DOCSLIB.ORG

Vitamin B6 Metabolism and Regulation of Pyridoxal Kinase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Vitamin B6 Metabolism and Regulation of Pyridoxal Kinase Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2009 VITAMIN B6 METABOLISM AND REGULATION OF PYRIDOXAL KINASE Amit Gandhi Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Chemicals and Drugs Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2008 This Dissertation is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. © Amit K. Gandhi 2009 All Rights Reserved VITAMIN B 6 METABOLISM AND REGULATION OF PYRIDOXAL KINASE A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at Virginia Commonwealth University. By AMIT K. GANDHI M.S (Pharmaceutical Science), Rajiv Gandhi University, Indore, India, 2003 B.Pharm, Rajiv Gandhi University, Indore, India, 2001 Director: Martin K. Safo, Ph.D Assistant Professor, Department of Medicinal Chemistry Virginia Commonwealth University Richmond, Virginia December, 2009 Acknowledgement I would like to take this opportunity to express my deep gratitude and profound respect to my advisor, Dr. Martin K. Safo, for his supervision, advice, and guidance in this research work. His support and insight have been invaluable in the progression of my research. I also appreciate his words of encouragement, which kept me always in an innovative mood and guided me at all the times to bring about the best in me. He is my mentor and teacher whom I shall remember forever. I sincerely acknowledge Dr. Jason P. Rife, Dr. Glen E. Kellogg, Dr. Darrell L. Peterson and Dr. Walter M. Holmes for serving as my graduate committee members and for their advice, supervision, and support throughout my research. I extend my sincere thanks to Dr. Faik N. Musayev for teaching me various protein purification and crystallographic techniques. My heartfelt thanks go to Dr. Mohini S. Ghatage, who helped me in protein expression, purification, and enzyme kinetic studies. I would like to thank Dr. Richmond Danso-Danquah, who helped me in synthesis studies. iii I gratefully acknowledge Dr. Verne Schirch for his constant guidance and motivation throughout my research. I would also like to convey my regards and thanks to Dr. Donald J. Abraham, for the financial support provided to me. I can not express my emotions to my family, my wife, my parents, and my brother, who have provided countless moments of inspiration and motivation to achieve my goals. I also owe thanks to my all friends and all my well wishers, who have always inspired me for success. I also thank Institute for Structural Biology and Drug Discovery (ISBDD) for providing me all the necessary facilities and resources. Finally, I am grateful to the Department of Medicinal Chemistry, School of Pharmacy for giving me teaching assistantship and opportunity to perform research work. iv Table of Contents Page Acknowledgements............................................................................................................iii List of Tables .................................................................................................................... ix List of Figures ..................................................................................................................... x Abstract…….. .................................................................................................................. xiv Chapter 1 General Introduction .............................................................................................. 1 1.1 Pathways of Vitamin B 6 Metabolism…………………………………...1 1.2 Structure and Function of Pyridoxal Kinase…………………………... 3 1.3 Catalytic Mechanism of Pyridoxal Kinase …………………………... 4 1.4 Pyridoxine 5’-Phosphate Oxidase …………………………………….. 5 1.5 Vitamin B 6 Requiring Enzymes……………………………………….. 6 1.6 Vitamin B 6 Enzymes, Neurotransmitters and Brain Function………….8 1.7 PLP and Vitamin B 6 Toxicity ………………………………………… 9 1.8 MgATP Substrate Inhibition of PL Kinase in the presence of PLP ......10 1.9 Vitamin B 6 Deficiency ………………………………………………...10 1.10 PL Kinase Inhibitors and PLP Deficiency……………….…………...11 1.11 Genetic Defects in PL Kinase or PNP Oxidase and PLP Deficiency. .12 1.12 Other Disorders Associated with Vitamin B 6 Deficiency…………... 13 v 1.13 Conclusion……………………………..……………………………. 14 2 Determine the Kinetic and Structural Properties of Human PL Kinase………… 16 2.1 Introduction…………………………………………………………... 16 2.2 Methods 2.2.1 Expression and Purification of Human PL Kinase………………… 17 2.2.2 Determination of Kinetic Constants of PL and MgATP…………… 18 2.2.3 Human PL kinase Activity in the Presence of Monovalent Cations.. 18 2.2.4 Crystallization and Structure Determination of Human PL Kinase… 18 2.3 Results and Discussion 2.3.1 Kinetic Constants and Synergism Between PL and ATP…………… 22 2.3.2 Effect of Different Monovalent Metals on Human PL Kinase activity…………………………………………………… 26 2.3.3 Structural Studies……………………………………………………. 26 2.4 Conclusion…………………………………………………………….. 34 3 Determine the Role of the Active site Residues Asp235 in PL Kinase Catalytic Function ………………………………………………………….…… 36 3.1 Introduction…………………………………………………………… 36 3.2 Methods 3.2.1 Site-directed Mutagenesis and purification of enzymes……………. 37 3.2.2 Determination of Kinetic Constants ………………………………... 38 vi 3.2.3 Crystallization, Data Collection, and Structure Determination ……. 38 3.3 Results and Discussion………………………………………………. 42 3.4 Conclusion……………………………………………………………. 48 4 Determine the Method of Kinetic Regulation of PL Kinase … ……………… 49 4.1 Introduction…………………………………………………………… 49 4.2 Methods 4.2.1 MgATP Substrate Inhibition Studies ……………………………… 50 4.2.2 ADP Product Inhibition Studies …………………………………..... 51 4.2.3 Crystallization, Data Collection, and Structure Determination ……..51 4.3 Results and Discussion 4.3.1 Severe MgATP Substrate Inhibition of PL Kinase in the Presence of PLP and Evidence of Tight PLP Binding in PL Kinase……….. 51 4.3.2 ADP Product Inhibition of PL Kinase……………………………… 57 4.3.3 MgATP and PLP Bind to PL Kinase to Form a Ternary complex…. 57 4.4 Conclusion …………………………………………………………… 62 5 Identify Drugs and Other Compounds that are Inhibitors of Pyridoxal Kinase .… 63 5.1 Introduction…………………………………………………………… 63 5.2 Methods 5.2.1 Selection of Compounds for Inhibition Study ……………………. 63 5.2.2 Determination of Inhibition Constants …………………………….. 64 vii 5.2.3 Crystallization, Data Collection, and Structure Determination ……. 65 5.3 Results and Discussion 5.3.1 Inhibition studies ………………………………………………….... 69 5.3.2 Structure of PL kinase-Inhibitor Complex …………………………. 71 5.4 Conclusion …………………………………………………………… 76 References……………………………………………………………………………….. 77 VITA…………….……………………………………………………………………….. 93 viii List of Tables Page Table 1: Data collection and refinement statistics for the hPL kinase crystals................ 21 Table 2: Kinetic parameters of human PL kinase substrates (in µM)………………..…..23 Table 3: Crystal information, data collection and refinement parameters of D235A and D235N mutants............................................................................................. 41 Table 4: Kinetic parameters of hPL kinase wild type and D235A and D235N mutants ...42 Table 5: Refinement parameters for the human PL kinase structure with bound ATP and PLP. .............................................................................................................. 53 Table 6: Refinement parameters for the human PL kinase structure with bound theophylline ........................................................................................................ 68 Table 7: Kinetic parameters of human PL kinase inhibition by drugs ……..………..…..70 ix List of Figures Page Figure 1: Structures of the six B6 vitamers . ........................................................................... 1 Figure 2: Scheme for the salvage pathway of vitamin B 6 metabolism ….………………..…… 2 Figure 3: PL kinase catalyzed reaction . ................................................................................. 3 Figure 4: Homodimeric structure of ePL kinase with bound PL (grey) and ATP ( blue) . ......... 4 Figure 5: Reaction catalyzed by PNP oxidase ........................................................................ 5 Figure 6: Homodimeric structure of ePNP oxidase with bound FMN (red) and PLP (brown). 6 Figure 7: Synthesis of neurotransmitters by B 6 enzymes (colored red) ..................................... 9 Figure 8: Binding equilibria for human PL kinase substrates . ............................................... 22 Figure 9: Determination of KA. ........................................................................................... 24 Figure 10: Determination of KB. ......................................................................................... 24 Figure 11: Determination of αK A. ....................................................................................... 25 Figure 12: Determination of αK B. ....................................................................................... 25 Figure 13: Activity of human PL kinase in the presence of either Na + or K +. ......................... 26 Figure 14: Overall structure of hPL kinase. ( A) The monomeric structure with bound ATP (stick), MPD (stick), Na + (brown sphere), and Mg 2+ (magenta sphere) at the active site. α- Helices
Load more

Recommended publications
  • Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans
    Am J Hum Genet 28:9-17, 1976 Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans CHING J. CHERN1 AND ERNEST BEUTLER2 Pyridoxine kinase (PNK; EC 2.7.1.35) catalyzes the phosphorylation of pyridox- ine to its active coenzyme form, pyridoxine phosphate: pyridoxine + ATP - + pyridoxine phosphate + ADP. The same enzyme catalyzes the phosphorylation of pyridoxal to pyridoxal phos- phate. Previous communications [1, 21 have shown that the average PNK activity in red cells of American blacks is significantly lower than that of American whites; in contrast, the activities of the enzyme in lymphocytes, granulocytes, and cultured skin fibroblasts from black subjects are the same as those from whites. To gain a better understanding of the genetics of the red cell PNK of blacks, the size of our population survey has been expanded, and some limited family studies have been carried out. To determine whether the enzyme deficiency of black subjects is due to a structural gene mutation or regulatory mutation, we have investigated further the biochemical characteristics of PNK in red cells of white and black donors. The results of our investigations suggest that low red cell PNK activity may be coded by a single structural allele which results in the pro- duction of an enzyme with reduced in vivo stability. MATERIALS AND METHODS Pyridoxine kinase activity was estimated by measuring MH-pyridoxine-5'-phosphate as described previously [3]. Assay results were found to be highly reproducible in the same subject at different times. The red cells of one normal white subject were assayed four times over a 2 month period.
    [Show full text]
  • Pyridoxal Phosphate Is Better Than Pyridoxine for Controlling Idiopathic Intractable Epilepsy
    512 ORIGINAL ARTICLE Arch Dis Child: first published as 10.1136/adc.2003.045963 on 25 April 2005. Downloaded from Pyridoxal phosphate is better than pyridoxine for controlling idiopathic intractable epilepsy H-S Wang, M-F Kuo, M-L Chou, P-C Hung, K-L Lin, M-Y Hsieh, M-Y Chang ............................................................................................................................... Arch Dis Child 2005;90:512–515. doi: 10.1136/adc.2003.045963 Aim: To study the difference between pyridoxine (PN) and its active form, pyridoxal phosphate, (PLP) in control of idiopathic intractable epilepsy in children. Methods: Among 574 children with active epilepsy, 94 (aged 8 months to 15 years) were diagnosed with idiopathic intractable epilepsy for more than six months. All received intravenous PLP 10 mg/kg, then 10 mg/kg/day in four divided doses. If seizures recurred within 24 hours, another dose of 40 mg/kg was See end of article for given, followed by 50 mg/kg/day in four divided doses. For those patients whose seizures were totally authors’ affiliations controlled, PLP was replaced by the same dose of oral PN. If the seizure recurred, intravenous PLP was ....................... infused followed by oral PLP 50 mg/kg/day. Correspondence to: Results: Fifty seven patients had generalised seizures (of whom 13 had infantile spasms) and 37 had focal Dr M-F Kuo, Division of seizure. Eleven had dramatic and sustained responses to PLP; of these, five also responded to PN. Within (Pediatric) Neurosurgery, six months of treatment with PLP or PN, five of the 11 patients were seizure free and had their previous Department of Surgery, National Taiwan University antiepileptic medicine tapered off gradually.
    [Show full text]
  • A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions
    A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions Pamela Kanellis1,2, Mark Gagliardi1, Judit P. Banath3, Rachel K. Szilard1, Shinichiro Nakada1, Sarah Galicia1, Frederic D. Sweeney1,2, Diane C. Cabelof4, Peggy L. Olive3, Daniel Durocher1,2* 1 Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada, 2 Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario, Canada, 3 British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada, 4 Karmanos Cancer Institute, Detroit, Michigan, United States of America Genome instability is a hallmark of cancer cells. One class of genome aberrations prevalent in tumor cells is termed gross chromosomal rearrangements (GCRs). GCRs comprise chromosome translocations, amplifications, inversions, deletion of whole chromosome arms, and interstitial deletions. Here, we report the results of a genome-wide screen in Saccharomyces cerevisiae aimed at identifying novel suppressors of GCR formation. The most potent novel GCR suppressor identified is BUD16, the gene coding for yeast pyridoxal kinase (Pdxk), a key enzyme in the metabolism of pyridoxal 59 phosphate (PLP), the biologically active form of vitamin B6. We show that Pdxk potently suppresses GCR events by curtailing the appearance of DNA lesions during the cell cycle. We also show that pharmacological inhibition of Pdxk in human cells leads to the production of DSBs and activation of the DNA damage checkpoint. Finally, our evidence suggests that PLP deficiency threatens genome integrity, most likely via its role in dTMP biosynthesis, as Pdxk-deficient cells accumulate uracil in their nuclear DNA and are sensitive to inhibition of ribonucleotide reductase.
    [Show full text]
  • Effect of Theophylline and Enprofylline on Bronchial Hyperresponsiveness
    Thorax: first published as 10.1136/thx.44.12.1022 on 1 December 1989. Downloaded from Thorax 1989;44:1022-1026 Effect of theophylline and enprofylline on bronchial hyperresponsiveness G H KOETER, J KRAAN, M BOORSMA, J H G JONKMAN, TH W VAN DER MARK From the Department ofPulmonology and Lung Function, University Hospital, Groningen; Pharma Bio Research, Assen; and Astra Pharmaceutica, Rijswijk, The Netherlands ABSTRACT The effect of increasing intravenous doses of theophylline and enprofylline, a new xanthine derivative, on bronchial responsiveness to methacholine was studied in eight asthmatic patients. Methacholine provocations were carried out on three days before and after increasing doses of theophylline, enprofylline, and placebo, a double blind study design being used. Methacholine responsiveness was determined as the provocative concentration of methacholine causing a fall of 20% in FEV, (PC20). The patients were characterised pharmacokinetically before the main study to provide an individual dosage scheme for each patient that would provide rapid steady state plasma concentration plateaus of 5, 10, and 15 mg/l for theophylline and 1 25, 2 5, and 3-75 mg/l for enprofylline. Dose increments in the main study were given at 90 minute intervals. FEV, showed a small progressive decrease after placebo; it remained high in relation to placebo after both drugs and this effect was dose related. Methacholine PC20 values decreased after placebo; mean values were (maximum difference 2-0 and 1 7 higher after theophylline and enprofylline than after placebo copyright. doubling doses of methacholine); the effect of both drugs was dose related. Thus enprofylline and theophylline when given intravenously cause a small dose related increase in FEV1 and methacholine PC20 when compared with placebo.
    [Show full text]
  • Composition: Each
    ______________________________________________________________________________________________________________ Composition: Each Tablet Contains L-Methylfolate 1mg Mecobalamin 1500 mcg Pyridoxal 5’-phosphate 0.5mg Pharmacokinetic properties: L-methylfolate is a water soluble molecule which is primarily excreted via the kidneys. In a study of subjects with coronary artery disease (n=21), peak plasma levels were reached in 1-3 hours following ORAL/PARENTERAL administration. Peak concentrations of L-methylfolate were found to be more than seven times higher than folic acid (129 ng ml-1 vs. 14.1 ng ml-1) following ORAL/PARENTERAL administration. The mean elimination half-life is approximately 3 hours after 5mg of oral L- methylfolate, administered daily for 7 days. The mean values for Cmax, Tmax, and AUC0-12 were 129 ng ml-1, 1.3 hr., and 383 respectively. Red blood cells (RBCs) appear to be the storage depot for folate, as RBC levels remain elevated for periods in excess of 40 days following discontinuation of supplementation. Plasma protein binding studies showed that L-methylfolate is 56% bound to plasma proteins. Mecobalamin substances bind to intrinsic factor; a glycoprotein secreted by the gastric mucosa, and are then actively absorbed from the gastrointestinal tract. Absorption is impaired in patients with an absence of intrinsic factor, with a malabsorption syndrome or with disease or abnormality of the gut, or after gastrectomy. Absorption from the gastrointestinal tract can also occur by passive diffusion; little of the vitamin present in food is absorbed in this manner although the process becomes increasingly important with larger amounts such as those used therapeutically. After intranasal dosage, peak plasma concentrations of cyanocobalamin have been reached in 1 to 2 hours.
    [Show full text]
  • Identifying and Characterizing Genes Involved in Telomere Length
    Tel Aviv University George S. Wise Faculty of Life Sciences Graduate School The Department of Molecular Microbiology and Biotechnology Identifying and Characterizing Genes Involved in Telomere Length Regulation in Saccharomyces cerevisiae Thesis submitted to the Senate of Tel Aviv University For the degree "Doctor of Philosophy (Ph.D.)" Submitted by Tal Yehuda Under the supervision of The deceased Dr. Anat Krauskopf and Prof. Martin Kupiec May 2008 עבודת המחקר שלי ארכה זמן רב, הן בגלל הנסיבות המיוחדות במעבדה והן בגלל סוג המחקר שבחרתי, לכן אני רוצה להודות לכל האנשים שליוו אותי בדרך ארוכה זו: החל מהמנחה הראשונה שלי- ענת קראוסקופף ז"ל, תודה על ההיכרות האישית והמדעית, למרטין קופייק- על הסבלנות הבלתי נלאית ללמד, לחנך ולהרביץ בי תורה, יישר כח! (תדע שהקשבתי לכל מילה), לחברי המעבדה- הישנים והחדשים, ובמיוחד לך יובל, תודה על העזרה ועל שיתוף הפעולה, למשפחתי העניפה- סבתותי, דודיי, חמיי, גיסותיי, הוריי ואחיי הנפלאים שהתעניינתם ושאלתם (גם אם ההסברים נשמעו לרוב עלומים), בעזרתכם הרבה סיימתי סוף סוף, ובמיוחד לבעלי האהוב- תודה על הכל ! וילדי היקרים לי מכל... ABSTRACT Telomeres are nucleoprotein structures present at the ends of eukaryotic chromosomes. Telomeres play a central role in guarding the integrity of the genome by protecting chromosome ends from degradation and fusion. Regulation of telomere length is central to their function. In order to broaden our knowledge about the mechanisms that control telomere length, we have carried out a systematic examination of ~4800 haploid deletion mutants of Saccharomyces cerevisiae for telomere-length alterations. Using this screen we have identified more than 150 new genes that affect telomere length. A novel array-based method for creating double mutants was used to sort the newly identified genes into epistasis groups.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • A Dissection of SARS‑Cov2 with Clinical Implications (Review)
    INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 489-508, 2020 A dissection of SARS‑CoV2 with clinical implications (Review) FELICIAN StanCIOIU1, GEORGIOS Z. PapaDAKIS2, STELIOS KTENIADAKIS3, BORIS NIKovaeviCH Izotov4, MICHAEL D. COLEMAN5, DEMETRIOS A. SpanDIDOS6 and ARISTIDIS TsatsaKIS4,7 1Bio‑Forum Foundation, 030121 Bucharest, Romania; 2Department of Radiology, Medical School, University of Crete, 71003 Heraklion; 3Emergency Department, Venizeleion General Hospital, 71409 Heraklion, Greece; 4Department of Analytical and Forensic Medical Toxicology, Sechenov University, 119991 Moscow, Russia; 5School of Life and Health Sciences, Aston University, B4 7ET Birmingham, UK; 6Laboratory of Clinical Virology, Medical School, 7Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, 71003 Heraklion, Greece Received May 15, 2020; Accepted June 9, 2020 DOI: 10.3892/ijmm.2020.4636 Abstract. We are being confronted with the most consequen- 1. Clinical aspects of COVID‑19 infections; acute respi‑ tial pandemic since the Spanish flu of 1918‑1920 to the extent ratory distress syndrome (ARDS); known and potential that never before have 4 billion people quarantined simultane- treatments ously; to address this global challenge we bring to the forefront the options for medical treatment and summarize SARS‑CoV2 In China, the first comprehensive analysis published on the structure and functions, immune responses and known treat- COVID‑19 (1) included 44,672 cases and 1,023 deaths, with an ments. Based on literature and our own experience we propose overall case-fatality rate (CFR) of 2.3%. There were 0 deaths new interventions, including the use of amiodarone, simv- in patients 9 years old or younger, and the CFR increased with astatin, pioglitazone and curcumin.
    [Show full text]
  • Evaluation of Bitter Kola Leaf Extract As an Anticorrosion Additive for Mild
    RESEARCH ARTICLE V.C. Anadebe, P.C. Nnaji, N.A. Okafor, J.O. Ezeugo, F.E. Abeng and O.D. Onukwuli, 6 S. Afr. J. Chem., 2021, 75, 6–17, <https://journals.co.za/content/journal/chem/>. Evaluation of Bitter Kola Leaf Extract as an Anticorrosion Additive for Mild Steel in 1.2 M H2SO4 Electrolyte Valentine Chikaodili Anadebea,* §, Patrick Chukwudi Nnajib, Nkechinyere Amaka Okaforc, Joseph Okechukwu Ezeugoc, Fidelis Ebunta Abengd and Okechukwu Dominic Onukwulie aDepartment of Chemical Engineering, Federal University Ndufu Alike, Ebonyi State, Nigeria. bDepartment of Chemical Engineering, Michael Okpara University of Agriculture, Abia State, Nigeria. cDepartment of Chemical Engineering, Chukwuemeka Odumegwu Ojukwu University, Nigeria. dMaterial and Electrochemistry Unit, Department. of Chemistry, Cross River University of Technology, Calabar, Nigeria. eDepartment of Chemical Engineering, Nnamdi Azikwe University Awka, Anambra State, Nigeria. Received 24 January 2020, revised 29 August 2020, accepted 29 August 2020. ABSTRACT Plant-based material, namely bitter kola leaf, as an additive for surface modification of mild steel in H2SO4 solution was thoroughly scrutinized using electrochemical, theoretical and optimization techniques. The functional groups, of the biomolecules of the bitter kola leaf extract, were examined using Fourier transform infrared spectrometry (FTIR) and gas chroma- tography-mass spectrophotometry (GC-MS). For clarification purpose, scanning electron microscopy (SEM) was used to inspect the texture of the degraded and inhibited steel after 21 h of immersion. For the response surface methodology (RSM), central composite design of Design-Expert Software was used to optimize the inhibition efficiency as a function of acid concentration, inhibitor concentration, temperature and time. The optimum inhibition efficiency of 93 % was obtained at 0.9 g L–1 bitter kola leaf.
    [Show full text]
  • Introduction: P2 Receptors
    Current Topics in Medicinal Chemistry 2004, 4, 793-803 793 Introduction: P2 Receptors Geoffrey Burnstock* Autonomic Neuroscience Institute, Royal Free and University College, London NW3 2PF, U.K. Abstract: The current status of ligand gated ion channel P2X and G protein-coupled P2Y receptor subtypes is described. This is followed by a summary of what is known of the distribution and roles of these receptor subtypes. Potential therapeutic targets of purinoceptors are considered, including those involved in cardiovascular, nervous, respiratory, urinogenital, gastrointestinal, musculo-skeletal and special sensory diseases, as well as inflammation, cancer and diabetes. Lastly, there are some speculations about future developments in the purinergic signalling field. HISTORICAL BACKGROUND It is widely recognised that purinergic signalling is a primitive system [19] involved in many non-neuronal as well The first paper describing the potent actions of adenine as neuronal mechanisms and in both short-term and long- compounds was published by Drury & Szent-Györgyi in term (trophic) events [20], including exocrine and endocrine 1929 [1]. Many years later, ATP was proposed as the secretion, immune responses, inflammation, pain, platelet transmitter responsible for non-adrenergic, non-cholinergic aggregation, endothelial-mediated vasodilatation, cell proli- transmission in the gut and bladder and the term ‘purinergic’ feration and death [8, 21-23]. introduced by Burnstock [2]. Early resistance to this concept appeared to stem from the fact that ATP was recognized first P2X Receptors for its important intracellular roles and the intuitive feeling was that such a ubiquitous and simple compound was Members of the existing family of ionotropic P2X1-7 unlikely to be utilized as an extracellular messenger.
    [Show full text]
  • Adenosine Receptors and Endothelial Cell Mediated Wound Healing
    Adenosine Receptors And Endothelial Cell Mediated Wound Healing Author Bonyanian, Zeinab Published 2017 Thesis Type Thesis (PhD Doctorate) School School of Medical Science DOI https://doi.org/10.25904/1912/1773 Copyright Statement The author owns the copyright in this thesis, unless stated otherwise. Downloaded from http://hdl.handle.net/10072/367912 Griffith Research Online https://research-repository.griffith.edu.au Adenosine Receptors And Endothelial Cell Mediated Wound Healing Zeinab Bonyanian BSc, MSc School of Medical Science Griffith Health Griffith University Submitted in fulfilment of the requirements of the degree of Doctor of Philosophy February 2017 1 STATEMENT OF ORIGINALITY This work has not previously been submitted for a degree or diploma in any university. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made in the thesis itself. Zeinab Bonyanian (Zina) 2 ACKNOWLEDGEMENT Firstly, I would like to express my sincere gratitude to my principal advisor, Associate Professor Roselyn Rose’Meyer, for the continuous support of my Ph.D study and related research, for her patience, motivation, and immense knowledge. Her guidance helped me during both the research and writing of this thesis. I could not imagine having a better supervisor and mentor for my Ph.D study. I would also like to acknowledge Associate Professor Joss Du Toit, my associate supervisor, and Professor David Shum for their support. I am very thankful to Dr. Janet Hussein for providing me with professional guidance and useful advice on my thesis writing. Many thanks to my friend Ms.
    [Show full text]
  • (PDXK) Human Variants in Drosophila Impacts on Genome Integrity
    www.nature.com/scientificreports OPEN The expression of four pyridoxal kinase (PDXK) human variants in Drosophila impacts on genome Received: 11 July 2019 Accepted: 15 September 2019 integrity Published: xx xx xxxx Elisa Mascolo1, Anna Barile2, Lorenzo Stufera Mecarelli 1, Noemi Amoroso1, Chiara Merigliano3, Arianna Massimi4, Isabella Saggio1,5, Torben Hansen 6, Angela Tramonti7,2, Martino Luigi Di Salvo2, Fabrizio Barbetti4, Roberto Contestabile2 & Fiammetta Vernì 1 In eukaryotes, pyridoxal kinase (PDXK) acts in vitamin B6 salvage pathway to produce pyridoxal 5′-phosphate (PLP), the active form of the vitamin, which is implicated in numerous crucial metabolic reactions. In Drosophila, mutations in the dPdxk gene cause chromosome aberrations (CABs) and increase glucose content in larval hemolymph. Both phenotypes are rescued by the expression of the wild type human PDXK counterpart. Here we expressed, in dPdxk1 mutant fies, four PDXK human variants: three (D87H, V128I and H246Q) listed in databases, and one (A243G) found in a genetic screening in patients with diabetes. Diferently from human wild type PDXK, none of the variants was able to completely rescue CABs and glucose content elicited by dPdxk1 mutation. Biochemical analysis of D87H, V128I, H246Q and A243G proteins revealed reduced catalytic activity and/or reduced afnity for PLP precursors which justify this behavior. Although these variants are rare in population and carried in heterozygous condition, our fndings suggest that in certain metabolic contexts and diseases in which PLP levels are reduced, the presence of these PDXK variants could threaten genome integrity and increase cancer risk. Diferently from bacteria and plants which synthesize ex novo the active form of vitamin B6, pyridoxal 5′ phos- phate (PLP), in other organisms PLP production relies on the salvaging activity of two enzymes: pyridoxal 5′-phosphate kinase (PDXK) and pyridoxine 5′-phosphate oxidase (PNPO).
    [Show full text]