DOCSLIB.ORG

Full A-Z List of Genetic Tests Document Reference Number: 413.001

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Sheffield Children’s NHS Foundation Trust Department: Sheffield Diagnostic Genetics Service Title: Full A-Z List of Genetic Tests Document reference number: 413.001 Full A-Z List of Genetic Tests SHEFFIELD DIAGNOSTIC GENETICS SERVICE You can search for a test by typing into the ‘Find’ facility in the toolbar above and pressing enter. Click the ‘Find next’ icon to locate multiple entries within the document. *Gene content for Next Generation Sequencing (NGS) panels can be referenced at: https://www.sheffieldchildrens.nhs.uk/sdgs/next-generation-sequencing/ FISH tests listed under “F” starting with constitutional FISH tests listed by chromosome number 1-22,X,Y, followed by oncology FISH tests listed A-Z by gene name. ** Our turnaround times are listed here based on the recommendations of the Association for Clinical Genetic Science (http://www.acgs.uk.com/media/949852/acgs_general_genetic_laboratory_reporting_recommendations_2015.pdf) and are in calendar days. These may be altered locally based on specific Service Level Agreement or clinical urgency. Turnaround Test Specimen Type Volume Notes/Comments Time** Achondroplasia, hypchondroplasia and Blood 0.5-5ml 2-6 weeks thanatophoric dysplasia 0.25-1ml BM in 5-10ml of Acute Lymphoblastic Leukaemia Bone marrow/ transport medium 14 days (ALL) + FISH leukaemic blood OR 1ml BM/VB in Li Hep 0.25-1ml BM in 5-10ml of Acute Myeloid Leukaemia (AML) (+/- Bone marrow/ transport medium 14 days FISH) leukaemic blood OR 1ml BM/VB in Li Hep Adrenoleukodystrophy (ALD) Blood 0.5-5ml EDTA 2-6 weeks (X-linked) ALK Breakapart FISH (2p23) for lung PETS 2x4µm 7 days cancer – FISH only sections on slides Alpha thalassaemia Blood 0.5-5ml EDTA 2-4 weeks Alport Syndrome sequencing panel Blood 0.5-5ml EDTA 2-6 Weeks Alveolar rhabdomyosarcoma – FISH PETS 2x4µm 14 days only sections on slides Anaplastic large cell lymphoma, ALK PETS 2x4µm 21 days positive – FISH only sections on slides Androgen Insensitivity Syndrome Blood 0.5-5ml EDTA 2-6 weeks (Testicular Feminisation) Antithrombin Deficiency Blood 0.5-5ml EDTA 2-6 weeks 10-20ml sterile universal / Amniotic fluid / Aneuploidy Detection QF-PCR 3-4 fronds sterile universal in 3 days chorionic villus CVS culture medium Amniotic fluid Aneuploidy FISH test 2-5ml in sterile universal 2-3 days sample Apolipoprotein E (APOE) ) / Type III Blood 0.5-5ml EDTA 4 weeks Hyperlipoproteinaemia – E2 allele Array CGH (see microarray) - - - Ataxia Next Generation Sequencing panel (Please see Hereditary Ataxia - - - panel) Known mutations 10-20ml sterile universal / only, in Ataxia telangiectasia/ATR-Seckel Amniotic fluid / collaboration with 3-4 fronds sterile universal in 3 days syndrome prenatal testing chorionic villus Institute of Cancer CVS culture medium Studies, Birmingham Date of issue: 21/12/20 Version number: 22 Author: Sarah Aspey Authorised by: Richard Kirk Page 1 of 13 Sheffield Children’s NHS Foundation Trust Department: Sheffield Diagnostic Genetics Service Title: Full A-Z List of Genetic Tests Document reference number: 413.001 Bernard-Soulier syndrome (GP1BA, Blood 0.5-5ml EDTA 2-6 weeks GB1BB, GP9) Blood / Bone Send to Lab BCR-ABL1 Quantitation (RQ-PCR) 0.5-5ml EDTA 14 days marrow immediately BCR-ABL1 Tyrosine kinase domain Blood / Bone Send to Lab 0.5-5ml EDTA 21 days (TKD) analysis (Sanger sequencing) marrow immediately Beta thalassaemia Blood 0.5-5ml EDTA 2-4 weeks PETS 2x4µm Bladder cancer –FISH only 21 days sections on slides Inform lab prior to Blooms syndrome Blood 3-4ml Li Hep 28 days sample dispatch Bone marrow failure Next Generation Sequencing panel* - Diamond-Blackfan anaemia - Dyskeratosis congenital *see website for - Fanconi anaemia panel content. Blood 0.5-5ml EDTA 6-12 weeks - Myelodysplastic syndrome Sub-panels - Severe congenital available neutropenia - Thrombocytopenia with absent radii BRAF (V-raf murine sarcoma viral PETS 8x10µm oncogenes homolog B1) mutations sections in 7 days affecting codon 600 in melanoma and universal colorectal cancer 6 weeks full Hereditary Breast & Ovarian Cancer screen, 2 *see website for (BRCA1, BRCA2 & PALB2) Next Blood 0.5-5ml EDTA weeks panel content Generation Sequencing* & MLPA predictive PETS 2x4µm Contact Lab prior to Breast Cancer (Her2) - FISH only 7 days sections on slides referral Hereditary Breast & Ovarian Cancer *see website for Blood 0.5-5ml EDTA 12 weeks Extended Gene Panel* panel content Bruck syndrome (PLOD2) Blood 0.5-5ml EDTA 2-6 weeks PETS 2x4µm Burkitt lymphoma –FISH only 21 days sections on slides CALR Exon 9 mutation screen Blood/Bone marrow 0.5-5ml EDTA 2 weeks Carnitine Acylcarnitine Translocase Blood or 0.5-5ml EDTA 2-6 weeks (CACT) Deficiency Fibroblasts Carnitine Palmitoyl Transferase Type2 (CPT2) Deficency Blood or - c.338C>T p.Ser113Leu 0.5-5ml EDTA 2-6 weeks Fibroblasts common mutation - Full sequencing Cartilage-associated protein (CRTAP) Blood 0.5-5ml EDTA 2-8 weeks -autosomal recessive OI. Cerebral AD Arteriopathy with Subcortical Infarcts & Blood 0.5-5ml EDTA 2-6 weeks Leukoencephalopathy (CADASIL) CGH/microarray –see microarray - - - Chimerism post bone marrow/stem 0.5-5ml EDTA cell transplant (Sex matched/ Blood/Bone marrow (see below if lineage-specific 7 days Powerplex) analysis required) Date of issue: 21/12/20 Version number: 22 Author: Sarah Aspey Authorised by: Richard Kirk Page 2 of 13 Sheffield Children’s NHS Foundation Trust Department: Sheffield Diagnostic Genetics Service Title: Full A-Z List of Genetic Tests Document reference number: 413.001 Chimerism post bone marrow/stem 2-3ml Li Hep cell transplant (Sex mis-matched Blood/Bone marrow (see below if lineage-specific 7 days (FISH)) analysis required) Chimerism if lineage-specific analysis 0.5-1ml EDTA required (MACS separated fraction Blood only 7 days (IN ADDITION TO ABOVE) e.g. CD3+) Blood preferable Chimerism Pre transplant DNA but other samples 0.5-5ml EDTA - storage (donor or recipient) can be processed e.g. buccal swabs Chromosome – Adult (with or without Blood 2-3ml Li Hep 28 days FISH) Chromosome – Child (with or without Blood 1-2ml Li Hep 28 days FISH) * smaller samples can be attempted Chromosome – Neonate Blood 0.5 – 1ml* Li Hep 10 days but may reduce the likelihood of a successful result Chromosome (with or without FISH) Amniotic Fluid 10-20ml sterile universal 14 days PRENATAL sample Chromosome (with or without FISH) 3-4 fronds sterile universal in CVS 14 days PRENATAL CVS culture medium Chromosome (with or without FISH) Fetal blood 0.5-1ml Li Hep 10 days PRENATAL cordocentesis Chromosome (with or without FISH) Cord blood 1-3ml Li Hep 10 days POSTNATAL Placental biopsy at See our “additional cord insertion site, information” page Chromosome (with or without FISH) <1cm cubed Sterile tissue fetal membrane, 28 days for information FETAL LOSS culture medium pots villi and cord regarding sending biopsies samples 1-2mm cubed Chromosome (with or without FISH) Skin biopsy Sterile tissue culture medium 2-3 weeks pots Solid Tumour <1cm cubed Universal with 5- Chromosome (with or without FISH) 21 days Biopsy 10ml of transport medium Universal with 5-10ml of Chronic Lymphoproliferative Bone marrow/ transport medium 21 days Leukaemia (CLL) –FISH leukaemic blood OR BM/VB Li Hep If blood ONLY then FISH result will be Chronic Myeloid Leukaemia (CML) 0.25-1ml BM in 5-10ml of Bone marrow issued and bone Karyotyping &/or BCR-ABL1 FISH (at transport medium 7 days /leukaemic blood marrow sample diagnosis) OR 1ml BM/VB in Li Hep requested for karyotyping Chronic Myeloid Leukaemia (CML) 0.25-1ml BM in 5-10ml of Bone marrow Karyotyping &/or BCR-ABL1 FISH transport medium 14 days /leukaemic blood (monitoring) OR 1ml BM/VB in Li Hep Collagen 6 related myopath panel Blood 0.5-5ml EDTA 2-6 Weeks Colorectal Cancer (HNPCC/FAP) *see website for Blood 0.5-5ml EDTA 12 weeks Extended Gene Panel* panel content *see website for Connective Tissue Disorders Next panel content Blood 0.5-5ml EDTA 12 weeks Generation Sequencing Panel Sub-panels available Congenital thrombotic Blood 0.5-5ml EDTA 2-6 weeks thrombocytopenic purpura Date of issue: 21/12/20 Version number: 22 Author: Sarah Aspey Authorised by: Richard Kirk Page 3 of 13 Sheffield Children’s NHS Foundation Trust Department: Sheffield Diagnostic Genetics Service Title: Full A-Z List of Genetic Tests Document reference number: 413.001 (ADAMTS13 deficiency) 2-6 weeks Crigler-Najjar Syndrome types I and II Blood 0.5-5ml EDTA cfDNA testing for EGFR mutations Peripheral blood 10ml PB in Streck/Paxgene 7 days Preservative tubes (Relapse or diagnostic) preservative tubes can be supplied by the laboratory if required. Contact lab prior to sending Cutis Laxa sequencing panel Blood 0.5-5ml EDTA 2-6 weeks Blood or Dried Cystic fibrosis – 50-mutatIon panel 0.5-5ml EDTA 2 weeks bloodspots Cystic fibrosis – newborn screening - 4-mutation and 50-mutation Dried bloodspots 0.5-5ml EDTA 4 days panels Cystic fibrosis – newborn screening NGS pilot study Dried bloodspots 0.5-5ml EDTA 4 days - NGS panel (332 mutations) Dementia Next Generation * see website for Blood 0.5-5ml EDTA 12 weeks Sequencing Panel* panel content Dentatorubral-pallidoluysian atrophy Blood 0.5-5ml EDTA 4 weeks (DRPLA) Dermatofibrosarcoma protuberans – PETS 4x4µm 21 days FISH only sections on slides Diamond Blackfan Anaemia (RPS19) Blood 0.5-5ml EDTA 2-8 weeks Diamond Blackfan Anaemia (dosage Blood 0.5-5ml EDTA 8 weeks testing by MLPA) Dopa-responsive dystonia (Segawa Blood 0.5-5ml EDTA 2-8 weeks syndrome), dominant DYPD Blood 3-5mL EDTA 3 days Dystonia and Parkinsonism Next *see website for Blood 0.5-5ml EDTA 12 weeks
Recommended publications
  • Familial Intellectual Disability As a Result of a Derivative Chromosome

    Familial Intellectual Disability As a Result of a Derivative Chromosome

    Zhang et al. Molecular Cytogenetics (2018) 11:18 DOI 10.1186/s13039-017-0349-x RESEARCH Open Access Familial intellectual disability as a result of a derivative chromosome 22 originating from a balanced translocation (3;22) in a four generation family Kaihui Zhang1†, Yan Huang2†, Rui Dong1†, Yali Yang2, Ying Wang1, Haiyan Zhang1, Yufeng Zhang1, Zhongtao Gai1* and Yi Liu1* Abstract Background: Balanced reciprocal translocation is usually an exchange of two terminal segments from different chromosomes without phenotypic effect on the carrier while leading to increased risk of generating unbalanced gametes. Here we describe a four-generation family in Shandong province of China with at least three patients sharing severe intellectual disability and developmental delay resulting from a derivative chromosome 22 originating from a balanced translocation (3;22) involving chromosomes 3q28q29 and 22q13.3. Methods: The proband and his relatives were detected by using karyotyping, chromosome microarray analysis, fluorescent in situ hybridization and real-time qPCR. Results: The proband, a 17 month-old boy, presented with severe intellectual disability, developmental delay, specific facial features and special posture of hands. Pedigree analysis showed that there were at least three affected patients. The proband and other two living patients manifested similar phenotypes and were identified to have identically abnormal cytogenetic result with an unbalanced translocation of 9.0 Mb duplication at 3q28q29 and a 1.7Mb microdeletion at 22q13.3 by karyotyping and chromosome microarray analysis. His father and other five relatives had a balanced translocation of 3q and 22q. Fluorescence in situ hybridization and real-time qPCR definitely validated the results.
  • ZNF44 (NM 016264) Human Tagged ORF Clone Product Data

    ZNF44 (NM 016264) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC224254 ZNF44 (NM_016264) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ZNF44 (NM_016264) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ZNF44 Synonyms: GIOT-2; KOX7; ZNF; ZNF55; ZNF58; ZNF504 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 ZNF44 (NM_016264) Human Tagged ORF Clone – RC224254 ORF Nucleotide >RC224254 representing NM_016264 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCAGTGGCCTTTGAGGATGTGGCTGTGAACTTCACCCATGAGGAGTGGGCTTTGCTGGGTCCAT CACAGAAGAATCTCTACAGAGATGTGATGCGAGAAACCATTAGGAACCTGAACTGTATAGGAATGAAATG GGAAAACCAGAACATTGATGATCAGCACCAAAATCTCAGGAGAAATCCAAGGTGTGATGTGGTAGAGAGA TTTGGTAAAAGTAAAGATGGTAGTCAGTGTGGAGAAACCTTAAGCCAGATTCGAAATAGTATTGTAAACA AGAACACTCCCGCCAGAGTAGATGCATGTGGAAGCAGTGTGAATGGAGAAGTCATAATGGGTCATTCATC CCTGAATTGCTACATCAGAGTTGATACTGGACACAAACACCGGGAGTGTCATGAATATGCAGAGAAGTCA TATACACATAAGCAGTGTGGGAAAGGCTTAAGTTATCGCCACTCCTTTCAAACATGTGAAAGGCCTCACA CTGGAAAGAAACCCTATGATTGTAAGGAATGTGGAAAAACCTTCAGTTCTCCTGGAAACCTTCGAAGACA TATGGTAGTAAAAGGTGGAGATGGACCTTATAAATGTGAATTGTGTGGGAAAGCCTTTTTTTGGCCCAGT
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • 3 Chromosome Chapter

    3 Chromosome Chapter

    Chromosome 3 ©Chromosome Disorder Outreach Inc. (CDO) Technical genetic content provided by Dr. Iosif Lurie, M.D. Ph.D Medical Geneticist and CDO Medical Consultant/Advisor. Ideogram courtesy of the University of Washington Department of Pathology: ©1994 David Adler.hum_03.gif Introduction The size of chromosome 3 is ~200 Mb. Within this chromosome, there are thousands of genes, many of which are necessary for normal intellectual development or involved in the formation of body organs. Deletions of Chromosome 3 The length of the short arm of chromosome 3 is ~90 Mb. Most known deletions of 3p are caused by the loss of its distal 15 Mb segment (3p25–pter). Deletions of the more proximal segments are relatively rare; there are only ~50 reports on such patients. Therefore, it would be premature to talk about any syndrome related to deletions of the proximal part of 3p. The location of the breakpoints, size of deletion, and reported abnormalities are different in most described patients. However, recurrent aortal stenosis in patients with deletion 3p11p14.2, abnormal lung lobation in patients with deletion 3p12p14.2, agenesis or hypoplasia of the corpus callosum in patients with deletion 3p13, microphthalmia and coloboma in patients with deletion 3p13p21.1, choanal atresia and absent gallbladder in patients with deletion 3p13p21, and hearing loss in patients with deletion 3p14 are all indicators that the above–mentioned segments likely contain genes involved in the formation of these systems. Deletions of 3p Deletion of 3p25–pter The most distal segment of the short arm of chromosome 3 is 3p26 and spans ~8 Mb.
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Abbott Molecular Oncology and Genetics 2016 U.S

    Abbott Molecular Oncology and Genetics 2016 U.S

    DESCRIPTOR, 9/12, ALL CAPS ABBOTT MOLECULAR ONCOLOGY AND GENETICS 2016 U.S. Product Catalog Area for placed imagery Only use imagery that is relevant to the communication CHOOSE TRANSFORMATION See where it will take you at AbbottMolecular.com 2 ASR Analyte Specific Reagent GPR General Purpose Reagent IVD In Vitro Diagnostic RUO Research Use Only All products manufactured and/or distributed by Abbott Molecular should be used in accordance with the products’ labeled intended use. Products labeled “Research Use Only” should be used for research applications, and are not for use in diagnostic procedures. CEP, LSI, AneuVysion, MultiVysion, PathVysion and Vysis are registered trademarks of Vysis, Inc., AutoVysion, ProbeChek, SpectrumAqua, SpectrumBlue, SpectrumGreen, SpectrumGold, SpectrumOrange, SpectrumRed, SpectrumFRed, TelVysion, ToTelVysion, UroVysion and VP 2000 are trademarks of Abbott Molecular in various jurisdictions. All other trademarks are the property of their respective owners. 3 Abbott Molecular is Transforming Laboratory Partnerships and Productivity—Today and into the Future As a leader in molecular diagnostics, Our commitment to exploring new clinical frontiers is evident in the development and delivery of innovative systems and Abbott is committed to providing assay solutions that aid physicians in the diagnosis of disease, selection of therapies and monitoring of disease. solution-oriented oferings built The new product oferings in this catalog and those coming on FISH and PCR. Building on throughout the remainder of 2016 have been designed in partnership with laboratories, directly incorporating the a proven track record of service feedback we’ve gathered from you. These options expand the Vysis FISH portfolio and increase productivity by to the worldwide community of driving improvements in laboratory efciency and enabling researchers and clinicians, Abbott customization of solutions on a lab by lab basis.
  • See Shalini C Reshmi's Curriculum Vitae

    See Shalini C Reshmi's Curriculum Vitae

    Shalini C. Reshmi, Ph.D. Contact Information: Institute for Genomic Medicine Nationwide Children’s Hospital 575 Childrens Crossroads, RB3-WB2233 Columbus, OH 43215 Lab: (614) 722-5321 Fax: (614) 355-6833 [email protected] CURRENT ACADEMIC POSITIONS 2/2018-present Assistant Professor, Department of Pediatrics, The Ohio State University, Columbus, OH 7/2009-present Assistant Professor (Clinical), Department of Pathology, The Ohio State University, Columbus, OH ADMINISTRATIVE APPOINTMENT 10/2016-present Director, Clinical Laboratory Institute for Genomic Medicine Nationwide Children's Hospital, Columbus, OH 9/2012-10/2016 Associate Director, Cytogenetics/Molecular Genetics Laboratory Nationwide Children's Hospital, Columbus, OH 12/2008-9/2012 Assistant Director, Cytogenetics/Molecular Genetics Laboratory Nationwide Children's Hospital, Columbus, OH EDUCATION 9/2001-5/2005 Ph.D. Human Genetics University of Pittsburgh, Graduate School of Public Health Pittsburgh, PA 9/1994-4/1996 M.S. Human Genetics University of Pittsburgh, Graduate School of Public Health Pittsburgh, PA 8/1988-5/1992 B.S. Biology The Catholic University of America Washington, D.C. TRAINING 7/2007-10/2008 American College of Medical Genetics and Genomics Clinical Molecular Genetics University of Chicago, Pritzker School of Medicine Chicago, IL 7/2005-6/2007 American College of Medical Genetics and Genomics Clinical Cytogenetics University of Chicago, Pritzker School of Medicine Chicago, IL Board Certifications 2 9/01/09- Diplomate, American Board of
  • Cytogenetic Abnormalities in 772 ... -.: Scientific Press International Limited

    Cytogenetic Abnormalities in 772 ... -.: Scientific Press International Limited

    Journal of Applied Medical Sciences, vol. 3, no. 3, 2014, 19-29 ISSN: 2241-2328 (print version), 2241-2336 (online) Scienpress Ltd, 2014 Cytogenetic Abnormalities in 772 Patients with Mental Retardation (MR) in Southern Region of Turkey: Report and Review Osman Demirhan1*, Nilgün Tanrıverdi1, Erdal Tunç1, Dilara Süleymanova1 and Deniz Taştemir2 Abstract Mental retardation (MR) is a heterogeneous condition, affecting 1-3% of general population. Identification of chromosomal abnormalities (CAs) associated with mental disorders may be especially important given the unknown pathophysiology and the probable genetic heterogeneity of MR. In this study, we aimed to evaluate karyotype results of 772 MR cases, retrospectively. For karyotyping, standard lymphocyte culturing and GTG banding methods were done. For analysis, cytovision software was used. In result, out of 772 MR cases, 87 cases showed abnormal chromosomal constitutions (11.3%), and normal karyotype results were detected in 88.7% of all patients. Numerical and structural CAs were detected in 2.6% (20 of 772) and 8.7 (67 of 772) of cases, respectively. This study revealed Down syndrome as the most common chromosomal abnormality (1%). The ratio of X chromosome monosomy was 0.6%. In conclusion, patients with MR should be routinely karyotyped. Interesting CAs we found, may harbor important genes for MR and give important tips for linkage in possible genome scan projects. Keywords: Chromosomal abnormalities, GTG-banding, karyotype, MR 1 Introduction MR is the most frequent cause of serious handicap in children and young adults with an estimated prevalence up to 1-3% of the population, and is one of the more important topics in medical science [1,2].
  • Supplementary Table 3 Gene Microarray Analysis: PRL+E2 Vs

    Supplementary Table 3 Gene Microarray Analysis: PRL+E2 Vs

    Supplementary Table 3 Gene microarray analysis: PRL+E2 vs. control ID1 Field1 ID Symbol Name M Fold P Value 69 15562 206115_at EGR3 early growth response 3 2,36 5,13 4,51E-06 56 41486 232231_at RUNX2 runt-related transcription factor 2 2,01 4,02 6,78E-07 41 36660 227404_s_at EGR1 early growth response 1 1,99 3,97 2,20E-04 396 54249 36711_at MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F 1,92 3,79 7,54E-04 (avian) 42 13670 204222_s_at GLIPR1 GLI pathogenesis-related 1 (glioma) 1,91 3,76 2,20E-04 65 11080 201631_s_at IER3 immediate early response 3 1,81 3,50 3,50E-06 101 36952 227697_at SOCS3 suppressor of cytokine signaling 3 1,76 3,38 4,71E-05 16 15514 206067_s_at WT1 Wilms tumor 1 1,74 3,34 1,87E-04 171 47873 238623_at NA NA 1,72 3,30 1,10E-04 600 14687 205239_at AREG amphiregulin (schwannoma-derived growth factor) 1,71 3,26 1,51E-03 256 36997 227742_at CLIC6 chloride intracellular channel 6 1,69 3,23 3,52E-04 14 15038 205590_at RASGRP1 RAS guanyl releasing protein 1 (calcium and DAG-regulated) 1,68 3,20 1,87E-04 55 33237 223961_s_at CISH cytokine inducible SH2-containing protein 1,67 3,19 6,49E-07 78 32152 222872_x_at OBFC2A oligonucleotide/oligosaccharide-binding fold containing 2A 1,66 3,15 1,23E-05 1969 32201 222921_s_at HEY2 hairy/enhancer-of-split related with YRPW motif 2 1,64 3,12 1,78E-02 122 13463 204015_s_at DUSP4 dual specificity phosphatase 4 1,61 3,06 5,97E-05 173 36466 227210_at NA NA 1,60 3,04 1,10E-04 117 40525 231270_at CA13 carbonic anhydrase XIII 1,59 3,02 5,62E-05 81 42339 233085_s_at OBFC2A oligonucleotide/oligosaccharide-binding
  • Single Cell Transcriptomics in Schizophrenia Postmortem Brain: Moving Beyond Bulk Lysate

    Single Cell Transcriptomics in Schizophrenia Postmortem Brain: Moving Beyond Bulk Lysate

    SINGLE CELL TRANSCRIPTOMICS IN SCHIZOPHRENIA POSTMORTEM BRAIN: MOVING BEYOND BULK LYSATE Richard Crist June 8th, 2020 Schizophrenia Transcriptomics ■ Microarray and RNA sequencing ■ Differentially expressed genes across many cortical and sub-cortical regions – Dorsolateral prefrontal cortex (dlPFC) (Fillman et al, 2013) – Anterior Cingulate Cortex (Zhao et al, 2015; Hong et al, 2013) – Superior temporal gyrus (Wu et al, 2012) – Hippocampus (Hwang et al, 2013; Kohen et al, 2014) – Amygdala (Chang et al, 2017) ■ Enrichment of pathways and gene networks – Neural development – Axon guidance – Inflammation and immune-related proteins CommonMind Consortium ■ Largest transcriptomic analysis of schizophrenia – 258 cases/279 controls – RNAseq in dlPFC ■ 693 differentially expressed genes Fromer et al, 2016 Cell Diversity in Postmortem Brain ■ Brain, like all tissues, consists of many cell types – Major cell populations (e.g. astrocytes) – Distinct sub-populations (e.g. PVALB+ interneurons) ■ Problems in assessing differential expression in bulk lysate – Inability to identify which cells are affected – Missed expression changes in less common cell types Penney et al, 2019 Schizophrenia Single Cell Transcriptomics ■ Immunofluorescence and laser capture microdissection to collect individual populations of cells ■ Layer III/V pyramidal neurons (Arion et al, 2017) – 72 PFC samples – 36 cases/36 controls – 100 cells per layer for each sample – Expression assessed by microarray – 1,783 differentially expressed probe sets corresponding to 1,420 genes
  • Targeted Sequence Capture and Ultra High Throughput Sequencing for Gene Discovery in Inherited Diseases

    Targeted Sequence Capture and Ultra High Throughput Sequencing for Gene Discovery in Inherited Diseases

    Unicentre CH-1015 Lausanne http://serval.unil.ch Year : 2013 Targeted sequence capture and Ultra High Throughput sequencing for gene discovery in inherited diseases Dl GIOIA SILVIO ALESSANDRO Dl GIOIA SILVIO ALESSANDRO, 2013, Targeted sequence capture and Ultra High Throughput sequencing for gene discovery in inherited diseases Originally published at : Thesis, University of Lausanne Posted at the University of Lausanne Open Archive. http://serval.unil.ch Droits d’auteur L'Université de Lausanne attire expressément l'attention des utilisateurs sur le fait que tous les documents publiés dans l'Archive SERVAL sont protégés par le droit d'auteur, conformément à la loi fédérale sur le droit d'auteur et les droits voisins (LDA). A ce titre, il est indispensable d'obtenir le consentement préalable de l'auteur et/ou de l’éditeur avant toute utilisation d'une oeuvre ou d'une partie d'une oeuvre ne relevant pas d'une utilisation à des fins personnelles au sens de la LDA (art. 19, al. 1 lettre a). A défaut, tout contrevenant s'expose aux sanctions prévues par cette loi. Nous déclinons toute responsabilité en la matière. Copyright The University of Lausanne expressly draws the attention of users to the fact that all documents published in the SERVAL Archive are protected by copyright in accordance with federal law on copyright and similar rights (LDA). Accordingly it is indispensable to obtain prior consent from the author and/or publisher before any use of a work or part of a work for purposes other than personal use within the meaning of LDA (art. 19, para.
  • The Effect of Compound L19 on Human Colorectal Cells (DLD-1)

    The Effect of Compound L19 on Human Colorectal Cells (DLD-1)

    Stephen F. Austin State University SFA ScholarWorks Electronic Theses and Dissertations Spring 5-16-2018 The Effect of Compound L19 on Human Colorectal Cells (DLD-1) Sepideh Mohammadhosseinpour [email protected] Follow this and additional works at: https://scholarworks.sfasu.edu/etds Part of the Biotechnology Commons Tell us how this article helped you. Repository Citation Mohammadhosseinpour, Sepideh, "The Effect of Compound L19 on Human Colorectal Cells (DLD-1)" (2018). Electronic Theses and Dissertations. 188. https://scholarworks.sfasu.edu/etds/188 This Thesis is brought to you for free and open access by SFA ScholarWorks. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of SFA ScholarWorks. For more information, please contact [email protected]. The Effect of Compound L19 on Human Colorectal Cells (DLD-1) Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 4.0 License. This thesis is available at SFA ScholarWorks: https://scholarworks.sfasu.edu/etds/188 The Effect of Compound L19 on Human Colorectal Cells (DLD-1) By Sepideh Mohammadhosseinpour, Master of Science Presented to the Faculty of the Graduate School of Stephen F. Austin State University In Partial Fulfillment Of the Requirements For the Degree of Master of Science in Biotechnology STEPHEN F. AUSTIN STATE UNIVERSITY May, 2018 The Effect of Compound L19 on Human Colorectal Cells (DLD-1) By Sepideh Mohammadhosseinpour, Master of Science APPROVED: Dr. Beatrice A. Clack, Thesis Director Dr. Josephine Taylor, Committee Member Dr. Rebecca Parr, Committee Member Dr. Stephen Mullin, Committee Member Pauline Sampson, Ph.D.