DOCSLIB.ORG

Identifying and Characterizing Genes Involved in Telomere Length

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identifying and Characterizing Genes Involved in Telomere Length Tel Aviv University George S. Wise Faculty of Life Sciences Graduate School The Department of Molecular Microbiology and Biotechnology Identifying and Characterizing Genes Involved in Telomere Length Regulation in Saccharomyces cerevisiae Thesis submitted to the Senate of Tel Aviv University For the degree "Doctor of Philosophy (Ph.D.)" Submitted by Tal Yehuda Under the supervision of The deceased Dr. Anat Krauskopf and Prof. Martin Kupiec May 2008 עבודת המחקר שלי ארכה זמן רב, הן בגלל הנסיבות המיוחדות במעבדה והן בגלל סוג המחקר שבחרתי, לכן אני רוצה להודות לכל האנשים שליוו אותי בדרך ארוכה זו: החל מהמנחה הראשונה שלי- ענת קראוסקופף ז"ל, תודה על ההיכרות האישית והמדעית, למרטין קופייק- על הסבלנות הבלתי נלאית ללמד, לחנך ולהרביץ בי תורה, יישר כח! (תדע שהקשבתי לכל מילה), לחברי המעבדה- הישנים והחדשים, ובמיוחד לך יובל, תודה על העזרה ועל שיתוף הפעולה, למשפחתי העניפה- סבתותי, דודיי, חמיי, גיסותיי, הוריי ואחיי הנפלאים שהתעניינתם ושאלתם (גם אם ההסברים נשמעו לרוב עלומים), בעזרתכם הרבה סיימתי סוף סוף, ובמיוחד לבעלי האהוב- תודה על הכל ! וילדי היקרים לי מכל... ABSTRACT Telomeres are nucleoprotein structures present at the ends of eukaryotic chromosomes. Telomeres play a central role in guarding the integrity of the genome by protecting chromosome ends from degradation and fusion. Regulation of telomere length is central to their function. In order to broaden our knowledge about the mechanisms that control telomere length, we have carried out a systematic examination of ~4800 haploid deletion mutants of Saccharomyces cerevisiae for telomere-length alterations. Using this screen we have identified more than 150 new genes that affect telomere length. A novel array-based method for creating double mutants was used to sort the newly identified genes into epistasis groups. The genes that, when deleted, shorten the telomeres were chosen for further analysis. A panel of thirty such mutants, representing all the complexes identified in variuos genome-wide screen, was crossed to five strains with short telomeres: cdc73, dcc1, rfm1, vps34 and srb2. The results provide new insights about the mechanisms that control telomere length. 1 ABSTRACT ................................................................................................................... 1 1. INTRODUCTION ..................................................................................................... 5 1.1 Telomere function. ............................................................................................... 5 Figure 1.1: Schematic drawing of telomere composition. ..................................... 7 1.2 The role of telomeres in cancer progression and aging. ...................................... 8 1.3. Telomere length regulation. .............................................................................. 10 Figure 1.2: Schematic drawing of telomeres capping proteins from different organisms. ............................................................................................................ 22 1.4. Telomeric Silencing. ......................................................................................... 22 1.5 Modular epistasis. .............................................................................................. 26 Figure 1.3: Schematic drawing of genetic relation between genes participating in telomere length regulation. .................................................................................. 30 1.6 Genome-wide screens. ....................................................................................... 30 1.7 CDC73 ............................................................................................................... 31 1.8 DCC1 ................................................................................................................. 32 1.9 RFM1 ................................................................................................................. 33 1.10 VPS34 .............................................................................................................. 34 1.11 SRB2 ................................................................................................................ 35 2. MATERIALS AND METHODS ............................................................................. 37 2.1. Growth media.................................................................................................... 37 YEAST ................................................................................................................. 37 BACTERIA: ........................................................................................................ 38 2.2. Yeast genetics ................................................................................................... 38 2.3. S. cerevisiae strains ........................................................................................... 39 2 2.3.1. BY4741 background: ..................................................................................... 39 2.3.2. Tester strains (from the lab stock): ................................................................ 40 2.4. Plasmids ............................................................................................................ 41 2.5. PCR analysis ..................................................................................................... 41 Table 2.1- List of primers that were used for the deletion verification. .............. 42 2.6. Molecular biology techniques ........................................................................... 49 Table 2.2- Primers used for telomeric probe. ...................................................... 52 2.7. Quantification of telomere length ..................................................................... 53 3. RESULTS ................................................................................................................ 54 3.1 Isolating of TLM genes in a genomic screen. .................................................... 54 3.2 Confirming the identity of TLM mutants. ......................................................... 56 Table 3.1. List of S. cerevisiae genes that affect telomere length when deleted . 57 Figure 3.1.Representive Southern blot of mutants that alter S. cerevisiae telomere length.................................................................................................................... 63 Table 3.2: Saccharomyces cerevisiae genes that produce questionable telomere length alterations when deleted.. .......................................................................... 64 Table 3.3: Saccharomyces cerevisiae deletion mutants with heterogeneous telomere lengths. .................................................................................................. 65 3.3 Organizing genes in epistasis groups by TEA. .................................................. 66 Figure 3.2: Schematic presentation of the development of "the magic marker" 68 Figure 3.3: Working plan of TEA- Telomere Epistasis Assay. ........................... 70 3.4 TEA controls. ..................................................................................................... 70 3.5 Analyzing telomeres. ......................................................................................... 71 Figure 3.4: A representative page from the soft wear GelQuant.. ....................... 72 3 Table 3.4: Epistasis relation between 5 TEA genes and the panel of 30 short TLM genes. .......................................................................................................... 73 Figure 3.5: Schematic presentation of the epistatic relations between the TEA genes and the TLM genes. ................................................................................... 75 4. DISCUSSION .......................................................................................................... 78 4.1 The results of the genomic screen. ..................................................................... 78 4.2 Comparison of the two screens. ......................................................................... 79 4.3 TLM genes sorted in functional groups. ............................................................ 80 Figure 4.1: The different sections of the Mediator. ............................................. 83 Table 4.1: Neighboring ORFs that produce telomere length alterations when deleted. ................................................................................................................. 86 4.4 Performing Epistasis test for TLM genes. ......................................................... 88 4.5 Sorting TLM genes into epistasis groups........................................................... 91 4.6 How is CDC73 involved in telomere length regulation? ................................... 93 Figure 4.2: Schematic diagram of EST3 transcription and the involvement of Rpb9 and Cdc73 ................................................................................................... 93 5. BIBLIOGRAPHY .................................................................................................... 95 111 ........................................................................................................................... תקציר 4 1. INTRODUCTION 1.1 Telomere function. Telomeres are the specialized DNA-protein structures at the ends of eukaryotic chromosomes. The telomeric structure performs a capping function,it defines the end of the chromosome as a native edge, rather than a DNA double strand break (DSB).
Load more

Recommended publications
  • Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans
    Am J Hum Genet 28:9-17, 1976 Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans CHING J. CHERN1 AND ERNEST BEUTLER2 Pyridoxine kinase (PNK; EC 2.7.1.35) catalyzes the phosphorylation of pyridox- ine to its active coenzyme form, pyridoxine phosphate: pyridoxine + ATP - + pyridoxine phosphate + ADP. The same enzyme catalyzes the phosphorylation of pyridoxal to pyridoxal phos- phate. Previous communications [1, 21 have shown that the average PNK activity in red cells of American blacks is significantly lower than that of American whites; in contrast, the activities of the enzyme in lymphocytes, granulocytes, and cultured skin fibroblasts from black subjects are the same as those from whites. To gain a better understanding of the genetics of the red cell PNK of blacks, the size of our population survey has been expanded, and some limited family studies have been carried out. To determine whether the enzyme deficiency of black subjects is due to a structural gene mutation or regulatory mutation, we have investigated further the biochemical characteristics of PNK in red cells of white and black donors. The results of our investigations suggest that low red cell PNK activity may be coded by a single structural allele which results in the pro- duction of an enzyme with reduced in vivo stability. MATERIALS AND METHODS Pyridoxine kinase activity was estimated by measuring MH-pyridoxine-5'-phosphate as described previously [3]. Assay results were found to be highly reproducible in the same subject at different times. The red cells of one normal white subject were assayed four times over a 2 month period.
    [Show full text]
  • A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions
    A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions Pamela Kanellis1,2, Mark Gagliardi1, Judit P. Banath3, Rachel K. Szilard1, Shinichiro Nakada1, Sarah Galicia1, Frederic D. Sweeney1,2, Diane C. Cabelof4, Peggy L. Olive3, Daniel Durocher1,2* 1 Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada, 2 Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario, Canada, 3 British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada, 4 Karmanos Cancer Institute, Detroit, Michigan, United States of America Genome instability is a hallmark of cancer cells. One class of genome aberrations prevalent in tumor cells is termed gross chromosomal rearrangements (GCRs). GCRs comprise chromosome translocations, amplifications, inversions, deletion of whole chromosome arms, and interstitial deletions. Here, we report the results of a genome-wide screen in Saccharomyces cerevisiae aimed at identifying novel suppressors of GCR formation. The most potent novel GCR suppressor identified is BUD16, the gene coding for yeast pyridoxal kinase (Pdxk), a key enzyme in the metabolism of pyridoxal 59 phosphate (PLP), the biologically active form of vitamin B6. We show that Pdxk potently suppresses GCR events by curtailing the appearance of DNA lesions during the cell cycle. We also show that pharmacological inhibition of Pdxk in human cells leads to the production of DSBs and activation of the DNA damage checkpoint. Finally, our evidence suggests that PLP deficiency threatens genome integrity, most likely via its role in dTMP biosynthesis, as Pdxk-deficient cells accumulate uracil in their nuclear DNA and are sensitive to inhibition of ribonucleotide reductase.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • A Dissection of SARS‑Cov2 with Clinical Implications (Review)
    INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 489-508, 2020 A dissection of SARS‑CoV2 with clinical implications (Review) FELICIAN StanCIOIU1, GEORGIOS Z. PapaDAKIS2, STELIOS KTENIADAKIS3, BORIS NIKovaeviCH Izotov4, MICHAEL D. COLEMAN5, DEMETRIOS A. SpanDIDOS6 and ARISTIDIS TsatsaKIS4,7 1Bio‑Forum Foundation, 030121 Bucharest, Romania; 2Department of Radiology, Medical School, University of Crete, 71003 Heraklion; 3Emergency Department, Venizeleion General Hospital, 71409 Heraklion, Greece; 4Department of Analytical and Forensic Medical Toxicology, Sechenov University, 119991 Moscow, Russia; 5School of Life and Health Sciences, Aston University, B4 7ET Birmingham, UK; 6Laboratory of Clinical Virology, Medical School, 7Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, 71003 Heraklion, Greece Received May 15, 2020; Accepted June 9, 2020 DOI: 10.3892/ijmm.2020.4636 Abstract. We are being confronted with the most consequen- 1. Clinical aspects of COVID‑19 infections; acute respi‑ tial pandemic since the Spanish flu of 1918‑1920 to the extent ratory distress syndrome (ARDS); known and potential that never before have 4 billion people quarantined simultane- treatments ously; to address this global challenge we bring to the forefront the options for medical treatment and summarize SARS‑CoV2 In China, the first comprehensive analysis published on the structure and functions, immune responses and known treat- COVID‑19 (1) included 44,672 cases and 1,023 deaths, with an ments. Based on literature and our own experience we propose overall case-fatality rate (CFR) of 2.3%. There were 0 deaths new interventions, including the use of amiodarone, simv- in patients 9 years old or younger, and the CFR increased with astatin, pioglitazone and curcumin.
    [Show full text]
  • Vitamin B6 Metabolism and Regulation of Pyridoxal Kinase
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2009 VITAMIN B6 METABOLISM AND REGULATION OF PYRIDOXAL KINASE Amit Gandhi Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Chemicals and Drugs Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2008 This Dissertation is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. © Amit K. Gandhi 2009 All Rights Reserved VITAMIN B 6 METABOLISM AND REGULATION OF PYRIDOXAL KINASE A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at Virginia Commonwealth University. By AMIT K. GANDHI M.S (Pharmaceutical Science), Rajiv Gandhi University, Indore, India, 2003 B.Pharm, Rajiv Gandhi University, Indore, India, 2001 Director: Martin K. Safo, Ph.D Assistant Professor, Department of Medicinal Chemistry Virginia Commonwealth University Richmond, Virginia December, 2009 Acknowledgement I would like to take this opportunity to express my deep gratitude and profound respect to my advisor, Dr. Martin K. Safo, for his supervision, advice, and guidance in this research work. His support and insight have been invaluable in the progression of my research. I also appreciate his words of encouragement, which kept me always in an innovative mood and guided me at all the times to bring about the best in me. He is my mentor and teacher whom I shall remember forever.
    [Show full text]
  • (PDXK) Human Variants in Drosophila Impacts on Genome Integrity
    www.nature.com/scientificreports OPEN The expression of four pyridoxal kinase (PDXK) human variants in Drosophila impacts on genome Received: 11 July 2019 Accepted: 15 September 2019 integrity Published: xx xx xxxx Elisa Mascolo1, Anna Barile2, Lorenzo Stufera Mecarelli 1, Noemi Amoroso1, Chiara Merigliano3, Arianna Massimi4, Isabella Saggio1,5, Torben Hansen 6, Angela Tramonti7,2, Martino Luigi Di Salvo2, Fabrizio Barbetti4, Roberto Contestabile2 & Fiammetta Vernì 1 In eukaryotes, pyridoxal kinase (PDXK) acts in vitamin B6 salvage pathway to produce pyridoxal 5′-phosphate (PLP), the active form of the vitamin, which is implicated in numerous crucial metabolic reactions. In Drosophila, mutations in the dPdxk gene cause chromosome aberrations (CABs) and increase glucose content in larval hemolymph. Both phenotypes are rescued by the expression of the wild type human PDXK counterpart. Here we expressed, in dPdxk1 mutant fies, four PDXK human variants: three (D87H, V128I and H246Q) listed in databases, and one (A243G) found in a genetic screening in patients with diabetes. Diferently from human wild type PDXK, none of the variants was able to completely rescue CABs and glucose content elicited by dPdxk1 mutation. Biochemical analysis of D87H, V128I, H246Q and A243G proteins revealed reduced catalytic activity and/or reduced afnity for PLP precursors which justify this behavior. Although these variants are rare in population and carried in heterozygous condition, our fndings suggest that in certain metabolic contexts and diseases in which PLP levels are reduced, the presence of these PDXK variants could threaten genome integrity and increase cancer risk. Diferently from bacteria and plants which synthesize ex novo the active form of vitamin B6, pyridoxal 5′ phos- phate (PLP), in other organisms PLP production relies on the salvaging activity of two enzymes: pyridoxal 5′-phosphate kinase (PDXK) and pyridoxine 5′-phosphate oxidase (PNPO).
    [Show full text]
  • The Crystal Structure of the Plasmodium Falciparum Pdxk Provides an Experimental Model for Pro-Drug Activation
    crystals Brief Report The Crystal Structure of the Plasmodium falciparum PdxK Provides an Experimental Model for Pro-Drug Activation Kai Gao 1 , Wenjia Wang 1 , Thales Kronenberger 2,3 , Carsten Wrenger 3 and Matthew R. Groves 1,* 1 Drug Design XB20, Groningen Research Institute of Pharmacy, University of Groningen, 9700 AD Groningen, The Netherlands; [email protected] (K.G.); [email protected] (W.W.) 2 Department of Medical Oncology & Pneumology, Internal Medicine VIII, University Hospital Tübingen, 72076 Tübingen, Germany; [email protected] 3 Unit for Drug Discovery, Department of Parasitology, Institute of Biomedical Sciences, University of São Paulo, 05508-000 São Paulo, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +31-(0)50-363-3305 Received: 2 August 2019; Accepted: 11 October 2019; Published: 17 October 2019 Abstract: Pyridoxine/pyridoxal kinase (PdxK), belongs to the ribokinase family and is involved in the vitamin B6 salvage pathway by phosphorylating 5-pyridoxal (PL) into an active form. In the human malaria parasite, Plasmodium falciparum, Pf PdxK functions to salvage vitamin B6 from both itself and its host. Here, we report the crystal structure of Pf PdxK from P. falciparum in complex with a non-hydrolyzable ATP analog (AMP-PNP) and PL. As expected, the fold is retained and both AMP-PNP and PL occupy the same binding sites when compared to the human ortholog. However, our model allows us to identify a FIxxIIxL motif at the C terminus of the disordered repeat motif (XNXH)m that is implicated in binding the WD40 domain and may provide temporal control of Pf PdxK through an interaction with a E3 ligase complex.
    [Show full text]
  • Recombinant Human Pyridoxal Kinase/PDXK
    Recombinant Human Pyridoxal Kinase/PDXK Catalog Number: 8658-PK DESCRIPTION Source E. coli­derived Glu2­Leu312, with N­terminal Met and 6­His tag Accession # O00764 N­terminal Sequence Met Analysis Predicted Molecular 36 kDa Mass SPECIFICATIONS SDS­PAGE 36 kDa, reducing conditions Activity Measured by its ability to phosphorylate Pyridoxal Hydrochloride. The specific activity is >85 pmol/min/μg, as measured under the described conditions. Endotoxin Level <1.0 EU per 1 μg of the protein by the LAL method. Purity >80%, by SDS­PAGE under reducing conditions and visualized by Colloidal Coomassie® Blue stain at 5 μg per lane. Formulation Supplied as a 0.2 μm filtered solution in Tris, NaCl and DTT. See Certificate of Analysis for details. Activity Assay Protocol Materials l Universal Kinase Activity Kit (Catalog # EA004) l 10X Assay Buffer (supplied in kit): 250 mM HEPES, 1.5 M NaCl, 100 mM MgCl2, 100 mM CaCl2, pH 7.0 l Recombinant Human Pyridoxal Kinase/PDXK (rhPDXK) (Catalog # 8658­PK) l ATP (supplied in kit): 10 mM l Pyridoxal Hydrochloride (Sigma, Catalog # P6155), 50 mM in deionized water l 96­well Clear Plate (Catalog # DY990) l Plate Reader (Model: SpectraMax Plus by Molecular Devices) or equivalent Assay 1. Prepare 1X Assay Buffer by diluting 10X stock with deionized water. 2. Dilute 1 mM Phosphate Standard supplied in the Universal Kinase Activity Kit by adding 40 µL of the 1 mM Phosphate Standard to 360 µL of 1X Assay Buffer for a 100 µM stock. This is the first point of the standard curve. 3. Continue standard curve by performing six one­half serial dilutions of the 100 µM Phosphate stock in 1X Assay Buffer.
    [Show full text]
  • On the Specialization History of the ADP-Dependent Sugar Kinase Family
    130 On the Specialization History of the ADP-Dependent Sugar Kinase Family Felipe Merino and Victoria Guixé Laboratorio de Bioqímica y Biología Molecular Facultad de Ciencias Universidad de Chile Chile 1. Introduction Sugars are one of the most common carbon sources used by heterotrophic organisms. Indeed, sugar phosphorylation is thought to be a key step in the cellular metabolism since, just after transport into the cell, these molecules are phosphorylated to trap them for further metabolic processing. There are several known pathways used to produce pyruvate from the incoming sugar (like glucose or galactose) which is accompanied by the synthesis of ATP and the production of reductive power. Amongst them, the Embden-Meyerhof pathway, or glycolysis, seems to be the most commonly used. Some microorganisms can also use the Entner-Doudoroff pathway. Also, although the pentose phosphate pathway is generally associated with nucleotide synthesis and reductive power in the form of NADPH it also can be linked to the flux from glucose to pyruvate as this pathway has fructose-6-phosphate and glyceraldehyde-3-phosphate as intermediates. Some microorganisms, such as Lactococcus lactis, use a pathway very similar to glycolysis, but instead of start from glucose they use galactose as main carbon source. In this fashion glucokinases are replaced by galactokinases and phosphosfructokinases by tagatose-6-phosphate kinases (van Rooijen et al., 1991). Interestingly, all the above mentioned pathways ultimately converge through glyceraldehyde-3-phosphate. In this way, the main difference between them is what happens with the hexoses. Here, one of the most important reactions are the initial phosphorylations, e.g.
    [Show full text]
  • Carbohydrate Kinases: a Conserved Mechanism Across Differing Folds
    catalysts Review Carbohydrate Kinases: A Conserved Mechanism Across Differing Folds Sumita Roy 1, Mirella Vivoli Vega 2 and Nicholas J. Harmer 1,* 1 Living Systems Institute, University of Exeter, Stocker Road, Exeter EX4 4QD, UK; [email protected] 2 Department of Biomedical Experimental and Clinical Sciences, University of Florence, Viale Morgagni 50, 50134 Florence, Italy; mirella.vivoli@unifi.it * Correspondence: [email protected]; Tel.: +44-1392-725179 Received: 2 November 2018; Accepted: 21 December 2018; Published: 2 January 2019 Abstract: Carbohydrate kinases activate a wide variety of monosaccharides by adding a phosphate group, usually from ATP. This modification is fundamental to saccharide utilization, and it is likely a very ancient reaction. Modern organisms contain carbohydrate kinases from at least five main protein families. These range from the highly specialized inositol kinases, to the ribokinases and galactokinases, which belong to families that phosphorylate a wide range of substrates. The carbohydrate kinases utilize a common strategy to drive the reaction between the sugar hydroxyl and the donor phosphate. Each sugar is held in position by a network of hydrogen bonds to the non-reactive hydroxyls (and other functional groups). The reactive hydroxyl is deprotonated, usually by an aspartic acid side chain acting as a catalytic base. The deprotonated hydroxyl then attacks the donor phosphate. The resulting pentacoordinate transition state is stabilized by an adjacent divalent cation, and sometimes by a positively charged protein side chain or the presence of an anion hole. Many carbohydrate kinases are allosterically regulated using a wide variety of strategies, due to their roles at critical control points in carbohydrate metabolism.
    [Show full text]
  • NAPRALERT Classification Codes
    NAPRALERT Classification Codes June 1993 STN International® Copyright © 1993 American Chemical Society Quoting or copying of material from this publication for educational purposes is encouraged, providing acknowledgement is made of the source of such material. Classification Codes in NAPRALERT The NAPRALERT File contains classification codes that designate pharmacological activities. The code and a corresponding textual description are searchable in the /CC field. To be comprehensive, both the code and the text should be searched. Either may be posted, but not both. The following tables list the code and the text for the various categories. The first two digits of the code describe the categories. Each table lists the category described by codes. The last table (starting on page 56) lists the Classification Codes alphabetically. The text is followed by the code that also describes the category. General types of pharmacological activities may encompass several different categories of effect. You may want to search several classification codes, depending upon how general or specific you want the retrievals to be. By reading through the list, you may find several categories related to the information of interest to you. For example, if you are looking for information on diabetes, you might want to included both HYPOGLYCEMIC ACTIVITY/CC and ANTIHYPERGLYCEMIC ACTIVITY/CC and their codes in the search profile. Use the EXPAND command to verify search terms. => S HYPOGLYCEMIC ACTIVITY/CC OR 17006/CC OR ANTIHYPERGLYCEMIC ACTIVITY/CC OR 17007/CC 490 “HYPOGLYCEMIC”/CC 26131 “ACTIVITY”/CC 490 HYPOGLYCEMIC ACTIVITY/CC ((“HYPOGLYCEMIC”(S)”ACTIVITY”)/CC) 6 17006/CC 776 “ANTIHYPERGLYCEMIC”/CC 26131 “ACTIVITY”/CC 776 ANTIHYPERGLYCEMIC ACTIVITY/CC ((“ANTIHYPERGLYCEMIC”(S)”ACTIVITY”)/CC) 3 17007/CC L1 1038 HYPOGLYCEMIC ACTIVITY/CC OR 17006/CC OR ANTIHYPERGLYCEMIC ACTIVITY/CC OR 17007/CC 2 This search retrieves records with the searched classification codes such as the ones shown here.
    [Show full text]
  • Supplementary Material
    Supplementary Material TABLE S1: List of FSFs that were likely acquired via HGT in the AB, AE, and BE taxonomic groups. Both the SCOP and alphanumeric identifiers were used to define FSFs. HGT direction was inferred from fdifference, which is the difference in f-values between fformer (e.g. A in the AB taxonomic group) and flatter (B in AB). Taxonomic SCOP HGT FSF Id FSF name f f f group Id former latter difference direction Sulfolobus fructose- AB 111249 d.280.1 1,6-bisphosphatase- 0.7143 0.0353 0.679 A to B like tRNA-intron endonuclease N- AE 55267 d.75.1 0.9429 0.0154 0.9274 A to E terminal domain- like AN1-like Zinc AE 118310 g.80.1 0.3143 0.9498 -0.6355 E to A finger Mitochondrial AE 47157 a.23.4 import receptor 0.0143 0.7066 -0.6923 E to A subunit Tom20 AE 55418 d.86.1 eIF4e-like 0.1286 1 -0.8714 E to A Supernatant protein AE 101576 b.132.1 factor (SPF), C- 0.0143 0.8996 -0.8853 E to A terminal domain Eukaryotic DNA topoisomerase I, N- AE 56741 e.15.1 0.0143 0.9498 -0.9355 E to A terminal DNA- binding fragment AE 109993 a.222.1 VPS9 domain 0.0143 0.9846 -0.9703 E to A Transcription factor BE 69705 d.202.1 NusA, N-terminal 0.9954 0.0039 0.9915 B to E domain BE 48295 a.4.12 TrpR-like 0.9831 0.0039 0.9793 B to E Small protein B BE 74982 b.111.1 0.9985 0.0347 0.9637 B to E (SmpB) N-terminal domain BE 48024 a.81.1 0.9877 0.027 0.9607 B to E of DnaB helicase C-terminal domain BE 47789 a.60.3 of RNA polymerase 0.9954 0.0502 0.9452 B to E alpha subunit GreA transcript BE 46557 a.2.1 cleavage protein, N- 0.9555 0.0116 0.9439 B to E terminal
    [Show full text]