Both LCCL-Domains of Human CRISPLD2 Have High Affinity for Lipid A

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Biochimie 97 (2014) 66e71

Contents lists available at ScienceDirect

Biochimie

journal homepage: www.elsevier.com/locate/biochi

Research paper Both LCCL-domains of human CRISPLD2 have high afﬁnity for lipid A

Viktor Vásárhelyi, Mária Trexler, László Patthy*

Institute of Enzymology, Research Centre for Natural Sciences, Hungarian Academy of Sciences, Budapest H-1518, PO Box 7, Hungary

article info abstract

Article history: The LCCL-domain is a recently defined protein module present in diverse extracellular multidomain Received 15 May 2013 proteins. Practically nothing is known about the molecular function of these domains; based on func- Accepted 20 September 2013 tional features of proteins harboring LCCL-domains it has been suggested that these domains might Available online 1 October 2013 function as lipopolysaccharide-binding domains. Here we show that the two LCCL-domains of human CRISPLD2 protein, a lipopolysaccharide-binding serum protein involved in defense against endotoxin Keywords: shock, have higher affinity for the lipid A, the toxic moiety of lipopolysaccharides than for ipopoly- CRISPLD2 protein saccharide. Our observation that the LCCL-domains of CRISPLD2 are specific for the toxic lipid A moiety of Endotoxin LCCL-domain the endotoxin suggests that it may block the interaction between endotoxins and the host endotoxin Lipid A receptors without interfering with the development of antibacterial immunity against the polysaccharide Lipopolysaccharide moiety of LPS. We suggest that the anti-inflammatory function of CRISPLD2 protein may account for its role in various pathological and developmental processes. Ó 2013 The Authors. Published by Elsevier Masson SAS. Open access under CC BY-NC-ND license.

1. Introduction domains might function in the innate immune system, possibly as lipopolysaccharide-binding domains [1,5]. The strongest argu- The LCCL-domain is a recently discovered, conserved protein ment in favor of this assumption was that Limulus factor C has high module named after its presence in Limulus factor C, cochlear affinity for lipopolysaccharides and serves in recognition of gram- protein Coch-5b2 and late gestation lung protein Lgl1, the first and negative bacteria. Another line of evidence for this assumption best studied multidomain proteins in which this domain-type was came from a survey of structural and functional information about recognized [1]. Recent studies have revealed that Plasmodium Lgl1, a late gestation lung protein containing two LCCL-domains [1]. species have several types of extracellular multidomain proteins Our analyses suggested that Lgl1 protein might play an important containing LCCL-domains and that other genera of Apicomplexa role in host defense against microbial infection by recognizing (including Cryptosporidium, Toxoplasma, Eimeria and Theileria) polysaccharides of invading pathogens [1]. Recent studies have contain orthologs of these proteins [2e4]. confirmed that the Lgl1 protein (renamed as Cysteine-Rich Secre- Very little is known about the molecular function of LCCL- tory Protein LCCL Domain containing 2, CRISPLD2) has high affinity domains. Based on a survey of the functional features of proteins for lipopolysaccharide and plays a critical role in defense against harboring LCCL-domains we have suggested earlier that LCCL- endotoxin shock [6]. In the present work we tested the hypothesis that the LCCL- domains of CRISPLD2 may be involved in the binding of lipopolysaccharide by this protein. Our results show that both LCCL- domains of human CRISPLD2 protein have high affinity for lipid A, the toxic moiety of lipopolysaccharides.

Abbreviations: CRISPLD2, Cysteine-Rich Secretory Protein LCCL Domain containing 2; CRISPLD2_LCCL1, protein containing the ﬁrst LCCL domain of CRISPLD2; 2. Experimental methods CRISPLD2_LCCL2, protein containing the second LCCL domain of CRISPLD2; CRISPLD2_LCCL1þ2, protein containing the ﬁrst and second LCCL domains of 2.1. Reagents, enzymes, PCR primers, proteins, bacterial strains, cell CRISPLD2; LPS, lipopolysaccharide; LA, Lipid A; LGL1, late gestation lung protein 1; lines and media NSCLP, non-syndromic cleft lip and palate; SPR, surface plasmon resonance. * Corresponding author. Budapest H-1113, Karolina út 29, Hungary. Tel.: þ36 1 Restriction enzymes, T4 DNA Ligase and Klenow polymerase 2093 537; fax: þ36 1 4665 465. E-mail addresses: [email protected] (V. Vásárhelyi), [email protected] were New England Biolabs products (Beverly, MA, USA). PCR (M. Trexler), [email protected], [email protected] (L. Patthy). primers were obtained from Integrated DNA Technologies

0300-9084 Ó 2013 The Authors. Published by Elsevier Masson SAS. Open access under CC BY-NC-ND license. http://dx.doi.org/10.1016/j.biochi.2013.09.021 V. Vásárhelyi et al. / Biochimie 97 (2014) 66e71 67

(Coralville, IA, USA). For ampliﬁcation reactions we used Taq po- rate constants of the association reactions and the equilibrium lymerase from Fermentas (Vilnius, Lithuania) or the proof-reading dissociation constants of the interactions of LCCL-domains with thermostable polymerase Accuzyme (Bioline, London, UK). lipopolysaccharide and lipid A one must know the effective mo- The Pichia pastoris expression system was obtained from Invi- lecular weight of these compounds. However, LPS (lipopolysac- trogen (Carlsbad, CA, USA), the pCDFDuet-1 bacterial expression charide from E. coli 0127:B8 strain, SigmaeAldrich, St. Louise, MO, vector was the product of Novagen (Gibbstown, NJ, USA). The USA) is heterogeneous and tends to form aggregates of varying Escherichia coli JM109 bacterial strain was used for DNA propaga- sizes. In the presence of strong surface active agents and in the tion during DNA manipulation steps while bacterial protein absence of divalent cations bacterial endotoxins consist of 10e expression was performed in E. coli BL21(DE3). 20 kDa macromolecules, whereas in the absence of surface active CM5 sensorchips and the reagents for protein coupling to the agents lipopolysaccharide forms micellar structures with a molec- chips were from Biacore AB (Uppsala, Sweden). Lipopolysaccharide ular weight of approximately 1000 kDa. Since we studied the from E. coli 0127:B8 strain and lipid A from E. coli F583 strain were interaction of lipopolysaccharide with LCCL-domains in solutions purchased from SigmaeAldrich (St. Louise, MO, USA). containing 5 mM EDTA and 0.005% Tween 20 we calculated kinetic constants based on the assumption that the effective molecular 2.2. Protein analyses weight of lipopolysaccharide is 20 kDa.

The composition of protein samples was analyzed by SDS-PAGE 2.4. Expression of the two LCCL-domains of human CRISPLD2 under both reducing and nonreducing conditions. The gels were stained with Coomassie brilliant Blue G-250. The DNA encoding both LCCL-domains of human CRISPLD2 The concentrations of the recombinant proteins were deter- protein (residues Met284-Gln497 of full-length protein) was mined using extinction coefficients calculated with the online amplified from human placenta cDNA library with the primer pair: protein analysis tool, Protparam (http://us.expasy.org/tools/ 50 GCCGAATTCATGACCCAAGTCGTCAGATGTG 30 and 50 GCCTCTA- protparam.html). We have used the following extinction co- GATGCCTGACAGCAAAGATCCGG 30. efficients: CRISPLD2_LCCL1: 6335 M 1 cm 1, CRISPLD2_LCCL2: The amplified DNA was digested with EcoRI and XbaI restriction 11835 M 1 cm 1, CRISPLD2_LCCL1þ2: 18170 M 1 cm 1. enzymes and ligated into the pPICZalphaA expression vector N-terminal sequencing was performed on an Applied Bio- digested with EcoRI-XbaI enzymes. The resulting expression systems 471A protein sequencer with an on-line ABI 120A phe- cassette consists of the inducible AOX1 promoter of the alcohol nyltiohydantoin (PTH) analyzer. oxidase 1 gene of P. pastoris, the yeast alpha-mating factor secretion signal sequence, the DNA insert encoding both LCCL-domains of 2.3. Surface plasmon resonance analysis human CRISPLD2, a myc-epitope, a hexahistidine His tag and the 30 termination signal of the AOX1 gene. The pPICZalphaA expression Surface plasmon resonance measurements were performed on a plasmid contains the zeocin resistance gene for easy selection of BIACORE X (GE Healthcare, Stockholm, Sweden) instrument. Pro- positive transformants. The molecular mass calculated for the teins to be immobilized were dissolved in 50 mM sodium acetate, amino acid sequence of the recombinant protein containing resi- pH 4.5 and 50 ml of 2.6 mM CRISPLD2_LCCL1þ2, or 70 ml of 2.5 mM dues Met284-Gln497 of CRISPLD2 and residues derived from the CRISPLD2_LCCL1, or 35 mlof67.5mM CRISPLD2_LCCL2 solutions expression vector was 26,836 Da. were injected with a 5 ml/min flow rate on a CM5 sensor chip E. coli JM109 cells were transformed with the ligation mixture activated by the amine coupling method according to the in- and clones containing the insert encoding the LCCL-domains were structions of the manufacturer. isolated. After sequence verification the pPICZalphaA plasmid Stock solutions of 2.5 mg/ml of lipopolysaccharide from E. coli containing the insert was linearized and P. pastoris GS115 cells were 0127:B8 strain, 200 mM of diphosphoryl Lipid A from E. coli F583 transformed by electroporation. Genomic DNA was prepared from strain were prepared in 20 mM HEPES buffer, pH 7.5, containing Zeocin resistant colonies to check the insertion of the expression 150 mM NaCl, 5 mM EDTA and 0.005% Tween 20. The solutions plasmids into the yeast chromosome. Verified P. pastoris clones were sonicated at 37 C for 15 min. were grown in 400 ml medium containing 2% peptone, 1% yeast For interaction measurements 80 ml aliquots of different con- extract and 5% glycerol for 72 h then the medium was changed to centrations of lipopolysaccharide or lipid A solutions were injected induction medium containing 100 mM potassium phosphate pH over the sensorchips with a 20 ml/min flow rate, followed by 7.5, 0.2% ammonium sulfate, 0.34% Yeast Nitrogen Base, 0.004% 10 min flow of buffer. Binding and washes were performed in histidine, 0.00004% biotin and 1% methanol; culture flasks were 20 mM HEPES buffer, pH 7.5 containing 150 mM NaCl, 5 mM EDTA shaken for 48 h and methanol addition was repeated every 24 h. and 0.005% Tween 20. After each cycle the chips were regenerated The cells were centrifuged and the supernatant was applied by injection of 20 ml 50 mM NaOH with 60 ml/min flow rate. The onto Ni-affinity columns. Unbound components were removed by injected lipopolysaccharide or lipid A solutions were always diluted washing the column with ten column volumes of 20 mM TRISeHCl and thoroughly vortexed just before injection. buffer, pH 7.9 containing 500 mM NaCl and 30 mM imidazole and Control flow cells were prepared by executing the coupling re- the bound proteins were eluted with 20 mM TRISeHCl buffer, pH action in the presence of coupling buffer alone. Control flow cells 7.9 containing 300 mM imidazole and with 20 mM TRISeHCl buffer, were used to obtain control sensorgrams showing non-specific pH 7.9 containing 300 mM imidazole and 500 mM NaCl. binding to the surface as well as refractive index changes result- SDS-PAGE analysis of the elution fractions revealed that the ing from changes in bulk properties of the solution. Control sen- fractions contained two forms of the recombinant protein: a pro- sorgrams were subtracted from sensorgrams obtained with tein with w18 kDa molecular weight was eluted with 20 mM TRISe immobilized ligand. To correct for differences between the reaction HCl buffer, pH 7.9 containing 300 mM imidazole, while a w30 kDa and reference surfaces we have also subtracted the average of protein was eluted with 20 mM TRISeHCl buffer, pH 7.9 containing sensorgrams obtained with blank running buffer injections. 300 mM imidazol and 500 mM NaCl. The kinetic parameters for each interaction were determined by The w30 kDa protein was further purified by Sephacryl S-200 fitting the experimental data with BIAevaluation software 4.0. The chromatography in 50 mM phosphate buffer, pH 7.0 containing data were fitted to a model of 1:1 Langmuir interaction. To calculate 300 mM NaCl and stored in frozen fractions. Before use, the protein 68 V. Vásárhelyi et al. / Biochimie 97 (2014) 66e71

pCDFDuet-1a expression plasmid contains a streptomycin resistance gene for selection of positive transformants. The molecular mass calculated for the amino acid sequence of the recombinant CRISPLD2_LCCL1+2 protein containing residues Met284-Ser378 of CRISPLD2 and residues derived from the expression vector was 13,351 Da. CRISPLD2_LCCL1 E. coli JM109 cells were transformed with the ligation mixtures CRISPLD2_LCCL2 and clones containing the LCCL-domain were isolated. After sequence verification E. coli BL21(DE3) cells were transformed and Fig. 1. Domain architecture of human CRISPLD2 protein and the structure of the re- fi protein expression in 3L 2TY medium was induced with 0.1 mM combinant proteins containing its constituent LCCL-domains. The gure shows the b domain architecture of human CRISPLD2 protein defined by Pfam (http://pfam.sanger. isopropylthio- -galactoside. Inclusion bodies were dissolved in 8 M ac.uk/). The positions of the CAP-domain (residues 62e200), the two LCCL-domains urea, 100 mM TRISeHCl, 5 mM EDTA, 100 mM dithioerythritol, pH (residues 288e379 and residues 389e483) and the three recombinant proteins are 8.0 and applied on a Sephacryl S-300 column equilibrated with the drawn to scale. same buffer. Fractions were analyzed by SDS-PAGE analysis and samples containing the recombinant protein (w15 kDa) were pooled and was gel filtered on Sephadex G-25 columns equilibrated with the dialyzed two times against 3 L of 50 mM TRISeHCl buffer, pH 8.0 appropriate buffer. The N-terminal amino acid sequence of the containing 0.5 mM EDTA, 0.1 mM phenylmethanesulfonylfluoride, w30 kDa protein was found to be EAEAEFMTQVVRCDTKM, (resi- followed by dialysis against 3 L of 50 mM TRISeHCl buffer, pH 8.0. dues underlined correspond to the N-terminal sequence of CRISP- Protein precipitates were removed by centrifugation and the su- LD2_LCCL1þ2, residues in italic come from the expression vector). pernatant was applied onto a Ni-agarose column. The bound re- The relative position of the CRISPLD2_LCCL1þ2 protein within the combinant protein was eluted with 20 mM TRISeHCl buffer, pH 7.9 full-length CRISPLD2 protein is illustrated in Fig. 1. containing 300 mM imidazol and 500 mM NaCl. Fractions con- The w18 kDa protein was further purified by ion exchange taining recombinant protein were pooled, chromatographed on chromatography on a CM-Sepharose Fast Flow column equilibrated Sephacryl S-200 columns equilibrated with 50 mM phosphate with 50 mM TRISeHCl buffer, pH 7.5. The protein bound to the buffer, pH 7.0 containing 150 mM NaCl. Fractions containing pure matrix was eluted with 200 mM NaCl, 50 mM TRISeHCl pH 7.5, recombinant protein were pooled and were stored in frozen dialyzed against 0.1 M ammonium bicarbonate buffer, pH 8.0 and fractions. lyophilized. The N-terminal amino acid sequence of the w15 kDa protein is The N-terminal amino acid sequence of the w18 kDa protein MGSSHHHHHHSQDRSEFMTQVVR; residues underlined correspond was found to be MVSKVKVQ. This sequence is identical with the to residues 284e289 of CRISPLD2 protein, the residues in italic Met380 e Gln387 segment of CRISPLD2, indicating that proteolytic correspond to the N-terminal His-tag of the expression vector. The cleavage of the Phe379-Met380 bond in the interdomain region relative position of CRISPLD2_LCCL1 within the full-length separating the first and second LCCL-domains of CRISPLD2 led to CRISPLD2 protein is illustrated in Fig. 1. the production of the 18 kDa protein (CRISPLD2_LCCL2) containing the second LCCL-domain. The molecular mass calculated for the amino acid sequence of the w18 kDa protein containing residues 3. Results Met360-Gln497 of CRISPLD2 and residues derived from the expression vector was 15,491 Da. The relative position of the Studies on the interaction of lipopolysaccharide with immobi- CRISPLD2_LCCL2 protein within the full-length CRISPLD2 protein is lized LCCL-domains of CRISPLD2 protein by surface plasmon reso- illustrated in Fig. 1. nance spectroscopy revealed that both CRISPLD2_LCCL1 and CRISPLD2_LCCL2 had affinity for the endotoxin (Fig. 2, Table 1.). 2.5. Expression of the first LCCL-domain of human CRISPLD2 Assuming an effective molecular weight of 20 kDa for lipopolysaccharide (see section 2.3) the equilibrium dissociation constants The DNA encoding the first LCCL-domain of CRISPLD2 (residues for the LPS-CRISPLD2_LCCL1 and LPS-CRISPLD2_LCCL2 interaction 0 7 3 Met284-Ser378 of full-length protein) was amplified with the 5 were KD ¼ 1.48 10 M and KD ¼ 1.84 10 M, respectively. It GCCGAATTCATGACCCAAGTCGTCAGATGTG 30 forward and 50 GCCTC should be noted that CRISPLD2_LCCL1 has higher affinity for lipo- TAGAGAGCTGGAAGGTTTGTATTTGC 30 reverse primers from the polysaccharide than CRISPLD2_LCCL2. pPICZalphaA plasmid containing the two LCCL-domains of The CRISPLD2_LCCL1þ2 protein (containing both LCCL- CRISPLD2. domains) had significantly higher affinity for lipopolysaccharide The amplified DNA was digested with EcoRI and XbaI restriction than either one of the constituent domains: the equilibrium enzymes and ligated into pPICZalphaA vector digested with the dissociation constant of the LPS-CRISPLD2_LCCL1þ2 interaction is 9 same enzymes. Although integration of the expression plasmid characterized with a KD of 2.36 10 M(Table 1). Our observation into the yeast chromosome was verified by PCR, none of the P. that the two LCCL-domains cooperate in LPS-binding probably re- pastoris clones harboring the expression plasmid produced flects the fact that lipopolysaccharide is a multivalent ligand, due to detectable amount of the recombinant protein, therefore we have the formation of aggregates. constructed bacterial expression vectors for the expression of this Interestingly, CRISPLD2_LCCL1 and CRISPLD2_LCCL2 had similar protein in E. coli. affinity for the lipid A (Fig. 3, Table 2). Assuming an effective mo- The insert encoding the first LCCL-domain of CRISPLD2 was lecular weight of 1798 for lipid A the equilibrium dissociation isolated from the pPICZalphaA_CRISPLD2_LCCL1 plasmid by EcoRI constants for the LA-CRISPLD2_LCCL1 and LA-CRISPLD2_LCCL2 6 6 and SalI digestion and ligated into pCDFDuet-1a plasmid digested interaction were KD ¼ 6.84 10 M and KD ¼ 4.61 10 M, with EcoRI and XhoI (the pCDFDuet-1a plasmid was constructed respectively. from pCDFDuet-1 by BamHI digestion and blunt-end religation in The CRISPLD2_LCCL1þ2 protein (containing both LCCL- order to modify the reading frame). The resulting expression domains) had orders of magnitude higher affinity for Lipid A 10 cassette consists of the T7lac promoter, a hexahistidine His tag and (KD ¼ 3.33 10 M) than either one of the constituent domains 6 the insert encoding the first LCCL-domain of CRISPLD2. The (KD ¼ 5e7 10 M; Table 2). This observation probably indicates V. Vásárhelyi et al. / Biochimie 97 (2014) 66e71 69

Table 1 Kinetic parameters of the interaction of LPS with immobilized recombinant LCCL domains. The rate constants of the association and dissociation reactions and the equilibrium dissociation constants of the interactions were determined from surface plasmon resonance measurements with the Biaevaluation software 4.0. The rate constants of the association were calculated with the assumption that the molecular mass of LPS is 20 kDa.

Proteins KD (M) ka (1/Ms) kd (1/s) CRISPLD2_LCCL1 1.48 10 7 6.11 103 9.02 10 4 CRISPLD2_LCCL2 1.84 10 3 6 0.011 CRISPLD2_LCCL1þ2 2.36 10 9 1.34 104 3.15 10 5

determined for lipopolysaccharide and lipid A can’t be compared: a simple comparison of KD values does not tell us whether the polysaccharide moiety increases affinity for CRISPLD2_LCCL1 domain or it decreases affinity for the CRISPLD2_LCCL2 domain. Comparison of dissociation rate constants of the complexes of recombinant proteins with lipid A and lipopolysaccharide, however, does not suffer from the uncertainty of effective molecular weights of lipid A and lipopolysaccharide. Inspection of the data in Tables 1 and 2 clearly shows that the polysaccharide moiety increases the rate of dissociation by w two orders of magnitude, from 5.63 10 4/s (LA-CRISPLD2_LCCL2 complex) to 0.011/s (LPS- CRISPLD2_LCCL2 complex). In view of this observation we may conclude that in the case of the CRISPLD2_LCCL2 domain the polysaccharide moiety interferes with the proper binding of the lipid A moiety. Comparison of the dissociation rate constants of the LA- CRISPLD2_LCCL1þ2 and LPS-CRISPLD2_LCCL1þ2 complexes also indicates a negative influence of the polysaccharide-moiety: whereas the LA-CRISPLD2_LCCL1þ2 complex dissociates with a rate constant of 3.49 10 8/s the value for the LPS- CRISPLD2_LCCL1þ2 complex is a thousand-fold higher, 3.15 10 5/s. This observation indicates that the LCCL-domains of CRISPLD2 are more effective in binding the toxic lipid A moiety of the endotoxin than the lipopolysaccharide.

4. Discussion

In the present work we have shown that both LCCL-domains of human CRISPLD2 have high affinity for lipid A and that they are significantly more effective in binding the toxic lipid A moiety of the endotoxin than lipopolysaccharide. Accordingly, it seems to be more appropriate to describe CRISPLD2 as a lipid A-binding protein than a lipopolysaccharide-binding protein. Fig. 2. Characterization of the interaction of the LCCL-domains of human CRISPLD2 In view of the structure-function aspects of lipopolysaccharide with E. coli O127:B8 serotype lipopolysaccharide by surface plasmon resonance assays. this distinction may have important functional implications. Sensorgrams of the interactions of (A) CRISPLD2_LCCL1þ2 protein with lipopolysac- Lipopolysaccharides of Gram-negative bacteria are responsible charide (1.25 mg/ml, 2.5 mg/ml, 5 mg/ml, 12.5 mg/ml, 25 mg/ml, 50 mg/ml, 75 mg/ml and for a variety of biological effects associated with Gram-negative 100 mg/ml); (B), CRISPLD2_LCCL1 protein with lipopolysaccharide (50 mg/ml, 75 mg/ml 100 mg/ml, 150 mg/ml and 200 mg/ml); (C) CRISPLD2_LCCL2 protein with lipopolysac- sepsis. They contain three distinct regions: the lipid A moiety, the charide (500 mg/ml, 750 mg/ml, 1000 mg/ml, 1500 mg/ml and 2000 mg/ml). For each core region and a polysaccharide portion. The lipid A moiety is the experiment one set of representative data of three parallels are shown. For the sake of most conserved part of endotoxin, it is highly conserved in E. coli clarity the concentrations of analytes are not indicated in the panel; in each case SPR [7e9]. response increased parallel with the increase of analyte concentration. It is now well established that the lipid A moiety represents the toxic principle of endotoxic lipopolysaccharides, whereas their that lipid A is a multivalent ligand, due to the formation of more variable polysaccharide regions are primarily responsible for aggregates. their immunogenic, antigenic properties [10]. LPS is recognized by It is interesting to note that whereas the two LCCL-domains have the Toll-like receptor TLR4-MD-2 complex, lipid A is the crucial similar affinity for lipid A (Table 2), their affinities are markedly moiety in this interaction: five of the six lipid chains of lipid A are different for lipopolysaccharide (Table 1), raising the question as to inserted into a deep hydrophobic pocket of MD-2, whereas the how the polysaccharide moiety of lipopolysaccharide affects its sixth lipid chain interacts with TLR4 [11]. affinity for these LCCL-domains. Since phagocytic cells have enzymes that deacylate the toxic The effective molecular weights of lipopolysaccharide and lipid lipid A moiety of lipopolysaccharide they may detoxify it without A are unknown (see Section 2.3), therefore the KD values destroying its immunogenicity or antigenicity. As a corollary, 70 V. Vásárhelyi et al. / Biochimie 97 (2014) 66e71

Table 2 Kinetic parameters of the interaction of diphosphoryl lipid A with immobilized recombinant LCCL-domains. The rate constants of the association and dissociation reactions and the equilibrium dissociation constants of the interactions were determined from surface plasmon resonance measurements with the Biaevaluation software 4.0. The rate constants of the association were calculated with a molecular mass of 1798 Da.

Proteins KD (M) ka (1/Ms) kd (1/s) CRISPLD2_LCCL1 6.84 10 6 127 8.71 10 4 CRISPLD2_LCCL2 4.61 10 6 122 5.63 10 4 CRISPLD2_LCCL1þ2 3.33 10 10 105 3.49 10 8

gene among the genes that are induced in human airway epithelial cells by the anti-inflammatory adenosine A2B-receptor agonist Bay 60-6583 [13]. This observation suggests that the enhanced expression of CRISPLD2, a lipid A antagonist, could help reduce exacer- bations of COPD caused by infection with gram-negative bacteria. The anti-inflammatory function of CRISPLD2 protein may also have relevance for the role of CRISPLD2 (also known as LGL1) in various developmental processes. Recent studies suggest that the CRISPLD2 gene might be involved in the etiology of non-syndromic cleft lip and palate (NSCLP) [14e17]. Strong support for the involvement of the CRISPLD2 gene in the etiology of NSCLP was provided in a recent study that has shown that knock down of the crispld2 gene in zebrafish disturbed palate and jaw formation [18]. Practically nothing is known, however, as to how loss of CRISPLD2 protein might contribute to craniofacial malformations. In view of the anti-inflammatory function of CRISPLD2 protein it seems possible that mutations affecting the CRISPLD2 gene increase the risk of NSCLP since they decrease the level of this lipid A antagonist, thereby increasing the chance of inflammation caused by infection with gram-negative bacteria. According to this interpretation the role of the CRISPLD2 gene in NSCLP reflects the fact that CRISPLD2 is an anti-inflammatory protein. The observation that infection and maternal fever during early pregnancy increase the risk of NSCLP [19,20] is in harmony with this interpretation. Several studies have addressed the role of LGL1/CRISPLD2 in lung development. Oyewumi et al. [21] have shown that antisense oli- godeoxynucleotides that decrease Lgl1 mRNA and protein levels inhibit branching morphogenesis in fetal rat lung. Studies on Lgl1þ/ micehavealsoconfirmed that the Lgl1 protein is required for developmental processes that precede lung formation [22]. Lgl1þ/ mice were found to display a complex phenotype characterized by delayed histological maturation, features of inflammation in the post-natal period and altered lung mechanics at maturity. Since LGL1 Fig. 3. Characterization of the interaction of the LCCL-domains of human CRISPLD2 protein (i.e. CRISPLD2 protein) is a lipid A-binding protein it seems with diphosphoryl lipid A by surface plasmon resonance assays. Sensorgrams of the þ interactions of (A) CRISPLD2_LCCL1þ2 protein with diphosphoryl lipid A (5 mg/ml, plausible to assume that the decreased levels of the protein in Lgl1 / 9 mg/ml, 18 mg/ml, 36 mg/ml and 48 mg/ml); (B), CRISPLD2_LCCL1 protein with mice may explain their increased sensitivity to inflammation. diphosphoryl Lipid A (36 mg/ml, 72 mg/ml, 144 mg/ml and 216 mg/ml); (C) Similarly, the role of LGL1 in lung morphogenesis may also be CRISPLD2_LCCL2 protein with diphosphoryl Lipid A (72 mg/ml, 216 mg/ml and 288 mg/ related to its molecular function as a lipid A antagonist. It is now ml). For each experiment one set of representative data of three parallels are shown. well established that morphogenesis of fetal lung is severely For the sake of clarity the concentrations of analytes are not indicated in the panel; in fl e each case SPR response increased parallel with the increase of analyte concentration. affected by in ammation induced by endotoxin [23 26], therefore it seems likely that LGL1 exerts its influence on morphogenesis through the inhibition of Toll-like receptor signaling. In harmony detoxification of lipopolysaccharide without the elimination of its with this interpretation loss of Lgl1 [27] or induction of Toll- immunogenic and antigenic properties may prevent excessive in- signaling by endotoxin [26] have similar effects on fetal lung flammatory response while promoting the development of anti- development: inhibition of distal airway branching and alveolari- bacterial immunity [12]. zation through disruption of epithelialemesenchymal interactions. The fact that the LCCL-domains of CRISPLD2 are specific for the toxic lipid A moiety of the endotoxin suggests that CRISPLD2 may effectively block the interaction between endotoxins and the TLR4- Acknowledgments MD-2 complex, thereby blocking LPS-induced pro-inflammatory signaling. We note with interest that a recent study on chronic This work was supported by grant TECH_09_A1-FixPred9 of the obstructive pulmonary disease (COPD) has identified the CRISPLD2 National Office for Research and Technology of Hungary. V. Vásárhelyi et al. / Biochimie 97 (2014) 66e71 71

References A.E. Czeizel, L. Ma, B.T. Chiquet, J.T. Hecht, A.R. Vieira, M.L. Marazita, CRISPLD2 variants including a C471T silent mutation may contribute to nonsyndromic cleft lip with or without cleft palate, Cleft Palate Craniofac. J. [1] M. Trexler, L. Bányai, L. Patthy, The LCCL module, Eur. J. Biochem. 267 (2000) 48 (2011) 363e370. 5751e5757. [16] X. Shen, R.M. Liu, L. Yang, H. Wu, P.Q. Li, Y.L. Liang, X.D. Xie, T. Yao, [2] C. Claudianos, J.T. Dessens, H.E. Trueman, M. Arai, J. Mendoza, G.A. Butcher, T.T. Zhang, M. Yu, The CRISPLD2 gene is involved in cleft lip and/or cleft T. Crompton, R.E. Sinden, A malaria scavenger receptor-like protein essential palate in a Chinese population, Birth Defects Res. A Clin. Mol. Teratol. 91 for parasite development, Mol. Microbiol. 45 (2002) 1473e1484. (2011) 918e924. [3] F. Tosini, A. Agnoli, R. Mele, M.A. Gomez Morales, E. Pozio, A new modular [17] J. Shi, X. Jiao, T. Song, B. Zhang, C. Qin, F. Cao, CRISPLD2 polymorphisms are protein of Cryptosporidium parvum, with ricin B and LCCL domains, expressed associated with non-syndromic cleft lip with or without cleft palate in a in the sporozoite invasive stage, Mol. Biochem. Parasitol. 134 (2004) 137e147. northern Chinese population, Eur. J. Oral Sci. 118 (2010) 430e433. [4] F. Tosini, E. Trasarti, E. Pozio, Apicomplexa genes involved in the host cell [18] Q. Yuan, B.T. Chiquet, L. Devault, M.L. Warman, Y. Nakamura, E.C. Swindell, invasion: the Cpa135 protein family, Parassitologia 48 (2006) 105e107. J.T. Hecht, Craniofacial abnormalities result from knock down of non- [5] E. Liepinsh, M. Trexler, A. Kaikkonen, J. Weigelt, L. Bányai, L. Patthy, G. Otting, syndromic clefting gene, crispld2, in zebrafish, Genesis 50 (2012) 871e881. NMR structure of the LCCL domain and implications for DFNA9 deafness [19] M.J. Dixon, M.L. Marazita, T.H. Beaty, J.C. Murray, Cleft lip and palate: un- disorder, EMBO J. 20 (2001) 5347e5353. derstanding genetic and environmental influences, Nat. Rev. Genet. 12 (2011) [6] Z.Q. Wang, W.M. Xing, H.H. Fan, K.S. Wang, H.K. Zhang, Q.W. Wang, J. Qi, 167e178. H.M. Yang, J. Yang, Y.N. Ren, S.J. Cui, X. Zhang, F. Liu, D.H. Lin, W.H. Wang, [20] S. Shahrukh Hashmi, M.S. Gallaway, D.K. Waller, P.H. Langlois, J.T. Hecht, M.K. Hoffmann, Z.G. Han, The novel lipopolysaccharide-binding protein National Birth Defects Prevention Study, Maternal fever during early preg- CRISPLD2 is a critical serum protein to regulate endotoxin function, nancy and the risk of oral clefts, Birth Defects Res. A Clin. Mol. Teratol. 88 J. Immunol. 183 (2009) 6646e6656. (2010) 186e194. [7] C. Erridge, E. Bennett-Guerrero, I.R. Poxton, Structure and function of lipo- [21] L. Oyewumi, F. Kaplan, S. Gagnon, N.B. Sweezey, Antisense oligodeox- polysaccharides, Microbes Infect. 4 (2002) 837e851. ynucleotides decrease LGL1 mRNA and protein levels and inhibit branching [8] R. Stenutz, A. Weintraub, G. Widmalm, The structures of Escherichia coli O- morphogenesis in fetal rat lung, Am. J. Respir. Cell Mol. Biol. 28 (2003) polysaccharide antigens, FEMS Microbiol. Rev. 30 (2006) 382e403. 232e240. [9] P.O. Magalhães, A.M. Lopes, P.G. Mazzola, C. Rangel-Yagui, T.C. Penna, [22] J. Lan, L. Ribeiro, I. Mandeville, K. Nadeau, T. Bao, S. Cornejo, N.B. Sweezey, A. Pessoa Jr., Methods of endotoxin removal from biological preparations: a F. Kaplan, Inflammatory cytokines, goblet cell hyperplasia and altered lung review, J. Pharm. Pharm. Sci. 10 (2007) 388e404. mechanics in Lgl1þ/- mice, Respir. Res. 10 (2009) 83. [10] L. Gabrielli, A. Capitoli, D. Bini, F. Taraballi, C. Lupo, L. Russo, L. Cipolla, Recent [23] C.S. Muratore, F.I. Luks, Y. Zhou, M. Harty, J. Reichner, T.F. Tracy, Endotoxin approaches to novel antibacterials designed after LPS structure and alters early fetal lung morphogenesis, J. Surg. Res. 155 (2009) 225e230. biochemistry, Curr. Drug Targets 13 (2012) 1458e1471. [24] T.S. Blackwell, A.N. Hipps, Y. Yamamoto, W. Han, W.J. Barham, M.C. Ostrowski, [11] B.S. Park, D.H. Song, H.M. Kim, B.S. Choi, H. Lee, J.O. . Lee, The structural basis F.E. Yull, L.S. Prince, NF-kB signaling in fetal lung macrophages disrupts airway of lipopolysaccharide recognition by the TLR4-MD-2 complex, Nature 458 morphogenesis, J. Immunol. 187 (2011) 2740e2747. (2009) 1191e1195. [25] T.J. Benjamin, B.J. Carver, E.J. Plosa, Y. Yamamoto, J.D. Miller, J.H. Liu, R. van der [12] R.S. Munford, How do animal phagocytes process bacterial lipopolysaccha- Meer, T.S. Blackwell, L.S. Prince, NF-kappaB activation limits airway branching rides? APMIS 99 (1991) 487e491. through inhibition of Sp1-mediated fibroblast growth factor-10 expression, [13] S. Greer, C.W. Page, T. Joshi, D. Yan, R. Newton, M.A. Giembycz, Concurrent J. Immunol. 185 (2010) 4896e4903. agonism of adenosine A2B- and glucocorticoid receptors in human airway [26] L.S. Prince, H.I. Dieperink, V.O. Okoh, G.A. Fierro-Perez, R.L. Lallone, Toll-like epithelial cells cooperatively induces genes with anti-inflammatory potential: receptor signaling inhibits structural development of the distal fetal mouse a novel approach to treat COPD, J. Pharmacol. Exp. Ther. (2013 Jul 2) (Epub lung, Dev. Dyn. 233 (2005) 553e561. ahead of print). [27] L. Oyewumi, F. Kaplan, N.B. Sweezey, Lgl1, a mesenchymal modulator of early [14] B.T. Chiquet, A.C. Lidral, S. Stal, J.B. Mulliken, L.M. Moreno, M. Arcos-Burgos, lung branching morphogenesis, is a secreted glycoprotein imported by late C. Valencia-Ramirez, S.H. Blanton, J.T. Hecht, CRISPLD2: a novel NSCLP gestation lung epithelial cells, Biochem. J. 376 (2003) 61e69. candidate gene, Hum. Mol. Genet. 16 (2007) 2241e2248. [15] A. Letra, R. Menezes, M.E. Cooper, R.F. Fonseca, S. Tropp, M. Govil, J.M. Granjeiro, S.R. Imoehl, M.A. Mansilla, J.C. Murray, E.E. Castilla, I.M. Orioli,