Tel Aviv University
George S. Wise Faculty of Life Sciences Graduate School
The Department of Molecular Microbiology and Biotechnology
Identifying and Characterizing Genes Involved in Telomere Length
Regulation in Saccharomyces cerevisiae
Thesis submitted to the Senate of Tel Aviv University
For the degree "Doctor of Philosophy (Ph.D.)"
Submitted by
Tal Yehuda
Under the supervision of
The deceased Dr. Anat Krauskopf and Prof. Martin Kupiec
May 2008 עבודת המחקר שלי ארכה זמן רב, הן בגלל הנסיבות המיוחדות במעבדה והן בגלל סוג המחקר שבחרתי,
לכן אני רוצה להודות לכל האנשים שליוו אותי בדרך ארוכה זו:
החל מהמנחה הראשונה שלי- ענת קראוסקופף ז"ל, תודה על ההיכרות האישית והמדעית,
למרטין קופייק- על הסבלנות הבלתי נלאית ללמד, לחנך ולהרביץ בי תורה, יישר כח! (תדע שהקשבתי
לכל מילה),
לחברי המעבדה- הישנים והחדשים, ובמיוחד לך יובל, תודה על העזרה ועל שיתוף הפעולה,
למשפחתי העניפה- סבתותי, דודיי, חמיי, גיסותיי, הוריי ואחיי הנפלאים שהתעניינתם ושאלתם (גם אם
ההסברים נשמעו לרוב עלומים), בעזרתכם הרבה סיימתי סוף סוף,
ובמיוחד לבעלי האהוב- תודה על הכל !
וילדי היקרים לי מכל...
ABSTRACT
Telomeres are nucleoprotein structures present at the ends of eukaryotic chromosomes. Telomeres play a central role in guarding the integrity of the genome by protecting chromosome ends from degradation and fusion. Regulation of telomere length is central to their function. In order to broaden our knowledge about the mechanisms that control telomere length, we have carried out a systematic examination of ~4800 haploid deletion mutants of Saccharomyces cerevisiae for telomere-length alterations. Using this screen we have identified more than 150 new genes that affect telomere length. A novel array-based method for creating double mutants was used to sort the newly identified genes into epistasis groups. The genes that, when deleted, shorten the telomeres were chosen for further analysis. A panel of thirty such mutants, representing all the complexes identified in variuos genome-wide screen, was crossed to five strains with short telomeres: cdc73, dcc1, rfm1, vps34 and srb2. The results provide new insights about the mechanisms that control telomere length.
1
ABSTRACT ...... 1
1. INTRODUCTION ...... 5
1.1 Telomere function...... 5
Figure 1.1: Schematic drawing of telomere composition...... 7
1.2 The role of telomeres in cancer progression and aging...... 8
1.3. Telomere length regulation...... 10
Figure 1.2: Schematic drawing of telomeres capping proteins from different
organisms...... 22
1.4. Telomeric Silencing...... 22
1.5 Modular epistasis...... 26
Figure 1.3: Schematic drawing of genetic relation between genes participating in
telomere length regulation...... 30
1.6 Genome-wide screens...... 30
1.7 CDC73 ...... 31
1.8 DCC1 ...... 32
1.9 RFM1 ...... 33
1.10 VPS34 ...... 34
1.11 SRB2 ...... 35
2. MATERIALS AND METHODS ...... 37
2.1. Growth media...... 37
YEAST ...... 37
BACTERIA: ...... 38
2.2. Yeast genetics ...... 38
2.3. S. cerevisiae strains ...... 39
2 2.3.1. BY4741 background: ...... 39
2.3.2. Tester strains (from the lab stock): ...... 40
2.4. Plasmids ...... 41
2.5. PCR analysis ...... 41
Table 2.1- List of primers that were used for the deletion verification...... 42
2.6. Molecular biology techniques ...... 49
Table 2.2- Primers used for telomeric probe...... 52
2.7. Quantification of telomere length ...... 53
3. RESULTS ...... 54
3.1 Isolating of TLM genes in a genomic screen...... 54
3.2 Confirming the identity of TLM mutants...... 56
Table 3.1. List of S. cerevisiae genes that affect telomere length when deleted . 57
Figure 3.1.Representive Southern blot of mutants that alter S. cerevisiae telomere
length...... 63
Table 3.2: Saccharomyces cerevisiae genes that produce questionable telomere
length alterations when deleted...... 64
Table 3.3: Saccharomyces cerevisiae deletion mutants with heterogeneous
telomere lengths...... 65
3.3 Organizing genes in epistasis groups by TEA...... 66
Figure 3.2: Schematic presentation of the development of "the magic marker" 68
Figure 3.3: Working plan of TEA- Telomere Epistasis Assay...... 70
3.4 TEA controls...... 70
3.5 Analyzing telomeres...... 71
Figure 3.4: A representative page from the soft wear GelQuant...... 72
3 Table 3.4: Epistasis relation between 5 TEA genes and the panel of 30 short
TLM genes...... 73
Figure 3.5: Schematic presentation of the epistatic relations between the TEA
genes and the TLM genes...... 75
4. DISCUSSION ...... 78
4.1 The results of the genomic screen...... 78
4.2 Comparison of the two screens...... 79
4.3 TLM genes sorted in functional groups...... 80
Figure 4.1: The different sections of the Mediator...... 83
Table 4.1: Neighboring ORFs that produce telomere length alterations when
deleted...... 86
4.4 Performing Epistasis test for TLM genes...... 88
4.5 Sorting TLM genes into epistasis groups...... 91
4.6 How is CDC73 involved in telomere length regulation? ...... 93
Figure 4.2: Schematic diagram of EST3 transcription and the involvement of
Rpb9 and Cdc73 ...... 93
5. BIBLIOGRAPHY ...... 95
111 ...... תקציר
4 1. INTRODUCTION
1.1 Telomere function.
Telomeres are the specialized DNA-protein structures at the ends of eukaryotic
chromosomes. The telomeric structure performs a capping function,it defines the end
of the chromosome as a native edge, rather than a DNA double strand break (DSB).
This capping allows a cell with linear chromosomes to function properly, while
maintaining efficient mechanisms for DSB repair. Muller coined the term ‘telomere’,
which comes from Greek—telos meaning end and meros meaning part—based on this chromosome end protection phenomenon (Muller, 1938). When telomeric capping is abolished, activation of a DSB repair mechanism may cause telomere-telomere fusions resulting in chromosomal aberrations. Through their capping function telomeres carry out an essential role in maintaining chromosomal stability and integrity (Chan and Blackburn, 2002).
A linear DNA molecule cannot be completely replicated by the cellular DNA polymerase. This is known as the end replication problem (Watson, 1972). The requirment of all DNA polymerases for a primer in order to initiate DNA replication is the underlying reasone for the "end replication problem". This primer is later removed from the DNA and the gap is repaired. At telomeres, no upstream fragment is present, resulting in a gap of unreplicated DNA (Levy et al., 1992). In the absence of any other specific DNA polymerization activity chromosomes will loss sequences at each cell division. To avoid this unfortunate outcome, cells add non-coding sequences at the ends of each chromosome to be used as “buffering sequences”. In most organisms this task is performed by telomerase, a cellular reverse transcriptase that copies a short template sequence within its own RNA into the telomeric sequence
5 (Harrington, 2003). This result in the formation of repetitive sequences at the end of each chromosome- termed the telomeric repeats. When telomerase is inactivated, telomeres shorten from one division to the other (Blasco et al., 1997; Harley et al.,
1990; Lundblad and Szostak, 1989; Niida et al., 1998). Therefore, telomeres are also
essential for the complete replication of the chromosome.
Telomerase elongates the telomere, adding one repeat at a time to the telomeric
single stranded substrate: this results in elongation of the single stranded DNA
(ssDNA) at the end of the chromosome (Harrington, 2003; Henderson and Blackburn,
1989; Makarov et al., 1997; McElligott and Wellinger, 1997). Following telomerase
action, the DNA polymerase can replicate the complementary strand, creating a
double stranded DNA (dsDNA) molecule (Greider, 1996; Zakian, 1995). Addition of
new sequences by telomerase is tightly regulated, resulting in the telomeres of many
organisms being kept within a small size range. The major part of the telomere is
composed of this dsDNA, but due to the end replication problem, and probably also to
the activity of exonuclases, telomeres end with a short strech of ssDNA (Diede and
Gottschling, 1999; Tsukamoto et al., 2001; Wellinger et al., 1996; Wellinger et al.,
1993). This ssDNA can serve as a substrate for telomerase in the following round of
DNA replication (Bodnar et al., 1998; Harrington and Greider, 1991; Lingner and
Cech, 1996; Wang et al., 1998).
6 Subtelomere ssDNA dsDNA dsDNA Telomeric repeat binding protein Secondery telomeric binding proteins ssDNA Telomeric reapeat binding protein
Figure 1.1: Schematic drawing of telomere composition. In the budding yeast Saccharomyces cerevisiae four essential telomerase components were identified (Est1-4p), of which Est2p performs the catalytic function
(Bryan et al., 1998; Greider and Blackburn, 1985; Lendvay et al., 1996; Lingner et al.,
1997b; Martin-Rivera et al., 1998; Metz et al., 2001; Nakamura et al., 1997).
Telomerase catalytic subunits were also found in many organisms including fission yeast, ciliates, nematodes, humans and mice. In most of the studied species the telomerase RNA component was also discovered (e.g. TLC1 in Saccharomyces cerevisiae, TER1 in Kluveromyces lactis, hTR in humans and mTR in mice) (Blasco et al., 1995; Feng et al., 1995; Greider and Blackburn, 1989; Singer and Gottschling,
1994).
Telomeric repeats serve as binding pads for several telomeric-repeat binding proteins (Figure 1.1). Some proteins are specific for the dsDNA region, others for the ssDNA region or the ssDNA-dsDNA junction (Harrington, 2003; Saldanha et al.,
2003; van Steensel et al., 1998). The length of the telomeric repeat and the DNA sequence of a single repeat varies between species, but it is generally a G- rich sequence (e.g TTAGGG in mammals, (TG)1-6TG2-3 in S. cerevisiae) (Chakhparonian and Wellinger, 2003). In yeast, one telomeric binding protein binds two to three
7 telomeric repeats (18bp) (Griffith et al., 1999; Nishikawa et al., 1998; Palladino et al.,
1993). Telomeric- repeat binding proteins serve as nucleating centers for other telomeric proteins, which all together form a high molecular weight ordered structure.
This structure has an important role in regulating the access of proteins to the telomere, thus regulating telomere length, location and chromatin condensation
(Chakhparonian and Wellinger, 2003; Harrington, 2003; Lustig, 1998; Saldanha et al.,
2003; Taddei and Gasser, 2004; van Steensel et al., 1998). Telomeric binding proteins are also involved in forming a heterochromatin environment resulting in transcriptional silencing of genes placed close to the telomere. This phenomenon is called telomeric silencing or Telomere Position Effect (TPE). The function of the telomeric binding proteins will be discussed in the next sections.
1.2 The role of telomeres in cancer progression and aging.
Cells cannot divide indefinitely. Cultured cells from multicellular spcies cease to
divide after a certain time period in culture and are said to have a finite life span.The
process that limits the proliferative potential of cells has been termed cellular or replicative senescence (Linskens et al., 1995). This observation leaves the question of how do cells sense the number of divisions through which they have gone?
Telomere length is a possible answere to this question. In somatic cells, telomerase activity is repressed. As a result, telomeres of all somatic cells and tissues tested, shorten with replicative age (Allsopp et al., 1995; Harley, 1991). At present telomere shortening is perhaps the most viable explanation of a cell division "counting" mechanism.
A causal relationship between telomere shortening and in vitro cellular senescence was demonstrated as the reactivation of telomerase in cultured cells results in
8 extended life span leading to their apparent immortalization (Bodnar et al., 1998). The limited replicative potential of somatic cells, dictated by telomere shortening, can act as a tumor suppression mechanism. It has been shown that replenishing telomeres by an active telomerase is one of the few essential steps that a normal human fibroblast cell must take on its way to become cancerous (Counter et al., 1998).
Yeast cells defective in telomerase activity, such as the S. cerevisiae telomerase mutants tlc1 or est2, show a very similar phenotype to that seen in mammalian cells: progressive telomere shortening accompanied by gradual loss in cell viability through a senescence-like mechanism (Lingner et al., 1997a; Lundblad and Szostak, 1989;
McEachern and Blackburn, 1995; Singer and Gottschling, 1994).
Telomerase activation is the primary, but not the sole mechanism for preventing senescence due to telomere shortening. In mammalian cells tumors can be formed occasionally by activation of alternative mechanisms for telomere elongation (ALT)
(Bryan et al., 1997). The nature of ALT is unclear, but the study of telomere function in yeast has shed some light on ALT formation. In the absence of telomerase, two alternative recombination pathways collaborate to maintain the telomeres of S. cerevisiae and create postsenescence survivors: one, which activates a break-induced- replication mechanism, and another which uses a gene conversion- based mechanism
(Le et al., 1999). In the absence of RAD52, both pathways are inactivated and no cells survive telomerase loss (Le et al., 1999).
Progressive shortening of telomeres in the absence of telomerase and ALT results in the generation of chromosomal end-to-end fusions in late generation mTR-/- mice
(Blasco et al., 1997; Holstege et al., 1998). The telomeric fusions result in chromosomal aberrations, which can lead to cell death or serve as tumor promoting agents (O'Sullivan et al., 2002). A similar genomic catastrophe is also seen in the last
9 passages of yeast lacking telomerase (Hackett et al., 2001; Hackett and Greider,
2003). Furthermore, another feature common to mammals and yeast is the activation
of a cellular DNA damage response as a result of telomere shortening (AS and
Greider, 2003; d'Adda di Fagagna et al., 2003; Enomoto et al., 2002). In mammalian
cells telomere shortening also triggers replicative senescence by means of the
activation of growth inhibition pathways dependent on Rb and p53 (Artandi and
DePinho, 2000). Bypass of replicative senescence produces further telomere erosion, telomere-telomere fusions, and eventually, cell death known as crisis (Counter et al.,
1998; Romanov et al., 2001; Zhu et al., 1999). Exogenous expression of the catalytic subunit of telomerase prevents both replicative senescence and crisis (Bodnar et al.,
1998).
1.3. Telomere length regulation.
Telomere length is tightly regulated. Although telomere length varies between
species (from 400bp in yeast to 10Kb in humans and 100Kb in mice), for each species a certain length is maintained through each cellular division and between the different telomeres in each cell (Chakhparonian and Wellinger, 2003). One of the most intriguing questions in telomere biology is how do cells maintain stable telomere length when telomerase activity was shown to be a very processesive biochemical activity. Many studies
in the last two decades have started to answer this question by discovering the many proteins,
most of which are part of the telomeric complex, that regulate telomere length in both
positive and negative ways. The study of telomere length regulation is mostly a genetic study
in which the role of each gene in telomere length regulation is assessed from its loss of
function phenotypes.
The topic of telomere length regulation is therefore composed of two issues. The
first one deal with the mechanisms that maintain telomeres in a stable length at each 10 cell cycle and the second one deal with the mechanisms that coordinate telomere length between different telomeres to ensure that telomere length is similar between telomeres of a given cell at each time point. Currently many mechanisms are known to be responsible for maintaining telomeres at a stable length, but few are known to be responsible for coordinating telomere lengths (McEachern et al., 2000; van Steensel et al., 1998). These two types of mechanisms seem to be connected: loss of coordination of telomere length, which is manifested by heterogeneous telomere length, is observed in telomeric mutants that exhibit strong elongation phenotypes (e.g.: telomerase RNA mutants), but such an effect is not seen in moderately elongated telomeres or in shortened telomeres (Krauskopf and Blackburn, 1996; Prescott and
Blackburn, 2000). These results may lead to the conclusion that proteins that are the main negative regulators of telomere length are also the main regulators of telomere length coordination.
Telomere length regulation can be performed by controlling two enzymatic functions: one of telomere elongation, namely telomerase, and the other of telomere degradation, namely exonucleases (Bertuch and Lundblad, 1998; Diede and
Gottschling, 1999; Tsukamoto et al., 2001). Most of the proteins involved in telomere length regulation were shown to perform their action through telomerase (McEachern et al., 2000; van Steensel et al., 1998). The involvement of exonucleases in telomere length regulation is minor, probably due to the fact that in normal conditions telomeres are inaccessible to exonucleases, but are accessible to telomerase in order to allow telomere maintenance (Bertuch and Lundblad, 1998; Diede and Gottschling,
1999; Tsukamoto et al., 2001).
Telomere binding proteins, which bind either the telomeric dsDNA or the telomeric ssDNA repeats, negatively regulate telomere length by affecting the accessibility of
11 telomerase to the telomeres (Figure 1.2). This task is conserved in various organisms,
although the proteins may diverge in the their sequence (Gilson and Géli, 2007;
McEachern et al., 2000; van Steensel et al., 1998). The evidence for the involvement
of dsDNA binding proteins in negative regulation of telomere length came mainly
from examining telomere length changes in cells carrying deletions, dominant
negative alleles, and overexpressed proteins. In most cases loss of function of the
dsDNA telomeric binding proteins resulted in telomere elongation and overexpression
resulted in shortening, as expected.
Many of the dsDNA binding proteins share homology with the DNA-binding
domain of the Myb family of transcription factors (Konig and Rhodes, 1997). Based
on their sequence the dsDNA binding proteins can be divided into the different
groups: the Rap1p and the TRF groups. In most species (mammals, fission yeast) a
TRF homologue binds the telomeric dsDNA repeats (Bilaud et al., 1997; Broccoli et
al., 1997; Cooper et al., 1997; Griffith et al., 1999; Spink et al., 2000; Vassetzky et al.,
1999) while a Rap1p homologue, if present, binds the telomere mainly by interacting
with TRF proteins (Lee et al., 1999; Li et al., 2000). In budding yeast a TRF
homologue was found - TBF1 (Bilaud et al., 1996; Koering et al., 2000). This protein
binds to the human consensus sequence, which is located at internal positions of the
yeast chromosomes, and is probably not involved in any telomeric function (Bilaud et
al., 1996; Koering et al., 2000). Instead of the TRF homologue, Rap1p binds directly
the telomeric repeats (Conrad et al., 1990; Longtine et al., 1989). These discoveries
have led evolutionary researchers to claim that in the ancestor of all species both of
these proteins performed a telomeric function, but due to telomeric template
mutations budding yeasts lost the ability to bind TRF and were forced to use Rap1p as
the main telomere binding protein (Li et al., 2000).
12 TRF homologues are nonessential genes, which currently perform a role only in the
telomeric context. On the other hand, Rap1p is not specific to telomeric sequences.
Rap1p can bind the telomeric consensus, and a related sequence found in many
upstream activating sequences (UAS). Rap1p binds to the UAS sequences and
regulate the expression of many genes; Rap1 is an essential protein (Morse, 2000;
Shore, 1994; Walker et al., 2001).
Mice and humans carry two dsDNA binding proteins of the TRF family: Trf1p and
Trf2p, both of which form homodimers (Griffith et al., 1999). Expression of dominant
negative forms of Trf1p results in telomere elongation, and overexpression of the
native protein results in telomere shortening (van Steensel and de Lange, 1997). Thus
Trf1p acts as a negative regulator of telomere elongation (van Steensel and de Lange,
1997). Trf1 has an isoform, called Pin2, which is probably formed by alternative splicing. Trf1p and Pin2 are functionally indistinguishable and form heterodimers and homodimers (Shen et al., 1997). Recently, the transcriptional activator c-Myc was found as a TRF1/PIN2-binding protein. The c-Myc-TRF1/PIN2 interaction was observed both in vitro and in vivo. Again, overexpression of this TRF1/PIN2- interacting domain of c-Myc leads to telomere elongation in vivo (Kim and Chen,
2007). Trf2p, on the other hand, is mainly involved in telomere regulation through
interactions with the ssDNA of the telomere ( discussed later), and it also negatively
regulate telomerase via hRap1p interaction (Li and de Lange, 2003). In fission yeast
deletion of Taz1p, the Trf1p homologue, results in robust telomere elongation, again
demonstrating the role of these proteins in negative regulation of telomere length
(Cooper et al., 1997).
The Rap1 protein can be divided into three domains. The N terminal domain is important for transcriptional regulation, but does not play a significant role in
13 telomeres (Kyrion et al., 1992; Liu et al., 1994; Sussel and Shore, 1991; Walker et al.,
2001). The central portion of the protein is occupied by a large DNA binding domain, essential for all of Rap1p functions (Kyrion et al., 1992; Liu et al., 1994; Sussel and
Shore, 1991; Walker et al., 2001). The C terminal domain plays several important roles at the telomere, as a regulator of telomere length and silencing (discussed in the next chapter) (Kyrion et al., 1992; Liu et al., 1994; Sussel and Shore, 1991; Walker et al., 2001). Small deletions in the C terminal domain of Rap1p (rap1∆C) in budding yeast results in a moderate telomere elongation (Kyrion et al., 1992). Large deletions in the C terminus of Rap1p result in a null (lethal) allele (Krauskopf and Blackburn,
1996).
The importance of Rap1p binding to telomere length control was examined using telomeric mutants. Mutations inserted in the telomerase RNA template can be used to replace the native telomeric repeats with mutant repeats that cannot bind Rap1p
(Krauskopf and Blackburn, 1996; Krauskopf and Blackburn, 1998; Prescott and
Blackburn, 2000). These mutations affect Rap1p binding only at the telomere without affecting its other transcriptional functions. Using these mutants, first in K. lactis and then in S. cerevisiae, it was shown that Rap1p is a main factor in telomere length regulation (Krauskopf and Blackburn, 1996; Prescott and Blackburn, 2000). Different telomeric mutations in the Rap1p binding site results in telomere elongation, the extent of which is correlated with the degree in which binding is lost (Krauskopf and
Blackburn, 1996; Krauskopf and Blackburn, 1998; Prescott and Blackburn, 2000).
Strains carrying mutations unable to bind Rap1p cause the strongest phenotype of telomere elongation and loss of telomere length coordination (Krauskopf and
Blackburn, 1996; Prescott and Blackburn, 2000).
14 The dsDNA binding proteins create a scaffold on which other proteins can attach
and form a higher ordered molecular structure. Most of these proteins were shown to
participate in telomere length regulation (Figure 1.2).
In mammals Trf1p binds a large number of proteins, not present in yeast cells, including PinX1, Tin2p and Tankyrase1 and 2 and the c-myc transcription activator
mentioned above (Ivessa et al., 2002; Kaminker et al., 2001; Kim and Chen, 2007;
Lee et al., 1999; Sbodio et al., 2002; Yavuzer et al., 1998) Mutations in PinX1 and
Tin2p result in telomere elongation, demonstrating their importance in negative length
regulation of the telomeres (Ivessa et al., 2002; Lee et al., 1999). On the other hand,
Tankyrase1 and 2 are thought to positively regulate telomere elongation by adding
modifications of poly-ADP ribose to Trf1p, which promotes its detachment from the
telomere (Cook et al., 2002; Smith et al., 1999). Trf2p interacts with hRap1p (Li et al.,
2000). Expression of dominant negative alleles of hRap1p results in telomere
elongation, a phenotype that is similar to that of scRap1p mutation (Li and de Lange,
2003).
In budding yeast Rap1p interacts with two proteins through its C terminus, Rif1p
and Rif2p (Hardy et al., 1992; Wotton and Shore, 1997). Deletion of RIF1 results in a
telomere elongation phenotype much more severe than deletion of RIF2, and the
double mutant exhibits a synergistic effect that resembles the effect of the largest
truncation of Rap1p C terminus (Hardy et al., 1992; Wotton and Shore, 1997).
Overexpression of each of these proteins can suppress the telomeric phenotype of the
rap1∆C mutation (Wotton and Shore, 1997).
Several proteins were shown to positively regulate telomere length. Depletion of
these proteins results in shortening of telomere length. The Tel1p Kinase, is the yeast
ATM homolog (Smilenov et al., 1997), the human gene is defective in patients with
15 ataxia-telongesia (AT) syndrome. A-T patients exhibit elevated cancer incidence and
short telomeres (Pandita, 2002). Deletion of TEL1 in yeast results in severe telomere shortening (by ~250 bp) and abolishment of the Rap1p counting machinery (Ray and
Runge, 1999), suggesting that Tel1p positively regulates telomerase activity when too
few Rap1p molecules are bound to the telomere (Greenwell et al., 1995). TEL2 was also found to be a positively regulator of telomere length, and was found to be essential. A mutant tel2-1 shows short telomeres and grows slowly at 37oC on rich
medium (Runge and Zakian, 1996).
In yeast, as in human cells, proteins that are involved in the non-homologous end
joining (NHEJ) pathway of DNA repair were found to associate with telomeres and
perform important functions in telomere length regulation. Human cells use NHEJ as
the main pathway to repair DSB, by ligating any two DNA molecules (Valerie and
Povirk, 2003). Yeast cells, on the other hand, prefer to use the recombination
pathway, but functional homologues of most of the human NHEJ proteins are also
found in yeast (Jason et al., 2002).
Since telomeres are the ends of DNA molecules, they may resemble a DSB and
attract NHEJ components. However, at telomeres these proteins do not promote
ligation, which would lead to aberrations, but serve as capping proteins preventing
telomeric shortening. The reason why NHEJ proteins act in different ways at
telomeres and at DSBs is yet unclear, but since telomeres bind many specific proteins
that are not present at DSBs, it is possible that these proteins prevent the access of the
whole NHEJ protein complex, thus preventing telomere-telomere fusion (Critchlow
and Jackson, 1998; D'Amours and Jackson, 2002; Featherstone and Jackson, 1999;
Williams and Lustig, 2003).
16 Three of the NHEJ protein complexes were found to associate with telomeres. The
KU heterodimer complex (Ku80p and Ku70p) and the SIR complex (Sir2p, Sir3p and
Sir4p), both of which are involved in DSB protection from degradation and the MRX complex (Rad50p, Mre11p and Nbs1-in humans or Xrs2p-in yeast), which is needed for DSB resection (Boulton and Jackson, 1996; Boulton and Jackson, 1998; Palladino et al., 1993) . In mammals the KU and MRX complexes were found to interact with both TRF heterodimers, while in budding yeast these proteins are recruited to the telomere directly by interaction with the telomeric DNA (Hsu et al., 1999; Hsu et al.,
2000; Song et al., 2000; Wu et al., 2000; Zhu et al., 2000).
In yeast the KU heterodimer binds the junction of ssDNA and dsDNA of the telomere and spreads into the subtelomeric region (Luo et al., 2002; Martin et al.,
1999). Others have shown that KU does not only bind telomeric DNA but also performs an essential role in regulating telomere length. In yeast, deletion of either one of the yKU proteins causes severe telomeric shortening (up to 150bp) (Boulton and Jackson, 1996; Porter et al., 1996) and creates a large ssDNA overhang of the telomeric G- strand (Polotnianka et al., 1998). This telomeric dysfunction activates a
DNA damage response and cell cycle arrest at the restrictive temperature of 370C
(Teo and Jackson, 2001). The effect of ∆yku70/∆yku80 on ssDNA formation and on
telomere length is probably unlinked, as shown by separation of function studies (Roy
et al., 2004). Several experiments point to the possibility that KU does not affect
telomeres only by regulating telomerase, but also by regulating exonucleases. First, in
∆yku70 the Rap1p counting machinery is still active (Ray and Runge, 1999). Second,
a double deletion of YKU70 and telomerase RNA act synergistically with respect to
cell viability (Gravel et al., 1998). Third, the appearance of enlarged ssDNA
overhangs is dependent on the Exo1p exonuclease (Maringele and Lydall, 2002).
17 These facts altogether support the claim that the yKu70p/yKu80p heterodimer acts in protecting the telomeric dsDNA from degradation by 5’ to 3’ exonucleases. Since ssDNA is unstable, the creation of elongated ssDNA can serve as a substrate for degradation; therefore also contribute to telomere shortening.
In NHEJ the KU heterodimer recruits the SIR complex. The SIR protein complex is an essential component of telomeric silencing/TPE (as will be discussed in the next section). At telomeres the SIR complex is recruited through binding to the yKU heterodimer and also by binding to Rap1p (Luo et al., 2002; Martin et al., 1999). yKU initially interacts with Sir4p, which then recruits Sir2p and Sir3p (Tsukamoto et al.,
1997). Although mutations in any of the SIR components have the same effect on telomeric silencing, with respect to telomere length regulation different Sir mutations have different effects on telomere length (Brachmann et al., 1998; Palladino et al.,
1993). Whereas deletion of SIR3 or SIR4 results in short telomeres, the ∆sir2 strain exhibits minor telomere shortening: these phenotypes are smaller than those seen in
∆yku strains (Palladino et al., 1993). In all three cases no increase in the amounts of telomeric ssDNA was detected, suggesting the possibility that the non-silencing phenotypes of YKU70/YKU80 deletion do not solely result from inability to recruit
SIR proteins to the telomere.
Additional proteins that operate in NHEJ are Mre11p/Rad50p/Xrs1p, the components of the MRX complex. Although these proteins exhibit telomeres as short as in KU (and TEL1 deletion) (Boulton and Jackson, 1998; Ritchie and Petes, 2000), the question of whether they act in telomere length regulation through yKu70p/yKu80p heterodimer is still unresolved. Some studies have shown an epistatic relationship between the two complexes, while others have shown a synthetic lethal effect, and therefore the two complexes have been mapped to two different
18 pathways (Boulton and Jackson, 1998; DuBois et al., 2002). On the other hand, the
MRX proteins were shown to operate in the Tel1p pathway (Ritchie and Petes, 2000).
The fact that the Tel1p and KU pathways are unlinked (Porter et al., 1996), further
contributes to the enigmatic nature of this issue. The most commonly used model
places the MRX complex in the Tel1p pathway, leaving yKu70p/yKu80p heterodimer
out of it.
The telomere end serves as a binding pad for specific telomeric ssDNA binding
proteins. As in the dsDNA region of the telomere, in the ssDNA region telomeres are
also bound by one type of protein that forms a scaffold to which other proteins can
bind. The ssDNA at telomeres is the site at which telomerase action is performed,
therefore ssDNA-binding proteins may help recruit or prevent the recruitment of
telomerase to its ssDNA substrate (Kanoh et al., 2003).
In mammals the telomeric ssDNA is very long (Makarov et al., 1997) and electron-
microscope studies have shown it to create a lariat called the T-loop (Griffith et al.,
1999). In the T-loop the ssDNA invades the dsDNA of the chromatin, probably by
interacting with the TRF2 heterodimer (Griffith et al., 1999). Introducing a dominant
negative allele of TRF2 into p53- proficient cells results in apoptosis (Karlseder et al.,
1999), while introducing the same allele to p53- deficient cells results in senescence
accompanied by high incidents of chromosomal fusions (van Steensel et al., 1998).
p53 binds to T-loops, suggesting that activation of apoptosis occurs trough sensing of
the state of the T-loops (Griffith et al., 1999). Overexpression of TRF2 in primary
cells increases the rate of telomere shortening without accelerating senescence and
reduces the telomere length at senescence, possibly due to TRF2 protection of
critically short telomeres from fusion (Karlseder et al., 1999). In mammals (and
fission yeast) Pot1p binds the ssDNA. This protein is thought to protect telomeric
19 ssDNA when the T-loop unfolds (Loayza et al., 2004). The model deduced from these findings claims that the accessibility of telomerase to the telomere is determined by the ability to open the T-loop, and the repression of polymerization on the ability to recreate it. In addition, the T-loop structure is an important feature of telomere capping which is needed for prevention of aberrations and its loss activates the p53 checkpoint (Greider, 1999; Wei and Price, 2003).
In yeast the telomeres are very short (~300bp) and the ssDNA region is composed of less than a dozen nucleotides and therefore cannot form a stable T-loop. In elongated telomeres, as in ALT cells or mutants that have elongated telomeres, telomere circles and loops were seen in recent works (Cesare and Griffith, 2004;
Cesare et al., 2008; Groff-Vindman et al., 2005). In S. cerevisiae the ssDNA is bound by Cdc13p (Lin and Zakian, 1996). CDC13 was initially identified as an essential gene, mutations in which cause cell cycle arrest due to DNA damage checkpoint activation (Garvik et al., 1995). The cause of this arrest is the accumulation of large amounts of ssDNA starting at the G-rich of the telomeres strand and invading into the internal parts of the chromosome (Garvik et al., 1995; Nugent et al., 1996). Another allele of CDC13 was discovered in a screen for shortening telomeres (est4- for Ever
Shorter Telomeres) (Lendvay et al., 1996). This allele does not cause accumulation of ssDNA, but instead causes progressive shortening of telomeres at the restrictive temperature (Nugent et al., 1996). The discovery of other alleles of CDC13 that cause telomere elongation has created a puzzle that was solved when two Cdc13p interactors, Stn1p and Ten1p, were discovered (Grandin et al., 2001; Grandin et al.,
1997). Detailed analysis has shown that Ten1p acts as a positive regulator of telomerase while Stn1p is a negative regulator (Chandra et al., 2001; Grandin et al.,
2001; Grandin et al., 1997; Pennock et al., 2001). The current model that explains all
20 of these findings states that Cdc13p participates in telomere length regulation and in
protecting the dsDNA from degradation (Nugent et al., 1996; Tsukamoto et al., 2001).
It regulates telomerase negatively by binding Stn1p and positively by recruiting
Ten1p, and serves as a “cap” protecting the telomere from 5’ to 3’ exonucleases
(Pennock et al., 2001; Spink et al., 2000; Tsukamoto et al., 2001).
The last mechanism of telomere length regulation that will be mentioned in this
section is based on the interaction between telomeres and the replication machinery.
Telomeres are replicated not only by telomerase, but also by the cellular DNA
polymerases. The function of DNA polymerases may influence telomerase activity.
Indeed, mutations in polα, pol, polδ and some of their interacting proteins cause
changes in telomere length, hence affect telomerase action (Diede and Gottschling,
1999; Ohya et al., 2002; Qi and Zakian, 2000).
21
Figure 1.2: Schematic drawing of telomeres capping proteins from different organisms. Taken from (Gilson and Géli, 2007)
1.4. Telomeric Silencing.
Genes placed near the telomere are not as transcriptionaly active as in other chromosomal regions due to telomeric silencing. Some of the telomeric proteins may impose gene silencing by directly affecting nearby histones to form a condensed chromatin state (Tham and Zakian, 2002). Telomeric silencing acts in an epigenetic manner, genes do not remain stably silenced, but can become active for several divisions and then become repressed again in a stochastic manner. The changes from active to silenced state and vice-versa are called switching (Aparicio and Gottschling,
1994; Gottschling et al., 1990). Genes involved in telomere silencing can affect the
22 establishment of the silenced state, the propagation of silenced state and the rate of switching between silenced to active state and vice-versa.
When the phenomenon of telomeric silencing was first discovered it was called
TPE for Telomere Position Effect (Levis et al., 1985). The name TPE resulted from experiments in which positioning of the white gene in any chromosomal location
tested could change the color of Drosophila melanogaster eye from red to white, but
positioning it near the telomere resulted in red and white patched eye (Levis et al.,
1985). Later on, telomeric silencing was discovered in Ciliates and several yeasts
including S. cerevisiae (Gottschling et al., 1990), K. lactis (Gurevich et al., 2003), C.
albicans, S. pombe (Nimmo et al., 1994), and also in mammals (Baur et al., 2001;
Koering et al., 2002).
The study of telomeric silencing has resulted in the identification of many genes
responsible for chromatin condensation and re-condensation and helped us understand
how silenced chromatin forms. In Trypanosome telomeric chromatin plays an
important role in ensuring antigenic variation, which is vital for avoiding
identification of this parasite by the immune system (Rudenko et al., 1996). In S.
cerevisiae the telomeres were suggested to act as storage places for easily available
silencing protein, like SIR and KU proteins that participate also in DSB repair (Mills
et al., 1999). No other direct roles for telomeric silencing are known, but proper
functioning of telomeric silencing is important for proper functioning of the telomere.
The SIR complex proteins (Sir2p/Sir3p/Sir4p) are essential for any telomeric
silencing. The name SIR (Silenced Information Regulators) resulted from their initial
identification (along with Sir1p) as genes responsible for silencing at the mating type
loci (HMR, HML) (Shore et al., 1984). Silencing at HMR and HML takes place by
physical interactions between the SIR proteins and Rap1p. The Sir2p gene is also
23 responsible for repression of transcription near the rDNA as a component of the
RENT complex (Net1p, Cdc14p and Nan1p) (Fritze et al., 1997; Straight et al., 1999).
The discovery of Rap1p at telomeres and the SIR-Rap1 interaction has led the
researches to test whether SIR proteins are also present at telomeres and whether they
perform a similar role in telomeric silencing (Moretti et al., 1994). They found that
deletion of SIR2, SIR3, SIR4 genes, but not SIR1, results in complete loss of
telomeric silencing (inability to grow on 5FOA or loss of red sectors of ADE2
silencing) (Brachmann et al., 1998; Chien et al., 1993; Renauld et al., 1993). The SIR protein complex function is dependent on each of its components; a deletion of any of them results in loss of recruitment to the telomere (Cockell et al., 1995; Laroche et al.,
1998).
The SIR complex is recruited to the telomere either by Rap1p binding or by interaction with KU (Cockell et al., 1995; Laroche et al., 1998). It is thought that SIR recruitment to the telomere is carried out mainly by Rap1p, whereas KU is important for spreading silencing to the subtelomeric region (Luo et al., 2002; Martin et al.,
1999). Nonetheless both mechanisms are essential for silencing. Rap1p binds Sir3p and Sir4p through its C-terminal domain. They in turn recruit Sir2p to the telomere
(Cockell et al., 1995; Luo et al., 2002). Truncation of the C terminal domain of Rap1p results in complete loss of silencing (Kyrion et al., 1992; Liu et al., 1994). Since the regions of Rap1p that bind Rif1p and Rif2p overlap those that bind the SIR complex, deletion of the RIF proteins results in elevation of silencing in wild-type and the
Δyku70 cells, probably due to elevated number of the SIR- Rap1p telomeric complexes (Hardy et al., 1992; Mishra and Shore, 1999). KU heterodimer recruits SIR complex through Sir4p, and overexpression of Sir4p can partly elevate silencing in
KU deficient strains (Laroche et al., 1998).
24 Silencing at the telomere is carried out by Sir3p and Sir4p binding to the N termini
of histones H3 and H4 (Hecht et al., 1995). This binding brings Sir2p in close
proximity to the histone tails allowing efficiently NAD-dependent histone deactylation (Braunstein et al., 1993; Imai et al., 2000). This is probably the cause for histone H4 amino terminus requirement for telomeric silencing (Thompson et al.,
1993). Sir2p- mediated histone deactylation leads to the condensation of the nearby histones and this effect spreads towards the internal parts of the chromosome
(Kristjuhan et al., 2003; Robyr et al., 2002).
In yeast there are several SIR2 homologues called HST1-4, which are evolutionary conserved. Deletion of HST1 or HST2 does not lead to any silencing phenotype, but the double mutant Δhst3Δhst4 shows a reduction in telomeric silencing (Brachmann et al., 1998). Hst2 probably has a role in silencing by titering a yet unidentified Sir2p ligand (Brachmann et al., 1998).
Another complex, which is involved in telomeric silencing and in histone modification, is the Rpd3p H3-H4 histone deactylase complex. This complex is composed of Rpd3p, Sap30p, Sds3p, Pho23p and Sin3p (Loewith et al., 2001; Sussel et al., 1995). Deletion of any one of these proteins results in elevation of silencing at
HMR, rDNA and also at telomeres as evident by solid pink colonies of clones harboring the ADE2 construct (Rundlett et al., 1996; Sussel et al., 1995). GCN5, which also exhibits elevation of telomeric silencing, was shown to operate together with the RPD3 complex (Sun and Hampsey, 1999). The fact that Rpd3p is not present at telomeres may indicate that the increase in silencing observed in these mutants may be a side effect of their influence on other chromosomal regions (Robyr et al., 2002).
25 1.5 Modular epistasis.
When dealing with “natural” populations the subject of genetic variation between
individuals becomes paramount. This variation can come into play in two ways, first,
different alleles can confer distinct phenotypes caused directly from sequence
variations and secondly identical alleles can perfome differently due to the
background variation in other loci. In this view, understanding the genetic
relationships (i.e epistasis) cousing specific phenotype is of great importance to
human wellbeing (Hartman et al., 2001). The history of biological research proves
that there is a deep conservation between organims. Time and time again, biological
observations made in simple unicellular organisms proved to be conserved in complex
multicellular organims (Hartman et al., 2001).
The building blocks of genetic networks are genetic interactions (Segre et al.,
2005). Gene interactions analyzed by gene deletions can be devided into three groups:
additive, aggravating and buffering gene deletion interactions. Below, I will use the
metabolic modeling of Segre and co-workers (Segre et al., 2005), modifying it to suit
telomere regulation. The two enzyme deletions are represented by ΔX and ΔY (Figure
1.3). In an additive relationship all components participate in parallel pathways. A
deletion (either ΔX or ΔY) along each pathway causes a telomeric phenotype. When
both deletions are performed, the phenotype represents the sum of both single deletion
phenotypes. For simplicity one could think of two mutants that cause telomeric
shortening, and the double mutant would show telomeres which would be as short as
the sum of the shortening effect of both single mutants (Figure 1.3 a). Synergistic
relations can be explained in a simplified example of a component that can be
produced through two alternative routes. Disruption of each pathway causes only a
partial phenotype, and the double mutant exhibits synergistic effects. Since both
26 pathways produce the same intermediate, this type of aggravating interactions suggests functional association between the mutated genes. In the extreme situation, this type of interaction may lead to synthetic lethality, or in a more moderate situation to an extreme telomeric length phenotype,the severity of which greatly exceeding that of the expected combination of both single deletion phenotypes. Another explanation for synergistic relations, that was mentioned before, is that both genes may encode parts of the same complex, involved in telomere regulation (Hartman et al., 2001). In a deletion of each gene, a moderate phenotype appears, since the complex is still functional, but in a double mutant the complex either does not function or its function is extremely impaired, resulting in an extreme telomeric phenotype. Buffering relations could be divided into "full" and "partial" buffering (Figure 1.3 b). In full buffering relations, named epistatic relations, both genes are placed along a single regulation pathway, each causing a telomeric phenotype. The double mutant exhibits the same phenotype as that of one of the single mutants. Hence the deletion of the gene that is placed later along the pathway is fully buffered by the epistatic gene
(Figure 1.3 c). In partial buffering relations, the two genes still participate in the same telomere regulation pathway, but with the help of aditional genes that partially bypass the pathway. In this situation when both genes are deleted, telomere length regulation would still function, in a way that the phenotype of the double mutant would be less extreme than the sum of the effect of both deletions (Figure 1.3 d).
27 b
c
d
28 e
f
29 Figure 1.3: Schematic drawing of genetic relation between genes participating in telomere length regulation. Inspired by (Segre et al., 2005). a) Additive relations, b) Synergistic relations, c) Full buffering epistatic relations, d) Partial buffering relations-intermediate, e) An example of Southern blot of one single mutant, Wild Type, Double mutant and Second single mutant from left to right, with epistatic relations of the first single mutants over the second one, f) An example of Southern blot of
Wild Type, Double mutant, one single mutant and Second single mutant from left to right, with additive relations between the genes. The Explanations are within the text (Detailed explanations for telomeric Southerns are in M&M). Empty circles and squares represent components or steps along the regulation pathways, full circles or squares represent final components of the pathway.
From the genetic perspective, epistatic interactions are of particular importance for elucidating functional association between genes. This premise has motivated genome-wide screens for identifying pairs of synthetic-lethal (SL) mutations (Tong et al., 2004). SL or syntheticaly sick (SS) interactions can occure between genes that share a common function in an essential proccess, in which case the two genes perfom a similar biochemichal fuction, these interactions compromise the majority of interactions discovered in yeast. Or alternatively SL/SS interactions can occur between genes that participate in two processes which together serve an essential cellular function, for example DNA replication and DNA repair, two procceses which compensate for each other (Hartman et al., 2001).
1.6 Genome-wide screens.
Genes for most of the proteins mentioned in sections 1.1-1.4 alter telomere length when mutated. Average telomere length can therefore be a very sensitive assay of telomere function. Many genes related to telomere function in yeast have been found to have similar roles in other organisms, including humans. It is therefore reasonable to predict that identifying genes that alter yeast telomere will lead to useful insights into human telomere biology. We have utilized a collection of deletion mutants of all
30 non-essential genes to systematically search for genes affecting telomere length. We found >150 genes that were not previously known to alter telomere length (Askree et al., 2004). These genes affect several different cell processes, including DNA and
RNA metabolism, chromatin modification and vacuolar traffic.
Out of this collection I have chosen to work with the genes that, when deleted, shorten telomeres. Out of the 120 genes found in the screen I picked thirty genes from different complexes in an attempt to represent the whole collection. In this work I have tried to sort this "panel of 30" into epistasis groups using a novel array-based method for creating double mutants. The mutant panel was crossed to strains deleted for each of 5 other genes: cdc73, dcc1, rfm1, vps34 and srb2. Double mutants were created and their telomere length analyzed. Our results provide insights about the pathways that regulate telomere length.
Below I described briefly the five genes chosen:
1.7 CDC73
The Paf1 complex (Paf1C), consisting of Paf1p, Hpr1p, Cdc73, Ctr9, Leo1, Rtf1 and Ccr4p, is associated with RNA Polymerase II throughout the transcription cycle
(Mueller and Jaehning, 2002). The carboxy-terminal domain (CTD) of the largest
subunit of RNA Pol II, Rpb1 has several phosphorylation states through the
transcription cycle, and these changes mediate in part its association with different
transcription factors. The unphosphorylated CTD associates with initiation factors and the promoter, phosphorylation at Serine 5 of the CTD (Ser5) is required for promoter
escape and association with capping factors, and phosphorylation at Serine 2 (Ser2) is
necessary for interactions with histone modifying enzymes and the cleavage and
polyadenylation factors (Penheiter et al., 2005). The Paf1C of yeast and humans
31 associates with the unphosphorylated form of Pol II at promoters and with the Ser2- and Ser5-phosphorylated forms present during elongation (Penheiter et al., 2005;
Rozenblatt-Rosen et al., 2005). Although the Paf1C appears to be associated with Pol
II at all transcriptionally active yeast genes its loss results in transcript abundance
changes for only a small subset. There are differences in the genome-wide expression
levels among deletions of different genes from the Paf1C (Penheiter et al., 2005).
1.8 DCC1
Sister chromatid cohesion, the physical association of replicated sister chromatids
after DNA replication, is critical to high fidelity chromosome transmission. Sister
chromatid cohesion is established during S phase at discrete sites along the
chromosome, maintained until the metaphase-anaphase transition, and rapidly
dissolved when chromatids separate to opposite poles [reviewed in (Nasmyth et al.,
2000)]. Many proteins participate in this progress. Scc1p/Mcd1p, Smc1p, Smc3p, and
Scc3p/Irr1p are involved in holding the sister chromatid together in a complex named
cohesin (Toth et al., 1999). Scc2p and Scc4p form a separate complex required for
achieving sister chromatid cohesion, and are not part of the core cohesin complex
(Ciosk et al., 2000; Toth et al., 1999). Replication Factor C (RFC) is composed of five
subunits (Rfc1-5). It functions as a clamp loader, binding to DNA and loading the
PCNA ring, which in turn recruits different polymerases for DNA replication
[reviewed in (Majka and Burgers, 2004)]. There are three alternative RFC known; in all three the Rfc1 large subunit is replaced by an alternative protein. The identites of the clamps that work with each loader are not fully known (Majka and Burgers,
2004). In the alternative RFC Ctf18-Ctf8-Dcc1, CTF8 was identified in a screen for mutants that missegregate a chromosome fragment (Spencer et al., 1990). The other two components in this complex were found to bind to Ctf18 (Mayer et al., 2001). It
32 has been shown that Ctf18 is the protein that interacts with the RFC's and Dcc1 is the connector between Ctf8 and Ctf18 (Mayer et al., 2001). In vitro, the Ctf18 complex functions to unload PCNA, even in the absence of Dcc1 and Ctf8. This alternative
RFC complex is probably responsible for loading DNA polymerases selectively onto sites of cohesin deposition (Mayer et al., 2001), and this activity was suggested to be important to the establishment of sister chromatid cohesion (Bylund and Burgers,
2005).
1.9 RFM1
A complex containing Rfm1, Hst1 and Sum1 (RHS) was found to repress the
middle sporulation genes during vegetative growth and early meiosis in yeasts
(McCord et al., 2003; Xie et al., 1999).
There are two major subclasses of transcriptional repression. One involves gene-
specific repression, while the other involves transcriptional silencing of large regions
of the chromosome in a gene-independent manner and requires Sir2 NAD+-dependent
histone deacetylase. RHS is one of the complexes known to function as a repressor for
specific genes. Sum1 is a DNA binding protein that recognizes a motif called the
middle sporulation element (Li et al.) (Xie et al., 1999). Hst1 is an orthologue of Sir2
and has protein deacetylase activity (Derbyshire et al., 1996). Finally, Rfm1 seems to act as a tethering factor that recruit Hst1 to Sum1 (McCord et al., 2003). Analyzing the results from the microarrays done in (McCord et al., 2003) it appears there are two groups of genes in the middle sporulation gene group: one is repressed only by Sum1 and the other is repressed by the three component complex (Sum1, Hst1 and Rfm1).
In a new study they tried to distinguish between Hst1 (known to function in specific genes repression) and Sir2 (known to function in repression of large regions of the chromosome) and to map their domains, according to their function with proteins in 33 the same complex. In order to do so they built chimeric proteins between Hst1 and
Sir2 and measured the repression of a reporter in deletion strains of the Sir proteins and in deletion strains of the RHS (Mead et al., 2007). The authors concluded that
none of the chimeras was able to repress transcription of the reporter in an rfm1 strain.
These data suggest that all of these chimeras interact with the Sum1- Rfm1 complex to repress MSE-regulated promoters. In my analysis I need to see whether in the
telomere regulation all the interactions seen with Rfm1 are mutual to Hst1 and to
Sum1 or there are separations between these genes that share the same complex.
1.10 VPS34
Vps34 is the only Phosphatidylinositol 3-Kinase (PI3K) in yeast and together with
Vps15 it is essential for protein sorting (Schu et al., 1993). Unlike other PI3Ks in
other organisms, which bind the cellular membrane, the Vps34-Vps15 complex is
located in a subcellular compartment, probably at the endosome membrane
(Slessareva et al., 2006). In the yeast Saccharomyces cerevisiae, a G protein signaling apparatus is required for cell-cell communication leading to mating. Haploid a and α cells secrete type-specific pheromones (a factor and α factor) that promote cell fusion and the formation of an a/α diploid. Events leading up to mating include cell division arrest, new gene transcription, and morphological changes (Dohlman and Thorner,
2001). Recently it was shown that both Vps34 and Vps15 bind Gpa1, a GTP-binding alpha subunit of the heterotrimeric G protein coupled to the pheromone receptors.
Interestingly, Vps34 binds preferentially to the GTP-bound form of Gpa1 and Vps15 preferentially binds the GDP-bound form of this protein. In the same article they showed that both proteins are required for proper signaling by the Gpa1 of the pheromone pathway in yeast (Slessareva et al., 2006).
34 1.11 SRB2
The Mediator is a complex tightly associated with RNA polymerase II (PolII) in
vivo. In an in vitro system reconstituted with purified general transcription factors, the
Mediator complex enables PolII to respond to transcriptional activators. In addition,
Mediator stimulates transcription factor IIH (TFIIH)-dependent, in vitro
phosphorylation of the carboxy-terminal domain (CTD) of the largest subunit of PolII,
Rpb1 (Lee et al., 1999). The CTD is highly conserved in eukaryotes. It contains 26-52
repeated heptapeptide sequences, in S. cerevisiae there are 26-27 repeats. Deletion mutation in CTD is lethal, but truncation of several repeats cause slow growth, cold
sensitivity and induce gene expression in vivo, and defects in transcription-initiation
in vitro (Nonet and Young, 1989). The SRB gene family was found through a genetic screen for suppressors of the ts phenotype of truncated-CTD (Thompson et al., 1993).
Deletions of the SRB genes showed that both SRB4 and SRB6 are essential but SRB5
and SRB2 are not, although they exhibit slow growth and cold sensitivity like CTD
truncation mutants.
There are two known complexes that associate with the core complex of RNA Pol
II: the Srb4- and the Mediator- complexes. Both of them share some of the Srb
proteins (Srb2, Srb4, Srb5, Srb6, and Srb7) as well as the products of previously
described transcriptional regulatory genes (GAL11, SIN4, RGR1, ROX3, and
HRS1/PGD1/MED3). In addition, several subunits (Med1, Med2, Med4, Med6,
Med7, Med8, Med9, Med10, and Med11) were identified as components of both PolII
complexes. However, some components differ between the two PolII complexes;
specifically, certain Srb proteins (Srb8, Srb9, Srb10, and Srb11) and the Swi-Snf
complex are absent from the Mediator-PolII complex (holoenzyme) (Nonet and
Young, 1989). Genetic studies revealed that some of the genes that encode Mediator
35 subunits are required for transcriptional regulation of specific genes, while others are necessary for general transcription in-vivo. The Srb4 sub-complex is composed of:
Srb4, Srb5, Srb2, Srb6 and Med6 all required for general transcription events.
According to Lee et al. cell extracts from S. cerevisiae mutants with a deletion in
either SRB2 or SRB5 show 80% decrease in both activated and basal transcription compared to the wild-type strain, meaning that both gene products are needed for activated and basal transcription in vitro (Lee et al., 1999).
Deletion of two genes encoding components of the mediator (Srb2 and Srb5) were
found in our screen, and in a similar screen (Gatbonton et al., 2006), to cause telomere
shortening. However, four other components of the mediator: (Srb8, Srb9, Srb10 and
Med1) were found in the second screen to have long telomeres. This was the reason I
chose one of the short genes to try and sort it into epistasis group along with the
"chosen 30" hoping in the near future someone will complete the picture with the long
genes from our collection.
36 2. MATERIALS AND METHODS
PCR-Polymerase Chain Reaction,
RT-Room Temperature
TLM-Telomere Length Maintenance,
TEA-Telomere Epistasis Assay
2.1. Growth media
YEAST:
YPD (yeast rich medium) - 1% Bacto yeast extract (DIFCO), 2% Bacto peptone
(DIFCO), 2% Glucose .
SD (yeast defined medium) - 0.67% Bacto yeast nitrogen base w/o amino acids
(DIFCO), 2% Glucose. Amino acids were added according to requirement (SIGMA).
SD for G418 - 0.17% YNB w/o amino acids and ammonium sulfate (DIFCO), 0.1%
MSG (L-glutamic acid sodium salt hydrate) (SIGMA), 2% Glucose containing
200mg/l G418 Geneticin (CalBioChem).
5FOA: 0.67% Bacto yeast nitrogen base without amino acids, 2% glucose, 50mg/l
Uracil, 0.8 gr/l 5FOA.
SPO - 1% Potassium acetate, 0.1% Bacto yeast extract, 0.05% Glucose + 10% of all the necessary amino acids.
Thialysine medium is SD with the appropriate amino acids according to the selection needed, without lysine containing 100mg/l thialysine (S-(2-aminoethyl)-L-cysteine hydrochloride) (SIGMA).
37 Canavanine medium is SD with the appropriate amino acids according to the
selection needed, without arginine containing 40mg/l canavanine (SIGMA).
For solid media 20g/l agar was added (SD was also supplemented with 160µl/l NaOH
10N).
BACTERIA:
LB - 1% Bacto Tryptone, 0.5% Bacto yeast extract, 0.17M NaCl.
Ampicilin (Amersham) 50 mg/l was added to LB+Amp plates.
2.2. Yeast genetics
Mating: two haploid colonies were mixed on YPD plate and incubated overnight at
30º. The mixture was streaked or replicated to appropriate selective plates and grown at 30º, until colonies were visible.
Sporulation: The diploids from the selective plate were patched on a YPD plate and grown for two days at 30º. Then replicated to solid sporulation medium and incubated
for 10-12 days at 250 C. In some cases, a 3 ml saturated diploid culture was washed
with 1ml SPO medium, resuspended in 3ml SPO medium and left to sporulate for 7-
10 days at 250 C.
Co-segregation test: Telomere length phenotypes of 27 candidate strains were
checked by testing cosegregation of the length phenotype with the deletion (G418r).
The candidate mutant strains were mated with BY4742 wild type, and the resulting
heterozygous diploids were sporulated. Tetrads picked were scored for G418
resistance on YPD plates supplemented with 200 mg/l G418 (Amersham
Biosciences). Telomere length was estimated by Southern blot analysis.
38 2.3. S. cerevisiae strains
2.3.1. BY4741 background:
BY4741: MATa ura3Δ met15Δ leu2Δ his3Δ. This strain is of S288c background and
was used as a standard for the sequencing project and for the deletion collection.
TLM strains: selected strains from the Saccharomyces Genome Deletion Project
(Winzeler, 1999) in which each strain was deleted for a single ORF (replaced by the
KanMX4 cassette, which confers G418 resistance). (See Table 3.1).
TEA strains: five selected TLM strains for the Telomere Epistasis Assay; CDC73,
DCC1, RFM1, VPS34 and SRB2. These strains were subjected to marker swapping as
detailed below.
Y3656: MATα ura3Δ his3Δ leu2Δ met15Δ Δcan::MFA1pr-HIS3 MFα1pr-LEU2 (Tong
A. and Boone Charles)
Y8205: MATα ura3Δ his3Δ leu2Δ met15Δ can1Δ::STE2pr-Sp_his5 lyp1Δ::STE3pr-
LEU2. This strain was created by Tong A. and Boone C. to select for haploids of one
mating type in the synthetic genetic array (Tong and Boone, 2007).
yTG273: MATα ura3Δ his3Δ trp1Δ::hisG leu2Δ met15Δ can1Δ::STE2pr-Sp_his5
lyp1Δ::STE3pr-LEU2. This strain is of Y8205 background and was created by
transformation of the plasmid ptrp1–ΔFAhUh (cut with BamHI) harboring the
trp1::hisG_URA3_hisG construct followed by two consecutive selections: first
selection for Uracil prototrophs and Tryptophan auxotrophs to create yTG270: then
selection for Uracil and Tryptophan auxotrophs to create yTG273.
yTG329 : (yTG273 background) MATα cdc73Δ::URA3. Created by two consecutive
transformations: first with plasmid pAG60 (cut with NotI) containing the
39 kanmx::URA3 allele into the strain cdc73Δ from the deletion library to create
yTG322, and then with PCR fragment created by PCR on that strain with primers
located on the 5' and 3' UTR sequences of CDC73 (1054+1055) containing the
cdc73::URA3MX4 fragment into yTG273. Uracil prototrophs that were sensitive to
G418 were selected and presence of cdc73Δ::URA3 was confirmed in PCR. CDC73 is mentioned here and in the following text as an example; the same procedures were done with the rest of the five TEA genes. yTG323 MATα his3Δ leu2Δ can1Δ::STE2pr-Sp_his5 lyp1Δ::STE3pr-LEU2 trp1:hisG vps34Δ:Ca URA3 yTG325 MATα his3Δ leu2Δ can1Δ::STE2pr-Sp_his5 lyp1Δ::STE3pr-LEU2 trp1:hisG rfm1Δ:Ca URA3 yTG327 MATα his3Δ leu2Δ can1Δ::STE2pr-Sp_his5 lyp1Δ::STE3pr-LEU2 trp1:hisG srb2Δ:Ca URA3 yTG337 MATα his3Δ leu2Δ can1Δ::STE2pr-Sp_his5 lyp1Δ::STE3pr-LEU2 trp1:hisG dcc1Δ:Ca URA3 yTG276 MATα his3Δ leu2Δ can1Δ::STE2pr-Sp_his5 lyp1Δ::STE3pr-LEU2 trp1:hisG hoΔ:Ca URA3
2.3.2. Tester strains (from the lab stock):
287: MATa ura4 car2 gal2.
288: MATα ura4 car2 gal2.
#7: MATa his1
#8: MATα his1
Diploid strains construction:
40 TLM strains were crossed to each of the five TEA strains on YPD and selected by streaks on SD-URA-TRP +G418 to generate diploids double heterozygotes for the two mutations e.g CDC73/cdc73Δ::URA3 TLM/tlmΔ::KanMX4 and ura3Δ/ ura3Δ his3Δ/ his3Δ TRP1/ trp1Δ leu2Δ /leu2Δ met15Δ /met15Δ CAN1/can1Δ::STE2pr-
Sp_HIS5 LYP1/ lyp1Δ::STE3pr-LEU2. TLM were crossed in parallel to yTG276 (see above) to generate HO/hoΔ::URA3 TLM/tlmΔ::KanMX4.
Haploid double mutant strains construction:
Diploids were sporulated at 25ºC on solid sporulation medium for 7-10 days. The spores were streaked on SD-Ura-Leu-Lys + G418 + thialysine to generate haploid double mutant strains:
1. MATα cdc73Δ::URA3 tlmΔ::KanMX4 ura3Δ his3Δ lyp1Δ::STE3pr-LEU2.
2. MATα hoΔ::URA3 tlmΔ::KanMX4 ura3Δ his3Δ lyp1Δ::STE3pr-LEU2.
2.4. Plasmids
pAG60: CaURA3MX4 (Goldstein et al., 1999) ptrp1–ΔFAhUh: trp1:hisG_URA3_hisG plasmid. The plasmid carries the trp1-ΔFA deletion flanked by 0·45 kb 5' and 0·49 kb 3' genomic DNA for directing recombination at the TRP1 locus (Horecka and Jigami, 1999)
2.5. PCR analysis
Presence of the appropriate deletion was verified in all the TLM strains that were
found in the screen, by PCR analysis using an upstream primer from each gene and a
primer from inside the KanMX cassette . When necessary, the reaction was repeated
using the KanMX primer and a primer complementary to the UPTAG primer that was
41 used to create the deletion strains . This PCR product was sequenced in order to
identify the strain by its unique tag (Winzeler et al., 1999; Winzeler, 1999).
Presence of the appropriate deletion and lack of wild-type copy in the putative
double mutants haploids were verified by PCR analysis using primers upstream and
downstream of each of the five AEA genes (see Table 2) or using an upstream primer
from each gene and a primer from inside the KanMX cassette for the TLM genes.
When the gene open reading frame resembled the KanMX insertion in length,
enzymatic restriction of the PCR product ensured which allele is the wild-type and
which one is the deletion. PCR reaction was performed with an annealing temperature
of 550C, using primers at a final concentration of 0.4µM. Elongation time was 1
minute for each Kb of the longer predicted product.
Table 2.1- List of primers that were used for the deletion verification. PRIMER SEQUENCE (5’ TO 3’) NO. PRIMER NAME
CTTAGATCCTTGTCACATAATC 313 SMI1.u
CGATTATTGCTACGGCCATC 314 TRK1.u
CTTCCAAGTGAATGAAAGTGC 315 YJL163C.u
GTGGTGCTAAAGGAATAGATG 316 KRE21.u
GTGCAATATGCGAAAGAACAC 317 YLR390W.u
GAGATACATGGAAAGAAATAGG 318 GRD12.u
GCCCTTTTGTCATCTTCTGG 319 CDC73.u
GCGAAAGTCGTAGGTGTTTG' 320 YBR077C.u
CCCGTGTCTTTCTCTACCA 321 PDX3.u
CAAGGATTATCTGTTGGGATG 322 GRD8.u
GTAATGAGTTGGTAGTTTTCTC 323 TPD3.u
42 CTTTGTACAAGCCGTTATTGG 324 RSC2.u
GTTTCCAAAAGAGTCAATTGTG 325 SHI1.u
GAAAAGTAACGCTATTACATCC 326 RPL38.u
GTTCCTTTTAGAATAGCACCC 327 YOR008C-A.u
GTACCAACTTTACCTGCTTTC 352 UGO1.u
CAGGTTGGTGGAAGATTACC 353 TPI1.u
GAATGCCGTTTGTTGGCTTC 336 BUD23.u
CAGACTAACGACTATATGCAC 337 HCM1.u
GTGACTTTCAAGGCAACGTC 338 CRY1.u
GGTAAGGTTGCCATTGATAAG 339 APE3.u
CTTCATGGATTGCAAGAATTAG 340 SHY1.u
CTTTGCTAGCATAGGAATAGG 341 YGR042W.u
CGATAATGTAAGAGGGTTCTG 342 CSM1.u
CAGAAACAACAGCACATGATC 343 APT1.u
CCACTGTAAGAACATAAGAATG 344 YPL183W-A.u
GCCTCATAAAGCTGTCTCTG 345 MRPL28.u
CTATCCATGGTATATGTGAGG 346 YGR064W.u
GCCAAAACTACCATGCTCTG 347 YCR043C.u
CAAGGTTATAAGAAGTGCCA 348 YPL183C.u
GATTACGTTAAAGCCTGTCTG 418 YPL183C.u
CCATTTGCTGAAAAGTTATACG 349 VPL3.u
GACTGGACAATGTGTCTTCG 350 SOH1.u
GGAGCACTATCCAATATGCG 351 LST7.u
CATGTGGGACATTGTAGGTG 378 KRE28.u
43 GCAAGTTCAATAACTACCAAAG 379 PCP1.u
GATTAATGGTTGCGAAGTGAG 380 SCW11.u
GGTTAATCGATGATTGATCAAC 381 RPS30B.u
GTGCTGTTATAACCGTACAAG 382 CST6.u
GACACCAAACCATAGAACGC 383 URE2.u
GGTCAGTAAGTCAATTGCCG 384 VPS28.u
CAGTCCGTGTATGGGATTTG 385 YBR197C.u
GCAGTTCTATAATCCAAGAATG 386 KKQ8.u
CTTGTGTTATGGAGTTACTGC 387 FYV12.u
GTAGTAACTAGCTTAGCATCG 388 RRP8.u
GGATTCCTAAATCCTCGAGG 389 HIT1.u
CATTGGAGGTACCTTTTGAAG 390 TOM5.u
CTCATCTTCTCTAGTGATACG 391 VAM7.u
GGATATGAAGATTGGTGATATC 392 RTF1.u
GTATCCCAAGTTTGCAATTGG 393 RFM1.u
CTGGCGTAAACTTGACTAGC 394 BRO1.u
GCGACATATTGCAATCATCTG 395 YPL041C.u
GTCTACAATATTGTCGTCTCC 396 SNF8.u
CTGGAAGAACTATATAGACAAG 397 OPI1.u
GCTATTGGTAACCATGAAGTG 398 SIT4.u
CAAGATGGTTCAATGAGACAG 399 ERG28.u
GTGAGAAATTTGTGTAATACCC 400 RPB4.u
GAACGATTGGTCAAGGCTTG 401 MRPL38.u
GAGTTGTGTGTATTCAACTATG 419 MAS5.u
44 GCACTTAATCTAGCTTGGTAC 414 YDR115W.u
CGTTGACGGATTCGTTGATG 415 YIL042C.u
GTGCAATATGCGAAAGAACAC 406 CCW14.u
CGATTAAGCCATAGGGAAAAC 407 YTA7.u
CAATTGTAATAGCGCTTAATCG 408 RIF2.u
CTTTGACAACTTACAACAAGAG 409 YJR080C.u
CCAGCAAAGAAGTCAATCTAC 410 ADE12.u
CTCCTCCAACTTGTTAGAATG 411 PEP6.u
GATGTCCACGAGGTCTCT 305 Up-tag
CTAGAGATTCCTCTAGCGAG 466 RPS16A.u
GAAAGTATGGAAGGATGCTTC 465 OGG1.u
GTCGTATGTTCGGTACAAATG 464 YML035C-A.u
GTCTTCAAGAATCCAAACTCC 463 HSP104.u
CTCATATATACAATGTCTGACG 462 YEL033W.u
GCTTAAATCAAGAATAAACCCC 461 TAT2.u
GAACGAAAGATTATTCGCATTG 460 RPS17A.u
GTACCCTGCAATAGAGGTAC 474 SSN8.u
CGGCAAGTTCTCTAGTAGAC 473 BUD30.u
CGATAAGCGCTTCTATTTTCC 472 YOR1.u
GATCTTTACAGTATATAGAGGC 471 VPS65.u
GGAAGGTTCGAACAGCATTG 470 MAK10.u
GAGCAGTGCTTGCTTTTCAG 469 RPS4B.u
CATAGAGGAAGCTCAATGGC 468 PPE1.u
GAAGAGGCATCTACAGAATTG 467 RPS10A.u
45 CCCAATTCTACTCCTGCAAG 484 LRP1.u
CTTGGAATAGTAATACTTGCAC 483 YPL144W.u
GCGATGTGTATGTAAGCACG 482 BEM4.u
CTTCTTTAGAGATTATTACGGC 481 HST1.u
CATTATCCATGACATGACACG 480 SIN3.u
GCTTTTGTTCACAAGGATTTAG 479 YOR322C.u
CCCAACAGGTTCTATCTATTG 478 MRPL44.u
CTAATAACAGTACTAAGAACGC 477 SSE1.u
CTTTTGACGATTCTTCGAGTG 476 STO1.u
CATACATATTCAATGAGCTGAG 475 YMR116C.u
GATTAGGTTTCATTGCCATAAC 497 VPS34.u
GGAGCAAAGTCATCTCAGTC 496 SPT1.u
CTCACGATTAATGGTCTTTTTC 495 KEM1.u
CAAAAACGATACATGAAGATGG 494 RPL1B.u
CTAAATAACTTCAGCACATTTTC 493 YDL118W.u
CAAGATTTGGAAGAGCAAGTC 492 PRS3.u
CAGTCTCACGTTTCTATGCG 491 CVT9.u
CCCAACCTCATTCCTCTTTC 490 CSR2.u
CTTTTCTTACCAGGCCGCC 489 RPL13B.u
CTTCAAACATCCGTGCACTG 488 RPL12B.u
GTTGGATACTGATCTGATCTC 487 RPP1A.u
CTTGCCTGTTTTTCCGCAAC 486 ADO1.u
CTTTGCGCCCAATTCTACTC 485 DCC1.u
GACCAACTGTTCGGTATGTG 509 YER093C-A.u
46 GTGGTACATAACGAACTAATAC 508 ADH1.u
CGCCATTTCATGGAAACCTG 507 NPL6.u
CATTTGTAATGAAGCAGGATTC 506 MAK31.u
CGTTAGAGTCCCTTAAAAGTC 505 YPL105C.u
GTTCGAAACGCTGTTTTGATG 504 GUP2.u
GAGAACATAAAGTAGTTCCCG 503 LEA1.u
GAAGTACTGTTACTGAAATGAG 502 NUP60.u
CGTATTTTTGTGAGCCTATCC 501 SAP30.u
CTTGACTCCGACTGAGGAG 500 MOT3.u
CAAAGGAGGATATAGTTTGCC 519 MMM1.u
GTTGGAATTAGCAGTGGAGG 518 BUD16.u
GAATAAGACTTGGCTGATGAG 517 GPB2.u
CAATGATGAATGCGTTTCTGC 516 PEP3.u
GTTAATCCTGCGGCTGCTG 515 YMR269W.u
GGCATATTTTGTAATGTGCTAG 514 POL32.u
GCTGGCTAAGATGTCTTTGG 513 BEM2.u
CAACAGATTATTTTCCATATCTC 512 NUT1.u
CAGCTTTATGCTCTAAAACCC 511 HMO1.u
CGACGGTTTTAGTTTGTTACC 510 MAK3.u
CATGTTTTCTTGGTCAAGGTC 529 GTR1.u
CAAAACGATAAAAGCTGGTG 528 SRB2.u
CTATTAAACTATTTTTTGTCTAGG 527 CTK1.u
GTTTGATCTCAAATCTACTAAAG 526 APG2.u
GTTATAGAGATCAAACTATATGC 525 RPN4.u
47 CTAGTTCCTCATTGCGAAGG 524 HUR1.u
GTCATCCACGTTAATACTCTG 523 VPS9.u
CCCCACCACAAATGAGAATG 522 EAP1.u
CTTCCATGACATCATCTAAGG 521 ARV1.u
CAGTAATAGAGCGATCCAAAG 520 ARG2.u
GAGAGCAGAAGGAAAACGAG 539 VPS75.u
CCCAGTATGTCTATTTGTGTG 538 HCH1.u
GAAGTTAGACTACGCACCAG 537 MFT1.u
GGAAGAGCTTTTCCTAGTATG 536 XDJ1.u
GCCATTCTAGTGATTTCGCC 535 SNF7.u
CAACACACGCATCATGACAG 534 BRE2.u
CCTCTAACTACAAAAAATGGTC 533 CGV3.u
GATAAATCAGAGCATTGAGTAG 532 YEL057C.u
CGATTAAGCCATAGGGAAAAC 531 YTA7.u
GCTATCACCTGCAGCTTTAC 530 YOL138C.u
GTTATGTATAGCCCATAGTTAC 545 ISA1.u
CCTTAGTTGGCGCCATGTG 544 VAM6.u
GCATATGTTCATCTTCATCTTC 543 MRT4.u
GCTGGCAAAGGAACGTAATG 542 STP22.u
CAAACATCTGTTTCGGTACAC 541 THP2.u
GTGATATCCTGTGATAAGATAG 540 YPL205C.u
CATATTACAGAAAGGGTTCGC 668 HO_UP
GATTGAAGCTGCTTTGTCCG 669 HO_DOWN
GTACGCTGCAGGTCGAC 666 U2
48 ATCGATGAATTCGACTC 671 D2
AACTCTTATTGGCCCTCGCATA 1053 CDC73_down0.5
TTGCTGTGGATGTCACTTTTGC 1052 CDC73_up0.5
GCATGCCCACCAAGTGAACTAT 1051 RFM1_down0.4
CATGGCATTGTACGAGTCATGG 1050 RFM1_up0.6
TGAGAACGAAACAAAGCAAAA 1042 VPS34_down0.5
ATCGGATTAGGTTTCATTGCCA 1041 VPS3_up0.45
CCTATATGTGGCCGCTGGAAC 1047 DCC1_down0.5
ACGACAGGTCTTTCTCCATTGG 1046 DCC1_up0.4
TCGGAGACCAAAGAGGAAAGAA 1045 SRB2_down0.5
ATATAACCTCGCGCTGAGCTTT 1044 SRB2_up0.5
GATGTCCACGAGGTCTCT 305 Tag-U1 (up)
GCCATCAAAATGTATGGATGC 304 Kan0.2D (down)
2.6. Molecular biology techniques
Yeast genomic DNA extraction
Phenol method - A 3ml of overnight culture was harvested, and the supernatant was
removed. To the tube we added ~0.3g acid-washed glass beads, 300µl lysis buffer
(2% Triton, 1% SDS, 0.1M NaCl, 10mM TrisHCl pH 8, 1mM EDTA) and 300µl
25:24:1 phenol:chloroform:isoamyl alcohol. Tubes were vortexed for 20’, and
centrifuged for 10’ at 14 krpm. The top phase was carefully transfered to a new tube
containing 3 volumes of ethanol in order to precipitate the DNA. Tubes were
incubated for 20' at RT and centrifuged for 10’ at 14 krpm. The pellet was
resuspended in 300µl TE x1 (10mM TrisHCl pH 7.5, 1mM EDTA) with RNase
49 (Sigma) 50µg/ml in 65ºC for 10'. Then DNA was precipitated by adding 0.3 volumes of 10M Ammonium acetate and 3 volumes of ethanol 100% and incubated at -20ºC for 30 min-16 hrs. Tubes were centrifuged for 10' at 14krpm at 4ºC. Pellet DNA was
washed with cold ethanol 70%, and resuspended in 50µl H2O or 10mM Tris-HCL pH
7.5.
Lyticase method - A 3ml of overnight culture was harvested, and the supernatant was
removed. To the tubes we added 200µl SEB buffer (1M Sorbitol, 14mM βME 0.1M
EDTA) and 5 µl Lyticase from a 1mg/ml stock solution. Tubes were incubated for 30’
in a gentle shake at 37ºC, and centrifuged for 2’ at 5 krpm and the supernatant was
removed . The pellet was well resuspended in 250µl EDS buffer (0.2%SDS,
2.5mMNaOH 50mMEDTA) and incubated for 15' at 65ºC. After an addition of 80µl
10M NH4OAc, the tubes were gently inverted several times and incubated for 60' on
ice. After centrifugation for 10’ at 14 krpm the supernatant was transferred to another
tube and DNA was precipitated by adding 150µl Isopropanol. The tubes were gently
inverted several times and centrifugated for 5’ at 14 krpm after which supernatant was
removed. Pellet DNA was washed with cold ethanol 70%, and resuspended in 50µl
H2O or 10mM Tris-HCL pH 7.5.
E. coli Plasmid extraction - Plasmids were extracted from E. coli using the DNA-
spin plasmid DNA purification kit (iNtRON).
Yeast chemical transformation - Yeast overnight cultures were diluted 1/20 into
50ml of YPD and incubated at 30ºC, 220 RPM for 4hrs. Cells were harvested at a
7 density of 2*10 cells/ml, washed twice with cold H2O and resuspended at a final
volume of 1ml H2O. 100µl of the cell suspension was then added to 360µl
transformation mix (33% PEG3500, 0.1M LiAcetate, 0.27 mg/ml Salmon Sperm
Single Stranded DNA (SSSSDNA)), 200 ng-1µg of plasmid or fragment DNA was
50 added and the mixture was vortexed gently and incubated at 42ºC for 40 min.
Following heat shock cells were spinned down and resuspended in 1 ml of YPD. Cells were incubated at RT for 30 min and then plated on selective plates.
E. coli transformation – Competent cells were thawed on ice. 50-100 µl bacteria were mixed with 1µl DNA, and incubated at 42ºC for 2'. Following heat shock cells were immediately transferred to ice for 2' and afterward resuspended in 1ml LB and were allowed to grow at 37º for 1hr. Appropriate dilutions were plated on selective plates (LB+ Amp) and allowed to grow over night at 37ºC.
Telomere Southern Blot - Genomic DNA was digested with XhoI for at least 3.5 hours at 37ºC and the digested DNA was separated in a 0.7% agarose gel in TBE x0.5 buffer (1:10 dilution of TBE x5: 0.45M Tris-Borate, 10mM EDTA pH 8) for 16 hrs at
56 V. Southern bolts were performed after shaking in 0.64% HCl for 10 min and in
0.4N NaOH for additional 10 min. The blotting was carried out in 0.4N NaOH for 5-
16 hours on NYTRAN nylon membrane (Whatman Schleicher & Schuell), then the membrane dried and subjected to UV cross-linking (1200μjouls X100 in a UV
Stratagene linker 1800).
Telomeric probe Preperation: 1) End labeling: S. cerevisiae-specific telomeric probes were end labeled by phosphorylation with T4 polynucleotide kinase (Biolabs) of 10-25ng of a telomeric G-strand oligonucleotide. Hybridization was carried out in hybridization buffer: 7%SDS, 1mM EDTA, 0.5M Na2HPO4 pH 7.2 (1 hr in 50ml)
and washes were performed with wash buffer: 1%SDS, 1mM EDTA, 0.2M Na2HPO4 pH
7.2 (total 20 min 100ml). Hybridizations and washes were performed at 45°C
2) Random priming: S. cerevisiae-specific telomeric probe was labeled by random
priming of 20 -25 ng of a telomeric fragment and of 20-25 ng of size-control
51 fragments using the DNA labeling mix (Biological industries). Both fragments were generated by PCR using the primers indicated in Table 3. For the telomeric probe, a specific region of the left telomere of chromosome VII was amplified to generate a product 300 bp long. The specificity of the sequence to the telomeres was confirmed by BLAST, using the product sequence as a query against the S. cerevisiae sequence dataset. As size-control probe, a specific region of chromosome II was amplified to generate a product 1100 bp long. The PCR product was ligated to pGEM vector by using the T4 DNA ligase (Roche). The plasmid was digested with NotI and the relevant fragment was purified from agarose gel. The size-control probe detects two bands from the XhoI digested genomic DNA in the sizes of 2044bp, 779bp and some of the bands of the 1kb marker (Fermentas) in the Southern blot. Hybridizations were carried out overnight in Church buffer (BSA 1%, buffer phosphate 0.5M, EDTA
1mM and SDS 7%) in 30ml, and washed three times (each one for 20 min in 40ml) with the following dilutions of SCCx20 (0.5M NaCl ,0.05m C6H5Na3O7): SSCx2 +
0.1%SDS, SSCx0.2 + 0.1% SDS and finally with SCCx2. Hybridizations and washes
were performed at 65°C.
Table 2.2- Primers used for telomeric probe. PURPOSE PRIMER SEQUENCE (5’ TO 3’) NO. PRIMER NAME
Telomeric probe TGTGGGTGTGGGTGTGGGTG 187 S. cerevisiae G-strand
-end labeling
Telomeric probe- GTTGGAGTTTTTCAGCGTTTGC 991 Left 2 up
random priming
Telomeric probe- TGTGAACCGCTACCATCAGC 990 Left 2 down
random priming
Size control TTGTAGGGGCCTTTTGTAATGT 1006 Tel-cont.up
52 probe- random priming
Size control GTGCGCCCAGTAAGGGGT 1007 Tel-cont.down
probe- random
priming
2.7. Quantification of telomere length
Two methods were used. 1) Internal control fragments containing S. cerevisiae
telomeric repeats were generated by purifying 1835 bp and 644 bp fragments resulting
from BsmAI and TaqI digests, respectively, of the plasmid pYt103 (Shampay et al.,
1984). Approximately 10 ng of each purified DNA was added to each lane together
with the XhoI digested genomic DNA. The average telomeric length for each lane was
estimated by plotting the peak of signal intensity of the shortest telomere band (Y’
telomeres) against the position of the added internal telomere size standards.
2) Later we switched to the following method. The peak of the signal intensity of
the shortest telomere band (Y’ telomeres) of each experimental strain was measured,
using the GelQuant software, by comparing it to the control size bands (size 2044 and
779bp). And during the final analysis I have been using the software Tel Quant that
was developed by the talented student Lior Unger from our lab. In this software each
band represents telomeres or length marker is measured and the data is transferred to
an Excel file. There we can calculate the difference in length of each strain from the
wild type, and each double mutant (the average of three independent strains) from its
single parent.
53 3. RESULTS
3.1 Isolating of TLM genes in a genomic screen.
In collaboration with the laboratory of Dr. Michael J. McEachern (Department of
Genetics, University of Georgia), we have carried out a genome-wide screen for
mutants affecting telomere length. In the first round of screening we used 4852 single
ORF deletion haploid strains as purchased from Research Genetics. Cultures were
grown on rich media and DNA from each strain in the collection was digested with
XhoI, separated by gel electrophoresis under standardized conditions and subjected to
Southern blot analysis using a telomere-specific probe. The telomeric probe produces
a complex pattern, derived from hybridization to many telomeric fragments, and also to several subtelomeric repeats (Zakian and Blanton, 1988). The latter served as internal controls, as their electrophoretic mobility is not usually affected by the various mutations. The shortest fragments (~1.3 kb in wild type cells), resulting from
Y’ -containing telomeres, were the most reliable in determining telomeric length differences between strains, both because they represent multiple telomeres and because length differences are most pronounced in the shortest fragments (the length of wild type telomeres in S.c is typically around 350bp) . Some of the higher bands, corresponding to telomeres containing an adjacent X element and no Y’ element (X’ telomeres), were also observed carefully in order to identify mutants with length alterations.
After the first round of screening, ~600 mutants exhibited possible short or long telomere phenotypes compared with the rest of the strains in the gel. Under the assumption that most of the deleted strains would have telomeres with a wild type length phenotype, we didn’t use the wild type strain in each southern in the first round
54 of screening. In the second round the 600 mutants were re-tested by at least two
additional rounds of fresh DNA preparations and Southern blotting. DNA from wild
type cells was run interspersed amongst the mutants in these gels to maximize the
chances of correctly identifying mutants with even a modest effect on telomere length. By this criterion, 173 strains were identified that consistently exhibited either
shorter or longer telomeres than wild type (see Table 3.1). In addition, 26 other
mutants were labeled as questionable gene candidates for telomere length phenotype
because they showed very mild telomere length phenotypes that failed to be detected
in at least one repeat Southern (see Table 3.2).
One additional DNA preparation and Southern blot was then carried out to measure
telomere length in each of the 173 mutants identified in the screen. The average
telomeric length for the shortest telomeric fragment (Y’ telomeres) was then
estimated by utilizing fragments generated by restriction digests of a plasmid
containing a cloned Saccharomyces telomere that were added to each genomic DNA
sample. These telomeric fragments ran at positions above and below the Y’ telomeric
bands and served as internal controls to measure size and to assure uniform migration
of different samples (see M&M). Figure 3.1 shows an example of one of these
Southern blots, each of which was run on long gels (25 cm) to maximize resolution of
telomeric length differences. Average Y’ telomere length for the wild type strain was
estimated from multiple samples run on the same gels. The change in Y’ telomere
length relative to the wild type was then estimated for each of the 173 mutants. 25 of
the 173 mutants in this last Southern blot analysis showed Y’ telomeres that had only
slight length differences with the wild type control (less than 25 bp). We have not
excluded them from our list since they had reproducibly shown slight length
55 differences in all other Southern blots carried out. These mutants are marked with an
asterisk both in the Figures and in the Tables.
3.2 Confirming the identity of TLM mutants.
The identity of each of the 173 mutants shown in Table 3.1 was confirmed by PCR
analysis (see M&M). The sizes of the Y’ telomeres were grouped into the following
categories: slightly short (<50 bp shorter than wild type), short (50-150 bp shorter
than wild type), very short (>150 bp shorter than wild type), and equivalent categories
for long telomere mutants (see Table 3.1). While consistently showing either long or
short telomere length, many of the deletion strains exhibit some variation in the
degree of their length phenotype when observed over repeated Southern blots. We have considered the length phenotypes from all Southern blots before assigning a
gene to one of the phenotypic groups shown in Table 3.1. Of the mutants identified,
123 exhibited shorter and 50 showed longer telomeres than wild type.
Twenty six mutants identified as having altered telomere length in our screen
(marked with ** in Table 3.1), were tested for co-segregation between the telomere
phenotype and the G418 resistance determinant, which was inserted in place of the
deleted gene in the deletion library. All of these except one showed clear co-
segregation of the telomeric phenotype with G418 resistance. The single exception,
yel033w, showed a short telomere phenotype that segregated independently from the antibiotic resistance. From our analysis we conclude that the yel033w deletion segregates with a very slow growth phenotype and the short telomeres segregate with a suppressor mutation responsible for restored growth. Thus, YEL033W, a dubious
ORF, appears to genetically interact with an unidentified gene with telomere function.
Our results imply that in the vast majority of our strains the telomere phenotype was caused by the relevant deletion. 56 Table 3.1. List of S. cerevisiae genes that affect telomere length when deleted.
Gene Telomere Function phenotype DNA metabolism EST1 VS Telomerase holoenzyme complex EST2 VS Telomerase reverse transcriptase EST3 VS Telomerase holoenzyme complex TEL1 VS (125) DNA damage response kinase YKU70 VS (110) DNA repair, Ku70/Ku80 complex YKU80 VS DNA repair, Ku70/Ku80 complex MRE11 VS DNA repair, MRX complex RAD50 VS DNA repair, MRX complex XRS2 VS (175) DNA repair, MRX complex RNH35* VS RNaseH, DNA replication; Int./Rif2 DCC1 S Sister chromatid cohesion HUR1 S (320) DNA replication; Int./Mec3 LRP1 S C1D ortholog, double-strand break repair YPL205C S Overlaps with HRR25 RIF1 VL (1080) Telomere maintenance, silencing RIF2 VL (700) Negative telomere regulator ELG1 VL (569) Genome stability PIF1 VL (620) Telomere maintenance, recombination OGG1 L (560) Base excision repair, shares PIF1 promoter POL32* sl (436) DNA polymerase Delta complex MLH1* sl Mismatch DNA repair CSM1 sl Meiotic chromosome segregation. Int./Zds2 YML035C-A* sl Antisense to SRC1 Chromatin, silencing, PolII transcription HST1 S (270) SIR2 homolog, histone deacetylase complex SUM1 S Suppressor of sir mutants RFM1 S Part of Hst1 histone deacetylase complex SIN3 S Part of Rpd3 histone deacetylase complex SAP30 S Part of Rpd3 histone deacetylase complex OPI1 S Interacts with Sin3
57 Gene Telomere Function phenotype DEP1 S Part of the Rpd3 histone deacetylase complex HDA2 S (265) Part of the HDA histone deacetylase complex CDC73 S Part of the Paf1 complex RTF1 S Part of the Paf1 complex BRE2 S Part of the SET1 histone methylase complex MFT1** ss (300) Tho and Paf1 complexes THP2 S Tho and Paf1 complexes SOH1** S Suppressor of hpr1 mutants (Tho and Paf1) RPB9 S (310) RNA polymerase II subunit RPB4, CTF15 S RNA polymerase II subunit SRB2 S Transcription, mediator complex SRB5** S Transcription, mediator complex RSC2 S (280) RSC complex, chromatin modelling CTK1 S PolII transcription regulation, protein kinase SPT21** S (114) PolII transcription, chromatin CST6 ss Transcriptional activator, chromosome stability NUP60* ss Silencing, part of the nuclear pore HTL1** VL (402) DNA replication and chromosome cycle HPR1 L (530) Tho and Paf1 complexes HCM1 L (502) Transcription factor (forkhead2) MMS19** L PolII transcription (TFIIH) and repair YDJ1* sl Forms a complex with Mms19 SSN8 L Transcription, mediator complex NUT1* sl (573) Transcription, mediator complex NFI1 sl (423) SUMO ligase, chromatin protein FMP26* sl Int./SAGA, reported mitochondrial protein VPS65* sl (473) Deletion affects SFH1 (RSC complex) HMO1* sl (545) ssDNA binding, HMG-box protein NPL6 sl Protein—nucleus import Vesicular traffic (vacuole, Golgi, ER, membrane synthesis) CAX4 VS ER, N-glycosylation, phosphatase VPS3 S Vacuolar sorting protein
58 Gene Telomere Function phenotype VPS9 S Vacuolar sorting protein VPS15** S Vacuolar sorting protein VPS18 S Vacuolar sorting protein VPS23** S Vacuolar sorting protein, ESCRT-I VPS28** S (260) Vacuolar sorting protein, ESCRT-I VPS22** S Vacuolar sorting protein, ESCRT-II VPS25** ss (280) Vacuolar sorting protein, ESCRT-II VPS36** S Vacuolar sorting protein, ESCRT-II VPS32 S Vacuolar sorting protein, ESCRT III YEL057C S Vacuolar sorting protein, ESCRT-III BRO1 S Vacuolar sorting protein, after ESCRT-III VPS34 S Vacuolar sorting protein VPS39 S Vacuolar sorting protein VPS75 S Vacuolar sorting protein VPS43 ss Vacuolar sorting protein APE3 S Vacuolar protein degradation ATG11 S Vacuolar targeting MOT3 S (335) Suppressor of spt3, increased sterol levels ARV1 S Sterol metabolism and transport AGP2 S Carnitine transporter, fatty acid metabolism YTA7 S Affects ergosterol and dolicol synthesis PDX3** S Pyridoxine phosphate oxidase ERJ5 S Golgi transport to ER LST7 S Golgi-to-surface traffic protein SUR4** S (315) Fatty acid synthesis, transport RPN4 S Ubiquitin degradation pathway PMT3* ss Protein-O-mannosyl-transferase, ER YSP3 ss Subtilisin-like peptidase RNA metabolism UPF1 VS Nonsense-mediated mRNA catabolism UPF2 VS Nonsense-mediated mRNA catabolism UPF3 VS (120) Nonsense-mediated mRNA catabolism
59 Gene Telomere Function phenotype KEM1 VS (235) Exonuclease, mRNA degradation RRP8 sl Methyltransferase, pre-rRNA processing STO1 sl (478) mRNA splicing and snRNA cap binding LEA1 sl (500) mRNA splicing YPL105C* sl Unknown, Int./Mud2, Msl5 YMR269W* sl Unknown, Int./elF2B Cell polarity, cell wall, bud site selection BEM4** S Cell polarity, actin organization YOR322C S Clathrin-coated vesicles BUD16** S Unknown, putative pyridoxal kinase YPL041C S Int./cell wall mutants, phosphoglucomutase YPL144W S Cell wall, phospholipids SMI1 S (290) Cell wall synthesis, chromatin binding CCW14 S Cell wall structural protein CSR2* ss Cell wall organization GPB2 Ss Pseudohyphal growth SPS100 ss Spore wall assembly LDB7 L (560) Cell wall organization BUD30 sl (698) Bud site selection BUD23* sl Bud site selection BEM2* sl Polarity, cytoskeleton, budding Protein modification and heat shock proteins SSE1** S Antioxidative response, cochaperone XDJ1** S (340) Chaperone regulator HSC82 S Heat shock protein HCH1 ss Chaperone activator, Hsp90 suppressor MAK10** L N-acetyltransferase MAK31** L (529) N-acetyltransferase MAK3** L N-acetyltransferase HSP104 sl (570) Heat shock protein CDH1 sl (528) APC/cyclosome regulator Ribosome and translation RPP1A VS Large ribosomal subunit
60 Gene Telomere Function phenotype RPL12B S (310) Large ribosomal subunit RPL13B S Large ribosomal subunit RPL1B S Large ribosomal subunit MRT4 S Ribosomal large subunit biogenesis EAP1 S Translation regulation RPS17A VL Small ribosomal subunit RPS10A* L Small ribosomal subunit RPS14A L Small ribosomal subunit ASC1 L (539) Ribosomal subunit RPS16A* sl Small ribosomal subunit RPS4B sl (489) Small ribosomal subunit HIT1*,** sl (550) Ribosome assembly Mitochondria MRPL44 S Mitochondrial ribosomal subunit MRPL38 S Mitochondrial ribosomal protein MMM1 S Mitochondrial organization ISA1 S Mitochondrial Fe/S protein maturation PTC1 S Mitochondrial inheritance TOM5* ss Mitochondrial outer membrane transport PCP1 ss Mitochondrial protease YIL042C ss Mitochondrial kinase YDR115W ss Mitochondrial ribosomal protein UGO1* sl Mitochondrial fusion Nucleotide metabolism PRS3 VS Ribose-phosphate pyrophosphokinase MET7** VS (190) Folylpolyglutamate synthetase ADO1 S Adenosine kinase ADE12 BRA9 S Adenylosuccinate synthetase GCV3 S (314) Folate production Phosphate metabolism PHO85** S (290) Phosphate metabolism PHO80** S Phosphate metabolism GTR1 S Phosphate transport
61 Gene Telomere Function phenotype PHO87** L (489) Phosphate uptake TAT2 sl Int./Pho23, synthetic lethality with pho85 Nitrogen metabolism URE2 S Nitrogen catabolite repression regulator ARG2 S Glutamate acetyl transferase Glycerol uptake GUP1 S (287) Glycerol uptake GUP2* sl Glycerol uptake Potassium transport TRK1 S (330) Potassium transporter Killer toxin-related FYV12* sl (507) Killer toxin sensitive KRE21 sl K1 killer toxin resistant KRE28 S (160) Killer toxin resistant PP2A-related TPD3* S Phosphatase type 2A subunit SIT4 S (195) Phosphatase type 2A subunit YOR1 L (484) Multidrug resistant transporter, Int./PP2A PPE1 L (484) Protein modification, Int./PP2A Unknown YDL118W VS Unknown YEL033W** VS Unknown (failed cosegregation test) YGR042W S Unknown YOL138C S Unknown YMR031W-A S Unknown, overlaps YMR031c YGL039W sl (430) NADPH-related oxidoreductase YOR008C-A sl Diepoxybutane and mitomycin C resistance *-Mutants with Y’ telomeres that had only slight length differences with the wild type control (less than 25 bp);
**-Mutants that were tested for co-segregation;
Genes previously known to affect telomere length are indicated in bold;
Genes marked in yellow were found also as TLM in Gatbonton (Gatbonton et al., 2006).
62 Numbers in brackets in the “Telomere phenotype” column represent the length of the telomeres of this mutant, , measured by the software mentioned in the Results section under the title ”3.5 Analyzing telomeres” on p 72. The length of the wt strain is 350 nt.
Int., interaction known with; ER, endoplastic reticulum; snRNA, small nuclear RNA; ssDNA, single- stranded DNA; APC, antigen-presenting cell; SAGA, Spt/Ada/Gcn5 acetyltransferase; SUMO, small ubiquitin-related modifier.
Remarks here refer to Table 3.2 as well.
Figure 3.1.Representive Southern blot of mutants that alter S. cerevisiae telomere length. Southern blot of XhoI-digested DNA of single gene knockout mutants of S. cerevisiae probed with telomeric sequences. Gene or ORF names, as well as BY4741 controls (WT), are indicated. Samples of DNA from mutants were combined with restriction-digested plasmid DNA to provide internal size standards. The two internal control bands are fragments of the plasmid pYt103 (Shampay et al., 1984) containing telomeric sequences that were generated by mixing separate digests done with BsmAI and with TaqI (producing the 1,835- and 644-bp fragments, respectively). The panel on the left shows a strain BY4741 control (WT p–) as well as the size standards without added yeast DNA.
63
Table 3.2: Saccharomyces cerevisiae genes that produce questionable telomere length alterations when deleted. Single knockout mutants of the listed genes showed slight telomere length defects in more than one but not all of initial Southern blots.
SNC2, marked in yellow, was found as a short TLM in Gatbonton (Gatbonton et al., 2006).
Remarks in Table 3.1 refer to Table 3.2 as well.
Questionable short Common ORF name name Function Translation initiation, interacts with YAL035W FUN12 CDC13 YJL120W Unknown YJL121C RPE1 Pentose phosphate shunt Mitochondria small ribosome YKL003C MRP17 subunit YLR021W Unknown YLR122C Unknown Protein-lipoylation, neighbor of YLR239C LIP2 VPS34 YLR262C YPT6 Enndosome to golgi transport YMR175W SIP18 (300) Osmotic stress response YMR315W Unknown YOR327C SNC2 Endocytosis YPR066W UBA3 Ubiquitin cycle
Questionable long Common ORF name name Function YAL018C Unknown YDL002C NHP10 Unknown, HMG-box protein YDL021W GPM2 Glycolysis, gluconeogenesis
64 YDR391C Unknown YEL007W Unknown YJR063W RPA12 POL 1 complex YMR038C LYS7 Copper chaperone activity YMR316C-B Unknown YNL016W PUB1 Nonsense-mediated mRNA catabolism YOR324C Unknown YOR357C GRD19 Protein retention in golgi YPL226W NEW1 Amino terminal domain acts as a prion YPL239W YAR1 Unknown YPR083W MDM36 Mitochondrial organization
None of the newly identified mutants appeared to have the ever shortening (EST)
phenotype characteristic of telomerase deletion mutants (Lendvay et al., 1996;
Lundblad and Szostak, 1989). Several other mutants (Table 3.3), repeatedly had
telomeres that were heterogeneous in length. Some of these appear to have Y’
telomeres of normal length but have elongated X telomeres, others displayed Y’
telomeres with a bimodal length distribution. Conceivably, the former might be
altered in the uncharacterized mechanism that leads to size differences between X and
Y’ telomeres (Craven and Petes, 1999).
Table 3.3: Saccharomyces cerevisiae deletion mutants with heterogeneous telomere lengths. ORF name Common Function Y' telomere length X telomeric name phenotype bands YAL053W Unknown Mix of wild type and long YER093C-A Unknown Mix of wild type and long YJL206C Unknown Mix of wild type and long YJR110W Phosphoric monoester Mix of wild type and Long
65 hydrolase long YLR028C ADE16 IMP cyclohydrolase activity, Variable: short or long aerobic respiration YLR057W Unknown Wild type Long YLR074C BUD20 Bud site selection Mix of wild type and long YLR096W KIN2 Membrane associated Mix of wild type and serine/threonine protein kinase long YLR231C BNA5 NAD biosynthesis, Mix of wild type and Long kynureninase in trytophan long degradation YLR325C RPL38 Cytosolic ribosomal subunit Mix of wild type and Long long YMR164C MSS11 Specific RNA polymerase II Mix of wild type and transcription factor activity long YMR192W APP2 Unknown Mix of wild type and long YOL082W CVT19 Protein-vacuolar targeting Mix of wild type and long Single knockout mutants of the listed genes reproducibly showed heterogeneity in
their observed telomere lengths. The observed phenotype of the shortest restriction
fragment observed (Y'-containing telomeres) are described. Most of the mutants
showed a bimodal distribution for the lengths of these telomeres. Four of the mutants
(see last column) had elongated X telomeres as the higher bands were longer than
those in the wild type. ADE16 deletion showed short telomeres in two Southern blots
and long telomeres in two Southern blots.
3.3 Organizing genes in epistasis groups by TEA.
Our genome-wide project uncovered a wealth of novel genes that affect telomere
length: Telomere Length Maintenance (TLM) genes. In order to classify these
66 mutants into functional categories we employed another genome wide methodology that we have developed. In this assay (Telomere Epistasis Assay, or TEA), we carry
out epistasis tests with our mutant collection. Each mutant strain is crossed to
different mutants that affect telomere length regulation pathways, in order to create
double mutants. The telomeric length phenotype of these double mutants is compared
to that of the single mutant parents and to the wild type. In this way we can identify
functional interactions between TLM genes and using these interaction classify them
into discrete functional categories.
An epistatic relationship between two genes occurs when both genes participate in
the same telomere length regulation pathway. In this case the telomere phenotype of
the double mutant would be the same as one of the single mutant parents. On the other
hand, an additive relationship between genes is expected when each gene participates
in a different telomere length regulation pathway. If both mutants show the same
telomere phenotype (either longer or shorter than the wild-type strain), the double
mutant is expected to have a more extreme telomere phenotype compared with each
single mutant parent. If each of the mutants shows the opposite telomere phenotype, it
is difficult to define the expected phenotype and those cases will not be discussed in
my work. A synergistic relationship between genes is expected when both genes share
a common biochemnical proccess.
In order to carry out the epistasis analysis with each of the mentioned mutants, TEA
takes advantage of the "magic marker" developed in yeast (Tong and Boone, 2006;
Tong et al., 2004). This technique facilitates selection of haploids mutant strains from
the collection of heterozygous diploids created by mating. Initial attempts to carry out
this analysis were by using the strain Y3656 created by Amy Tong from the
laboratory of Charles Boone. This strain carries the first version of the "magic
67 marker" where a selection for a specified mating type is possible. Inside the CAN1
gene a cassette was inserted, that can select between 'α' mating type (with Leu) and 'a'
mating type (with His) haploids, by the use of promoters of genes that are selectively
expressed in 'α' or 'a' haploids respectively (Figure 3.2). The detailed working plan for
TEA is described in Figure 3.3.
Several problems were encountered when this strain was used in TEA. The biggest
problem was the presence of false positive strains. After completing the procedure for
isolating mating-specific spores with the appropriate markers (G418r, Ura+, Leu+
colonies) further analysis showed that many of these were either diploids or
aneuploids. Therefore, many strains slipped through our initial selection scheme.
After switching to a better version of the "magic marker"; y8205, again created by
Amy Tong from the laboratory of Charles Boone, we obtained better results. In this strain there were two selection cassettes. One cassette for 'a' mating type selection with the gene HIS5 from S.pombe, which complements the his3 deletion in
S.cerevisiae, inserted in the gene CAN1, and a second cassette for 'α' mating type selection with the gene LEU2, inserted in the gene LYP1. A detailed scheme of the
magic marker is presented in Figure 3.2.
Figure 3.2: Schematic presentation of the development of "the magic marker".
A. CAN1CAN1 LYP1LYP1 1pr B. HIS3HIS3 α LEU2LEU2 MF?1pr MF? MFA1pr MF MFA1pr
C. Sp_HIS5Sp_his5 LEU2LEU2 STE3pr STE2pr STE3pr STE2pr
A. The two genes CAN1 and LYP1 encode Arginine and Lysine transporters respectively. When deleted in haploids cells become resistant to the drugs Canavanine and Thialysine respectively. B. The first version of the "magic marker" y3656, where two cassettes for haploid selection were inserted in the gene CAN1. The first cassette is the gene HIS3 under the promoter MFA1 that is expressed only in 'a' mating type haploids, and the second cassette is the gene LEU2 under the promoter MFα1 that is
68 expressed only in 'α' mating type haploids. C. The version of the "magic marker" in y8205, where two cassettes for haploid selection were inserted in two genes CAN1 and LYP1. Schizosaccharomyces pombe HIS5 gene that complements the his3 mutant in S.cerevisiae . This gene is under the promoter of STE2, expressed only in 'a' mating type haploids. The second cassette is the gene LEU2 under the promoter of STE3, which is expressed only in 'α' mating type haploids
Initially we chose to carry out TEA analysis with four well-characterized genes that
participate in telomere maintenance: KU70, TEL1 RIF1 and RIF2, thinking of
creating all the double mutants between these four and the 170 TLM genes. This plan
appeared to be too ambitious, considering the time limit. We therefore chose to focus
on the short TLM genes, and cross them with KU70 and TEL1 both of them having
extremely short telomeres. After creating most of the double mutants, the results
seamed to be very monotonous. Mutations in either TEL1 or KU7 were epistatic to most of the: mutants: we detected only two additive interactions between, TEL1 and
CTK1 and RPL12b. In retrospect we suspect that the extreme phenotype of the two mutants chosen made additive interactions very difficult to detect (alternatively both proteins are completely essential for any telomere processing). We reasoned that
mutations with a milder effect on telomere length may allow us to detect a broader
spectrum of interactions, since the range of possible differences between any single
and double mutants will be far greater.
Given this conclusion we chose to carry out the epistasis analysis with five mutants
exhibiting a mild short telomere phenotype: cdc73, dcc1, rfm1, vps34 and srb2.
Theoretically, we would like to do the crosses of all TLMs x TLMs. This comes to
170 x 170= 28,900 double mutants. We decided on the following, more realistic
strategy: First, we concentrated on mutants that exhibit short telomeres. Second, for each known physical complex we chose one representative, thus creating a panel of
30 representative genes. This is the panel that was crossed with the five genes,
mentioned above, and analyzed by Sounthern blots.
69 The working plan for TEA is described in Figure 3.3 for the case of cdc73 mutant as an epistasis tester.
Haploid telomere length mutants yTG
MATa tlm :: KanMX MATα cdc73::URA3 trp1
Mating [YPD plate]
Diploid selection [SD –URA –LYS]
Meiosis [SPO plates]
Haploid selection
Haploid double mutant [three independent streaks]
Determine telomere length (Southerns)
Figure 3.3: Working plan of TEA- Telomere Epistasis Assay. tlm, telomere length maintenance gene; CAN1, LYP1, genes encode Argnine and Lysine importers respectively. When deleted in haploids the cell becomes resistant to the drugs: Canavanine and Thialysine respectively; STE2pr, STE3pr, The promoters of the genes encode the receptors for the pheromones α factor and a factor respectively; Sp_his5,The Schizosaccharomyces pombe gene HIS5, complements his3 in S.c ;SD, minimal media lacking only the amino acids noted; YPD, rich media; SPO, sporulation media, media with reduced nutrient that induce sporulation in yeast; Streak, an isolation planting on a Petri dish.
3.4 TEA controls.
The phenotype of telomere length in mutants is gradually, and sometimes it takes a few dozens cell divisions until the final telomere length is achieved. The best example is the tel1 mutant, where the full expression of the mutant phenotype shows a very long lag (Lustig and Petes, 1986). Because of this reason, telomeres of the double mutants should be examined not immediately after sporulation, but rather after a few streaks, giving the phenotype enough time to get its full expression. We have decided
70 to make 3 streaks for each double mutant, which equals to ~75 cell divisions a number
that was estimated as a reasonable lag for the majority of the strains. . In addition, for
each strain we re-created the single-mutant together with the double—mutant, by
crossing to a strain carrying a deletion of the non-functional HO gene. This strain, which has normal telomeres, was crossed to the 120 tlm strains together with the other tea strains. Now each double mutant was compared, not to its single parent mutant from the deletion library, which have passed many more than 75 cell division, but to a newly built strain, that harbors the tlm deletion together with the ho deletion. This strain was processed in parallel to all the others and thus constitutes the perfect control. Another aspect of control was creating three independent double mutants
from each cross, and calculating the telomere length by the average of these three
strains. In the vast majority of the cases, the three double mutants showed identical
telomeric phenotypes. In about 20% of the cases, however, one of the strains was
different (and PCR confirmed that it was not a true double mutant). These were
disregarded. Compared to the worse results in the crosses with y3656, about 80%
false positives, this time the results are much more reliable.
3.5 Analyzing telomeres.
We analyzed telomeres length using the software "gel-quant" (fitted to our needs by
Lior Unger from our lab). A representative page of the analysis using Gel quant is
presented in Figure 3.4.
71
Figure 3.4: A representative page from the soft wear GelQuant. Models of expected results: There are two models to calculate the results. The first
one is the substractive model: each tlm mutant or double mutant is measured
compared to the wild type, and the difference (in base pairs) is calculated. This
difference represents the reduction in telomere length determined by the deletion(s). If
the relation between the two single mutants is additive we expect the phenotype of the
double mutant (its telomere length) to be the sum of both single parents’ telomere
length differences. For example, if mutant a is 50 bp shorter than wt, and mutant b is
150 bp shorter than wt, an independent effect of the two mutations would result in
telomeres 200 bp shorter than wt. Deviations from such expectation demonstrate
aggravating (synergistic) or ameliorating (epistatic) interactions.
The substractive model presented, however, is not the only one possible. A second model is multiplicative: Similar to models of relative fitness, we can calculate the ratio between the mutant telomere length and that of the wt control. In this case an
independent relation between the single mutations will result in double mutants
exhibiting telomeres whose length equals the multiplication of the ratios of each
72 single mutant, whereas higher or lower values imply synergistic or suppressive
relations respectively. For example, if we consider mutants a and b above (50 and 150
bp shorter than wt), they show telomeres 0.83 and 0.5 of wt (~300 bp). Thus an
additive relationship predicts 0.83 x 0.5= 0.42 (or 125 bp, 175 bp shorter than wt).
A priori, it is not clear which of the two models fits the biological results better,
although the differences are not too large. I have been using the substractive model in my calculation.
In Table 3.4 I have summarized all the relations I have found between the panel of
30 short tlm mutants and the five mild short tlm mutants analyzed by TEA.
Table 3.4: Epistasis relation between 5 TEA genes and the panel of 30 short TLM genes Srb2 Dcc1 Vps34 Cdc73 Rfm1 snf7 srb2 epistatic additive ? additive rfm1 epistatic gcv3 srb2 epistatic additive ? additive rfm1 epistatic kem1 kem1 additive additive additive kem1 epistatic epistatic hst1 both epistatic additive additive additive hst1 epistatic vps25 both epistatic additive vps34 additive rfm1 epistatic epistatic gup1 additive vps34 synergism gup1 epistatic epistatic xrs2 additive additive synergism xrs2 epistatic sip18 additive synergism synergism rfm1 epistatic upf3 additive additive additive upf3 epistatic hda2 additive suppression?? additive hda2 epistatic rpb9 additive additive ? rpb9 epistatic rfm1 epistatic tel1 additive additive additive intermediate
pho85 dcc1 vps34 additive intermediate epistatic epistatic??? sur4 additive dcc1 epistatic mft1 mft1 additive epistatic hur1 hur1 epistatic additive? hur1 epistatic additive additive rsc2 rsc2 epistatic additive vps34 additive additive
73 epistatic ku70 ku70 epistatic additive ku70 intermediate additive? epistatic? eap1 srb2 epistatic additive ?? additive additive mmm1 suppression?? additive ??? ???
vps28 suppression additive intermediate synergism intermediate trk1 additive intermediate synergism additive intermediate rpl12b synergism additive additive gpb2 additive additive ? additive additive xdj1 additive additive additive ccw14 ?? additive additive spt21 additive ? ? sse1 additive ?? additive additive '??' means this relation needs to be verified by either a second Southern or other tests that will be mentioned in the Discussion. Any pair of genes that shows an additive relation does not share the same telomere
maintenance pathway, and participate in different regulation pathways. So any double
mutants that showed an additive telomere phenotype of both single parents was not
included in the relation pathways schematically drawn in Figure 3.5. A diagram is
drawn for each one of the TEA genes and every color represents a different relation.
The arrowheads point the gene that is epistatic, meaning that the telomere phenotype
is similar between this single parent and the double mutant. The biological
explanation is that both genes share the same telomere regulation pathway, and the epistatic gene is localized higher in the pathway than the other single parent gene.
74 Figure 3.5: Schematic presentation of the epistatic relations between the TEA genes and the TLM genes. A. MMM1 KU70 VPS28 KEM1 SNF7 HST1 GCV3 SRB2 VPS25 EAP1 HUR1
RSC2
B.
TRK1
RPL12B
PHO85 DCC1 MFT1 SUR4
C.
MMM1
VPS28 VPS25
GUP1 KU70 VPS34 PHO85 HUR1
RSC2 SIP18
TRK1
75
D.
KU70
? CDC73 RPB9
SIP18
VPS28
GUP1
XRS2
E.
VPS28
TRK1
PHO85 GUP1 SNF7 TEL1 KEM1 GCV3 HST1 VPS25 RFM1 XRS2 RPB9 UPF3
SIP18 HDA2
76 The TEA gene
Epistatic relation between the genes
Intermediate relation of the two genes
Relation of Suppression
Relation of Synergism is seen between the genes
Relations found between the TEA gene and the TLM genes are mentioned in the diagram. The arrows and the colored ellipses represent exclusively these relations. A-E represents the relations with SRB2, DCC1, VPS34, CDC73 and RFM1 respectivly.
As seen in Figure 3.5 and Table 3.4 most of the pairs showed additive relations, as
expected from different telomere maintenance pathways. From the few genes that
showed other relations there is a minority that appeared in more than one diagram,
meaning that these few genes participate in a pathway common for more than one
TEA gene. One of these genes is RPB9; RFM1 is epistatic to RPB9 and RPB9 is epistatic to CDC73. A naive thought could place both TEA genes (RFM1 and
CDC73) in the same regulation pathway, but as seen from the rest of the relations, in most pairs those two TEA genes show different relations from one another, which means that according to the pathway that RPB9 is involved those two TEA genes are connected somehow, and this will be discussed later, but from first look, we can say that telomere length regulation is not a combination of separated pathways but a net of pathways connected among them.
77 4. DISCUSSION
4.1 The results of the genomic screen.
S. cerevisiae is the best understood system for studying telomere biology and many
genes with roles in telomere function are already known in this organism.
Nonetheless, our efforts have resulted in a wealth of additional candidate genes that alter telomere length when deleted. Our results indicate that a surprisingly large
percentage of the yeast genome is in some way linked to telomere metabolism. The
170 genes listed in Table 3.1 represent ≈3.2% of the estimated 5,538 genes of S.
cerevisiae. This number is certainly an underestimate of the total, given that >1,000
essential genes were not examined and because many genes known to mildly affect
telomere length in other strains were not found in our screen.
Of the 32 genes previously known to exhibit a telomeric phenotype when singly
deleted, our screen identified 18 (bold in Table 3.1). Genes not identified in our
screen include some with reported phenotypes that were very mild. These include
FOB1 (Weitao et al., 2003), SWD1 and SWD3 (Roguev et al., 2001), RRM3 (Ivessa et
al., 2002), EBS1 (Zhou et al., 2000), MLP1 and MLP2 (Hediger et al., 2002), SIR3
(Palladino et al., 1993), and DDC1 and RAD17 (Longhese et al., 2000). We have not
determined whether these genes were missed in our screen or whether they simply
behave differently in our strain background. Of the four additional genes not
identified in our screen, one (TOP3) (Kim et al., 1995) was not present in the
collection. Two of the three others [GAL11 (Suzuki and Nishizawa, 1994) and SIR4
(Palladino et al., 1993) but not CTF18 (Hanna et al., 2001)] showed mild telomere
length phenotypes when individually reexamined (data not shown). It is not
unexpected that mutants with slight telomere length alterations could be difficult to
78 distinguish from wild type or even overlooked by our screen. Yeast telomeres are not
only heterogeneous in size, but they are subject to size fluctuations even within clonal
lineages (Shampay and Blackburn, 1988). Although it is clear that our screen failed to
detect all mutants with slight telomere length phenotypes, we are confident that it
successfully identified the great majority of the nonessential genes that appreciably
affect telomere length when deleted [as seen by comparison to a similar screen carried
out by Gatbonton et al., see below (Gatbonton et al., 2006)]. Although absolute confidence that individual genes identified in this study affect telomere length will require additional experimentation, it is unlikely that our screen identified many false positives. Each mutant has had its telomere length examined several times and the identity of all has been confirmed through PCR testing. Moreover, 26 of 27 randomly sampled mutants have shown the expected meiotic cosegregation between the
KanMX marker and the telomeric phenotype (marked with two ** in Table 3.1).
4.2 Comparison of the two screens.
A seemilar screen as the one we carried out was performed by Gatbonton and co-
workers (Gatbonton et al., 2006). The overlap between the two screens was quite low
(the overlapping genes are marked with yellow in Table 3.1). In total, 58 genes
overlap between our data and Gatbonton, leaving 114 genes unique to our screen and
94 genes unique to Gatbonton's study. However, the results of the two screens are
more congruent than these numbers imply, since both sets of telomere-associated
genes include different members within the same genetic pathways. A striking
example is the overlap in ribosomal protein gene deletions: 24 RPS (small ribosomal subunit proteins) and RPL (large subunit) genes were identified in the two studies
(eight genes in our screen and 16 genes in Gatbonton) with only two genes overlapping. Similar results were found with VPS genes and the members of mediator
79 complex. Differences in the technical details of the primary screens and in the different methods used for verification of the initial hits likely account for the surprisingly low gene overlap and the considerable differences in the ratio of long to short telomere mutants in two studies. While XhoI restriction digest were used in both studies, Southern blots were carried out using a telomeric probe by us, and subtelomeric Y′-probe in Gatbonton's study. Unlike the Y′-probe, the use of telomeric probe is expected to increase the signal intensity of the long telomere mutants, which may be interpreted as DNA overloading rather than perturbation in telomere length and could be responsible for differences in the scoring of the mutants. On the other hand, the substantially lower number of the short telomere mutants in Gatbonton study (72 versus 120) is likely due to more stringent criteria for verification of the initial hits, which in Gatbonton study included evaluation of homozygous diploids as well as allelism studies for all short and some long telomere mutants (allelism studies were carried out for a small number of genes by us). An analysis of the differences between the two studies reveals that the majority of genes included by one study and not by the other represents mutants with a minor phenotype. As was mentioned before, some telomere phenotypes require many cell divisions to fully manifest: since analyses of segregants in the Gatbonton study were carried out after only 20–30 doublings in the mutants, some mutations that confer a delayed effect would not be detected creating a false-negative result.
4.3 TLM genes sorted into functional groups.
The genes identified in our screen have very diverse functions. Although some of
them are probably directly involved in telomere metabolism, most are likely to affect
telomere length indirectly either by altering the activity of proteins directly involved
in telomere maintenance, or by eliciting cellular mechanisms that lead to changes in
80 telomere length. The genes most likely to be directly involved in telomere size maintenance are those affecting DNA metabolism. In addition to the known DNA repair genes involved in telomere size control, such as components of the MRX
(Mre11/Rad50/Xrs2) and Ku (Yku70/Yku80) complexes, we have identified LRP1, the yeast homolog of the human protein C1D (Erdemir et al., 2002). In mammalian cells, this is a γ-irradiation-inducible nuclear matrix protein that activates DNA PK
(Yavuzer et al., 1998). The yeast homologue has roles both in homologous recombination and in nonhomologous end-joining (Erdemir et al., 2002). DCC1, as was mentioned before, encodes together with CTF18 and CTF8 a replication factor C
(RFC)-like clamp loader complex that affects sister chromatid segregation (Mayer et al., 2001). Interestingly, while members of this RFC-like complex have short telomeres (Gatbonton et al., 2006; Hanna et al., 2001) mutations in ELG1, the main component of an alternative RFC, lead to elongated telomeres (Table 1) (Ben-Aroya et al., 2003; Smolikov et al., 2004) and the Δrad24 strain, defective in a third RFC-
like (Green et al., 2000), exhibited no telomeric phenotype (data not shown). Another
mutant with links to DNA replication, the deletion of which causes telomere
shortening, is RNH35. This gene encodes an RNase H required for RNA primer removal during DNA synthesis (Chen et al., 2000). Its activity may be required for the coordination between replication of subtelomeric regions by the DNA polymerases and telomeric elongation by the telomerase. A similar role has been proposed for Elg1p (Smolikov et al., 2004).
Genes located in the proximity of the chromosomal ends are often subjected to epigenetic silencing (as mentioned before), also known as telomeric position effect
(Gottschling, 1992). Although many mutants that affect telomeric silencing have been isolated, not all of them exhibit changes in telomere length. Our screen has identified
81 components of several complexes previously known to affect silencing that produce short telomeres. These components include the HST1-SUM1-RFM1 histone
deacetylase (McCord et al., 2003) and the SIN3, SAP30, OPI1, and DEP1 genes,
encoding components of the Rpd3 histone deacetylase complex (Lamping et al.,
1994; Zhang et al., 1998). In addition, we have identified several components of the
Paf1, Set1, and Tho complexes, which seem to interact both in chromatin remodeling
and during transcription elongation [reviewed in (Krogan et al., 2003)]. Moreover,
mutations in certain components of the RSC, Mediator, and CTD phosphorylation
complexes, which are located at the interphase of chromatin remodeling and RNA
polymerase activation, also caused shortening of the telomeres. Not all of the
nonessential members of these complexes reduced telomere length, suggesting that
the link to telomere homeostasis may be due to the individual proteins in these
complexes. The isolation of so many mutants that lead to short telomeres by
interfering with chromatin remodeling functions suggests that chromatin integrity/modification plays an important role in elongating telomeres. We have also identified Δnup60 as a strain exhibiting short telomeres. Nup60 is required to anchor telomeres to the nuclear periphery, and a link between telomere position within the nucleus and chromatin remodeling affecting telomeric position effect has been shown
(Feuerbach et al., 2002). It is possible that telomere elongation also requires anchoring of telomeres to the nuclear periphery. In the same manner it was shown that telomeric repeats are essential for telomere anchoring, which is a crucial stage in meiosis and sister chromatid segregation (Scherthan, 2007). It has been proposed that homolog pairing might start at telomeres and proceed through the rest of the chromosome (Joseph and Lustig, 2007) suggesting that any change that involves regulating telomeric repeat number can affect meiosis and chromosome segregation.
82 We have not yet investigated whether the tlm mutants have meiotic defects, as predicted by this hypothesis.
A few genes that take a part in transcription and regulation of RNA Polymerase II
(RNA Pol II) were identified. Most of them exhibit short telomeres when deleted. A few of the genes encode proteins from the Mediator complex, which is a complex tightly associated with RNA polymerase II (PolII) in vivo (Lee et al., 1999). The
Mediator is divided into four functional sections: head, middle, tail and the CDK8 kinase (Collins et al., 2007). Genes encoding proteins from each section were found to have telomeric phenotype. Some were found in our screen (srb2, srb5, ssn8, ssn3 and nut1) others in (Gatbonton et al., 2006) (med1, srb8, srb9 and srb10). Interestingly, mutations in the genes of the head section cause short telomeres when deleted and genes belong to the CDK8 or the middle section cause long telomeres when deleted. It is obvious the Mediator influences telomere length regulation in a complex way, probably by affecting transcription of other genes. For a visual view of the Mediator and the different sections with their telomeric phenotype see Figure 4.1.
inviable Long telomeres
Short telomeres
Figure 4.1: The different sections of the Mediator. Based on (Collins et al., 2007)
83
Many genes with known vacuolar functions showed telomere length alterations
when individually deleted. The yeast vacuole is the functional analogue of the mammalian lysosome, the major site of degradation of both exogenous and endogenous macromolecules [reviewed in (Teter and Klionsky, 2000)]. Prominent amongst these genes are components of the ESCRT (endosomal sorting complex required for transport) complexes. Three ESCRT complexes are known to bind in succession to ubiquinated cargos in late endosomes and function in the sorting of proteins to be degraded by vacuole/lysosome in the multivesicular bodies pathway, a well conserved process in eukaryotes [reviewed in (Bache et al., 2003)]. The following 10 genes encoding components of the ESCRT complexes display a short telomere phenotype when deleted. These genes : Vps23; Vps28; Vps22; Vps25;
Vps36; Vps32; Yel057c; a phosphatidylinositol 3-kinase, Vps34; its associated kinase, Vps15; and a downstream player in the process, Bro1 (Bilodeau et al., 2002;
Nikko et al., 2003; Stack et al., 1995). Additional vacuolar genes identified include genes that act in vacuolar targeting for example the ATG11 and specific Golgi trafficking like ERJ5 and LST7 (Carla Fama et al., 2007; Roberg et al., 1997)
This connection between vacuolar targeting and telomere metabolism may be due to one or more telomeric proteins being regulated by degradation in the vacuole.
Interfering with the vacuolar pathway could cause an increase in the level of these proteins, creating an imbalance in telomere size. At this moment there are no obvious telomeric proteins known to be degraded by this pathway. Here is the place to mention that in a few genomic screens over the last few years, where the
Saccharomyces cerevisiae deletion collection was used, VPS mutants were isolated as well. Some of the screens looked for genes involved in trafficking (Sambade et al.,
84 2005) or mannosyl phosphate transfer to mannoprotein-linked oligosaccharides
(Corbacho et al., 2005). We expect vacuolar trafficking to affect these processes.
However, some of the screens affected DNA replication and repair functions. For example, a screen for genes required required for protection from doxorubicin (a chemotherapeutic agent) (Xia et al., 2007), or a screen for genes affecting replication
of RNA viruses (Panavas et al., 2005), or a screen for high spontaneous levels of
DNA repair enzymes (Alvaro et al., 2007).
In contrast to the >100 genes that led to short telomeres when deleted, only 50
deletion mutants exhibited a clear phenotype of elongated telomeres in our screen.
The reason for this asymmetry is unclear. One technical reason could be the use of the
telomeric probe as was mentioned in the beginning of this section. The mutants
causing lengthening were more difficult to organize in clear functional categories. In
addition to ELG1, discussed above, POL32, a nonessential subunit of DNA
polymerase δ (Gerik et al., 1998), is a candidate for having a direct link to telomere
metabolism. Two additional genes causing telomere elongation affect chromosome
segregation: CSM1, encoding a component of the kinetochore, and SRC1, which
affects sister-chromatid segregation (Rodriguez-Navarro et al., 2002) and seems to be
a target for cyclin-dependent kinase phosphorylation (Ubersax et al., 2003).
Deletion of only a few genes affecting chromatin/silencing caused telomere
elongation. These genes include two components of the Mediator complex (NUT1 and
SSN8) (Kuchin et al., 1995; Tabtiang and Herskowitz, 1998), two components of the
RSC complex (HTL1 and SFH1) (Cao et al., 1997; Romeo et al., 2002), and several
less well characterized genes. For example, NPL6 was defined as a nuclear pore
component; however, it binds histone H2B and many chromatin-remodeling factors
and localizes to the nucleus (Nelson et al., 1993).
85 Among the genes with long telomeres identified in our screen, there is only one clear case for which deletion of each subunit of a known complex caused a similar telomere phenotype. Deletion of each subunit of the NatC N-terminal acetyltransferase led to elongated telomeres. N-terminal acetylation is one of the most common cotranslational modification processes in eukaryotes [reviewed in (Polevoda and Sherman, 2003)] and is carried out by one of three complexes in a substrate- specific fashion.
In several cases, genes affecting telomere length are physically next to one another.
Deletion of one could potentially alter telomere length by changing the expression of its neighbor. Examples include one neighbor of STN1 and both neighbors of PIF1
(including the DNA repair gene OGG1). In addition, there are at least ten more pairs of neighboring genes in our list of candidates that show telomere length phenotype
when individually deleted; they are listed in Table 4.1.
Table 4.1: Neighboring ORFs that produce telomere length alterations when deleted. Candidates Common names Telomere phenotype when deleted YCR020W-B HTL1 L YCR020C-A MAK31 VL
YLL026W HSP104 sl YLL027W ISA1 S
YLR417W VPS36 S YLR418C CDC73 S
YMR142C RPL13B S YMR143W RPS16A sl
YOR321W PMT3 ss
86 YOR322C Unknown S
YMR224C MRE11 VS YMR225C MRPL44 S
Inviable, Deletion not present in the YDR082W STN1 collection (telomere-binding protein) YDR083W RRP8 Sl (506)
YML060W ODD1 L YML061C PIF1 L YML062C MFT1 Ss (300)
YBR035C PDX3 S Inviable, Deletion not present in the TLC1 collection (telomerase RNA)
YLR231C BNA5 H, ylr232w has normal telomeres YLR233C EST1 VS
YHR075C PPE1 L, yhr076w has normal telomeres YHR077C UPF2 VS
YLR239C LIP2 qs YLR240W VPS34 S, ylr241w has normal telomeres YLR242C ARV1 S
YJL120W Unknown qs YJL121C RPE1 qs
YDL020C RPN4 S (240) YDL021W GPM2 ql
87
Single knockout mutants of the listed neighboring genes showed telomere length defects in Southern blots. VS, very short. S, short. Ss, slightly short. qs, questionably short. VL, very long. L, long. sl, slightly long. ql, questionably long. H, hetergeneous. Genes previously known to alter telomere length are shown in bold.
Numbers in brackets in the “Telomere phenotype” column represent the length of the telomeres of this mutant, , measured by the software mentioned in the Results section under the title ”3.5 Analyzing telomeres” on p 72. The length of the wt strain is 350 nt.
4.4 Performing Epistasis test for TLM genes.
Epistasis analysis can be used in order to sort mutants into functional pathways [eg:
(Chan and Blackburn, 2003; Gatbonton et al., 2006; Meier et al., 2001; Rog et al.,
2005; Smolikov et al., 2004).
In order to sort the TLM genes found in our screen into epistasis groups, I
performed the TEA assay (see section 3.3). I first chose two of the best-understood
telomeric mutants, tel1 and yku70. Deletion of the ATM homologue TEL1 results in severe telomere shortening (by ~250 bp) and abolishment of the Rap1p counting machinery (Ray and Runge, 1999). Deletion of either one of the yKU proteins causes severe telomeric shortening (up to 150bp) (Boulton and Jackson, 1996; Porter et al.,
1996) and creates a large ssDNA overhang of the telomeric G- strand (Polotnianka et
al., 1998). After creating the 120 double mutants tlm-tel1, I have noticed that the vast majority of them showed short telomeres, similar to the tel1 parent. In other words, tel1 exhibited epistasis to all mutants. This phenomenon was observed for Δyku70 as
well. Considering the fact that trains carrying deletions of both tel1 and yku70 show
extremely short telomeres, it is possible that the detection of telomeres shorter than
those of the single mutants yku70 and tel1 is problematic. For example, those cells in
the population that have telomeres shorter than a certain threshold may undergo crisis
88 and are thus eliminated. Alternatively, this result could reflect technical problems, such as a weak signal as a result of smaller number of telomeric repeats. Another reason for the lack of additivity detection could be that the number of generations the strains underwent in my assay was not enough in order to get the final phenotype length. For example, in (Meier et al., 2001) the phenotype of cdc13-4 Δtel1 double mutants display shorter telomeres than either single mutant only after 125 generations.
As a comparison, our mutants were grown for 75 generations. The most extreme example can be seen in (Porter et al., 1996) where the genetic relations between Δtel1 and Δku70 were defined: the double mutant is indeed not shorter than the single mutant parents.
After these results were obtained, we decided to concentrate on 5 mutants showing milder phenotypes. These genes were not known before to be involved in telomere maintenance: CDC73, DCC1, RFM1, VPS34 and SRB2. Mutants in these genes were crossed with a panel of 30 tlm mutants with short telomeres, which were chosen to represent the whole collection. The panel of 30 genes was selected so that each gene belongs to a different complex. Much information has been gathered in yeast about protein complexes (Gavin et al., 2002; Krogan et al., 2006). This data was used to make the selection.
Performing TEA with these genes gave genetic relations from the whole spectrum of gene relations: additive, epistatic (full buffering), intermediate (partially buffering), synergistic and even suppressive. As seen in Table 3.4, most of the relations between
the five chosen genes and the panel of 30 were additive, as expected (Segre et al.,
2005). This emphasizes that the chosen genes in the TEA participate in separate telomere maintenance pathways. Thus, telomere length regulation correlates well with
89 the known knowledge about complexes involved in other mechanisms in the yeast
cell.
Below, I concentrate on each of the interaction categories:
1) Epistasis: About a fifth of the pairs in Table 3.4 gave epistatic relations between
the mutants. This result means that both genes participate in the same regulation
pathway regarding telomere length. Very few epistatic interactions were seen for
cdc73 (only rpb9, see below) and with dcc1 (pho85, sur4 and mft1). SUR4 is likely to affect expression of its neighboring gene, VID22, mutations in which are synthetic lethal with any gene affecting DNA repair and checkpoint functions (Collins et al.,
2007). MFT1 encodes a component of the THO complex (Chavez et al., 2000), which exhibits the same genetic interactions (Collins et al., 2007). These are also shared by dcc1(Collins et al., 2007) . Pho85 is a Cdk that interacts with Ku (Ho et al., 2002), but
its precise role remains unknown. In contrast to cdc73 and dcc1, strains deleted for the
SRB2, VPS34 and RFM1 genes showed many epistatic interactions.
2) Intermediate relations: Several mutant pairs exhibited a partial buffering
(intermediate) relation. These genes.probably participate in the same regulation
pathways, and the phenotype observed reflects incomplete buffering (Segre et al.,
2005). For example, vps28 showed intermediate relations with vps34, which is
expected, since both of them are involved in vacuolar transport (Robinson et al.,
1988). However, intermediate relations were found also with rfm1, a component of
the RHS histone deacetylase that affects chromatin and transcription. A reasonable
explanation could be that deletion of RFM1 mildly affects transcription of one of the
VPS genes, in addition to others.
90 3) Synergism: Several mutant pairs exhibited synergistic relations: rpl12b and
dcc1, xrs2 and cdc73, sip18 and vps34, etc. There are two ways to interpret these
relations: the genes may participate in competing-compensating pathways, so that when both genes are missing both pathways are inactive and telomere length is decreased dramatically. The second option is that both genes encode proteins that
belong to the same complex. In this case each missing protein causes a slight decrease in the complex function, but in the absence of both proteins the complex is not formed
or is unstable (Hartman et al., 2001). This second option is less reasonable since the
panel of 30 was chosen to represent different complexes (based on knowledge from
many publications), It may still be true if the proteins participate in different complexes for their cellular and telomere-specific roles. An example for this option is the Sir2 protein, that participates in silencing of transcription on three DNA regions in yeast chromosomes, and in each region a slightly different repertoire of proteins is involved; [reviewed in (Huang, 2002; Rusche et al., 2003)].
4) Suppression: Three pairs in Table 3.4 gave suppressive relationships, where the
telomeres of the double mutant were longer than those of the single mutants; somehow a second deletion "fixes" the telomere length so it is closer to the wild type than each of the mutations. The biological reason behind these relations is not simple.
One possible explanation is that the absence of two pathways may open a third, until
now inactive, pathway (Segre et al., 2005).
4.5 Sorting TLM genes into epistasis groups.
Formally, one would predict that all mutants that belong to a particular epistasis
group should exhibit identical interactions with additional mutants. As the 5 TEA
91 mutants analyzed were chosen because they are part of different protein complexes, one would also predict that each gene exhibiting epistatic relations to one of the TEA
genes would be additive (or synergistic) to all other four. This is true in general for
dcc1 and cdc73. The genetic interactors with these mutants are unique and specific.
However, the relations exhibited by the three other TEA mutants were complex: rfm1’
s epistasis group is large and overlapps those of vps34 and srb2. These two mutants,
although displaying different epistasis spectra, nonetheless show some overlap: vps35,
hur1 and src2 show epistasis relations with vps34 and with srb2 (Table 3.4).
It is not clear at this early stage of the TEA analysis, whether the behavior of rfm1
(which exhibits epistatic relations to 15/22 tested mutants) is exceptional, or whether
there will be many genes in this category. Rfm1, together with Hst1 and Sum1
conforms a complex (RHS) that represses transcription (McCord et al., 2003; Xie et
al., 1999) and thus may have very pleiotropic indirect effects in telomere length
control. It appears that mutants that affect chromatin/transcription tend to be
promiscuous in the epistasis groups they belong to. For example, HST1, encoding a
partner of Rfm1 (McCord et al., 2003), is also epistatic with srb2. The rest of the
genes that are grouped together with SRB2 and RFM1 have a known function that is
connected with sorting and transport of proteins. Eight more genes showed dual
relations with VPS34 and another TEA gene. Unlike the crosses with srb2, cdc73,
rfm1 and dcc1, the cross with vps34 was plagued by technical difficulties. For each
cross involving a TEA mutant and the “panel of 30” three independent double
mutants were subjected to Southern blot analysis. In contrast to all previous crosses,
the double mutants carrying vps34 frequently gave heterogeneous results, in which the
three isolates gave different telomeric results (question marks in table 3.4). Again, it is
not clear whether this behavior is particular for vps34 mutants, or a general feature
92 that will appear in the future too when we enlarge our data collection to include all results of 30 x 30 double mutants.
4.6 How is CDC73 involved in telomere length regulation?
As seen in Table 3.4, cdc73 showed partial epistasis with yku70 and only rpb9 was
fully epistatic to cdc73. As was mentioned before Cdc73 is a part of the PAF complex
(composed of Paf1, Hpr1, Cdc73, Ctr9, Leo1, Rtf1 and Ccr4p) which is associated with RNA Polymerase II throughout the transcription cycle (Mueller and Jaehning,
2002; Porter et al., 2002) and its loss results in transcript abundance changes for only a small subset of genes (Penheiter et al., 2005). Among the genes whose transcription is decreased when the Paf complex is defective is EST3. Its transcription is decreased
~2.5 fold compared with the wild type level (Penheiter et al., 2005). Est3 together with Est1 recruits Est2, the telomerase enzymatic subunit, to telomeres in vivo
(Friedman et al., 2003; Lingner et al., 1997a). A similar decrease of EST3 transcription is observed in a strain that harbors the mutation rpb1-1, which is the main subunit of RNA Pol II and acts together with Rpb9 (Holstege et al., 1998). We hypothesize that Rpb9 and Cdc73 are involved in the transcription regulation of EST3, thus showing epistasis. A schematic diagram is in Figure 4.2.
EST3
Rpb9
Paf1 Comp. (Cdc73)
Figure 4.2: Schematic diagram of EST3 transcription and the involvement of Rpb9 and Cdc73. Altogether many relations were found in the TEA crosses I carried out, and most of
them are informative, helping in the sorting of TLM genes into epistasis groups.
93 Many open questions remain, and it is likely that we will get answers for many of them when we complete the panel of 30 x 30 crosses. Of course our screen was carried out with the deletion collection of all the non-essential genes, and a complete
and systematic analysis of telomere length regulation requires also that the same
screen be carried out with the library of the essential genes, which is constructed these
days. It is most certain many more TLM genes will be found in this future screen.
Given the evolutionary conservation of the basic regulatory mechanisms, we expect that our analysis will shed results important for the understanding of telomere maintenance in cancer and aging.
94 5. BIBLIOGRAPHY
Allsopp, R. C., Chang, E., Kashefi-Aazam, M., Rogaev, E. I., Piatyszek, M. A., Shay, J. W., and Harley, C. B. (1995). Telomere shortening is associated with cell division in vitro and in vivo. Exp Cell Res 220, 194-200. Alvaro, D., Lisby, M., and Rothstein, R. (2007). Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination. PLoS Genet 3, e228. Aparicio, O. M., and Gottschling, D. E. (1994). Overcoming telomeric silencing: a trans-activator competes to establish gene expression in a cell cycle-dependent way. Genes Dev 8, 1133-1146. Artandi, S. E., and DePinho, R. A. (2000). A critical role for telomeres in suppressing and facilitating carcinogenesis. Curr Opin Genet Dev 10, 39-46. AS, I. J., and Greider, C. W. (2003). Short telomeres induce a DNA damage response in Saccharomyces cerevisiae. Mol Biol Cell 14, 987-1001. Askree, S. H., Yehuda, T., Smolikov, S., Gurevich, R., Hawk, J., Coker, C., Krauskopf, A., Kupiec, M., and McEachern, M. J. (2004). A genome-wide screen for Saccharomyces cerevisiae deletion mutants that affect telomere length. Proc Natl Acad Sci U S A 101, 8658-8663. Bache, K. G., Brech, A., Mehlum, A., and Stenmark, H. (2003). Hrs regulates multivesicular body formation via ESCRT recruitment to endosomes. J Cell Biol 162, 435-442. Baur, J. A., Zou, Y., Shay, J. W., and Wright, W. E. (2001). Telomere position effect in human cells. Science 292, 2075-2077. Ben-Aroya, S., Koren, A., Liefshitz, B., Steinlauf, R., and Kupiec, M. (2003). ELG1, a yeast gene required for genome stability, forms a complex related to replication factor C. Proc Natl Acad Sci U S A 100, 9906-9911. Bertuch, A., and Lundblad, V. (1998). Telomeres and double-strand breaks: trying to make ends meet. Trends Cell Biol 8, 339-342. Bilaud, T., Brun, C., Ancelin, K., Koering, C. E., Laroche, T., and Gilson, E. (1997). Telomeric localization of TRF2, a novel human telobox protein. Nat Genet 17, 236- 239. Bilaud, T., Koering, C. E., Binet-Brasselet, E., Ancelin, K., Pollice, A., Gasser, S. M., and Gilson, E. (1996). The telobox, a Myb-related telomeric DNA binding motif found in proteins from yeast, plants and human. Nucleic Acids Res 24, 1294-1303. Bilodeau, P. S., Urbanowski, J. L., Winistorfer, S. C., and Piper, R. C. (2002). The Vps27p Hse1p complex binds ubiquitin and mediates endosomal protein sorting. Nat Cell Biol 4, 534-539. Blasco, M. A., Funk, W., Villeponteau, B., and Greider, C. W. (1995). Functional characterization and developmental regulation of mouse telomerase RNA. Science 269, 1267-1270. Blasco, M. A., Lee, H. W., Hande, M. P., Samper, E., Lansdorp, P. M., DePinho, R. A., and Greider, C. W. (1997). Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 91, 25-34. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B., Harley, C. B., Shay, J. W., Lichtsteiner, S., and Wright, W. E. (1998). Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349- 352.
95 Boulton, S. J., and Jackson, S. P. (1996). Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in telomeric maintenance. Nucleic Acids Res 24, 4639-4648. Boulton, S. J., and Jackson, S. P. (1998). Components of the Ku-dependent non- homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing. EMBO J 17, 1819-1828. Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., and Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115-132. Braunstein, M., Rose, A. B., Holmes, S. G., Allis, C. D., and Broach, J. R. (1993). Transcriptional silencing in yeast is associated with reduced nucleosome acetylation. Genes Dev 7, 592-604. Broccoli, D., Smogorzewska, A., Chong, L., and de Lange, T. (1997). Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat Genet 17, 231-235. Bryan, T. M., Englezou, A., Dalla-Pozza, L., Dunham, M. A., and Reddel, R. R. (1997). Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 3, 1271-1274. Bryan, T. M., Sperger, J. M., Chapman, K. B., and Cech, T. R. (1998). Telomerase reverse transcriptase genes identified in Tetrahymena thermophila and Oxytricha trifallax. Proc Natl Acad Sci U S A 95, 8479-8484. Bylund, G. O., and Burgers, P. M. (2005). Replication protein A-directed unloading of PCNA by the Ctf18 cohesion establishment complex. Mol Cell Biol 25, 5445- 5455. Cao, Y., Cairns, B. R., Kornberg, R. D., and Laurent, B. C. (1997). Sfh1p, a component of a novel chromatin-remodeling complex, is required for cell cycle progression. Mol Cell Biol 17, 3323-3334. Carla Fama, M., Raden, D., Zacchi, N., Lemos, D. R., Robinson, A. S., and Silberstein, S. (2007). The Saccharomyces cerevisiae YFR041C/ERJ5 gene encoding a type I membrane protein with a J domain is required to preserve the folding capacity of the endoplasmic reticulum. Biochim Biophys Acta 1773, 232-242. Cesare, A. J., and Griffith, J. D. (2004). Telomeric DNA in ALT cells is characterized by free telomeric circles and heterogeneous t-loops. Mol Cell Biol 24, 9948-9957. Cesare, A. J., Groff-Vindman, C., Compton, S. A., McEachern, M. J., and Griffith, J. D. (2008). Telomere loops and homologous recombination-dependent telomeric circles in a Kluyveromyces lactis telomere mutant strain. Mol Cell Biol 28, 20-29. Chakhparonian, M., and Wellinger, R. J. (2003). Telomere maintenance and DNA replication: how closely are these two connected? Trends Genet 19, 439-446. Chan, S. W., and Blackburn, E. H. (2002). New ways not to make ends meet: telomerase, DNA damage proteins and heterochromatin. Oncogene 21, 553-563. Chan, S. W., and Blackburn, E. H. (2003). Telomerase and ATM/Tel1p Protect Telomeres from Nonhomologous End Joining. Mol Cell 11, 1379-1387. Chandra, A., Hughes, T. R., Nugent, C. I., and Lundblad, V. (2001). Cdc13 both positively and negatively regulates telomere replication. Genes Dev 15, 404-414. Chavez, S., Beilharz, T., Rondon, A. G., Erdjument-Bromage, H., Tempst, P., Svejstrup, J. Q., Lithgow, T., and Aguilera, A. (2000). A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae. Embo J 19, 5824-5834.
96 Chen, J. Z., Qiu, J., Shen, B., and Holmquist, G. P. (2000). Mutational spectrum analysis of RNase H(35) deficient Saccharomyces cerevisiae using fluorescence- based directed termination PCR. Nucleic Acids Res 28, 3649-3656. Chien, C. T., Buck, S., Sternglanz, R., and Shore, D. (1993). Targeting of SIR1 protein establishes transcriptional silencing at HM loci and telomeres in yeast. Cell 75, 531-541. Ciosk, R., Shirayama, M., Shevchenko, A., Tanaka, T., Toth, A., Shevchenko, A., and Nasmyth, K. (2000). Cohesin's binding to chromosomes depends on a separate complex consisting of Scc2 and Scc4 proteins. Mol Cell 5, 243-254. Cockell, M., Palladino, F., Laroche, T., Kyrion, G., Liu, C., Lustig, A. J., and Gasser, S. M. (1995). The carboxy termini of Sir4 and Rap1 affect Sir3 localization: evidence for a multicomponent complex required for yeast telomeric silencing. J Cell Biol 129, 909-924. Collins, S. R., Miller, K. M., Maas, N. L., Roguev, A., Fillingham, J., Chu, C. S., Schuldiner, M., Gebbia, M., Recht, J., Shales, M., et al. (2007). Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature 446, 806-810. Conrad, M. N., Wright, J. H., Wolf, A. J., and Zakian, V. A. (1990). RAP1 protein interacts with yeast telomeres in vivo: overproduction alters telomere structure and decreases chromosome stability. Cell 63, 739-750. Cook, B. D., Dynek, J. N., Chang, W., Shostak, G., and Smith, S. (2002). Role for the related poly(ADP-Ribose) polymerases tankyrase 1 and 2 at human telomeres. Mol Cell Biol 22, 332-342. Cooper, J. P., Nimmo, E. R., Allshire, R. C., and Cech, T. R. (1997). Regulation of telomere length and function by a Myb-domain protein in fission yeast. Nature 385, 744-747. Corbacho, I., Olivero, I., and Hernandez, L. M. (2005). A genome-wide screen for Saccharomyces cerevisiae nonessential genes involved in mannosyl phosphate transfer to mannoprotein-linked oligosaccharides. Fungal Genet Biol 42, 773-790. Counter, C. M., Hahn, W. C., Wei, W., Caddle, S. D., Beijersbergen, R. L., Lansdorp, P. M., Sedivy, J. M., and Weinberg, R. A. (1998). Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc Natl Acad Sci U S A 95, 14723-14728. Craven, R. J., and Petes, T. D. (1999). Dependence of the regulation of telomere length on the type of subtelomeric repeat in the yeast Saccharomyces cerevisiae. Genetics 152, 1531-1541. Critchlow, S. E., and Jackson, S. P. (1998). DNA end-joining: from yeast to man. Trends Biochem Sci 23, 394-398. d'Adda di Fagagna, F., Reaper, P. M., Clay-Farrace, L., Fiegler, H., Carr, P., Von Zglinicki, T., Saretzki, G., Carter, N. P., and Jackson, S. P. (2003). A DNA damage checkpoint response in telomere-initiated senescence. Nature 426, 194-198. D'Amours, D., and Jackson, S. P. (2002). The Mre11 complex: at the crossroads of dna repair and checkpoint signalling. Nat Rev Mol Cell Biol 3, 317-327. Derbyshire, M. K., Weinstock, K. G., and Strathern, J. N. (1996). HST1, a new member of the SIR2 family of genes. Yeast 12, 631-640. Diede, S. J., and Gottschling, D. E. (1999). Telomerase-mediated telomere addition in vivo requires DNA primase and DNA polymerases alpha and delta. Cell 99, 723-733. Dohlman, H. G., and Thorner, J. W. (2001). Regulation of G protein-initiated signal transduction in yeast: paradigms and principles. Annu Rev Biochem 70, 703-754.
97 DuBois, M. L., Haimberger, Z. W., McIntosh, M. W., and Gottschling, D. E. (2002). A Quantitative Assay for Telomere Protection in Saccharomyces cerevisiae. Genetics 161, 995-1013. Elena, S. F. (1999). Little evidence for synergism among deleterious mutations in a nonsegmented RNA virus. J Mol Evol 49, 703-707. Elena, S. F., and Lenski, R. E. (1997). Test of synergistic interactions among deleterious mutations in bacteria. Nature 390, 395-398. Enomoto, S., Glowczewski, L., and Berman, J. (2002). MEC3, MEC1, and DDC2 are essential components of a telomere checkpoint pathway required for cell cycle arrest during senescence in Saccharomyces cerevisiae. Mol Biol Cell 13, 2626-2638. Erdemir, T., Bilican, B., Cagatay, T., Goding, C. R., and Yavuzer, U. (2002). Saccharomyces cerevisiae C1D is implicated in both non-homologous DNA end joining and homologous recombination. Mol Microbiol 46, 947-957. Featherstone, C., and Jackson, S. P. (1999). Ku, a DNA repair protein with multiple cellular functions? Mutat Res 434, 3-15. Feng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A. A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J., and et al. (1995). The RNA component of human telomerase. Science 269, 1236-1241. Feuerbach, F., Galy, V., Trelles-Sticken, E., Fromont-Racine, M., Jacquier, A., Gilson, E., Olivo-Marin, J. C., Scherthan, H., and Nehrbass, U. (2002). Nuclear architecture and spatial positioning help establish transcriptional states of telomeres in yeast. Nat Cell Biol 4, 214-221. Friedman, K. L., Heit, J. J., Long, D. M., and Cech, T. R. (2003). N-terminal Domain of Yeast Telomerase Reverse Transcriptase: Recruitment of Est3p to the Telomerase Complex Mol Biol Cell 14, 1-13. Fritze, C. E., Verschueren, K., Strich, R., and Easton Esposito, R. (1997). Direct evidence for SIR2 modulation of chromatin structure in yeast rDNA. Embo J 16, 6495-6509. Garvik, B., Carson, M., and Hartwell, L. (1995). Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint. Mol Cell Biol 15, 6128-6138. Gatbonton, T., Imbesi, M., Nelson, M., Akey, J. M., Ruderfer, D. M., Kruglyak, L., Simon, J. A., and Bedalov, A. (2006). Telomere length as a quantitative trait: genome- wide survey and genetic mapping of telomere length-control genes in yeast. PLoS Genet 2, e35. Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M., et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415, 141- 147. Gerik, K. J., Li, X., Pautz, A., and Burgers, P. M. (1998). Characterization of the two small subunits of Saccharomyces cerevisiae DNA polymerase delta. J Biol Chem 273, 19747-19755. Gilson, E., and Géli, V. (2007). How telomeres are replicated. Nature reviews molecular cell biology 8, 825-838. Goldstein, A. L., Pan, X., and McCusker, J. H. (1999). Heterologous URA3MX cassettes for gene replacement in Saccharomyces cerevisiae. Yeast 15, 507-511. Gottschling, D. E. (1992). Telomere-proximal DNA in Saccharomyces cerevisiae is refractory to methyltransferase activity in vivo. Proc Natl Acad Sci U S A 89, 4062- 4065.
98 Gottschling, D. E., Aparicio, O. M., Billington, B. L., and Zakian, V. A. (1990). Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63, 751-762. Grandin, N., Damon, C., and Charbonneau, M. (2001). Ten1 functions in telomere end protection and length regulation in association with Stn1 and Cdc13. Embo J 20, 1173-1183. Grandin, N., Reed, S. I., and Charbonneau, M. (1997). Stn1, a new Saccharomyces cerevisiae protein, is implicated in telomere size regulation in association with Cdc13. Genes & Development 11, 512-527. Gravel, S., Larrivee, M., Labrecque, P., and Wellinger, R. J. (1998). Yeast Ku as a regulator of chromosomal DNA end structure. Science 280, 741-744. Green, C. M., Erdjument-Bromage, H., Tempst, P., and Lowndes, N. F. (2000). A novel Rad24 checkpoint protein complex closely related to replication factor C. Curr Biol 10, 39-42. Greenwell, P. W., Kronmal, S. L., Porter, S. E., Gassenhuber, J., Obermaier, B., and Petes, T. D. (1995). Tel1, a Gene Involved in Controlling Telomere Length in Saccharomyces-Cerevisiae, Is Homologous to the Human Ataxia- Telangiectasia Gene. Cell 82, 823-829. Greider, C. W. (1996). Telomere length regulation. Annu Rev Biochem 65, 337-365. Greider, C. W. (1999). Telomeres do D-loop-T-loop. Cell 97, 419-422. Greider, C. W., and Blackburn, E. H. (1985). Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43, 405-413. Greider, C. W., and Blackburn, E. H. (1989). A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 337, 331-337. Griffith, J. D., Comeau, L., Rosenfield, S., Stansel, R. M., Bianchi, A., Moss, H., and de Lange, T. (1999). Mammalian telomeres end in a large duplex loop. Cell 97, 503- 514. Groff-Vindman, C., Cesare, A. J., Natarajan, S., Griffith, J. D., and McEachern, M. J. (2005). Recombination at long mutant telomeres produces tiny single- and double- stranded telomeric circles. Mol Cell Biol 25, 4406-4412. Gurevich, R., Smolikov, S., Maddar, H., and Krauskopf, A. (2003). Mutant telomeres inhibit transcriptional silencing at native telomeres of the yeast Kluyveromyces lactis. Mol Genet Genomics 268, 729-738. Hackett, J. A., Feldser, D. M., and Greider, C. W. (2001). Telomere dysfunction increases mutation rate and genomic instability. Cell 106, 275-286. Hackett, J. A., and Greider, C. W. (2003). End resection initiates genomic instability in the absence of telomerase. Mol Cell Biol 23, 8450-8461. Hanna, J. S., Kroll, E. S., Lundblad, V., and Spencer, F. A. (2001). Saccharomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol Cell Biol 21, 3144-3158. Hardy, C. F. J., Sussel, L., and Shore, D. (1992). A Rap1-Interacting Protein Involved in Transcriptional Silencing and Telomere Length Regulation. Genes & Development 6, 801-814. Harley, C. B. (1991). Telomere loss: mitotic clock or genetic time bomb? Mutat Res 256, 271-282. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990). Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-460. Harrington, L. (2003). Biochemical aspects of telomerase function. Cancer Lett 194, 139-154.
99 Harrington, L. A., and Greider, C. W. (1991). Telomerase primer specificity and chromosome healing. Nature 353, 451-454. Hartman, J. L. t., Garvik, B., and Hartwell, L. (2001). Principles for the buffering of genetic variation. Science 291, 1001-1004. Hecht, A., Laroche, T., Strahl-Bolsinger, S., Gasser, S. M., and Grunstein, M. (1995). Histone H3 and H4 N-termini interact with SIR3 and SIR4 proteins: a molecular model for the formation of heterochromatin in yeast. Cell 80, 583-592. Hediger, F., Dubrana, K., and Gasser, S. M. (2002). Myosin-like proteins 1 and 2 are not required for silencing or telomere anchoring, but act in the Tel1 pathway of telomere length control. Journal of Structural Biology 140, 79-91. Henderson, E. R., and Blackburn, E. H. (1989). An overhanging 3' terminus is a conserved feature of telomeres. Mol Cell Biol 9, 345-348. Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor, P., Bennett, K., Boutilier, K., et al. (2002). Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry. Nature 415, 180-183. Holstege, F. C., Jennings, E. G., Wyrick, J. J., Lee, T. I., Hengartner, C. J., Green, M. R., Golub, T. R., Lander, E. S., and Young, R. A. (1998). Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95, 717-728. Horecka, J., and Jigami, Y. (1999). The trp1- delta FA designer deletion for PCR- based gene functional analysis in Saccharomyces cerevisiae. Yeast 15, 1769-1774. Hsu, H. L., Gilley, D., Blackburn, E. H., and Chen, D. J. (1999). Ku is associated with the telomere in mammals. Proc Natl Acad Sci U S A 96, 12454-12458. Hsu, H. L., Gilley, D., Galande, S. A., Hande, M. P., Allen, B., Kim, S. H., Li, G. C., Campisi, J., Kohwi-Shigematsu, T., and Chen, D. J. (2000). Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev 14, 2807-2812. Huang, Y. (2002). Transcriptional silencing in Saccharomyces cerevisiae and Schizosaccharomyces pombe. Nucleic Acids Res 30, 1465-1482. Imai, S., Armstrong, C. M., Kaeberlein, M., and Guarente, L. (2000). Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403, 795-800. Ivessa, A. S., Zhou, J.-Q., Schulz, V. P., Monson, E. K., and Zakian, V. A. (2002). Saccharomyces Rrm3p, a 5' to 3' DNA helicase that promotes replication fork progression through telomeric and subtelomeric DNA. Genes Dev 16, 1383-1396. Jason, L. J., Moore, S. C., Lewis, J. D., Lindsey, G., and Ausio, J. (2002). Histone ubiquitination: a tagging tail unfolds? Bioessays 24, 166-174. Joseph, I., and Lustig, A. J. (2007). Telomeres in meiotic recombination: the yeast side story. Cell Mol Life Sci 64, 125-130. Kaminker, P. G., Kim, S. H., Taylor, R. D., Zebarjadian, Y., Funk, W. D., Morin, G. B., Yaswen, P., and Campisi, J. (2001). TANK2, a new TRF1-associated poly(ADP- ribose) polymerase, causes rapid induction of cell death upon overexpression. J Biol Chem 276, 35891-35899. Kanoh, J., Francesconi, S., Collura, A., Schramke, V., Ishikawa, F., Baldacci, G., and Geli, V. (2003). The fission yeast spSet1p is a histone H3-K4 methyltransferase that functions in telomere maintenance and DNA repair in an ATM kinase Rad3- dependent pathway. J Mol Biol 326, 1081-1094. Karlseder, J., Broccoli, D., Dai, Y., Hardy, S., and de Lange, T. (1999). p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 283, 1321- 1325.
100 Kim, H., and Chen, J. (2007). c-Myc interacts with TRF1/PIN2 and regulates telomere length. Biochem Biophys Res Commun 362, 842-847. Kim, R., Caron, P., and Wang, J. (1995). Effects of Yeast DNA Topoisomerase III on Telomere Structure. PNAS 92, 2667-2671. Koering, C. E., Fourel, G., Binet-Brasselet, E., Laroche, T., Klein, F., and Gilson, E. (2000). Identification of high affinity Tbf1p-binding sites within the budding yeast genome. Nucleic Acids Res 28, 2519-2526. Koering, C. E., Pollice, A., Zibella, M. P., Bauwens, S., Puisieux, A., Brunori, M., Brun, C., Martins, L., Sabatier, L., Pulitzer, J. F., and Gilson, E. (2002). Human telomeric position effect is determined by chromosomal context and telomeric chromatin integrity. EMBO Rep 3, 1055-1061. Kondrashov, A. S. (1988). Deleterious mutations and the evolution of sexual reproduction. Nature 336, 435–440. Konig, P., and Rhodes, D. (1997). Recognition of telomeric DNA. Trends Biochem Sci 22, 43-47. Krauskopf, A., and Blackburn, E. H. (1996). Control of telomere growth by interactions of RAP1 with the most distal telomeric repeats. Nature 383, 354-357. Krauskopf, A., and Blackburn, E. H. (1998). Rap1 protein regulates telomere turnover in yeast. Proc Natl Acad Sci U S A 95, 12486-12491. Kristjuhan, A., Wittschieben, B. O., Walker, J., Roberts, D., Cairns, B. R., and Svejstrup, J. Q. (2003). Spreading of Sir3 protein in cells with severe histone H3 hypoacetylation. Proc Natl Acad Sci U S A 100, 7551-7556. Krogan, N. J., Cagney, G., Yu, H., Zhong, G., Guo, X., Ignatchenko, A., Li, J., Pu, S., Datta, N., Tikuisis, A. P., et al. (2006). Global landscape of protein complexes in the yeast Saccharomyces cerevisiae. Nature 440, 637-643. Krogan, N. J., Dover, J., Wood, A., Schneider, J., Heidt, J., Boateng, M. A., Dean, K., Ryan, O. W., Golshani, A., Johnston, M., et al. (2003). The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol Cell 11, 721-729. Kuchin, S., Yeghiayan, P., and Carlson, M. (1995). Cyclin-dependent protein kinase and cyclin homologs SSN3 and SSN8 contribute to transcriptional control in yeast. Proc Natl Acad Sci U S A 92, 4006-4010. Kyrion, G., Boakye, K. A., and Lustig, A. J. (1992). C-terminal truncation of RAP1 results in the deregulation of telomere size, stability, and function in Saccharomyces cerevisiae. Mol Cell Biol 12, 5159-5173. Lamping, E., Luckl, J., Paltauf, F., Henry, S. A., and Kohlwein, S. D. (1994). Isolation and characterization of a mutant of Saccharomyces cerevisiae with pleiotropic deficiencies in transcriptional activation and repression. Genetics 137, 55- 65. Laroche, T., Martin, S. G., Gotta, M., Gorham, H. C., Pryde, F. E., Louis, E. J., and Gasser, S. M. (1998). Mutation of yeast Ku genes disrupts the subnuclear organization of telomeres. Curr Biol 8, 653-656. Le, S., Moore, J. K., Haber, J. E., and Greider, C. W. (1999). RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase. Genetics 152, 143-152. Lee, Y. C., Park, J. M., Min, S., Han, S. J., and Kim, Y. J. (1999). An activator binding module of yeast RNA polymerase II holoenzyme. Mol Cell Biol 19, 2967- 2976.
101 Lendvay, T. S., Morris, D. K., Sah, J., Balasubramanian, B., and Lundblad, V. (1996). Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes. Genetics 144, 1399-1412. Lenski, R. E., Ofria, C., Collier, T. C., and Adami, C. (1999). Genome complexity, robustness and genetic interactions in digital organisms. Nature 400, 661-664. Levis, R., Hazelrigg, T., and Rubin, G. M. (1985). Effects of genomic position on the expression of transduced copies of the white gene of Drosophila. Science 229, 558- 561. Levy, M. Z., Allsopp, R. C., Futcher, A. B., Greider, C. W., and Harley, C. B. (1992). Telomere end-replication problem and cell aging. J Mol Biol 225, 951-960. Li, B., and de Lange, T. (2003). Rap1 affects the length and heterogeneity of human telomeres. Mol Biol Cell 14, 5060-5068. Li, B., Oestreich, S., and de Lange, T. (2000). Identification of human Rap1: implications for telomere evolution. Cell 101, 471-483. Li, S., Chen, X., Ruggiero, C., Ding, B., and Smerdon, M. J. (2006). Modulation of Rad26- and Rpb9-mediated DNA repair by different promoter elements. J Biol Chem 281, 36643-36651. Lin, J. J., and Zakian, V. A. (1996). The Saccharomyces CDC13 protein is a single- strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo. Proc Natl Acad Sci U S A 93, 13760-13765. Lingner, J., and Cech, T. R. (1996). Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proc Natl Acad Sci U S A 93, 10712-10717. Lingner, J., Cech, T. R., Hughes, T. R., and Lundblad, V. (1997a). Three Ever Shorter Telomere (EST) genes are dispensable for in vitro yeast telomerase activity. Proc Natl Acad Sci U S A 94, 11190-11195. Lingner, J., Hughes, T. R., Shevchenko, A., Mann, M., Lundblad, V., and Cech, T. R. (1997b). Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276, 561-567. Linskens, M. H., Harley, C. B., West, M. D., Campisi, J., and Hayflick, L. (1995). Replicative senescence and cell death. Science 267, 17. Liu, C., Mao, X., and Lustig, A. J. (1994). Mutational Analysis Defines a C-Terminal Tail Domain of RAP1 Essential for Telomeric Silencing in Saccharomyces cerevisiae. Genetics 138, 1025-1040. Loayza, D., Parsons, H., Donigian, J., Hoke, K., and de Lange, T. (2004). DNA binding features of human POT1: a nonamer 5'-TAGGGTTAG-3' minimal binding site, sequence specificity, and internal binding to multimeric sites. J Biol Chem 279, 13241-13248. Loewith, R., Smith, J. S., Meijer, M., Williams, T. J., Bachman, N., Boeke, J. D., and Young, D. (2001). Pho23 is associated with the Rpd3 histone deacetylase and is required for its normal function in regulation of gene expression and silencing in Saccharomyces cerevisiae. J Biol Chem 276, 24068-24074. Longhese, M. P., Paciotti, V., Neecke, H., and Lucchini, G. (2000). Checkpoint Proteins Influence Telomeric Silencing and Length Maintenance in Budding Yeast. Genetics 155, 1577-1591. Longtine, M. S., Wilson, N. M., Petracek, M. E., and Berman, J. (1989). A yeast telomere binding activity binds to two related telomere sequence motifs and is indistinguishable from RAP1. Curr Genet 16, 225-239. Lundblad, V., and Szostak, J. W. (1989). A Mutant with a Defect in Telomere Elongation Leads to Senescence in Yeast. Cell 57, 633-643.
102 Luo, K., Vega-Palas, M. A., and Grunstein, M. (2002). Rap1-Sir4 binding independent of other Sir, yKu, or histone interactions initiates the assembly of telomeric heterochromatin in yeast. Genes Dev 16, 1528-1539. Lustig, A. J. (1998). Mechanisms of silencing in Saccharomyces cerevisiae. Curr Opin Genet Dev 8, 233-239. Lustig, A. J., and Petes, T. D. (1986). Identification of Yeast Mutants with Altered Telomere Structure. Proceedings of the National Academy of Sciences of the United States of America 83, 1398-1402. Majka, J., and Burgers, P. M. (2004). The PCNA-RFC families of DNA clamps and clamp loaders. Prog Nucleic Acid Res Mol Biol 78, 227-260. Makarov, V. L., Hirose, Y., and Langmore, J. P. (1997). Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 88, 657-666. Maringele, L., and Lydall, D. (2002). EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants. Genes Dev 16, 1919-1933. Martin-Rivera, L., Herrera, E., Albar, J. P., and Blasco, M. A. (1998). Expression of mouse telomerase catalytic subunit in embryos and adult tissues. Proc Natl Acad Sci U S A 95, 10471-10476. Martin, S. G., Laroche, T., Suka, N., Grunstein, M., and Gasser, S. M. (1999). Relocalization of telomeric Ku and SIR proteins in response to DNA strand breaks in yeast. Cell 97, 621-633. Mayer, M. L., Gygi, S. P., Aebersold, R., and Hieter, P. (2001). Identification of RFC(Ctf18p, Ctf8p, Dcc1p): an alternative RFC complex required for sister chromatid cohesion in S. cerevisiae. Mol Cell 7, 959-970. McCord, R., Pierce, M., Xie, J., Wonkatal, S., Mickel, C., and Vershon, A. K. (2003). Rfm1, a novel tethering factor required to recruit the Hst1 histone deacetylase for repression of middle sporulation genes. Mol Cell Biol 23, 2009-2016. McEachern, M. J., and Blackburn, E. H. (1995). Runaway telomere elongation caused by telomerase RNA gene mutations. Nature 376, 403-409. McEachern, M. J., Krauskopf, A., and Blackburn, E. H. (2000). Telomeres and their control. Annu Rev Genet 34, 331-358. McElligott, R., and Wellinger, R. J. (1997). The terminal DNA structure of mammalian chromosomes. Embo J 16, 3705-3714. Mead, J., McCord, R., Youngster, L., Sharma, M., Gartenberg, M. R., and Vershon, A. K. (2007). Swapping the gene-specific and regional silencing specificities of the Hst1 and Sir2 histone deacetylases. Mol Cell Biol 27, 2466-2475. Meier, B., Driller, L., Jaklin, S., and Feldmann, H. M. (2001). New Function of CDC13 in Positive Telomere Length Regulation. Mol Cell Biol 21, 4233-4245. Metz, A. M., Love, R. A., Strobel, G. A., and Long, D. M. (2001). Two telomerase reverse transcriptases (TERTs) expressed in Candida albicans. Biotechnol Appl Biochem 34, 47-54. Mills, K. D., Sinclair, D. A., and Guarente, L. (1999). MEC1-dependent redistribution of the Sir3 silencing protein from telomeres to DNA double-strand breaks. Cell 97, 609-620. Mishra, K., and Shore, D. (1999). Yeast Ku protein plays a direct role in telomeric silencing and counteracts inhibition by rif proteins. Curr Biol 9, 1123-1126. Moretti, P., Freeman, K., Coodly, L., and Shore, D. (1994). Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev 8, 2257-2269.
103 Morse, R. H. (2000). RAP, RAP, open up! New wrinkles for RAP1 in yeast. Trends Genet 16, 51-53. Mueller, C. L., and Jaehning, J. A. (2002). Ctr9, Rtf1, and Leo1 are components of the Paf1/RNA polymerase II complex. Mol Cell Biol 22, 1971-1980. Muller, H. J. (1938). The remaking of chromosomes. The Collecting of Net-Woods Hole 13, 181-198. Muller, H. J. (1950). Our load of mutations. Am J Hum Genet 2, 111–176. Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B., and Cech, T. R. (1997). Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955-959. Nasmyth, K., Peters, J. M., and Uhlmann, F. (2000). Splitting the chromosome: cutting the ties that bind sister chromatids. Science 288, 1379-1385. Nelson, M. K., Kurihara, T., and Silver, P. A. (1993). Extragenic suppressors of mutations in the cytoplasmic C terminus of SEC63 define five genes in Saccharomyces cerevisiae. Genetics 134, 159-173. Niida, H., Matsumoto, T., Satoh, H., Shiwa, M., Tokutake, Y., Furuichi, Y., and Shinkai, Y. (1998). Severe growth defect in mouse cells lacking the telomerase RNA component. Nat Genet 19, 203-206. Nikko, E., Marini, A. M., and Andre, B. (2003). Permease recycling and ubiquitination status reveal a particular role for Bro1 in the multivesicular body pathway. J Biol Chem 278, 50732-50743. Nimmo, E. R., Cranston, G., and Allshire, R. C. (1994). Telomere-associated chromosome breakage in fission yeast results in variegated expression of adjacent genes. Embo J 13, 3801-3811. Nishikawa, T., Nagadoi, A., Yoshimura, S., Aimoto, S., and Nishimura, Y. (1998). Solution structure of the DNA-binding domain of human telomeric protein, hTRF1. Structure 6, 1057-1065. Nonet, M. L., and Young, R. A. (1989). Intragenic and extragenic suppressors of mutations in the heptapeptide repeat domain of Saccharomyces cerevisiae RNA polymerase II. Genetics 123, 715-724. Nugent, C. I., Hughes, T. R., Lue, N. F., and Lundblad, V. (1996). Cdc13p: a single- strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance. Science 274, 249-252. O'Sullivan, J. N., Bronner, M. P., Brentnall, T. A., Finley, J. C., Shen, W. T., Emerson, S., Emond, M. J., Gollahon, K. A., Moskovitz, A. H., Crispin, D. A., et al. (2002). Chromosomal instability in ulcerative colitis is related to telomere shortening. Nat Genet 32, 280-284. Ohya, T., Kawasaki, Y., Hiraga, S.-I., Kanbara, S., Nakajo, K., Nakashima, N., Suzuki, A., and Sugino, A. (2002). The DNA Polymerase Domain of polepsilon Is Required for Rapid, Efficient, and Highly Accurate Chromosomal DNA Replication, Telomere Length Maintenance, and Normal Cell Senescence in Saccharomyces cerevisiae. J Biol Chem 277, 28099-28108. Palladino, F., Laroche, T., Gilson, E., Axelrod, A., Pillus, L., and Gasser, S. M. (1993). Sir3 and Sir4 Proteins Are Required for the Positioning and Integrity of Yeast Telomeres. Cell 75, 543-555. Panavas, T., Serviene, E., Brasher, J., and Nagy, P. D. (2005). Yeast genome-wide screen reveals dissimilar sets of host genes affecting replication of RNA viruses. Proc Natl Acad Sci U S A 102, 7326-7331. Pandita, T. K. (2002). ATM function and telomere stability. Oncogene 21, 611-618.
104 Penheiter, K. L., Washburn, T. M., Porter, S. E., Hoffman, M. G., and Jaehning, J. A. (2005). A posttranscriptional role for the yeast Paf1-RNA polymerase II complex is revealed by identification of primary targets. Mol Cell 20, 213-223. Pennock, E., Buckley, K., and Lundblad, V. (2001). Cdc13 delivers separate complexes to the telomere for end protection and replication. Cell 104, 387-396. Phillips, P. C., Otto, S. P., Whitlock, M. C., and (eds. Wolf, J. B., Brodie III, E.D. & Wade, M.J.) (2000). Beyond the Average: The Evolutionary Importance of Gene Interactions and Variablity of Epistatic Effects. in Epistasis and the Evolutionary Process. Oxford University Press, New York, 20−38. Polevoda, B., and Sherman, F. (2003). N-terminal acetyltransferases and sequence requirements for N-terminal acetylation of eukaryotic proteins. J Mol Biol 325, 595- 622. Polotnianka, R. M., Li, J., and Lustig, A. J. (1998). The yeast Ku heterodimer is essential for protection of the telomere against nucleolytic and recombinational activities. Curr Biol 8, 831-834. Porter, S. E., Greenwell, P. W., Ritchie, K. B., and Petes, T. D. (1996). The DNA- binding protein Hdf1p (a putative Ku homologue) is required for maintaining normal telomere length in Saccharomyces cerevisiae. Nucleic Acids Res 24, 582-585. Porter, S. E., Washburn, T. M., Chang, M., and Jaehning, J. A. (2002). The yeast pafl- rNA polymerase II complex is required for full expression of a subset of cell cycle- regulated genes. Eukaryot Cell 1, 830-842. Prescott, J. C., and Blackburn, E. H. (2000). Telomerase RNA template mutations reveal sequence-specific requirements for the activation and repression of telomerase action at telomeres. Mol Cell Biol 20, 2941-2948. Qi, H., and Zakian, V. A. (2000). The Saccharomyces telomere-binding protein Cdc13p interacts with both the catalytic subunit of DNA polymerase alpha and the telomerase-associated est1 protein. Genes Dev 14, 1777-1788. Ray, A., and Runge, K. W. (1999). Varying the number of telomere-bound proteins does not alter telomere length in tel1Delta cells. Proc Natl Acad Sci U S A 96, 15044- 15049. Renauld, H., Aparicio, O. M., Zierath, P. D., Billington, B. L., Chhablani, S. K., and Gottschling, D. E. (1993). Silent domains are assembled continuously from the telomere and are defined by promoter distance and strength, and by SIR3 dosage. Genes Dev 7, 1133-1145. Ritchie, K. B., and Petes, T. D. (2000). The Mre11p/Rad50p/Xrs2p complex and the Tel1p function in a single pathway for telomere maintenance in yeast. Genetics 155, 475-479. Roberg, K. J., Bickel, S., Rowley, N., and Kaiser, C. A. (1997). Control of amino acid permease sorting in the late secretory pathway of Saccharomyces cerevisiae by SEC13, LST4, LST7 and LST8. Genetics 147, 1569-1584. Robinson, J. S., Klionsky, D. J., Banta, L. M., and Emr, S. D. (1988). Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8, 4936-4948. Robyr, D., Suka, Y., Xenarios, I., Kurdistani, S. K., Wang, A., Suka, N., and Grunstein, M. (2002). Microarray deacetylation maps determine genome-wide functions for yeast histone deacetylases. Cell 109, 437-446. Rodriguez-Navarro, S., Igual, J. C., and Perez-Ortin, J. E. (2002). SRC1: an intron- containing yeast gene involved in sister chromatid segregation. Yeast 19, 43-54. Rog, O., Smolikov, S., Krauskopf, A., and Kupiec, M. (2005). The yeast VPS genes affect telomere length regulation. Curr Genet 47, 18-28.
105 Roguev, A., Schaft, D., Shevchenko, A., Pijnappel, W. W. M. P., Wilm, M., Aasland, R., and Stewart, A. F. (2001). The Saccharomyces cerevisiae Set1 complex includes an Ash2 homologue and methylates histone 3 lysine 4. EMBO J 20, 7137-7148. Romanov, S. R., Kozakiewicz, B. K., Holst, C. R., Stampfer, M. R., Haupt, L. M., and Tlsty, T. D. (2001). Normal human mammary epithelial cells spontaneously escape senescence and acquire genomic changes. Nature 409, 633-637. Romeo, M. J., Angus-Hill, M. L., Sobering, A. K., Kamada, Y., Cairns, B. R., and Levin, D. E. (2002). HTL1 encodes a novel factor that interacts with the RSC chromatin remodeling complex in Saccharomyces cerevisiae. Mol Cell Biol 22, 8165- 8174. Roy, R., Meier, B., McAinsh, A. D., Feldmann, H. M., and Jackson, S. P. (2004). Separation-of-function mutants of yeast Ku80 reveal a Yku80p-Sir4p interaction involved in telomeric silencing. J Biol Chem 279, 86-94. Rozenblatt-Rosen, O., Hughes, C. M., Nannepaga, S. J., Shanmugam, K. S., Copeland, T. D., Guszczynski, T., Resau, J. H., and Meyerson, M. (2005). The parafibromin tumor suppressor protein is part of a human Paf1 complex. Mol Cell Biol 25, 612-620. Rudenko, G., McCulloch, R., Dirks-Mulder, A., and Borst, P. (1996). Telomere exchange can be an important mechanism of variant surface glycoprotein gene switching in Trypanosoma brucei. Mol Biochem Parasitol 80, 65-75. Rundlett, S. E., Carmen, A. A., Kobayashi, R., Bavykin, S., Turner, B. M., and Grunstein, M. (1996). HDA1 and RPD3 are members of distinct yeast histone deacetylase complexes that regulate silencing and transcription. Proc Natl Acad Sci U S A 93, 14503-14508. Runge, K., and Zakian, V. (1996). TEL2, an essential gene required for telomere length regulation and telomere position effect in Saccharomyces cerevisiae. Mol Cell Biol 16, 3094-3105. Rusche, L. N., Kirchmaier, A. L., and Rine, J. (2003). The establishment, inheritance, and function of silenced chromatin in Saccharomyces cerevisiae. Annu Rev Biochem 72, 481-516. Saldanha, S. N., Andrews, L. G., and Tollefsbol, T. O. (2003). Assessment of telomere length and factors that contribute to its stability. Eur J Biochem 270, 389- 403. Sambade, M., Alba, M., Smardon, A. M., West, R. W., and Kane, P. M. (2005). A genomic screen for yeast vacuolar membrane ATPase mutants. Genetics 170, 1539- 1551. Sbodio, J. I., Lodish, H. F., and Chi, N. W. (2002). Tankyrase-2 oligomerizes with tankyrase-1 and binds to both TRF1 (telomere-repeat-binding factor 1) and IRAP (insulin-responsive aminopeptidase). Biochem J 361, 451-459. Scherthan, H. (2007). Telomere attachment and clustering during meiosis. Cell Mol Life Sci 64, 117-124. Schu, P. V., Takegawa, K., Fry, M. J., Stack, J. H., Waterfield, M. D., and Emr, S. D. (1993). Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science 260, 88-91. Segre, D., Deluna, A., Church, G. M., and Kishony, R. (2005). Modular epistasis in yeast metabolism. Nat Genet 37, 77-83. Shampay, J., and Blackburn, E. H. (1988). Generation of telomere-length heterogeneity in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 85, 534-538. Shampay, J., Szostak, J. W., and Blackburn, E. H. (1984). DNA sequences of telomeres maintained in yeast. Nature 310, 154-157.
106 Shen, M., Haggblom, C., Vogt, M., Hunter, T., and Lu, K. P. (1997). Characterization and cell cycle regulation of the related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. Proc Natl Acad Sci U S A 94, 13618-13623. Shore, D. (1994). RAP1: a protean regulator in yeast. Trends Genet 10, 408-412. Shore, D., Squire, M., and Nasmyth, K. A. (1984). Characterization of two genes required for the position-effect control of yeast mating-type genes. Embo J 3, 2817- 2823. Singer, M. S., and Gottschling, D. E. (1994). TLC1: template RNA component of Saccharomyces cerevisiae telomerase. Science 266, 404-409. Slessareva, J. E., Routt, S. M., Temple, B., Bankaitis, V. A., and Dohlman, H. G. (2006). Activation of the phosphatidylinositol 3-kinase Vps34 by a G protein alpha subunit at the endosome. Cell 126, 191-203. Smilenov, L. B., Morgan, S. E., Mellado, W., Sawant, S. G., Kastan, M. B., and Pandita, T. K. (1997). Influence of ATM function on telomere metabolism. Oncogene 15, 2659-2665. Smith, J. S., Caputo, E., and Boeke, J. D. (1999). A Genetic Screen for Ribosomal DNA Silencing Defects Identifies Multiple DNA Replication and Chromatin- Modulating Factors. Mol Cell Biol 19, 3184-3197. Smolikov, S., Mazor, Y., and Krauskopf, A. (2004). ELG1, a regulator of genome stability, has a role in telomere length regulation and in silencing. Proc Natl Acad Sci U S A 101, 1656-1661. Song, K., Jung, D., Jung, Y., Lee, S. G., and Lee, I. (2000). Interaction of human Ku70 with TRF2. FEBS Lett 481, 81-85. Spencer, F., Gerring, S. L., Connelly, C., and Hieter, P. (1990). Mitotic chromosome transmission fidelity mutants in Saccharomyces cerevisiae. Genetics 124, 237-249. Spink, K. G., Evans, R. J., and Chambers, A. (2000). Sequence-specific binding of Taz1p dimers to fission yeast telomeric DNA. Nucleic Acids Res 28, 527-533. Stack, J. H., DeWald, D. B., Takegawa, K., and Emr, S. D. (1995). Vesicle-mediated protein transport: regulatory interactions between the Vps15 protein kinase and the Vps34 PtdIns 3-kinase essential for protein sorting to the vacuole in yeast. J Cell Biol 129, 321-334. Straight, A. F., Shou, W., Dowd, G. J., Turck, C. W., Deshaies, R. J., Johnson, A. D., and Moazed, D. (1999). Net1, a Sir2-associated nucleolar protein required for rDNA silencing and nucleolar integrity. Cell 97, 245-256. Sun, Z. W., and Hampsey, M. (1999). A general requirement for the Sin3-Rpd3 histone deacetylase complex in regulating silencing in Saccharomyces cerevisiae. Genetics 152, 921-932. Sussel, L., and Shore, D. (1991). Separation of transcriptional activation and silencing functions of the RAP1-encoded repressor/activator protein 1: isolation of viable mutants affecting both silencing and telomere length. Proc Natl Acad Sci U S A 88, 7749-7753. Sussel, L., Vannier, D., and Shore, D. (1995). Suppressors of Defective Silencing in Yeast - Effects on Transcriptional Repression at the Hmr Locus, Cell-Growth and Telomere Structure. Genetics 141, 873-888. Suzuki, Y., and Nishizawa, M. (1994). The Yeast Gal11 Protein Is Involved in Regulation of the Structure and the Position Effect of Telomeres. Molecular and Cellular Biology 14, 3791-3799. Tabtiang, R. K., and Herskowitz, I. (1998). Nuclear proteins Nut1p and Nut2p cooperate to negatively regulate a Swi4p-dependent lacZ reporter gene in Saccharomyces cerevisiae. Mol Cell Biol 18, 4707-4718.
107 Taddei, A., and Gasser, S. M. (2004). Multiple pathways for telomere tethering: functional implications of subnuclear position for heterochromatin formation. Biochim Biophys Acta 1677, 120-128. Teo, S. H., and Jackson, S. P. (2001). Telomerase subunit overexpression suppresses telomere-specific checkpoint activation in the yeast yku80 mutant. EMBO Rep 2, 197-202. Teter, S. A., and Klionsky, D. J. (2000). Transport of proteins to the yeast vacuole: autophagy, cytoplasm-to-vacuole targeting, and role of the vacuole in degradation. Semin Cell Dev Biol 11, 173-179. Tham, W. H., and Zakian, V. A. (2002). Transcriptional silencing at Saccharomyces telomeres: implications for other organisms. Oncogene 21, 512-521. Thompson, C. M., Koleske, A. J., Chao, D. M., and Young, R. A. (1993). A multisubunit complex associated with the RNA polymerase II CTD and TATA- binding protein in yeast. Cell 73, 1361-1375. Tong, A., and Boone, C. (2007). Yeast gene analysis. Vol 36, seconed edn. Tong, A. H., and Boone, C. (2006). Synthetic genetic array analysis in Saccharomyces cerevisiae. Methods Mol Biol 313, 171-192. Tong, A. H., Lesage, G., Bader, G. D., Ding, H., Xu, H., Xin, X., Young, J., Berriz, G. F., Brost, R. L., Chang, M., et al. (2004). Global mapping of the yeast genetic interaction network. Science 303, 808-813. Toth, A., Ciosk, R., Uhlmann, F., Galova, M., Schleiffer, A., and Nasmyth, K. (1999). Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes Dev 13, 320-333. Tsukamoto, Y., Kato, J., and Ikeda, H. (1997). Silencing factors participate in DNA repair and recombination in Saccharomyces cerevisiae. Nature 388, 900-903. Tsukamoto, Y., Taggart, A. K., and Zakian, V. A. (2001). The role of the Mre11- Rad50-Xrs2 complex in telomerase- mediated lengthening of Saccharomyces cerevisiae telomeres. Curr Biol 11, 1328-1335. Ubersax, J. A., Woodbury, E. L., Quang, P. N., Paraz, M., Blethrow, J. D., Shah, K., Shokat, K. M., and Morgan, D. O. (2003). Targets of the cyclin-dependent kinase Cdk1. Nature 425, 859-864. Valerie, K., and Povirk, L. F. (2003). Regulation and mechanisms of mammalian double-strand break repair. Oncogene 22, 5792-5812. van Steensel, B., and de Lange, T. (1997). Control of telomere length by the human telomeric protein TRF1. Nature 385, 740-743. van Steensel, B., Smogorzewska, A., and de Lange, T. (1998). TRF2 protects human telomeres from end-to-end fusions. Cell 92, 401-413. Vassetzky, N. S., Gaden, F., Brun, C., Gasser, S. M., and Gilson, E. (1999). Taz1p and Teb1p, two telobox proteins in Schizosaccharomyces pombe, recognize different telomere-related DNA sequences. Nucleic Acids Res 27, 4687-4694. Walker, J. R., Corpina, R. A., and Goldberg, J. (2001). Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 412, 607-614. Wang, H., Gilley, D., and Blackburn, E. H. (1998). A novel specificity for the primer- template pairing requirement in Tetrahymena telomerase. Embo J 17, 1152-1160. Watson, J. D. (1972). Origin of concatemeric T7 DNA. Nat New Biol 239, 197-201. Wei, C., and Price, M. (2003). Protecting the terminus: t-loops and telomere end- binding proteins. Cell Mol Life Sci 60, 2283-2294. Weitao, T., Budd, M., and Campbell, J. L. (2003). Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability. Mutat Res 532, 157-172.
108 Wellinger, R. J., Ethier, K., Labrecque, P., and Zakian, V. A. (1996). Evidence for a new step in telomere maintenance. Cell 85, 423-433. Wellinger, R. J., Wolf, A. J., and Zakian, V. A. (1993). Saccharomyces telomeres acquire single-strand TG1-3 tails late in S phase. Cell 72, 51-60. Whitlock, M. C., and Bourguet, D. (2000). Factors affecting the genetic load in Drosophila: synergistic epistasis and correlations among fitness components. Evolution Int J Org Evolution 54, 1654-1660. Williams, B., and Lustig, A. J. (2003). The paradoxical relationship between NHEJ and telomeric fusion. Mol Cell 11, 1125-1126. Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J. D., Bussey, H., et al. (1999). Functional characterization of the S-cerevisiae genome by gene deletion and parallel analysis. Science 285, 901-906. Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J. D., Bussey, H., Chu, A. M., Connelly, C., Davis, K., Dietrich, F., Dow, S. W., El Bakkoury, M., Foury, F., Friend, S. H., Gentalen, E., Giaever, G., Hegemann, J. H., Jones, T., Laub, M., Liao, H., Liebundguth, N., Lockhart, D. J., Lucau-Danila, A., Lussier, M., M'Rabet, N., Menard, P., Mittmann, M., Pai, C., Rebischung, C., Revuelta, J. L., Riles, L., Roberts, C. J., Ross-MacDonald, P., Scherens, B., Snyder, M., Sookhai-Mahadeo, S., Storms, R. K., Veronneau, S., Voet, M., Volckaert, G., Ward, T. R., Wysocki, R., Yen, G. S., Yu, K. X., Zimmermann, K., Philippsen, P., Johnston, M. & Davis, R. W. (1999). Functional characterization of the S-cerevisiae genome by gene deletion and parallel analysis. Science 285, 901-906. Wloch, D. M., Borts, R. H., and Korona, R. (2001). Epistatic interactions of spontaneous mutations in haploid strains of the yeast Saccharomyces cerevisiae. Journal of Evolutionary Biology 14, 310-316. Wotton, D., and Shore, D. (1997). Novel Rap1p-interacting factor, Rif2p, cooperates with Rif1p to regulate telomere length in Saccharomyces cerevisiae. Genes & Development 11, 748-760. Wu, G., Lee, W. H., and Chen, P. L. (2000). NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G2 phases in immortalized telomerase- negative cells. Implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 275, 30618-30622. Xia, L., Jaafar, L., Cashikar, A., and Flores-Rozas, H. (2007). Identification of genes required for protection from doxorubicin by a genome-wide screen in Saccharomyces cerevisiae. Cancer Res 67, 11411-11418. Xie, J., Pierce, M., Gailus-Durner, V., Wagner, M., Winter, E., and Vershon, A. K. (1999). Sum1 and Hst1 repress middle sporulation-specific gene expression during mitosis in Saccharomyces cerevisiae. Embo J 18, 6448-6454. Yavuzer, U., Smith, G. C., Bliss, T., Werner, D., and Jackson, S. P. (1998). DNA end- independent activation of DNA-PK mediated via association with the DNA-binding protein C1D. Genes Dev 12, 2188-2199. Zakian, V. A. (1995). Telomeres: beginning to understand the end. Science 270, 1601-1607. Zakian, V. A., and Blanton, H. M. (1988). Distribution of telomere-associated sequences on natural chromosomes in Saccharomyces cerevisiae. Mol Cell Biol 8, 2257-2260. Zhang, X., Morera, S., Bates, P. A., Whitehead, P. C., Coffer, A. I., Hainbucher, K., Nash, R. A., Sternberg, M. J., Lindahl, T., and Freemont, P. S. (1998). Structure of an
109 XRCC1 BRCT domain: a new protein-protein interaction module. Embo J 17, 6404- 6411. Zhou, J., Hidaka, K., and Futcher, B. (2000). The Est1 subunit of yeast telomerase binds the Tlc1 telomerase RNA. Mol Cell Biol 20, 1947-1955. Zhu, J., Wang, H., Bishop, J. M., and Blackburn, E. H. (1999). Telomerase extends the lifespan of virus-transformed human cells without net telomere lengthening. Proc Natl Acad Sci U S A 96, 3723-3728. Zhu, X. D., Kuster, B., Mann, M., Petrini, J. H., and de Lange, T. (2000). Cell-cycle- regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 25, 347-352.
110 תקציר
טלומרים הם מבנים של דנ"א וחלבונים הנמצאים בקצוות כרומוזומים ביצורים אאוקריוטים.
טלומרים ממלאים תפקיד מרכזי בשמירת שלמות הגנום ע"י הגנת הכרומוזום מעיכול ואיחוי קצוות.
לבקרת אורך הטלומרים יש חשיבות מרכזית לתפקודם הכולל. במטרה להרחיב את הידע שלנו לגבי
המנגנון המבקר אורך טלומרים, ביצענו סריקה מערכתית של כ4800- מוטנטים האפלואידים אשר לכל
אחד חסר בגן אחר של השמר Saccharomyces cerevisiae. בסריקה זו בדקנו שינויים באורך
הטלומרים של כל אחד מהמוטנטים. זיהינו למעלה מ150- גנים המשפיעים על אורך הטלומרים. על מנת
למיין את רשימת הגנים החדשים שזיהינו לקבוצות אפיסטזיס, השתמשנו בשיטה חדשה ליצירת מוטנטים
כפולים. בחרנו להמשיך ולעבוד עם הגנים שבהעדרם יש טלומרים קצרים. סידרה של 30 מוטנטים
כאלה, המייצגים את כל הקומפלקסים שנמצאו בסריקה הגנומית, הוכלאה לחמישה מוטנטים בעלי
טלומרים קצרים: cdc73, dcc1, vps34, srb2 וrfm1- . התוצאות מאירות את מנגנוני בקרת אורך
הטלומרים באור חדש ומעניין.
111 אוניברסיטת תל אביב
הפקולטה למדעי החיים ע"ש ג'ורג' ס. וייס
המחלקה למיקרוביולוגיה מולקולרית וביוטכנולגיה
זיהוי ואפיון גנים המעורבים בבקרת אורך טלומרים בשמר ההנצה
Sacchromyces cerevisiae
חיבור לשם קבלת התואר "דוקטור לפילוסופיה"
הוגש לסנאט של אוניברסיטת תל אביב
מאת
טל יהודה
עבודה זו נעשתה בהנחייתם של
דר' ענת קראוסקופף ז"ל ופרופ' מרטין קופייק
מאי 2008
112