The Effects of Perfluorooctanoic Acid (PFOA) on Cell Viability and Gene Expression of Peroxisome Proliferator–activated Receptors (PPARs) and Estrogen Receptors (ERs) in MCF-7 Cells

By: April Smith Advising Professor: Dr. Jennifer Cannon, Ph.D. What are MCF-7 cells?

 Human breast cancer cell line that is an invasive ductal carcinoma

 Contain peroxisome proliferator-activated receptors (PPARs) and estrogen receptors

 Commonly used in endocrine disruption studies

 Isolated in 1970 from a 69 year old Caucasian nun What are Estrogen Receptors (ERs)?

 Steroid hormone receptors activated by the hormone estrogen  The activation of ERs stimulates cell proliferation and/or survival  Two isoforms in MCF-7 cells  ERα  ERβ  Exhibit crosstalk with PPARs  ERs bind and repress PPAR regulatory elements  Gene expression of ERα is decreased when PPARγ is bound to an agonist What are peroxisome proliferator- activated receptors (PPARs)?

 Ligand activated transcription factor within all mammalian cells  PPARs have several isoforms in MCF-7 cells • PPARα • PPARβ • PPARγ

 They regulate many genes in the cells that are involved in processes such as… • Proliferation • Inflammation • Differentiation • Metabolism What is perfluorooctanoic acid PFO A (PFOA)? PPA R

 Synthetic, in the class of perfluorinated chemicals (PFCs)  Highly stable  Half life of nearly 4.5 years in the human body  Bioaccumulates  Can be taken in by the body through contact with skin, inhalation, and ingestion  Endocrine disruptor  PFOA is a ligand to PPARs Where are PFCs and PFOA found?

 Trace amounts are found in the water supply  Nonstick coatings of pots and pans  Cosmetics  Flame retardant clothing  Plastics  Meat (fish in particular)  Microwave popcorn PFOA WAS EVEN MENTIONED ON THE SIMPSONS!!!! (Season 21, Episode 6, “Pranks & Greens”) Proposed Questions…

 Does PFOA affect cell viability of MCF-7 cells?

 Does PFOA affect gene expression of ERα or ERβ in MCF-7 cells?

 Does PFOA affect gene expression of PPARα, PPARβ, or PPARγ in MCF-7 cells? Experiment for Testing MCF-7 Cell Viability with PFOA Exposure

+ PFOA MCF-7 Cells One Plate at 24 hours One Plate at 48 hours Two 96-well plates of MCF-7 cells treated with different [PFOA]

CellTiter-Blue® reagent (4h incubation) Synergy HT BioTek Plate Reader MCF-7 cell viability decreases as the time of PFOA exposure and PFOA concentrations increase, but is not significant until 100μM M PFOA at 48hr

1.2 l 1 (p<0.05) o r t 0.8 * n * o 0.6 C

t 0.4 n 24h e 0.2 c r 48h e 0 P Experiment for Testing PPAR & ER Gene Expression with 24h PFOA Exposure

+ PFOA MCF-7 Cells Cells plated and treated for RNA Isolated 24h

Real-time PCR RNA Reverse RNA Quantified for PPAR & ER Transcribed isoforms ERα gene expression is significantly decreased in MCF-7 cells treated for 24h with PFOA

1.2 1 P<0.05

l P<0.05 o

r * t 0.8

n * o C

0.6 t n e

c 0.4 r e

P 0.2 0 CTRL 50uM PFOA 100uM PFOA ERβ Gene Expression Results

 There was not enough ERβ expressed in the MCF-7 cells to garner any significant results

 However, this is not due to PFOA exposure because this was the same outcome for the control samples PPARα gene expression is significantly decreased in MCF-7 cells treated for 24h with PFOA

1.2 P<0.05 l 1 P<0.05 o r * t n 0.8 * o C t 0.6 n e c

r 0.4 e P 0.2 0 CTRL 50uM PFOA 100uM PFOA There is no significant difference in PPARβ gene expression in MCF-7 cells treated with PFOA versus control for 24h

1.2 l o

r 1 t n

o 0.8 C t 0.6 n e c

r 0.4 e

P 0.2 0 CTRL 50uM PFOA 100uM PFOA There is no change in PPARγ gene expression in MCF-7 cells treated for 24h with PFOA versus control

1.2 l 0.8 o r t n 0.4 o C

t 0 n e c r e P Review

 MCF-7 cells are a human invasive breast ductal carcinoma

 PFOA is a known endocrine disruptor that binds to and acts as a ligand to PPARs

 Estrogen Receptors and PPARs exhibit cross talk Conclusion

 Cell viability is significantly reduced in MCF-7 cells treated for 48h with 100μM M PFOA  PPARα and ERα gene expression was significantly decreased at both 50μM M and 100μM M PFOA at 24h of exposure  Neither PPARβ or PPARγ exhibited a significant decrease at 50μM M or 100μM M PFOA during the 24h time period Proposed Mechanism and Do ERα protein Future Studies Is PFOA’s levels actions decrease? mediated by PFOA activation of PPARγ? to ds Bin d … Does an tes iva expression of act anti-apoptotic proteins such Estrogen as Bcl-2 change after exposure? Receptor PPARγ α (ERα)

Is cell death occurring by apoptosis? Anti- apoptotic Apoptosi proteins s Acknowledgements

 The author wishes to acknowledge GRU’s Center for Undergraduate Research and Department of Biological Sciences for funding this project. Also, a special thank you to Dr. Cannon for being such a great research advisor! References  Malony E and Waxman D. “Transactivation of PPAR α and PPAR γ by structurally diverse environmental chemicals.” National Center for Biotechnology Information. U.S. National Library of Medicine, 1 Dec. 1999. Web. 11 Sept. 2014.  Bonofiglio D, Gabriele S, Aquila S, Catalano S, Gentile M, Middea E, Giordano F, and Andò S. "Estrogen receptor α binds to peroxisome proliferator–activated receptor response element and negatively interferes with peroxisome proliferator–activated receptor γ signaling in breast cancer cells." Clinical Cancer Res. American Association for Cancer Research, 30 Nov. 2004. Web. 17 Apr. 2014. .  Peters J, Shah Y, and Gonzalez F. “The Role of Peroxisome Proliferator-activated Receptor in Carcinogenesis and Chemoprevention.” Europe PubMed Central. Nat Rev Cancer, 09 Feb. 2012. Web. 28 May 2014.  Tachibana K, Kobayashi Y, Tanaka T, Tagami M, Sugiyama A, Katayama T, Ueda C, Yamasaki D, Ishimoto K, Sumitomo M, Uchiyama Y, Kohro T, Sakai J, Hamakubo T, Kodama T, and Doi T. "Gene expression profiling of potential peroxisome proliferator-activated receptor (PPAR) target genes in human hepatoblastoma cell lines inducibly expressing different PPAR isoforms." National Center for Biotechnology Information. U.S. National Library of Medicine, 03 Oct. 2005. Web. 25 May 2014. .  Wang X, and Kilgore M. "Signal cross-talk between estrogen receptor alpha and beta and the peroxisome proliferator-activated receptor gamma1 in MDA-MB-231 and MCF-7 breast cancer cells." National Center for Biotechnology Information. U.S. National Library of Medicine, 30 Aug. 2002. Web. 12 Sept. 2014.  Jamie M, Peden-Adams M, Keller J, and Germolec D. "Toxicology of perfluorinated compounds." Environmental Sciences Europe. N.p., 22 Nov. 2011. Web. 12 May 2014. .  Takacs M and Abbott B. "Activation of mouse and human peroxisome proliferator–activated receptors (α, β/δ, γ) by perfluorooctanoic acid and perfluorooctane sulfonate." National Center for Biotech. Info. U.S. National Library of Medicine, 17 Oct. 2006. Web. 10 Apr. 2014. .Kurebayashi J, Otsuki T, Kunisue H, Tanaka K, Yamamoto S, and Sonoo H. "Expression levels of estrogen receptor-α, estrogen receptor-β, coactivators, and corepressors in breast cancer." Clinical Cancer Research. Departments of Breast and Thyroid Surgery [J. K., H. K., K. T., S. Y., H. S.] and Hygiene [T. O.], Kawasaki Medical School, Kurashiki, Okayama 701-0192, Japan, Feb. 2000. Web. 25 May 2014. .  Hölzer J, Midasch O, Rauchfuss K, Kraft M, Reupert R, Angerer J, Kleeschulte P, Marschall N, Wilhelm M. “Biomonitoring of perfluorinated compounds in children and adults exposed to perfluorooctanoate-contaminated drinking water.” Environ Health Perspect 2008, 5:651-657.  Kannan K, Corsolini S, Falandysz J, Fillmann G, Kumar K, Loganathan B, Mohd M, Olivero J, Van Wouwe N, Yang J, Aldous K. “Perfluorooctanesulfonate and related fluorochemicals in human blood from several countries.” Environ Sci Technol 2004, 38:4489-4495.  Berger U, Glynn A, Holmström K, Berglund M, Ankarberg E, Törnkvist A. “Fish consumption as a source of human exposure to perfluorinated alkyl substances in Sweden-analysis of edible fish from Lake Vättern and the Baltic Sea.” Chemosphere 2009, 76:799-804.  Olsen G, Gilliland F, Burlew M, Burris J, Mandel J, Mandel J. “An epidemiological investigation of reproductive hormones in men with occupational exposure to perfluorooctanoic acid.” J Occ Env Med 1998, 40:614-622.  Faddy H, Robinson A, Lee W, Holman N, Monteith G, and Roberts-Thomson S. "Peroxisome proliferator-activated receptor alpha expression is regulated by estrogen receptor alpha and modulates the response of MCF-7 cells to sodium butyrate." National Center for Biotechnology Information. U.S. National Library of Medicine, Feb. 2006. Web. 04 Jan. 2015.  Vladusic E, Hornby A, Guerra-Vladusic F, Lakins J, and Lupa R. "Expression and regulation of estrogen receptor beta in human breast tumors and cell lines." National Center for Biotechnology Information. U.S. National Library of Medicine, Jan.-Feb. 2000. Web. 04 Apr. 2015. .  Clemons, M., and Paul G. "Estrogen and the risk of breast cancer." N engl J med 344.4 (2001): 276-285.  Pettinelli, P. and Videla L. "Up-regulation of PPAR-gamma MRNA expression in the liver of obese patients: an additional reinforcing lipogenic mechanism to SREBP-1c induction." National Center for Biotechnology Information. U.S. National Library of Medicine, May 2011. Web. 12 Mar. 2015. .  “Pranks and Greens”. The Simpsons. 21st Century Fox, 2009. Itunes. Images

 http://biomonitoring.ca.gov/chemicals/perfluorochemicals-pfcs  http://www.oasiscolonics.com/2010/10/there-is-no-such-thing- as-pure-water.html  http://www.thanksmailcarrier.com/2012/11/all-clad-b3-bonded- aluminum-cookware-collection-review.html  http://planetbyn.com/2012/04/19/air-popped-microwave- popcorn/  http://yimuangz.blogspot.com/2012/12/9th-confession- cosmetics.html  http://officesupplygeek.com/ink-review/blue/midnight-blue- fountain-pen-ink-by-papier-plume-in-new-orleans/ Questions ? Figure 1: PPAR & ER Primer Sequences Used in Realtime-PCRs

Gene Forward Primer 5’ to 3’ Reverse Primer 5’ to 3’ Product Size (Base Pairs)

CTATCATTTGCTGTGGAGAT AAGATATCGTCCGGGTG PPARα 121 CG GTT

GTCACACAACGCTATCCGT AGGCATTGTAGATGTGC PPARβ 143 TT TTGG

ACAGACAAATCACCATTCG CTCTTTGCTCTGCTCCT PPARγ 104 T G

AGACATGAGAGCTGCCAA GCCAGGCACATTCTAGA ERα 299 CC AGG

TCACATCTGTATGCGGAAC CGTAACACTTCCGAAGT ERβ 346 C CGG Figure 2: PPAR Primer Sequence Validation Gels Figure 3: Estrogen Receptor Primer Sequence Validation Gels