DOCSLIB.ORG

(Title of the Thesis)*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(Title of the Thesis)* University of Huddersfield Repository Ali, Antasar Mohamed Biochemical Characterization of a Novel Mammalian Polyphosphate Dependent Glucokinase Original Citation Ali, Antasar Mohamed (2016) Biochemical Characterization of a Novel Mammalian Polyphosphate Dependent Glucokinase. Doctoral thesis, University of Huddersfield. This version is available at http://eprints.hud.ac.uk/id/eprint/32663/ The University Repository is a digital collection of the research output of the University, available on Open Access. Copyright and Moral Rights for the items on this site are retained by the individual author and/or other copyright owners. Users may access full items free of charge; copies of full text items generally can be reproduced, displayed or performed and given to third parties in any format or medium for personal research or study, educational or not-for-profit purposes without prior permission or charge, provided: • The authors, title and full bibliographic details is credited in any copy; • A hyperlink and/or URL is included for the original metadata page; and • The content is not changed in any way. For more information, including our policy and submission procedure, please contact the Repository Team at: [email protected]. http://eprints.hud.ac.uk/ BIOCHEMICAL CHARACTERIZATION OF A NOVEL MAMMALIAN POLYPHOSPHATE DEPENDENT GLUCOKINASE By Antasar Mohamed Ali Supervisor Dr.Shamus Burns A thesis submitted to the University of Huddersfield in partial fulfilment of the requirements for the degree of Doctor of Philosophy The University of Huddersfield (2016) i Declaration I hereby declare that this submission is my own work and that, to the best of my knowledge and belief, it contains no material previously published or written by another person nor material which has been accepted for the award of any other degree or diploma of the university or other institute of higher learning, except where due acknowledgment has been made in the text. ii Acknowledgement I am indebted to many people who have helped me throughout the course of this thesis. I have had a huge opportunity to learn and apply my theoretical and practical knowledge in accomplishing this research. First of all I would like to thank my family for giving me inspiration and support all the way through and for patiently helping me to handle the stress in critical stages of this thesis. I would like to pay my heartiest gratitude to my great supervisor Dr Shamus Burns for his continuous support, guidance and advice to complete the research. His directions and cooperation enlightened me to accomplish this thesis to fulfil particular research objectives. Therefore, I’m really indebted to him. I pay heartiest gratitude to my friends and my fellow workmates for giving me inspiration and continuous support in way of completing this thesis. Finally, thanks to everyone whoever, directly and indirectly supported me in completing my thesis. Without their support and contribution, it would be hard to complete my research. iii Abstract Hexokinases are a family of enzymes that catalyse the phosphorylation of glucose by transferring the γ- phosphoryl group from adenosine triphosphate (ATP) to the sixth position hydroxyl group of glucose to generate Glucose 6-phosphate (G6P). Until now, five isozymes of mammalian hexokinase (HK) have been described: types I, II, III and IV, all of them ATP dependent, and type V which is ADP-dependent. The present thesis describes a novel hexokinase, we have designated as PPGKm. The enzyme is strictly polyphosphate (pp) dependent, is correctly defined as a glucokinase (GK), by virtue of its kinetics and is present in mammalian tisues, at high activity in liver. The enzyme does not use ATP and ADP and indeed appears to be inhibited by them. As far as can be ascertained this is the first description of a mammalian enzyme using inorganic polyphosphate as a phosphoryl donor. Polyphosphate is used as phosphoryl donor in bacterial systems and is quite well characterized, although only two micro-organisms have been shown to be strictly pp- dependent like the one described here. This novel enzyme (PPGKm) also showed unique features, differing from the others hexokinases in having a longer half-life and can be stored for several months at -20˚C without loss of activity. However, thermal stability was lower than other hexokinases studied. The enzyme activity is concentrated in the hepatocyte nucleus has a higher molecular weight compared to Hexokinases 1, 2 and 3. The full biological significance of the enzyme is as yet unclear, and attempts to purify and sequence it have been only partly successful. Its specific role in cellular, and especailly nuclear metabolism remains unknown. iv Abbreviations ADP Adenosine diphosphate ANOVA Analysis of variance AP4A Diadenosin tetraphosphate AP5A Diadenosin pentaphosphate ATP Adenosine triphosphate CTP Cyctidine triphosphate DAPI 4',6-diamidino-2-phenylindole Ddppk1 Eukaryotes homolog to bacterial polyphosphate kinase1. DH2O Distilled water D2O Deuterium oxide DTE 1, 4-Dithioerythritol DTT Dithiothreitol ESI-MS Electrospray ionization mass-spectroscopy F1P Fructose 1 phosphate F6P Fructose 6 phosphate FGF Fibroblast growth factor FK Fructokinase G1P Glucose 1phosphate G6P Glucose 6 phosphate GK Glucokinase GKRP Glucokinase regulatory protein GTP Guanosin triphosphate HK Hexokinase HKDC1 Hexokinase domain containing 1 HMP Hexamethaphosphate HPLC High pressure liquid chromatography HSP70 Heat shock protein70 LC-MS/MS Liquid chromatography mass-spectroscopy MCF7 Human carcinoma cell line mTOR Mammalian target of rapamycine MODY2 Maturity onset diabetes of the young type2 MS Masss-pectroscopy NAD Nicotinamine adenine dinucleotide (oxidized form) NADH Nicotinamine adenine dinucleotide (reduced form) NDK Nucleotide diphosphate kinase Na HEPES Sodium salt (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) NMR Nuclear magnetic resonance PAP Polyphosphate: AMP phosphotransferase PCs Human plasma cells Pi Inorganic phosphate v P700 Polyphosphate of 700 chain length PBS Phosphate buffer saline PHB Polyhydroxybutyrate Poly-Pi60 Polyphosphate has chain length of 60 phosphates PPGK Polyphosphate glucokinase PPGKm Mammalian polyphosphate glucokinase Poly-Pi Polyphosphate PPK1 Polyphosphate kinase 1 PPX Exoployphosphatase Pvds RNA polymerase Sigma factor gene of Pseudomonas aeruginosa . RecA Gene encodes DNA-recombinase Rpos Gene which encodes RNA polymerase sigma factor SDS-PAGE Sodium dodecyl sulphate- polyacrylamide gel electrophoresis SOS Global response to DNA damage TOR Target of rapamycine Tri-P Tripoly phosphate Tris (hydroxymethyl) aminomethane TSP Trimethlsilyl propanoic acid UTP Uridine triphosphate VDAC Voltage -dependent anion channel vi Units: µg Microgram mg Milligram mM Millimolar mL Milliliter ˚C Degree celsius V/V Volume/Volume W/V Weight /Volume IU International unit Ppm Part per million vii Table of Contents Declaration ........................................................................................................................................... ii Acknowledgement ............................................................................................................................... iii Abstract ................................................................................................................................................iv Abbreviations ........................................................................................................................................ v Table of Contents .............................................................................................................................. viii List of Figures..................................................................................................................................... xii List of Tables ......................................................................................................................................xvi Chapter 1 Introduction ........................................................................................................................... 1 Part One: Evolution of Hexokinases Isoenzymes and their regulatory role ................................ 1 1.1.1 Sugar specificity and naming conventions ................................................................................... 2 1.1.2 Molecular mass of hexokinases in different phyla ....................................................................... 4 1.1.3 Tissue distribution of hexokinase isoenzymes in mammalian systems ........................................ 5 1.1.4 Subcellular Distribution of Isoenzymes ....................................................................................... 7 Part Two: Introduction to polyphosphate .................................................................................. 20 1.2.1 The main functions of polyphosphate in cells of living organisms ............................................ 21 1.2.2 Intracellular polyphosphate levels and subcellular distribution ................................................. 29 1.2.3 Main enzymes of polyphosphate metabolism............................................................................. 32 1.2.4 Applications of polyphosphate ................................................................................................... 43 1.2.5 Various forms of Polyphosphate in cells ...................................................................................
Load more

Recommended publications
  • Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans
    Am J Hum Genet 28:9-17, 1976 Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans CHING J. CHERN1 AND ERNEST BEUTLER2 Pyridoxine kinase (PNK; EC 2.7.1.35) catalyzes the phosphorylation of pyridox- ine to its active coenzyme form, pyridoxine phosphate: pyridoxine + ATP - + pyridoxine phosphate + ADP. The same enzyme catalyzes the phosphorylation of pyridoxal to pyridoxal phos- phate. Previous communications [1, 21 have shown that the average PNK activity in red cells of American blacks is significantly lower than that of American whites; in contrast, the activities of the enzyme in lymphocytes, granulocytes, and cultured skin fibroblasts from black subjects are the same as those from whites. To gain a better understanding of the genetics of the red cell PNK of blacks, the size of our population survey has been expanded, and some limited family studies have been carried out. To determine whether the enzyme deficiency of black subjects is due to a structural gene mutation or regulatory mutation, we have investigated further the biochemical characteristics of PNK in red cells of white and black donors. The results of our investigations suggest that low red cell PNK activity may be coded by a single structural allele which results in the pro- duction of an enzyme with reduced in vivo stability. MATERIALS AND METHODS Pyridoxine kinase activity was estimated by measuring MH-pyridoxine-5'-phosphate as described previously [3]. Assay results were found to be highly reproducible in the same subject at different times. The red cells of one normal white subject were assayed four times over a 2 month period.
    [Show full text]
  • Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
    Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14).
    [Show full text]
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
    [Show full text]
  • Polymerase Ribozyme with Promoter Recognition
    In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World.
    [Show full text]
  • A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions
    A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions Pamela Kanellis1,2, Mark Gagliardi1, Judit P. Banath3, Rachel K. Szilard1, Shinichiro Nakada1, Sarah Galicia1, Frederic D. Sweeney1,2, Diane C. Cabelof4, Peggy L. Olive3, Daniel Durocher1,2* 1 Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada, 2 Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario, Canada, 3 British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada, 4 Karmanos Cancer Institute, Detroit, Michigan, United States of America Genome instability is a hallmark of cancer cells. One class of genome aberrations prevalent in tumor cells is termed gross chromosomal rearrangements (GCRs). GCRs comprise chromosome translocations, amplifications, inversions, deletion of whole chromosome arms, and interstitial deletions. Here, we report the results of a genome-wide screen in Saccharomyces cerevisiae aimed at identifying novel suppressors of GCR formation. The most potent novel GCR suppressor identified is BUD16, the gene coding for yeast pyridoxal kinase (Pdxk), a key enzyme in the metabolism of pyridoxal 59 phosphate (PLP), the biologically active form of vitamin B6. We show that Pdxk potently suppresses GCR events by curtailing the appearance of DNA lesions during the cell cycle. We also show that pharmacological inhibition of Pdxk in human cells leads to the production of DSBs and activation of the DNA damage checkpoint. Finally, our evidence suggests that PLP deficiency threatens genome integrity, most likely via its role in dTMP biosynthesis, as Pdxk-deficient cells accumulate uracil in their nuclear DNA and are sensitive to inhibition of ribonucleotide reductase.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Identifying and Characterizing Genes Involved in Telomere Length
    Tel Aviv University George S. Wise Faculty of Life Sciences Graduate School The Department of Molecular Microbiology and Biotechnology Identifying and Characterizing Genes Involved in Telomere Length Regulation in Saccharomyces cerevisiae Thesis submitted to the Senate of Tel Aviv University For the degree "Doctor of Philosophy (Ph.D.)" Submitted by Tal Yehuda Under the supervision of The deceased Dr. Anat Krauskopf and Prof. Martin Kupiec May 2008 עבודת המחקר שלי ארכה זמן רב, הן בגלל הנסיבות המיוחדות במעבדה והן בגלל סוג המחקר שבחרתי, לכן אני רוצה להודות לכל האנשים שליוו אותי בדרך ארוכה זו: החל מהמנחה הראשונה שלי- ענת קראוסקופף ז"ל, תודה על ההיכרות האישית והמדעית, למרטין קופייק- על הסבלנות הבלתי נלאית ללמד, לחנך ולהרביץ בי תורה, יישר כח! (תדע שהקשבתי לכל מילה), לחברי המעבדה- הישנים והחדשים, ובמיוחד לך יובל, תודה על העזרה ועל שיתוף הפעולה, למשפחתי העניפה- סבתותי, דודיי, חמיי, גיסותיי, הוריי ואחיי הנפלאים שהתעניינתם ושאלתם (גם אם ההסברים נשמעו לרוב עלומים), בעזרתכם הרבה סיימתי סוף סוף, ובמיוחד לבעלי האהוב- תודה על הכל ! וילדי היקרים לי מכל... ABSTRACT Telomeres are nucleoprotein structures present at the ends of eukaryotic chromosomes. Telomeres play a central role in guarding the integrity of the genome by protecting chromosome ends from degradation and fusion. Regulation of telomere length is central to their function. In order to broaden our knowledge about the mechanisms that control telomere length, we have carried out a systematic examination of ~4800 haploid deletion mutants of Saccharomyces cerevisiae for telomere-length alterations. Using this screen we have identified more than 150 new genes that affect telomere length. A novel array-based method for creating double mutants was used to sort the newly identified genes into epistasis groups.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • A Dissection of SARS‑Cov2 with Clinical Implications (Review)
    INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 489-508, 2020 A dissection of SARS‑CoV2 with clinical implications (Review) FELICIAN StanCIOIU1, GEORGIOS Z. PapaDAKIS2, STELIOS KTENIADAKIS3, BORIS NIKovaeviCH Izotov4, MICHAEL D. COLEMAN5, DEMETRIOS A. SpanDIDOS6 and ARISTIDIS TsatsaKIS4,7 1Bio‑Forum Foundation, 030121 Bucharest, Romania; 2Department of Radiology, Medical School, University of Crete, 71003 Heraklion; 3Emergency Department, Venizeleion General Hospital, 71409 Heraklion, Greece; 4Department of Analytical and Forensic Medical Toxicology, Sechenov University, 119991 Moscow, Russia; 5School of Life and Health Sciences, Aston University, B4 7ET Birmingham, UK; 6Laboratory of Clinical Virology, Medical School, 7Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, 71003 Heraklion, Greece Received May 15, 2020; Accepted June 9, 2020 DOI: 10.3892/ijmm.2020.4636 Abstract. We are being confronted with the most consequen- 1. Clinical aspects of COVID‑19 infections; acute respi‑ tial pandemic since the Spanish flu of 1918‑1920 to the extent ratory distress syndrome (ARDS); known and potential that never before have 4 billion people quarantined simultane- treatments ously; to address this global challenge we bring to the forefront the options for medical treatment and summarize SARS‑CoV2 In China, the first comprehensive analysis published on the structure and functions, immune responses and known treat- COVID‑19 (1) included 44,672 cases and 1,023 deaths, with an ments. Based on literature and our own experience we propose overall case-fatality rate (CFR) of 2.3%. There were 0 deaths new interventions, including the use of amiodarone, simv- in patients 9 years old or younger, and the CFR increased with astatin, pioglitazone and curcumin.
    [Show full text]
  • Structure-Function Studies of Enzymes from Ribose Metabolism
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko,
    [Show full text]
  • Inorganic Polyphosphate in Mammals: Where’S
    Biochemical Society Transactions (2020) https://doi.org/10.1042/BST20190328 Review Article Inorganic polyphosphate in mammals: where’s Wally? Downloaded from https://portlandpress.com/biochemsoctrans/article-pdf/doi/10.1042/BST20190328/867675/bst-2019-0328c.pdf by University College London (UCL) user on 19 February 2020 Yann Desfougères, Adolfo Saiardi and Cristina Azevedo Medical Research Council Laboratory for Molecular Cell Biology, University College London, London, U.K. Correspondence: Adolfo Saiardi ([email protected]) Inorganic polyphosphate (polyP) is a ubiquitous polymer of tens to hundreds of ortho- phosphate residues linked by high-energy phosphoanhydride bonds. In prokaryotes and lower eukaryotes, both the presence of polyP and of the biosynthetic pathway that leads to its synthesis are well-documented. However, in mammals, polyP is more elusive. Firstly, the mammalian enzyme responsible for the synthesis of this linear biopolymer is unknown. Secondly, the low sensitivity and specificity of available polyP detection methods make it difficult to confidently ascertain polyP presence in mammalian cells, since in higher eukaryotes, polyP exists in lower amounts than in yeast or bacteria. Despite this, polyP has been given a remarkably large number of functions in mammals. In this review, we discuss some of the proposed functions of polyP in mammals, the lim- itations of the current detection methods and the urgent need to understand how this polymer is synthesized. Introduction Arthur Kornberg and Igor Kulaev spent a large part of their careers working on inorganic polyphos- phate (polyP). Convinced of the fundamental importance of this ‘forgotten polymer’, they and their teams developed tools to study polyP in a wide range of organisms from bacteria to mammals [1,2].
    [Show full text]
  • 200703 Supplemental Magnani Et Al Clean Version
    Supplemental Data Sleeping Beauty-engineered CAR T cells achieve anti-leukemic activity without severe toxicities Chiara F. Magnani, Giuseppe Gaipa, Federico Lussana, Daniela Belotti, Giuseppe Gritti, Sara Napolitano, Giada Matera, Benedetta Cabiati, Chiara Buracchi, Gianmaria Borleri, Grazia Fazio, Silvia Zaninelli, Sarah Tettamanti, Stefania Cesana, Valentina Colombo, Michele Quaroni, Giovanni Cazzaniga, Attilio Rovelli, Ettore Biagi, Stefania Galimberti, Andrea Calabria, Fabrizio Benedicenti, Eugenio Montini, Silvia Ferrari, Martino Introna, Adriana Balduzzi, Maria Grazia Valsecchi, Giuseppe Dastoli, Alessandro Rambaldi, Andrea Biondi Table of Contents: Supplemental Methods ...................................................................................................... 2 Supplemental Figure 1. .................................................................................................... 13 Supplemental Figure 2. .................................................................................................... 14 Supplemental Figure 3. .................................................................................................... 15 Supplemental Figure 4. .................................................................................................... 16 Supplemental Figure 5. .................................................................................................... 17 Supplemental Figure 6. .................................................................................................... 18 Supplemental
    [Show full text]