Tyr142Cys up to Little CRX c.425A>G Benign 1.458 protein 0.00* 4.32 194 conserved rs61748442 UV brown bat 27 function (score: 1.0) 28 (considering 8 species) 29 Highly 30 Weakly conserved, p.Val242Met CRX c.724G>A Benign 1.033 Tolerated 0.20 4.32 21 conserved up to Dog RS61748459 31 UV (score: 0.2) (considering VAR_007949 32 8 species) 33 Prediction Highly Disruption of Affect Weakly Probably basis: conserved, annotated 34 RDH12 c.524C>T p.Ser175Leu protein 0.00* 3.61 145 conserved damaging sequence up to Fruitfly binding site 35 function (score: 0.2) annotation (considering (PolyPhen) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 32 of 63

Genetic screening of LCA in Belgium 31

1 2 PolyPhen SIFT Nucleotide Amino acid Domain/ PSIC Median Grantham Nucleotide Amino acid 3 Gene Remarks change change Region Prediction score Prediction Score sequence score conservation conservation 4 difference conservation 5 15 species) 6 Highly Affect Weakly conserved, 7 Probably RDH12 c.698T>A p.Val233Asp 2.616 protein 0.00* 3.60 152 conserved up to Fruitfly damaging 8 function (score: 0.0) (considering 9 15 species) Moderately 10 Affect Probably Highly conserved AHI1 c.2273A>C p.His758Pro WD 4 2.679 protein 0.03* 3.39 77 11 damaging conserved (considering function 12 (score: 1.0) 12 species) 13 Highly For Peer Review conserved, 14 Affect Highly Possibly up to AHI1 c.2433T>G p.Asn811Lys WD 5 1.719 protein 0.00* 3.39 94 conserved 15 damaging Tetraodon function (score: 1.0) 16 (considering 17 12 species) 18 Disruption of Prediction Weakly annotated Highly 19 Probably basis: conserved functional AHI1 c.3368C>T p.Ser1123Phe Tolerated 0.07 3.67 155 conserved damaging sequence (considering site (modified 20 (score: 0.9) 21 annotation 12 species) residue) (PolyPhen) 22 23 24 Supplementary Table S2: in-silico predictions of the novel missense variants and known unclassified variants identified in this study using the Alamut 25 software. 26 Alamut provides for each variant the HGVS nomenclature and a nucleotide conservation score which was computed at UCSC from 17 vertebrates and has a 27 range between 0 and 1 (http://genome.ucsc.edu/cgi-bin/hgTrackUi?g=multiz17way). For missense variants, Alamut calculates the Grantham distance and 28 automatically fills in queries for PolyPhen and SIFT prediction servers, based on the UniProt protein identifiers and FASTA sequences of several orthologs, 29 respectively. In addition, information on topological as well as functional domains and variations (VAR) was extracted from the UniProtKB database using the 30 following identifiers: O15078 ( CEP290 ), P82279 ( CRB1 ), Q16518 ( RPE65 ), Q02846 ( GUCY2D ), Q9NZN9 ( AIPL1 ), O43186 ( CRX ), Q96NR8 ( RDH12 ) and AHI1 31 Q8N157 ( ) (http://www.uniprot.org/uniprot/). Variants were designated as “unclassified variant (UV)” if no consensus was seen in all prediction programs used. *These substitutions may have been predicted to affect function just because the sequences used were not diverse enough. 32

33 34 35 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 33 of 63 Human Mutation

32 Coppieters et al. 1 2 Supplementary Table S3 – Part I 3 4 5 Patient Night Color Gene Gender Photophobia ERG Fundus aspect Other features 6 no Blindness vision 7 8 CEP290 Optic disc pallor 9 Absent p.[Cys998X]+ LCA-1 M Retinal vessel attenuation 10 (4mo) [Cys998X] Normal macula 11 Pigmentary retinopathy 12 Normal macula (6yrs) 13 CEP290 ForAbsent Peer ReviewRetinal vessel attenuation p.[Cys998X]+ LCA-2 M Mild Eyepoking 14 (5mo & 1.5yrs) Salt and pepper alterations [Cys998X] 15 Pseudopapilledema 16 HyperAF ring around macula 17 (14yrs) Normal optic discs 18 CEP290 Retinal vessel attenuation Absent + Eyepoking p.[Cys998X]+ LCA-3 M + + Normal peripheral retina 19 (4mo) (6yrs) Enophthalmos 20 [Arg108X ] Beginning of hyperAF around macula (6yrs) 21 CEP290 Retinal vessel attenuation Absent 22 p.[Cys998X(+ LCA-4 F Tapetal reflex of posterior pole (2yrs) 23 )Gln899X ] Pseudopapilledema CEP290 24 Absent Eyepoking p.[Cys998X(+ LCA-5 M (4mo) Enophthalmos 25 )Arg1465X] 26 Retinal vessel attenuation 27 White marbleized changes Macular oedema 28 (3.2yrs) 29 Retinal vessel attenuation CEP290 White marbleized around vascular arcade 30 Strong Severe CRD B/R and p.[Cys998X]+ LCA-6 F - Discrete RPE alterations Exotropia 31 (since 3.6yrs) (3.3yrs) G/R [Lys1575X] No macular reflex 32 (4.9yrs) 33 Extensive peripheral outer retinal atrophy 34 Limited spicular intraretinal pigmentation Relative macular preservation 35 Relatively darker perifoveal ring 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 34 of 63

Genetic screening of LCA in Belgium 33

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 (18yrs) 8 Peripheral salt and pepper intraretinal pigmentation 9 Relative macular preservation (22yrs) 10 Extensive midperipheral and peripheral outer retinal 11 atrophy Eyepoking Limited spicular intraretinal pigmentation Enophthalmos 12 Subnormal CEP290 (+) + Relative macular preservation Exotropia 13 + (1yr) p.[Cys998X(+ LCA-7 M (later in For Peer(early in ReviewDevelopment of synchysis scintillans Posterior SCP (early in life) Absent 14 )Lys1575X] life) life) (33yrs) cataract (star (21yrs) 15 More extensive intraretinal pigmentation (predominantly shaped) (49yrs) 16 spicular) Relative macular preservation 17 Hyper AF in central macula and mid- and far periphery 18 Extensive confluent atrophy 19 (49yrs) CEP290 20 Absent p.[Cys998X(+ LCA-8 F R/G Optic disc pallor (16yrs) 21 )Lys1575X] 22 CEP290 Severe 23 p.[Cys998X]+ LCA-9 M + CRD Marbleized retinal changes [Arg1782X ] (5mo & 1.2yrs) 24 CEP290 Nummular pigmentation 25 p.[Cys998X]+ LCA-10 F Pseudopapilledema [Asp128Glufs Deleted : ND 26 Maculopathy 27 X17 ] CEP290 28 p.[Cys998X]+ Absent Optic disc pallor Eyepoking LCA-11 M 29 [Glu146Glyfs (6mo) Yellow confluent peripheral spots Enophthalmos 30 X17 ] 31 CEP290 Retinal vessel attenuation p.[Cys998X(+ Peripheral pepper and salt alterations LCA-12 M Absent Enophthalmos 32 )Arg621IlefsX Macular RPE alterations 33 2] (6mo) CEP290 34 Absent Optic disc pallor p.[Cys998X(+ LCA-13 F (4mo) Retinal vessel attenuation 35 )Leu1141Phef 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 35 of 63 Human Mutation

34 Coppieters et al. 1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 sX5 ] 8 CEP290 Granular pigment alterations Eyepoking p.[Cys998X]+ Absent 9 LCA-14 F Normal macula Enophthalmos [Thr1334Ilefs (5mo) (7mo) Cataract 10 X2 ] 11 Retinal vessel attenuation LCA-15 CEP290 (7mo) 12 (Perrault, p.[Cys998X(+ Hyperaemic optic disc Eyepoking Field Code Changed 13 Delphin M - Absent )Glu1656Asnf For Peer ReviewMarbleized, white spots Enophthalmos et al. 14 sX3] Nummular pigmentation 2007) 15 (2yrs) 16 CEP290 p.[Cys998X]+ Absent 17 LCA-16 M Yellow spots Eyepoking [Ala1832Profs (6mo & 10mo) 18 X19] CEP290 Full optic disc with no apparent excavation 19 Absent p.[Cys998X]+ Marbleized fundus changes in the midperiphery 20 LCA-17 M (5mo) Eyepoking [Lys1840Argf Normal macula

21 sX5 ] (8yrs) 22 Full optic discs Eyepoking CEP290 Limited outer retinal atrophy Enophthalmos 23 p.[Cys998X]+ + Absent LCA-18 M Midperipheral salt and pepper alterations Keratoconus with 24 [Glu1956Glyf (early in life) (3mo) Normal macula acute hydrops sX9 ] 25 (15yrs) (OD>OS) (13yrs) 26 Very small optic disc excavation Retinal vessel attenuation 27 CEP290 Mild midperipheral salt and pepper alterations p.[Cys998X]+ Absent Eyepoking 28 LCA-19 M + + Bull’s eye maculopathy with preservation of central [Donor Splice (3mo) Enophthalmos 29 macula, surrounded by concentric area of more defect ] 30 pronounced outer retinal atrophy 31 (14yrs) Eyepoking Optic disc pallor 32 CEP290 LCA-20 Enophthalmos Retinal vessel attenuation p.[Cys998X(+ (Yzer, Absent Cataract with lens 33 F - - RPE alterations )Acceptor Leroy et (9yrs) luxation 34 maculopathy unknown Splice defect ] al. 2006) Keratoconus (OD) (3mo) 35 Enucleation because 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 36 of 63

Genetic screening of LCA in Belgium 35

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 of phacolytic 8 glaucoma (OD) 9 CEP290 p.[Cys998X]+ Optic disc pallor LCA-21 M + Absent 10 [Acceptor Retinal vessel attenuation 11 splice defect ] CEP290 12 Normal optic discs p.[Cys998X(+ Absent 13 LCA-22 M - - White retinal spots )Acceptor For(4mo &Peer 9mo) Review Tapetal reflex 14 Splice defect ] 15 Salt and pepper alterations Normal macula 16 CEP290 (5mo) p.[Cys998X(+ Absent Eyepoking 17 LCA-23 F Pinkish optic disc )Acceptor (5mo & 1.5yrs) Enophthalmos 18 Mild retinal vessel attenuation Splice defect ] 19 RPE alterations (yellowish dots) 20 (6yrs) CEP290 21 p.[Lys1575X( LCA-24 M 22 +)Lys1575X] 23 No RPE alterations (4mo) 24 Retinal vessel attenuation 25 Discrete RPE alterations CEP290 (1.10yrs) 26 Severe Eyepoking p.[Lys1575X] Retinal vessel attenuation LCA-25 M - Strong CRD Enophthalmos 27 +[ Ala1566Pro HyperAF ring around macula (1.1yrs) Exotropia 28 ] (8yrs) 29 Retinal vessel attenuation 30 Salt and pepper alterations Mild macular pigment epithelial alterations 31 (10yrs) 32 No retinal vessel attenuation CEP290 No hyperpigmentation 33 p.[ Leu1694Pr Absent LCA-26 - Midperipheral reticular aspect, especially around vascular Strabismus o]+[ =, splice (4.5yrs) 34 arcades site ] 35 Assymetric ectopia foveae OS>OD 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 37 of 63 Human Mutation

36 Coppieters et al. 1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 (3yrs) 8 Normal optic disc 9 Deep intraretinal white spots along vascular arcades HyperAF ring around macula 10 No pigmentation/atrophy 11 (5.4yrs) Optic disc pallor 12 CEP290 Subnormal LCA-27 M + No RPE alterations 13 p.Cys998X (5mo & 1yr & 7yrs) For Peer ReviewNormal macula Deleted : [ 14 CEP290 Absent Deleted : (+)?] p.[Trp7Cys]+[ SLS-1 F Abnormal RPE 15 (2mo) 16 Trp7Cys] CEP290 + Keratoconus 17 p.[Lys1575X( SLS-2 F + (12yrs) Cataract 18 +)Arg1465X] 19 CEP290 20 p.[Lys1575X( SLS-3 M Eyepoking +)Arg1465X] 21 CORS-1 22 CEP290 (Brancati Field Code Changed 23 p.[Lys1575X( , Barrano F Enophthalmos +)Arg1465X] et al. 24 2007) 25 CEP290 Optic disc pallor p.[Gln1265X] LCA-JS- Absent 26 M - Salt and pepper alterations +[Acceptor 1 (first year of life) 27 Mild spicular intraretinal pigmentation splice defect] 28 CEP290 Normal optic discs LCA-JS- 29 p.[ Thr2457Al F + + Absent Retinal vessel attenuation 2 II-1 30 afsX27 ]+[ Thr Salt and pepper alterations 2457AlafsX27 LCA-JS- M + Absent 31 ] 2 II-1 32 CEP290 p.[Leu2448Th Absent 33 LCA-JS- Optic disc pallor rfsX8(+) Acce M + (4mo & 1.4yrs) 34 3 Retinal vessel attenuation ptor splice 35 defect ] 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 38 of 63

Genetic screening of LCA in Belgium 37

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 CRB1 8 p.[Lys801X(+ LCA-28 M Marbleized fundus changes 9 )Lys801X] Optic disc pallor 10 Retinal vessel attenuation Eyepoking (mild) 11 LCA-29 Basic Perivascular fibrosis Enophthalmos CRB1 (Yzer, Absent Severe R-G No clear PPRPE (mild) 12 p.[Lys801X(+ M + Mild Leroy et (1yr & 30.6yrs) and B-Y Fine intraretinal white flecks Posterior 13 )Gln362X] al. 2006) For Peerdeficienty ReviewNummular intraretinal pigmentation subcapsular cataract 14 Macular atrophy (OS>OD) 15 (30.6yrs) 16 CRB1 p.[Lys801X]+ LCA-30 M 17 [Arg764Cys] 18 Retinal vessel attenuation 19 Outer retinal atrophy RPE defects around vascular arcade 20 Perimacular atrophic spots 21 (3mo) LCA-31 Normal optic discs 22 CRB1 Eyepoking (Yzer, Absent Perivascular fibrosis 23 p.[Lys801X]+ M + - Basic Enophthalmos Leroy et (3mo) No clear PPRPE [Cys896X] Exotropia 24 al. 2006) Outer retinal atrophy 25 Small white dots 26 Nummular hyperpigmentation Pseudopapilledema 27 Macular atrophy 28 (8yrs) Depigmentation around macula 29 Eyepoking (15yrs) 30 Enophthalmos Macular aplasia: vessels of choroid become apparent LCA-32 Esotropia 31 CRB1 - (17yrs) (Yzer, Keratoconus with p.[Lys801X(+ F + (+ after Normal optic disc 32 Leroy et acute hydrops and Deleted : Depigmentation around )Cys896X] keratoconus) Retinal vessel attenuation 33 al. 2006) rupture of Descemet macula¶ Perivascular fibrosis (15yrs)¶ membrane 34 No clear PPRPE (20yrs) 35 Outer retinal atrophy Deleted : 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 39 of 63 Human Mutation

38 Coppieters et al. 1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 White retinal spots 8 Peripheral intraretinal pigment migration, predominant 9 nummular Some midperipheral lipofuscin depositions 10 Macular aplasia 11 Pseudopapilledema 12 (33yrs) Pale and slightly swollen optic disc 13 CRB1 Diffuse outer retinal atrophy ForAbsent Peer Review 14 p.[Lys801X(+ LCA-33 F + Small whitish deep intraretinal flecks (9mo & 1.7yrs) 15 )Cys948Tyr] Nummular intraretinal pigmentation 16 Limited macular atrophy CRB1 Retinal vessel attenuation 17 p.[Lys801X]+ Absent Eyepoking LCA-34 F + Macular pigmentation 18 [Acceptor (4mo & 1.5yrs) Strabismus Pseudopapilledema 19 splice defect ] CRB1 20 p.[Cys948Tyr( LCA-35 F Keratoconus (OS) 21 +)Cys948Tyr] 22 Enophthalmos 23 Optic disc pallor Cataract CRB1 Retinal vessel attenuation Glaucoma 24 p.[Cys948Tyr( LCA-36 F Nummular intraretinal pigmentation (neovascular with 25 +)Glu1330X] Macular alterations OD seclusio pupillae 26 Coats reaction and anterior synechiae) 27 CRB1 28 p.[Cys948Tyr] LCA-37 M + 29 +[Splice 30 defect] Optic disc pallor with irregular shape 31 Retinal vessel attenuation CRB1 Basic Eyepoking 32 Peripheral salt and pepper alterations p.[Cys948Tyr] Absent (until 9yrs) Enophthalmos LCA-38 M + - (6yrs) Deleted : 33 +[Splice (9.1yrs) Disturbed Exotropia Retinal vessel attenuation with tortuous aspect defect] (after 9yrs) 34 Extensive peripheral and macular outer retinal atrophy 35 Small white deep intraretinal flecks 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 40 of 63

Genetic screening of LCA in Belgium 39

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 Nummular intraretinal pigment migrations 8 Yellowish hue of the macula 9 6 astrocytoma-like retinal excrescences superior to right macula 10 Pseudopapilledema with prominent sheathing of blood 11 vessels near optic discs 12 (18yrs) Optic disc pallor 13 Retinal vessel attenuation For PeerBasic Review 14 Salt and pepper aspect (early in Macular aplasia 15 life) CRB1 Total chorioretina atrophy in the central macula Eyepoking 16 Absent Declining p.[Cys948Tyr] LCA-39a F + + Pseudopapilledema Enophthalmos (4mo) at the age 17 +[Splice Atrophic macular region with pigment near border Esotropia of 12yrs defect] (LCA- (3yrs) 18 Absent 39a) Total atrophy of retina and choriocapillaris 19 (15.11yrs) and Midperipheral small white dots 20 p.[Splice Midperipheral small nummular pigmentation 21 defect]+[Splic Optic disc pallor 22 e defect] Small excavation optic disc (OD, not OS) (LCA-39b) Retinal vessel attenuation 23 Absent LCA-39b M + - Extensive peripheral outer retinal atrophy (8yrs & 16yrs) 24 Limited nummular intraretinal pigmentation 25 Macular yellowish atrophy (OD>OS) 26 (16yrs) No optic disc excavation 27 CRB1 No perivascular sheathing Cataract (OS>OD) 28 p.[Splice Absent Severe outer retinal and central macular atrophy Retinal detachment LCA-40 M + - 29 defect(+)Splic (2yrs) Small deep intraretinal white flecks (OD: partial - 30 e defect] Extensive nummular intraretinal pigmentation inferior, OS: total) (11yrs) 31 32 CRB1 33 p.[ Leu814Arg fsX23 ]+[ Cys1 LCA-41 F + Mild Absent Disturbed Hyperaemic optic disc Eyepoking 34 240ProfsX24 ] II-1 (31yrs) Retinal vessel attenuation Enophthalmos 35 Small pigment clumps scattered through retina Esotropia 36 Pseudopapilledema 37 Normal macula (12yrs) 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 41 of 63 Human Mutation

40 Coppieters et al. 1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 Macular atrophy with pigment clumping 8 (21yrs) 9 Macular pseudocoloboma (23yrs) 10 Limited perivascular sheathing around optic disc 11 Extensive outer retinal atrophy 12 Small white intraretinal flecks 13 Pronounced nummular intraretinal pigmentation For Peer ReviewCentral macular atrophy 14 (36yrs) 15 Beginning macular atrophy with pigment alterations 16 (10yrs) Extensive peripheral outer retinal atrophy 17 Extensive macular atrophy Eyepoking Extreme hyperpigmentation around central macula Enophthalmos 18 LCA-41 Absent F + - Disturbed Pronounced peripapillary perivascular fibrosis Esotropia 19 II-2 (24yrs) Relative sparing of small retinal area just nasal to the SCP Cataract 20 optic disc (used for fixation) (complete, OS) 21 Pronounced mid and far-peripheral nummular intraretinal 22 pigmentation 23 (24yrs) White retinal spots CRB1 24 Absent Salt and pepper pigmentation Keratoconus p.[Trp1293X( LCA-42 F + (2yrs) Maculopathy Cataract (OD) 25 +)Trp1293X] 26 (2yrs) Optic disc pallor 27 Retinal vessel attenuation EORD-1 28 F + - CRD Salt and pepper alterations CRB1 II-1 Nummular intraretinal pigmentation (over 360°) 29 p.[Cys948Tyr] No maculopathy 30 +[Lys801X] Optic disc pallor EORD-1 31 M + Mild CRD Salt and pepper alterations II-2 32 No maculopathy 33 CRB1 Optic disc pallor p.[Cys948Tyr( EORD-2 M Peripheral nummular intraretinal pigmentation Cataract 34 +) Cys310Tyr ] No maculopathy 35 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 42 of 63

Genetic screening of LCA in Belgium 41

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 Hyperaemic optic disc Retina vessel attenuation 8 CRB1 + Strong Absent Midperipheral pigment alterations 9 p.[Cys948Tyr] EORD-3 F (since the (since early (4.10yrs) Pseudopapilledema +[ Asp491Val ] age of 5) age) 10 Bull’s maculopathy 11 (4yrs) CRB1 12 Absent Peripheral nummular intraretinal pigmentation p.[ Gln362X EORD-4 M Cataract 13 (5yrs) No maculopathy (+)Gln362X] For Peer Review 14 Pseudopapilledema CRB1 + Maculopathy (edema) 15 p.[Arg764Cys (since the Absent Normal SCP Cataract (OD) EORD-5 F - Coats reaction (OD) 16 (+)Arg764Cys age of 13- (12yrs) (12yrs) Glaucoma Mid-peripheral spicular intraretinal pigmentation ] 14) 17 Excavation optic disc (OS) 18 Discrete retinal vessel attenuation Strong Normal fundus 19 RPE65 - R/B (not (since the Absent Very small white intraretinal flecks in mid- and far p.[Arg44Gln] LCA-43 F (searches for R/Y) Esotropia 20 age of 13- (7mo & 2yrs) periphery +[Arg44Gln] light) (4yrs) 21 14) No preretinal fibrosis 22 (4yrs) 23 Retinal vessel attenuation Discrete RPE alterations 24 (5mo) RPE65 25 - Optic disc pallor p.[ Pro181Leu Absent LCA-44 M + (searches for Disturbed Retinal vessel attenuation 26 ]+[ Pro181Leu (5mo & 4yrs) light) Mild thinning of inferior retina ] 27 Limited midperipheral intraretinal pigmentation 28 Well-preserved macula 29 (7yrs) RPE65 Optic disc pallor 30 LCA-45a F p.[Arg234X]+ Depigmentations and round hyperpigmentations 31 [Trp331dup ] 32 (LCA-45a) and 33 LCA-45b p.[ Trp331dup 34 ]+[ Trp331du 35 p] (LCA-45b) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 43 of 63 Human Mutation

42 Coppieters et al. 1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 Retinal vessel attenuation RPE65 Limited but clear peripheral outer retinal atrophy 8 p.Leu341Ser LCA-46 F No intraretinal pigmentation 9 p.Ser121Leuf Relative preservation of essentially normal macula sX6 ( de novo ) 10 (21yrs) 11 Optic disc pallor 12 Retinal vessel attenuation No pigmentation 13 (5yrs) For Peer Review Eyepoking 14 Normal optic discs RPE65 Cataract (very - Retinal vessel attenuation 15 p.[Phe530Leu Absent G/B limited posterior LCA-47 M + (searches for Discrete retinal thinning 16 fsX40]+[Phe5 (9mo & 9yrs) R/0/P lens opacification) light) Cellophane maculopathy 30LeufsX40] Semimydriasis 17 Limited macular pigment alterations (ODS) 18 Peripheral hypopigmentation 19 Small discrete peripheral white flecks Total absence of AF 20 (9yrs) 21 Optic disc pallor RPE65 Retinal vessel attenuation 22 p.[Phe530Leu Absent LCA-48 M Basic Outer retinal atrophy especially in inferior midperiphery 23 fsX40]+[Arg1 (4mo & 1yr) Relative sparing of the macula. 24X] 24 Mild preretinal macular fibrosis 25 Retinal vessel attenuation 26 No pigment alterations Normal macula 27 RPE65 (1yr & 4.3yrs) - 28 p.[Phe530Leu Absent Peripheral pigment alterations LCA-49 M Strong (searches for Basic Semimydriasis fsX40]+[Splic (1.9yrs) (6yrs) 29 light) 30 e defect] Normal optic disc Limited retinal vessel attenuation 31 Peripheral RPE alterations without intraretinal pigment 32 Very limited foveal pigment alterations 33 RPE65 Normal vessels p.[ Arg296Lys Absent Mild RPE alterations Esotropia LCA-50 F 34 fsX7 ]+[Splice (5mo) No hyperpigmentation Hypertropia 35 defect] Normal macula 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 44 of 63

Genetic screening of LCA in Belgium 43

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 GUCY2D p.[Pro130Leuf 8 Absent sX36 LCA-51 M Normal fundus Eyepoking 9 (11mo & 3yrs) (+)Splice 10 defect] 11 GUCY2D Absent Eyepoking p.[Phe565Ser( LCA-52 M Normal fundus 12 (6mo) Enophthalmos 13 +)Phe565Ser] GUCY2D For Peer Review 14 p.[Arg768Trp( LCA-53 M 15 +)Arg768Trp] GUCY2D + + Eyepoking 16 Absent Normal fundus p.[Arg768Trp] LCA-54 F (since (since the age Enophthalmos (3mo) (1yr & 3.2yrs) 17 +[Phe565Ser] early age) of 2.6) Esotropia 18 Pseudopapilledema GUCY2D Essentially normal fundus 19 Absent p.[Arg768Trp] LCA-55 M - Limited peripheral salt and pepper alterations Eyepoking 20 (4.4yrs) +[ Lys866Asn ] Limited hyperAF of the central macula 21 (13yrs) Optic disc pallor 22 Eyepoking Retinal vessel attenuation 23 Enophthalmos GUCY2D Basic Limited peripheral outer retinal atrophy Esotropia 24 p.[ Glu196Val Absent Strong R/G No intraretinal pigmentation LCA-56 F - Strong Keratoconus with 25 ]+[ Pro711Leu (3mo) and B/Y Normal macula acute hydrops ] defect Foveolar yellowish atrophy 26 (OD>OS) No hyper- or hypoAF (16yrs) 27 (25yrs) 28 GUCY2D Absent Severely Optic disc hypoplasia LCA-57 F + 29 p.Pro575Leu (3.3yrs) disturbed Bull’s maculopathy LCA-58 Bull's eye maculopathy, diffuse RPE alterations; limited 30 AIPL1 (Yzer, Absent intraretinal pigment migration of spicular type; sub- or p.[Trp278X]+ F Mild 31 Leroy et (3mo & 1yr) deep intraretinal fine white deposits predominantly along [ Trp278X] 32 al. 2006) vascular arcades Retinal vessel attenuation 33 AIPL1 + Absent No intraretinal pigmentation 34 p.[Trp278X LCA-59 M (since the age Eyepoking (2yrs) Macular pigment alterations (+)Trp278X] of 4.10) 35 (5yrs) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 45 of 63 Human Mutation

44 Coppieters et al. 1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 Normal optic discs 8 Retinal vessel attenuation 9 AIPL1 Peripheral outer retinal atrophy p.[Trp278X LCA-60 M Spicular intraretinal pigmentation 10 (+)Trp278X] Total outer retinal aplasia of central macula, surrounded 11 by thin rim of hyperplastic RPE 12 (28yrs) Limited optic disc pallor 13 Retinal vessel attenuation AIPL1 StrongFor Peer Review 14 Absent Extensive outer retinal atrophy Eyepoking p.[Trp278X]+ LCA-61 F + (after first (3mo & 6mo) Mid and far-peripheral spicular pigmentation Esotropia 15 [ Trp278X] decade) 16 Better preserved macula with central yellow atrophy (19yrs) 17 AIPL1 Absent Optic disc pallor 18 p.[Thr114Ile; LCA-62 F Eyepoking (1.4yrs) Retinal vessel attenuation 19 Pro376Ser] CRX Absent LCA-63 M Eyepoking 20 p.Tyr142Cys (6mo) 21 CRX LCA-64 M 22 p.Val242Met RDH12 23 Optic disc pallor p.[Ala269Glyf EORD-6 M Retinal vessel attenuation 24 sX2]+[ Val233 Salt and pepper alterations 25 Asp ] 26 Limited retinal vessel attenuation 27 Better preservation of the chorioretina in the posterior pole than in the periphery 28 Clear retinal pigment epithelium alterations Peripheral areas of preserved chorioretina alternating with 29 RDH12 + areas of total atrophy with predominant spicular 30 p.[Ala269Glyf Absent Basic EORD-7 M (since + intraretinal pigmentation Esotropia sX2]+[ Ser175 (3.5yrs) (5.10yrs) 31 early age) (5yrs) Leu ] 32 Retinal vessel attenuation 33 Yellowish discoloration of central macula 34 More prominent spicular intraretinal pigmentation Areas with complete preservation of peripheral 35 chorioretina 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 46 of 63

Genetic screening of LCA in Belgium 45

1 2 3 Patient Night Color 4 Gene o Gender Photophobia ERG Fundus aspect Other features 5 n Blindness vision 6 7 (19yrs) 8 9 RDH12 p.[Ala269Glyf EORD-8 10 sX2(+)Ala269 11 GlyfsX2] RPGRIP1 12 LCA-65 Strong 13 p.Arg890X For Peer Review 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 47 of 63 Human Mutation

46 Coppieters et al. 1 2 Supplementary Table S3 – Part II 3 4 BCVA Refraction 5 Neurologic Patient (age) (age) Other Gene Gender Nyst VF MTS al Kidney 6 no Features 7 OD OS OD OS Features 8 CEP290 p.[Cys99 9 LCA-1 M LP? LP? +5 +5 Normal MRI 8X]+[Cys 10 998X] Deleted : CEP290 11 CEP290 p.[Cys99 20/600 20/600 12 LCA-2 M + +7 +7 - 13 8X]+[Cys (1yr & 5yrs) (1yr & 5yrs) 998X] For Peer Review Deleted : CEP290 14 MRI : RDI 15 Broadened Daytime Growth Deleted : NMR CEP290 +7 +7 supertentorial incontine retardation 16 Mild MR p.[Cys99 2/24 2/24 (3mo) (3mo) ventricular system nce (length and LCA-3 M + Autism 17 8X]+[ Arg (6yrs) (6yrs) +8.25 +8.25 without signs of Normal weigth)

18 108X ] (6yrs) (6yrs) intracranial kidney Prematurity Deleted : CEP290 19 hypertension US (36w) 20 (11mo) (6.10yrs) CEP290 21 p.[Cys99 NLP NLP LCA-4 F + - 22 8X(+) Gln (since birth) (since birth) 23 899X ] Deleted : CEP290 TDM brains: 24 modest cortical 25 atrophy with CEP290 NLP limited subdural 26 p.[Cys99 NLP +6 +6 LCA-5 M (1.8yrs & bifrontal fluid MEI 27 8X(+)Arg (1.8yrs & 8yrs) (4mo) (4mo) 8yrs) collection 1465X] 28 (4mo) Deleted : CEP290 29 EEG: normal 30 (4mo) Normal 31 kidney CEP290 1.5/24 3/36 MRI: 32 US, p.[Cys99 (3.6yrs) (3.6yrs) +4 +4 slightly Learning LCA-6 F + Reduced normal 33 8X]+[Lys 1/20 2/10 (18yrs) (18yrs) broadened lateral disability kidney 34 1575X] (18.5yrs) (18.5yrs) ventricles (3.4yrs) function Deleted : CEP290 35 (3yrs) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 48 of 63

Genetic screening of LCA in Belgium 47

1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 CF at 2m CF at 2m 6 CEP290 (21yrs) (21yrs) 30° p.[Cys99 LP with +3.5 +3.5 7 LCA-7 M + HM at 2m (35yrs & - 8X(+)Lys incomplete loc (42yrs) (42yrs) 8 (49yrs) 49yrs) 1575X] (49yrs) Deleted : CEP290 9 10 CEP290 1/60 1/36 p.[Cys99 (6yrs) (6yrs) 11 LCA-8 F + +5 +5 5° - 12 8X(+)Lys HM 2m HM 1.5m 1575X] (30yrs) (30yrs) Deleted : CEP290 13 CEP290 For Peer Review p.[Cys99 1/20 1/20 10° 14 LCA-9 M + +2.25 +2.25 Normal MRI - 15 8X]+[ Arg (6yrs) (6yrs) (6yrs) 1782X ] Deleted : CEP290 16 CEP290 Normal 17 p.[Cys99 Normal MRI kidney 8X]+[ Asp LCA-10 F + NLP NLP +4 +4 - Obesity 18 (10yrs) US 128Glufs 19 (10yrs) X17 ] Deleted : CEP290 20 CEP290 21 p.[Cys99 22 8X]+[ Glu LCA-11 M REM NLP NLP +8 +8 Normal MRI - 23 146Glyfs X17 ] Deleted : CEP290 24 CEP290 p.[Cys99 Normal 25 +10 +10 8X(+)Arg LCA-12 M + NLP NLP - kidney 26 (6mo) (6mo) 621IlefsX US (1yr) 27 2] Deleted : CEP290 28 CEP290 Normal CT scan p.[Cys99 MRI: 2 atypical 29 MR 8X(+) Leu LCA-13 F NLP NLP +8 +8 white matter Epilepsy 30 1141Phef lesions 31 sX5 ] (17yrs – 19yrs) Deleted : CEP290 CEP290 Limited 32 LP? LP? p.[Cys99 MRI: slightly ventricle 33 (7mo) (7mo) 8X]+[ Thr LCA-14 F + broadened lateral - septum NLP NLP 34 1334Ilefs ventricles (5mo) defect (7.8yrs) (7.8yrs) 35 X2 ] (VSD): slow Deleted : CEP290 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 49 of 63 Human Mutation

48 Coppieters et al. 1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 closure, 6 Asthma 7 Familial 8 palatoschisis Brother died 9 from SIDS 10 CEP290 LCA-15 Hypermetr Hypermetr p.[Cys99 (Perrault, ia ia 11 Normal MRI Dev del Discrete Field Code Changed 8X(+)Glu Delphin M + LP LP hypermetr hypermetr (1.3yrs) Autism? scoliosis 12 1656Asnf et al. opic opic 13 sX3] 2007) For Peer(strong) (strong) Review Deleted : CEP290 14 CEP290 15 p.[Cys99 8X]+[Ala LCA-16 M + NLP NLP +8 +8 - Obesitas 16 1832Profs 17 X19] Deleted : CEP290 18 Carrier of a non- 19 CEP290 pathogenic p.[Cys99 20 LP LP Autism translocation 8X]+[ Lys LCA-17 M + +7 +7 No loc No loc Normal IQ : 21 1840Argf 45,XY,t(13;1 22 sX5 ] 4) (father has Deleted : CEP290 23 the same) 24 Non-verbal 25 learning 26 disability CEP290 Ataxia Normal LP 27 p.[Cys99 LP (Mild) kidney No loc Conc Normal CT scan 8X]+[ Glu LCA-18 M + No loc Dyspraxia US 28 (early in constr (5mo) 1956Glyf (early in life) (10yrs) (5mo) 29 life) sX9 ] Balance Deleted : CEP290 30 and 31 coordinatio 32 n problems CEP290 Autism Normal MRI : Frontal and 33 p.[Cys99 NLP NLP Mild- kidney Deleted : NMR LCA-19 M + temporal cortical 34 8X]+[ Do (since birth) (since birth) moderate US atrophy 35 nor MR (6mo) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 50 of 63

Genetic screening of LCA in Belgium 49

1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 Splice Verbal IQ 6 defect ] = 55 Deleted : CEP290 7 Coordinati 8 on problems 9 CEP290 10 p.[Cys99 LCA-20 < 1/20 < 1/20 8X(+) Acc (Yzer, (45yrs) (45yrs) Meningitis 11 F + Severe MR Field Code Changed 12 eptor Leroy et NLP NLP (6w) Splice al. 2006) (54yrs) (54yrs) 13 defect ] For Peer Review Deleted : CEP290 14 Chrom dupl CEP290 14q24-32.3 15 Mild MR p.[Cys99 (< mother: ADHD 16 8X]+[ Acc carrier of a LCA-21 M + LP LP +5 +5 Normal CT scan Movement 17 eptor balanced abnormaliti splice translocation 18 es defect ] ) Deleted : CEP290 19 20 CEP290 21 p.[Cys99 8X(+) Acc 22 LCA-22 M - LP LP - eptor 23 Splice 24 defect ] Deleted : CEP290 25 Kidney US: 26 CEP290 Severe MR hyperden Hyperlax p.[Cys99 Dev Del 27 sity ligaments 8X(+) Acc - Epilepsy LCA-23 F + LP? LP? (3yrs) Hyperlordosi 28 eptor (1.2yrs) Axial No other s 29 Splice hypotonia signs of defect ] (mild) 30 NPHP Deleted : CEP290 31 (17yrs) 32 CEP290 p.[Lys157 LCA-24 M Severe MR 33 5X(+)Lys 34 1575X] Deleted : CEP290 35 CEP290 LCA-25 M + 20/600 20/600 +3.5 +3.5 10°- 15° Normal MRI - 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 51 of 63 Human Mutation

50 Coppieters et al. 1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 p.[Lys157 (9mo) (9mo) (9yrs) (9yrs) paracent (4mo) 6 5X]+[ Ala 1/60 1/24 ral 7 1566Pro ] (5yrs) (5yrs) Deleted : CEP290 CEP290 8 5/60 5/60 p.[ Leu16 (3yrs) (3yrs) +3.25 +3 9 94Pro ]+[ LCA-26 + 1/10 1/10 (4.5yrs) (4.5yrs) 10 =, splice (4.5yrs) (4.5yrs) 11 site ] Deleted : CEP290 12 CEP290 p.Cys998 LCA-27 M + 0.16 0.16 50° - Deleted : [ 13 X For Peer Review Deleted : (+)?] 14 Glue ear Clinodactyly 15 UTI Deleted : CEP290 Sibling died CEP290 - RDI 16 No reaction on No reaction shortly after p.[Trp7C No CKD5 17 SLS-1 F + light on light >+4 >+4 -? birth ys]+[ ataxia/hypo (5yrs) (2mo) (2mo) (enlarged 18 Trp7Cys] tonia RTx kidneys, Deleted : CEP290 19 (6yrs) chrom 6 20 defect) 21 Diagnosi 22 s renal insufficie 23 ncy 24 CEP290 (30yrs) Mild MR Syncopes p.[Lys157 <20° Broadened 4th RDI 25 SLS-2 F + LP with loc LP with loc Balance Scoliosis 5X(+)Arg (14yrs) ventricle Peritonea Comment [FC 1]: Correcte leeftijden 26 problems toevoegen 1465X] l dialysis 27 (34yrs) Deleted : CEP290 28 Kidney 29 transplan t (34yrs) 30 RDI 31 Moderate (7yrs) CEP290 MR Kidney 32 p.[Lys157 Recurrent SLS-3 M NLP NLP Severe US: 5X(+)Arg OM 33 autism hyperden 1465X] 34 Mild ataxia sity Deleted : CEP290 35 (13yrs) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 52 of 63

Genetic screening of LCA in Belgium 51

1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 CKD5 6 (16yrs) 7 Peritonea 8 l dialysis (since 9 the age 10 of 17) 11 RDI (6yrs) Scoliosis 12 Kidney Recurrent 13 CORS-1 US: CEP290 For Peer ReviewSevere MR OM (Brancati, hyperden 14 p.[Lys157 Ataxia Congenital Barrano F + LP with loc LP with loc +10, +12 +10, +12 + sity 15 5X(+)Arg Balance chylothorax et al. (6yrs) 1465X] problems Alternating 16 2007) CKD5 Deleted : CEP290 tachypnea 17 (14yrs) Syncopes 18 Deceased (16yrs) 19 CEP290 20 p.[Gln126 Hypotonia 5X]+[Acc + 21 LCA-JS-1 M + 1/100 1/100 +5 +5 tubular Walking eptor (4yrs) 22 problems splice 23 defect] Deleted : CEP290 24 CEP290 LCA-JS-2 Walking F + 1.5/10 1/10 +5 +5 10° + 25 p.[ Thr24 II-1 problems 57AlafsX Mild MR 26 27 ]+[ Thr LCA-JS-2 A + 1/20 1/20 +4.5 +3.5 10° + Walking 27 2457Alaf II-2 problems 28 sX27 ] Deleted : CEP290 CEP290 29 Severe p.[Leu24 psychomot Normal 30 48ThrfsX NLP NLP or kidney 31 8(+) Acce LCA-JS-3 M REM ? Scoliosis (since birth) (since birth) retardation US ptor 32 Hypotonia (1yr) splice 33 No ataxia defect ] Deleted : CEP290 34 CRB1 LCA-28 M 1/100 1/100 35 p.[Lys801 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 53 of 63 Human Mutation

52 Coppieters et al. 1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 X(+)Lys8 6 01X] Deleted : CRB1 7 OD: 8 central residual 9 visual 10 field, 11 20/600 20/600 OS: CRB1 LCA-29 (1yr) (1yr) temporal +2.25 +1.88 12 p.[Lys801 (Yzer, 1/30 <1/50 inferior M + (30.6yrs) (30.6yrs) - Field Code Changed 13 X(+)Gln3 Leroy et (7.9yrs) (7.9yrs) and For Peer(astigm) (astigm) Review Deleted : 14 62X] al. 2006) 1/40 1/40 partially 15 (25 yrs) (25 yrs) superior Deleted : CRB1 visual 16 field 17 intact 18 (30.6yrs ) 19 CRB1 20 p.[Lys801 LCA-30 M 21 X]+[Arg7 Deleted : ¶ 22 64Cys] Deleted : CRB1 CRB1 LCA-31 HM on 20 23 p.[Lys801 (Yzer, HM on 20 cm cm M + +10 +9.5 - Field Code Changed 24 X]+[Cys8 Leroy et (3mo & 6yrs) (3mo & 25 96X] al. 2006) 6yrs) Deleted : CRB1 26 40°; CRB1 LCA-32 1/100 1/100 remainin Asthma 27 p.[Lys801 (Yzer, (1yr) (1yr) +4 +4 g F + Torticollis Field Code Changed 28 X(+)Cys8 Leroy et <1/600 <1/600 (19yrs) (19yrs) temporal (to the left) Deleted : 29 96X] al. 2006) (35yrs) (35yrs) crescent (19yrs) Deleted : CRB1 30 CRB1 CF at 1m CF at 1m 31 p.[Lys801 (until 8yrs) (until 8yrs) LCA-33 F + +4 +4 10° - 32 X(+)Cys9 HM at 0.5m CF at 10cm 33 48Tyr] (9yrs) (9yrs) Deleted : CRB1 CRB1 Remaini 20/800 20/800 34 p.[Lys801 LCA-34 F + +5 +5 ng - (1.11yrs) (1.11yrs) 35 X]+[ Acce island in 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 54 of 63

Genetic screening of LCA in Belgium 53

1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 ptor peripher 6 splice al field 7 defect ] Deleted : CRB1 8 CRB1 p.[Cys94 9 8Tyr(+)C LCA-35 F LP LP 10 ys948Tyr 11 ] Deleted : CRB1 12 CRB1 p.[Cys94 LCA-36 F + LP LP - 13 8Tyr(+)G For Peer Review 14 lu1330X] Deleted : CRB1 CRB1 15 LP LP p.[Cys94 (decreased (decreased 16 8Tyr]+[S LCA-37 M + Normal CT scan - since the age of since the age 17 plice 13) of 13) 18 defect] Deleted : CRB1 CRB1 19 0.07 0.07 p.[Cys94 LP with LP with Normal CT scan 20 8Tyr]+[S LCA-38 M + +9 +9 10° - localisation localisation (5.9yrs) plice 21 (17yrs) (17yrs) 22 defect] Deleted : CRB1 CRB1 1.5/36 2/36 23 p.[Cys94 (4.9yrs) (4.9yrs) LCA-39a F + +4.75 +5.25 10° - 24 8Tyr]+[S HM 1m HM 1m 25 plice (15.11yrs) (15.11yrs) 26 defect] (LCA- 27 39a) 28 and p.[Splice 29 LCA-39b M 0.08 0.08 10°-20° - defect]+[ 30 Splice 31 defect] 32 (LCA- 33 39b) Deleted : CRB1 CRB1 0.08 0.08 34 p.[Splice LCA-40 M + (3yrs) (3yrs) <10° Normal CT scan - 35 defect(+) LP NLP 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 55 of 63 Human Mutation

54 Coppieters et al. 1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 Splice (22 yrs) (22 yrs) 6 defect] Deleted : CRB1 7 3/10 3/10 LCA-41 (8yrs) (8yrs) 8 F + +9 +9 30-50° - CRB1 II-1 CF at 15cm CF at 15cm 9 p.[ Leu81 (37yrs) (37yrs) 10 4ArgfsX2 50-60° 3]+[ Cys1 1/20 1/100 horizont 11 +4.5 +1.5 240Profs LCA-41 (14yrs) (14yrs) ally 12 F + Astigm Astigm - X24 ] II-2 1/20 CF at 50cm 70° Deleted : CRB1 13 For (28yrs) (28yrs) Peer Reviewverticall 14 y CRB1 15 2/10 4/10 p.[Trp129 LCA-42 F (2yrs) (2yrs) +5 +5 10° - 16 3X(+)Trp LP LP 17 1293X] Deleted : CRB1 CRB1 EORD-1 18 F - 1/50 1/50 +6 +6 60° - 19 p.[Cys94 II-1 8Tyr]+[L EORD-1 M 1/50 1/20 +3 +3 10° - 20 ys801X] II-2 Deleted : CRB1 21 CRB1 22 p.[Cys94 23 8Tyr(+) C EORD-2 M LP NLP + + 10° - ys310Tyr 24 ] Deleted : CRB1 MRI: 25 CRB1 Complet 2/10 2/10 subcortical white Learning 26 p.[Cys94 e (4yrs) (4yrs) +4.5 +4.5 matter lesions, disability 8Tyr]+[ A EORD-3 F + (4yrs) 27 1/20 1/20 (10.10yrs) (10.10yrs) frontal (right) in (but sp491Val 15°-30° 28 (11.9yrs) (11.9yrs) centrum semi- normal IQ) t] (11yrs) 29 ovale Deleted : CRB1 30 CRB1 p.[ 3/10 3/10 31 Gln362X EORD-4 M + (16yrs) (16yrs) +6 +6 10° - 32 (+)Gln36 LP LP 33 2X] Deleted : CRB1 CRB1 5/10 7/10 +2D +3D 30° Normal 34 p.[Arg76 EORD-5 F - (until 5yrs) (until 5yrs) (12yrs) (12yrs) (12yrs) - kidney 35 4Cys(+)A LP no loc HM +5D +5D Absent US 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 56 of 63

Genetic screening of LCA in Belgium 55

1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 rg764Cys (18.4yrs ) (18.4yrs ) (19yrs) 6 ] Deleted : CRB1 7 RPE65 p.[Arg44 +4.5 +4.5 Conc MR 8 LCA-43 F + 1/20 1/20 Normal MRI Obesitas Gln]+[Ar (7mo) (7mo) constr Autism 9 g44Gln] Deleted : RPE65 10 Mild RPE65 Normal perceptive 11 p.[ Pro18 3/10 Normal CT scan kidney 1/10 Behavioura hearing loss 12 1Leu ]+[ P LCA-44 M + (4yrs & -6 -6 and EEG US (4yrs & 9yrs) l anomalies (Cx26 ro181Leu 9yrs) (5mo) (2yrs) 13 negative) ] For Peer Review Deleted : RPE65 14 15 RPE65 LCA-45a F <1/20 <1/20 p.[Arg23 16 4X]+[ Trp 17 331dup ] 18 (LCA- 19 45a) and p.[ Trp33 LCA-45b 20 1dup ]+[ T 21 rp331du 22 p] (LCA- 45b) Deleted : RPE65 23 RPE65 24 p.Leu341 Ser 25 LCA-46 F 26 p.Ser121 LeufsX6 27 (de novo ) Deleted : RPE65 28 RPE65 p.[Phe530 1/10 1/10 29 Moderat Attention LeufsX40 (5yrs) (5yrs) +4 +4.5 LCA-47 M + e conc deficit 30 ]+[Phe53 5/100 5/100 (9yrs) (9yrs) constr disorder 31 0LeufsX4 (9yrs) (9yrs) 32 0] Deleted : RPE65 33 RPE65 15/100 12/100 p.[Phe530 (5yrs) (5yrs) LCA-48 M + -2.25 -2.5 40° - 34 LeufsX40 2/10 2/10 35 ]+[Arg12 (10yrs) (10yrs) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 57 of 63 Human Mutation

56 Coppieters et al. 1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 4X] Deleted : RPE65 6 RPE65 + < 0.035 0.1 +1.5 +2.5 7 p.[Phe530 (compensa Moderat (4.3yrs) (4.3yrs) (20mo) (20mo) Normal MRI LeufsX40 LCA-49 M tory head e conc - 8 1/60 1/20 +2.6 +1 (9mo) ]+[Splice movement constr 9 (10yrs) (10yrs) (10yrs) (10yrs) defect] s) Deleted : RPE65 10 RPE65 11 p.[ Arg29 1/10 1/10 +5 +5.75 Normal MRI 6LysfsX7 LCA-50 F + 12 (3yrs) (3yrs) (8mo) (8mo) (7mo) 13 ]+[Splice defect] For Peer Review Deleted : RPE65 14 GUCY2D 15 p.[Pro130 16 LeufsX36 LCA-51 M + NLP NLP (+)Splice 17 defect] Deleted : GUCY2D 18 GUCY2D US: p.[Phe565 hydro- 19 LCA-52 M + LP LP +4 +4 Normal MRI - 20 Ser(+)Phe uretero- 565Ser] nephrosis Deleted : GUCY2D 21 GUCY2D p.[Arg76 22 LCA-53 M 23 8Trp(+)A rg768Trp] Deleted : GUCY2D 24 GUCY2D Constric 25 p.[Arg76 1/600 1/120 +3.75 +4.25 LCA-54 F + ted - 8Trp]+[P (4.9yrs) (4.9yrs) (4.7yrs) (4.7yrs) 26 (2.6yrs) 27 he565Ser] Deleted : GUCY2D GUCY2D 28 p.[Arg76 MR 8Trp]+[ L LCA-55 M + LP LP +9 +9 10° 29 autism 30 ys866Asn ] Deleted : GUCY2D 31 GUCY2D 1/30 1/30 32 p.[ Glu19 Moderat (5.5yrs) (5.5yrs) 6Val ]+[ P LCA-56 F + +6 +6 e conc - 33 3/100 3/100 ro711Leu constr 34 (23yrs) (23yrs) ] Deleted : GUCY2D 35 GUCY2D LCA-57 F + 6/60 6/36 -6 -6 MRI: hypoplasia MR 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 58 of 63

Genetic screening of LCA in Belgium 57

1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 p.Pro575 optic nerves 6 Leu Deleted : GUCY2D 7 AIPL1 LCA-58 <20/600 <20/600 p.[Trp278 (Yzer, (3yrs) (3yrs) 8 F +8 +8 Normal CT scan - Field Code Changed X]+[ Leroy et 1/50 1/50 9 Trp278X] al. 2006) (8 yrs) (8 yrs) Deleted : AIPL1 10 AIPL1 <1/50 <1/50 p.[Trp278 Mild 11 (2yrs) (2yrs) +3.5D Normal CT scan X LCA-59 M + ? Developme 12 1/100 1/100 (2.5yrs) (6mo) (+)Trp27 ntal delay 13 (4.10yrs) (4.10yrs) 8X] For Peer Review Deleted : AIPL1 14 AIPL1 15 p.[Trp278 X LCA-60 M 16 (+)Trp27 17 8X] Deleted : AIPL1 18 20° (7yrs) 19 <1/100 <1/100 AIPL1 Residual (7yrs) (7yrs) 20 p.[Trp278 pericentr Normal CT scan LCA-61 F + LP with limited LP with +6 +6 - X]+[ al (10mo) 21 loc limited loc Trp278X] remnant 22 (21yrs) (21yrs) Deleted : AIPL1 s 23 (21yrs) 24 AIPL1 25 p.[Thr114 26 Ile; LCA-62 F + 1/10 1/10 Normal MRI - Pro376Se 27 r] Deleted : AIPL1 28 CRX 29 p.Tyr142 LCA-63 M + LP LP +9 +9 - Deleted : ¶ Cys (no date) 30 CRX 31 Deleted : ¶ p.Val242 LCA-64 M (no date) 32 Met 33 RDH12 5/10 5/10 30° Deleted : CRX p.[Ala269 (4yrs) (4yrs) (8yrs) EORD-6 M - Normal CT scan - Deleted : CRX 34 GlyfsX2] 1/10 1/10 5° 35 +[ Val233 (23yrs) (23yrs) (12yrs) 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 59 of 63 Human Mutation

58 Coppieters et al. 1 2 BCVA Refraction Neurologic Patient (age) (age) Other 3 Gene Gender Nyst VF MTS al Kidney no Features 4 OD OS OD OS Features 5 Asp ] 6 Deleted : RDH12 7 OD: 8 temporal crescent, 9 OS: 70° 10 RDH12 (6yrs) 3/9 3/9 p.[Ala269 OD: 11 (3.5yrs) (3.5yrs) GlyfsX2] EORD-7 M + status- - 12 HM 1.5/10 +[ Ser175 quo 13 (19yrs) (19yrs) Leu ] For Peer ReviewOS: Deleted : RDH12 14 central 15 5° (19.3yrs 16 ) 17 RDH12 18 p.[Ala269 19 GlyfsX2( EORD-8 M 4/10 4/10 10° +)Ala269 20 GlyfsX2] Deleted : RDH12 21 RPGRIP1 22 p.Arg890 LCA-65 M 1/10 1/10 10° X Deleted : RPGRIP1 23 24 Supplementary Table S3: Clinical data of 80 patients with mutation(s) in one of the LCA genes. 25 26 If available, the age of the first and last measurement is mentioned between brackets. A question mark indicates an uncertain status. Blank fields indicate 27 features for which no information could be obtained. Clinical data on the two patients included in the Phase I clinical trial for RPE65 gene-replacement therapy Deleted : ¶ 28 (LCA-47 and LCA-49) concern the period preceding therapy. Characteristics described in “Other features” are binocular, if not mentioned otherwise. 29 Abbreviations used: N o, number; cons, consanguinity; nyst, nystagmus; BCVA, best corrected visual acuity; OD, right eye; OS, left eye; ODS, both eyes; ERG, 30 electroretinogram; VF, visual field; MTS, molar tooth sign; MRI, magnetic resonance imaging; MR, mental retardation; NPHP, nephronophtisis; SE, spherical 31 equivalent; +, present; -, absent; yr(s), year(s); mo, month(s); W, week(s); REM, roving eye movements; HM, hand motion; LP, light perception; NLP, no light Deleted : ND, no data; 32 perception; CF, counting fingers; AF, autofluorescence; OCT , optical coherence tomography; US, ultrasound; SIDS, sudden infant death syndrome; conc constr, concentrically constricted; G, green; B, blue; R, red; O, orange; P, pink; RPE, retinal pigment epithelium; PPRPE, preserved para-arteriolar retinal 33 pigment epithelium; astigm, astigmatism; loc, localization; CRD: cone-rod dystrophy; SCP: subcapsularis posterior; dev del: developmental delay; MEI: middle 34 ear infections; RDI: renal diabetes insipidus; CKD5: renal failure; RTx: transplantation. Deleted : ¶ 35 36 37 38 39 40 41 42 43 44 45 46 John Wiley & Sons, Inc. 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Human Mutation Page 60 of 63

1 2 3 Page 5: [1] Deleted UGent 4/8/2010 2:06:00 PM 4 , 5 6 Page 5: [1] Deleted UGent 4/8/2010 2:06:00 PM 7 In three of them, two heterozygous variants were detected in two genes, respectively. The other one 8 carried a homozygous variant in one gene together with a heterozygous variant in another gene. 9 10 11 Page 5: [2] Deleted Frauke Coppieters 4/16/2010 3:23:00 PM 12 For one patient, t 13 14 Page 5: [2] Deleted Frauke Coppieters 4/16/2010 3:23:00 PM 15 the mutation 16 17 Page 5: [3] Deleted Frauke Coppieters 4/16/2010 3:23:00 PM 18 ( For Peer Review 19 20 Page 5: [3] Deleted Frauke Coppieters 4/16/2010 3:23:00 PM 21 , CRB1 p.Glu1330X)

22 23 Page 5: [3] Deleted Frauke Coppieters 4/16/2010 3:24:00 PM 24 of the LCA chip

25 26 Page 5: [4] Deleted UGent 4/8/2010 2:13:00 PM 27 on the LCA chip

28 29 Page 5: [4] Deleted UGent 4/8/2010 2:17:00 PM 30 direct 31

32 Page 5: [5] Deleted Frauke Coppieters 6/16/2010 11:28:00 AM 33 considered 34

35 Page 5: [5] Deleted Frauke Coppieters 6/16/2010 11:28:00 AM 36 using LCA chip analysis 37 38 Page 5: [6] Deleted Frauke Coppieters 4/16/2010 3:17:00 PM 39 As a second step 40 41 42 Page 5: [6] Deleted Frauke Coppieters 6/16/2010 11:29:00 AM 43 complete 44 45 Page 5: [6] Deleted Frauke Coppieters 6/16/2010 11:30:00 AM 46 a 47 48 Page 5: [6] Deleted Frauke Coppieters 6/16/2010 11:30:00 AM 49 analysis

50 51 Page 5: [6] Deleted Frauke Coppieters 4/16/2010 2:02:00 PM 52 Sanger

53 54 Page 5: [7] Deleted UGent 4/8/2010 2:25:00 PM 55 LCA

56 57 Page 5: [7] Deleted UGent 4/8/2010 2:25:00 PM 58 59 60 John Wiley & Sons, Inc. Page 61 of 63 Human Mutation

1 2 3 all 4 5 Page 5: [7] Deleted UGent 4/8/2010 2:22:00 PM 6 in the entire LCA cohort 7 8 Page 5: [7] Deleted UGent 4/8/2010 2:24:00 PM 9 identified in CEP290 -related LCA 10 11 12 Page 5: [8] Deleted UGent 4/8/2010 2:41:00 PM 13 , 14 15 Page 5: [8] Deleted UGent 4/8/2010 2:41:00 PM 16 LCA-25 17 18 Page 5: [8] Deleted For Peer UGent Review 4/8/2010 2:41:00 PM 19 , LCA-26

20 21 Page 5: [9] Deleted Frauke Coppieters 4/16/2010 1:00:00 PM 22 Table 2

23 24 Page 5: [9] Deleted Frauke Coppieters 6/16/2010 11:33:00 AM 25 that

26 27 Page 5: [10] Deleted UGent 4/8/2010 2:27:00 PM 28 several 29

30 Page 5: [10] Deleted UGent 4/8/2010 2:28:00 PM 31 three SLS, three LCA-JS and one CORS 32

33 Page 5: [10] Deleted UGent 4/8/2010 1:51:00 PM 34 Five 35 36 Page 5: [10] Deleted UGent 4/8/2010 2:28:00 PM 37 harboured 38 39 Page 5: [10] Deleted UGent 4/8/2010 2:29:00 PM 40 in one family, 41 42 43 Page 5: [10] Deleted UGent 4/8/2010 2:36:00 PM 44 with the disease 45 46 Page 5: [10] Deleted UGent 4/8/2010 2:29:00 PM 47 ( 48 49 Page 5: [10] Deleted UGent 4/8/2010 2:29:00 PM 50 )

51 52 Page 5: [11] Deleted UGent 4/8/2010 1:52:00 PM 53 In two patients, s

54 55 Page 5: [11] Deleted UGent 4/8/2010 1:52:00 PM 56 (

57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 62 of 63

1 2 3 Page 5: [11] Deleted UGent 4/8/2010 1:52:00 PM 4 and LCA-JS-3) 5 6 Page 5: [11] Deleted UGent 4/8/2010 1:52:00 PM 7 in two other patients, 8 9 10 Page 5: [11] Deleted UGent 4/8/2010 1:52:00 PM 11 ( 12 13 Page 5: [11] Deleted UGent 4/8/2010 1:53:00 PM 14 ) 15 16 Page 5: [11] Deleted UGent 4/8/2010 1:53:00 PM 17 18 For Peer Review 19 Page 5: [11] Deleted UGent 4/8/2010 1:53:00 PM 20 three of these patients

21 22 Page 5: [12] Deleted Frauke Coppieters 6/16/2010 11:35:00 AM 23 ), a novel mutation (

24 25 Page 5: [12] Deleted Frauke Coppieters 4/16/2010 1:00:00 PM 26 Table 2

27 28 Page 5: [12] Deleted Frauke Coppieters 6/16/2010 11:37:00 AM 29 whole 30

31 Page 13: [13] Deleted UGent 4/8/2010 3:56:00 PM 32 nine 33

34 Page 13: [13] Deleted UGent 4/8/2010 3:56:00 PM 35 seven 36 37 Page 13: [13] Deleted UGent 4/8/2010 3:55:00 PM 38 , 26 of which were novel 39 40 41 Page 13: [14] Deleted UGent 4/8/2010 3:51:00 PM 42 Mutations were identified in 69% (63/91) of probands, with an established diagnosis - two mutations 43 found - in 65% (59/91). 44 45 Page 13: [14] Deleted UGent 4/8/2010 3:56:00 PM 46 , 47 48 Page 13: [14] Deleted UGent 4/8/2010 3:56:00 PM 49 five of which were novel mutations

50 51 Page 13: [15] Deleted Frauke Coppieters 4/16/2010 2:44:00 PM 52 43

53 54 Page 13: [15] Deleted Frauke Coppieters 4/16/2010 2:44:00 PM 55 9

56 57 Page 13: [15] Deleted Frauke Coppieters 4/16/2010 2:46:00 PM 58 59 60 John Wiley & Sons, Inc. Page 63 of 63 Human Mutation

1 2 3 6 4 5 Page 13: [15] Deleted Frauke Coppieters 6/16/2010 5:18:00 PM 6 all patients of this study 7 8 Page 13: [16] Deleted Frauke Coppieters 6/16/2010 6:38:00 PM 9 could be 10 11 12 Page 13: [16] Deleted Frauke Coppieters 4/16/2010 2:59:00 PM 13 in which testing was possible 14 15 Page 13: [16] Deleted Frauke Coppieters 4/16/2010 2:57:00 PM 16 the 17 18 Page 13: [16] DeletedFor Peer Frauke Coppieters Review 4/16/2010 2:57:00 PM 19 of two probands

20 21 Page 13: [17] Deleted Frauke Coppieters 4/16/2010 2:56:00 PM 22 missense

23 24 Page 13: [17] Deleted Frauke Coppieters 4/16/2010 2:57:00 PM 25 in AIPL1

26 27 Page 13: [17] Deleted Frauke Coppieters 6/16/2010 5:20:00 PM 28 describing 29

30 Page 13: [18] Deleted Frauke Coppieters 6/16/2010 5:21:00 PM 31 these 32

33 Page 13: [18] Deleted Frauke Coppieters 6/16/2010 5:20:00 PM 34 changes 35 36 Page 13: [18] Deleted Frauke Coppieters 6/16/2010 5:20:00 PM 37 mutations 38 39 Page 13: [18] Deleted Frauke Coppieters 4/16/2010 3:00:00 PM 40 with LCA 41 42 43 Page 13: [18] Deleted Frauke Coppieters 4/16/2010 3:04:00 PM 44 both 45 46 Page 13: [19] Deleted Frauke Coppieters 6/16/2010 5:22:00 PM 47 compound heterozygous 48 49 Page 13: [19] Deleted Frauke Coppieters 4/16/2010 6:24:00 PM 50 an individual

51 52 Page 13: [19] Deleted Frauke Coppieters 4/16/2010 3:01:00 PM 53 all

54 55 Page 13: [19] Deleted Frauke Coppieters 4/16/2010 3:06:00 PM 56 CORS-1,

57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 64 of 63

1 2 3 Page 13: [20] Deleted Frauke Coppieters 4/16/2010 3:07:00 PM 4 the 5 6 Page 13: [20] Deleted Frauke Coppieters 4/16/2010 3:07:00 PM 7 gene 8 9 10 Page 13: [20] Deleted Frauke Coppieters 6/16/2010 5:23:00 PM 11 in CEP290 12 13 Page 13: [21] Deleted UGent 4/9/2010 11:58:00 AM 14 , 15 16 Page 13: [21] Deleted UGent 4/9/2010 11:58:00 AM 17 and RPGRIP1 (1%) 18 For Peer Review 19 Page 13: [22] Deleted Frauke Coppieters 6/16/2010 5:24:00 PM 20 through

21 22 Page 13: [22] Deleted Frauke Coppieters 6/16/2010 5:25:00 PM 23 analysis

24 25 Page 13: [22] Deleted Frauke Coppieters 4/16/2010 2:41:00 PM 26 The two variants identified in CRX had an uncertain pathogenic potential and were therefore not 27 included in these calculations.

28 29 Page 13: [23] Deleted Frauke Coppieters 6/16/2010 6:38:00 PM 30 31 31

32 Page 13: [23] Deleted Frauke Coppieters 6/16/2010 5:25:00 PM 33 variants/ 34

35 Page 13: [23] Deleted Frauke Coppieters 4/16/2010 3:09:00 PM 36 patients with LCA, EORD, SLS, LCA-JS or CORS 37 38 Page 13: [23] Deleted Frauke Coppieters 4/16/2010 3:08:00 PM 39 . Segregation and thorough bioinformatic evaluation allowed interpretation of these variants 40 41 42 Page 13: [23] Deleted Frauke Coppieters 4/16/2010 1:03:00 PM 43 Table 2 44 45 Page 13: [24] Deleted UGent 4/9/2010 12:10:00 PM 46 the 47 48 Page 13: [24] Deleted UGent 4/9/2010 12:10:00 PM 49 in

50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc.