DOCSLIB.ORG

Targeted Sequence Capture and Ultra High Throughput Sequencing for Gene Discovery in Inherited Diseases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Targeted Sequence Capture and Ultra High Throughput Sequencing for Gene Discovery in Inherited Diseases Unicentre CH-1015 Lausanne http://serval.unil.ch Year : 2013 Targeted sequence capture and Ultra High Throughput sequencing for gene discovery in inherited diseases Dl GIOIA SILVIO ALESSANDRO Dl GIOIA SILVIO ALESSANDRO, 2013, Targeted sequence capture and Ultra High Throughput sequencing for gene discovery in inherited diseases Originally published at : Thesis, University of Lausanne Posted at the University of Lausanne Open Archive. http://serval.unil.ch Droits d’auteur L'Université de Lausanne attire expressément l'attention des utilisateurs sur le fait que tous les documents publiés dans l'Archive SERVAL sont protégés par le droit d'auteur, conformément à la loi fédérale sur le droit d'auteur et les droits voisins (LDA). A ce titre, il est indispensable d'obtenir le consentement préalable de l'auteur et/ou de l’éditeur avant toute utilisation d'une oeuvre ou d'une partie d'une oeuvre ne relevant pas d'une utilisation à des fins personnelles au sens de la LDA (art. 19, al. 1 lettre a). A défaut, tout contrevenant s'expose aux sanctions prévues par cette loi. Nous déclinons toute responsabilité en la matière. Copyright The University of Lausanne expressly draws the attention of users to the fact that all documents published in the SERVAL Archive are protected by copyright in accordance with federal law on copyright and similar rights (LDA). Accordingly it is indispensable to obtain prior consent from the author and/or publisher before any use of a work or part of a work for purposes other than personal use within the meaning of LDA (art. 19, para. 1 letter a). Failure to do so will expose offenders to the sanctions laid down by this law. We accept no liability in this respect. Département de Génetique Médicale Targeted sequence capture and Ultra High Throughput sequencing for gene discovery in inherited diseases Thèse de doctorat en science de la vie (PhD) Présentée à la Faculté de biologie e médicine de l’Université de Lausanne par SILVIO ALESSANDRO DI GIOIA Diplômé en Biotechnologie Mèdicale, Université de Rome “Sapienza", Italie Jury Prof. Luc PELLERIN, president Dr. Carlo RIVOLTA, thesis director Prof. Anneke DEN HOLLANDER, expert Prof. Christian GRIMM, expert Lausanne, 2013 ACKNOWLEDGMENTS It is not easy to enclose in few words four year-path of professional and personal enrichment. These were wonderful years: each person I met would deserve an entire book. For space reason I shall limit my acknowledgments, although I aware they do not constitute an exhaustive list of all the person I happened to meet and admire during my PhD years. To them, first, this thesis is dedicated. To Dr. Carlo Rivolta, whose great passion for genetics and his profound humanity have been a beacon and example, even in the most difficult moments of this journey. To Prof. Ronald Roepman, which made me feel at home during my short visiting in Nijmegen, an experience I will never forget. To the collaborators, with whom I have traveled this journey: Prof. Yvan Arsenijevic, and Dr. Corinne Kostic from Hospital Jules Gonin of Lausanne, Dr. Michaël Hofer, Dr. Marie Cochard and Dr. Andrea Superti-Furga, form CHUV in Lausanne. To all the members of the laboratories of Medical Genetics, some like Adri and Goranka former colleagues, others actuals like Paola, Giulia, Luca, JJ, Hanna, Kostas, Pietro and Rosanna, Roman, Nathalie. Each single joke, hilarity and advice will be unforgettable memories. To Katie Chapman, who had the burdensome task to edit my thesis. To my friends of ITalaus, with whom I promoted the bright side of Italy and the friends of the theater association Pourquoi Pas, with whom I discovered another side of me. 2 To the old friends, like Valeria, Rosanna, Livio and Rosi, and all those with whom I spent wonderful moments while playing boardgames and having dinner. I hope I will enjoy such company for much longer. To my sister: no matter how far you are, you will never be far from my heart. To my parents: the thing I regret the most during these years was to be so far away from you. I have missed you, but I have always carried you with me over the years. I owe you everything in my life. Even this. Thanks. 3 INDEX RESUME 6 PREFACE 8 PART I - IDENTIFICATION AND CHARACTERIZATION OF A NEW GENE INVOLVED IN AUTOSOMAL RECESSIVE RETINITIS PIGMENTOSA 15 I.1INTRODUCTION 16 1.1 THE EYE 16 1.2 PHOTORECEPTOR CELLS AND THE VISION 18 1.3 STRUCTURE AND BIOLOGY OF PHOTORECEPTORS 23 1. 4 THE PHOTORECEPTOR CONNECTING CILIUM 25 1.5 RETINITIS PIGMENTOSA AND RELATED RETINAL DISTROPHIES 30 1.6 AUTOSOMAL RECESSIVE RP AND THE LOCUS RP28 35 I.2 PAPER 37 ULTRA HIGH THROUGHPUT SEQUENCING EXCLUDES MDH1 AS CANDIDATE GENE FOR RP28-LINKED RETINITIS PIGMENTOSA. 37 I.3 PAPER 44 NONSENSE MUTATIONS IN FAM161A CAUSE RP28-ASSOCIATED RECESSIVE RETINITIS PIGMENTOSA. 44 I.3 SUPPLEMENTARY MATERIALS 51 I.4 PAPER 55 FAM161A, ASSOCIATED WITH RETINITIS PIGMENTOSA, IS A COMPONENT OF THE CILIA-BASAL BODY COMPLEX AND INTERACTS WITH PROTEINS INVOLVED IN CILIOPATHIES. 55 I.4 SUPPLEMENTARY MATERIAL 67 I.5 ADDENDUM 72 YEAST-2-HYBRID SCREENING OF HUMAN AND BOVINE RETINAL LIBRARIES AND TANDEM AFFINITY PURIFICATION ANALISYS TO IDENTIFY FAM161A SPECIFIC INTERACTORS 72 INTRODUCTION 73 METHODS 73 RESULTS 75 DISCUSSION 77 I.6 DISCUSSION AND PERSPECTIVES 87 4 PART II -INVESTIGATING THE GENETIC BASIS OF PERIODIC FEVER WITH APHTHOUS STOMATITIS, PHARYNGITIS AND CERVICAL ADENITIS (PFAPA) SYNDROME 92 II.1 INTRODUCTION 93 1.1INNATE IMMUNE SYSTEM AND INFLAMMATION 93 1.2 AUTOINFLAMMATORY SYNDROMES (AIS) 96 1.3PFAPA SYNDROME 100 II.2 METHODS 104 2.1 PATIENT SELECTION, DNA COLLECTION AND PEDIGREE ANALYSIS 105 2.2 PBLS TRANSFORMATION BY EPSTEIN-BARR VIRUS (EBV) INFECTION 105 2.3 GENOTYPING AND LINKAGE ANALYSIS 106 2.4 NGS EXPERIMENTS 106 II.3 RESULTS 107 3.1 PFAPA SYNDROME PRESENTS AN AUTOSOMAL DOMINANT INHERITANCE WITH INCOMPLETE PENETRANCE 107 3.2 LINKAGE ANALYSIS REVEALS A SHARED REGION ON CHROMOSOME 8 108 3.3 EXOME SEQUENCING SHOWS NO CLEAR COMMON VARIANT ASSOCIATED WITH PFAPA PHENOTYPE. 110 3.4 SCREENING OF AUTOINFLAMMATORY FEVER GENES DOES NOT SUPPORT THEIR INVOLVEMENT PFAPA ETIOLOGY 112 3.5 SEVERAL RARE VARIANTS WERE PRESENT IN INFLAMMASOME-RELATED GENES 114 II.4 DISCUSSION AND PERSPECTIVES 121 REFERENCES 145 ABBREVIATIONS 158 5 RESUME L'introduction des technologies de séquençage de nouvelle génération est en vue de révolutionner la médecine moderne. L'impact de ces nouveaux outils a déjà contribué à la découverte de nouveaux gènes et de voies cellulaires impliqués dans la pathologie de maladies génétiques rares ou communes. En revanche, l'énorme quantité de données générées par ces systèmes ainsi que la complexité des analyses bioinformatiques nécessaires, engendre un goulet d'étranglement pour résoudre les cas les plus difficiles. L'objectif de cette thèse a été d’identifier les causes génétiques de deux maladies héréditaires utilisant ces nouvelles techniques de séquençage, couplées à des technologies d'enrichissement de gènes. Dans ce cadre, nous avons développé notre propre méthode de travail (pipeline) pour l’alignement des fragments de séquence (reads). Suite à l'identification de gènes, nous avons réalisé une analyse fonctionnelle pour élucider leur rôle dans la maladie. Dans un premier temps, nous avons étudié et identifié des mutations impliquées dans une forme récessive de la rétinite pigmentaire qui est à ce jour la dégénérescence rétinienne héréditaire la plus fréquente. En particulier, nous avons constaté que des mutations faux-sens dans le gène FAM161A étaient la cause de la rétinite pigmentaire préalablement associé avec le locus RP28. De plus, nous avons démontré que ce gène avait des fonctions au niveau du cil du photorécepteur, complétant le large spectre des cilliopathies rétiniennes héréditaires. Dans un second temps, nous avons exploré la possibilité qu'un syndrome, relativement fréquent en pédiatrie de fièvre récurrente, appelé PFAPA (acronyme de fièvre périodique avec adénite stomatite, pharyngite et cervical aphteuse) puisse avoir une origine génétique. L’étiologie de cette maladie n'étant pas claire, nous avons tenté d'identifier le spectre génétique de patients PFAPA. Comme nous n’avons pas pu mettre à jour un nouveau gène unique muté et responsable de la maladie chez tous les individus dépistés, il semblerait qu’un modèle génétique plus complexe suggérant l'implication de plusieurs gènes dans la pathologie ait été identifié chez les patients touchés. Ces gènes seraient notamment impliqués dans des processus liés à l'inflammation ce qui élargirait l’impact de ces études à d’autres maladies auto- inflammatoires. 6 ABSTRACT Next generation sequencing technologies are literally leading to a revolution in contemporary biology and medicine. The impact of these new tools has already been instrumental in the discovery of new genes and pathways involved in the etiology of rare or common inherited diseases. Conversely, the huge amount of data produced, and the complexity of the following bioinformatics analysis remain a bottleneck for solving the most challenging cases. The purpose of this thesis is to use these new sequencing techniques, in combination with DNA enrichment technologies, for the identification of the genetic cause of two hereditary diseases. In this framework we developed our own pipeline for reads mapping. Whenever possible, we also performed a deeper functional analysis to elucidate the role of this gene in the context of the disease. In the first part of the thesis we investigated and identified the genetic injury involved in an autosomal recessive form of retinitis pigmentosa, the most common inherited retinal degeneration. In particular, we found that non-sense mutations in the gene FAM161A were the cause of retinitis pigmentosa linked to the previously-mapped locus RP28. Coherently with our workflow, we studied this novel disease gene, and we could demonstrate that it had functions at the level of the photoreceptor connecting cilium, expanding the spectrum of retinal inherited ciliopathies.
Load more

Recommended publications
  • Educational Paper Ciliopathies
    Eur J Pediatr (2012) 171:1285–1300 DOI 10.1007/s00431-011-1553-z REVIEW Educational paper Ciliopathies Carsten Bergmann Received: 11 June 2011 /Accepted: 3 August 2011 /Published online: 7 September 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com Abstract Cilia are antenna-like organelles found on the (NPHP) . Ivemark syndrome . Meckel syndrome (MKS) . surface of most cells. They transduce molecular signals Joubert syndrome (JBTS) . Bardet–Biedl syndrome (BBS) . and facilitate interactions between cells and their Alstrom syndrome . Short-rib polydactyly syndromes . environment. Ciliary dysfunction has been shown to Jeune syndrome (ATD) . Ellis-van Crefeld syndrome (EVC) . underlie a broad range of overlapping, clinically and Sensenbrenner syndrome . Primary ciliary dyskinesia genetically heterogeneous phenotypes, collectively (Kartagener syndrome) . von Hippel-Lindau (VHL) . termed ciliopathies. Literally, all organs can be affected. Tuberous sclerosis (TSC) . Oligogenic inheritance . Modifier. Frequent cilia-related manifestations are (poly)cystic Mutational load kidney disease, retinal degeneration, situs inversus, cardiac defects, polydactyly, other skeletal abnormalities, and defects of the central and peripheral nervous Introduction system, occurring either isolated or as part of syn- dromes. Characterization of ciliopathies and the decisive Defective cellular organelles such as mitochondria, perox- role of primary cilia in signal transduction and cell isomes, and lysosomes are well-known
    [Show full text]
  • The Transcription Factor Pou3f1 Promotes Neural Fate Commitment
    RESEARCH ARTICLE elifesciences.org The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways Qingqing Zhu1,2†, Lu Song1†, Guangdun Peng1, Na Sun3, Jun Chen1, Ting Zhang1, Nengyin Sheng1, Wei Tang1, Cheng Qian1, Yunbo Qiao1, Ke Tang4, Jing-Dong Jackie Han3, Jinsong Li1, Naihe Jing1* 1State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 2Department of Neurosurgery, West China Hospital, Sichuan University, Sichuan, China; 3Key Laboratory of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 4Institute of Life Science, Nanchang University, Nanchang, Jiangxi, China Abstract The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased *For correspondence: njing@ incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives sibcb.ac.cn preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses †These authors contributed indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of equally to this work BMP and Wnt signaling.
    [Show full text]
  • Ciliopathiesneuromuscularciliopathies Disorders Disorders Ciliopathiesciliopathies
    NeuromuscularCiliopathiesNeuromuscularCiliopathies Disorders Disorders CiliopathiesCiliopathies AboutAbout EGL EGL Genet Geneticsics EGLEGL Genetics Genetics specializes specializes in ingenetic genetic diagnostic diagnostic testing, testing, with with ne nearlyarly 50 50 years years of of clinical clinical experience experience and and board-certified board-certified labor laboratoryatory directorsdirectors and and genetic genetic counselors counselors reporting reporting out out cases. cases. EGL EGL Genet Geneticsics offers offers a combineda combined 1000 1000 molecular molecular genetics, genetics, biochemical biochemical genetics,genetics, and and cytogenetics cytogenetics tests tests under under one one roof roof and and custom custom test testinging for for all all medically medically relevant relevant genes, genes, for for domestic domestic andand international international clients. clients. EquallyEqually important important to to improving improving patient patient care care through through quality quality genetic genetic testing testing is is the the contribution contribution EGL EGL Genetics Genetics makes makes back back to to thethe scientific scientific and and medical medical communities. communities. EGL EGL Genetics Genetics is is one one of of only only a afew few clinical clinical diagnostic diagnostic laboratories laboratories to to openly openly share share data data withwith the the NCBI NCBI freely freely available available public public database database ClinVar ClinVar (>35,000 (>35,000 variants variants on on >1700 >1700 genes) genes) and and is isalso also the the only only laboratory laboratory with with a a frefree oen olinnlein dea dtabtaabsaes (eE m(EVmCVlaCslas)s,s f)e, afetuatruinrgin ag vaa vraiarniatn ctl acslasisfiscifiactiaotino sne saercahrc ahn adn rde rpeoprot rrte rqeuqeuset sint tinetrefarcfaec, ew, hwichhic fha cfailcitialiteatse rsa praidp id interactiveinteractive curation curation and and reporting reporting of of variants.
    [Show full text]
  • ZNF44 (NM 016264) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC224254 ZNF44 (NM_016264) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ZNF44 (NM_016264) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ZNF44 Synonyms: GIOT-2; KOX7; ZNF; ZNF55; ZNF58; ZNF504 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 ZNF44 (NM_016264) Human Tagged ORF Clone – RC224254 ORF Nucleotide >RC224254 representing NM_016264 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCAGTGGCCTTTGAGGATGTGGCTGTGAACTTCACCCATGAGGAGTGGGCTTTGCTGGGTCCAT CACAGAAGAATCTCTACAGAGATGTGATGCGAGAAACCATTAGGAACCTGAACTGTATAGGAATGAAATG GGAAAACCAGAACATTGATGATCAGCACCAAAATCTCAGGAGAAATCCAAGGTGTGATGTGGTAGAGAGA TTTGGTAAAAGTAAAGATGGTAGTCAGTGTGGAGAAACCTTAAGCCAGATTCGAAATAGTATTGTAAACA AGAACACTCCCGCCAGAGTAGATGCATGTGGAAGCAGTGTGAATGGAGAAGTCATAATGGGTCATTCATC CCTGAATTGCTACATCAGAGTTGATACTGGACACAAACACCGGGAGTGTCATGAATATGCAGAGAAGTCA TATACACATAAGCAGTGTGGGAAAGGCTTAAGTTATCGCCACTCCTTTCAAACATGTGAAAGGCCTCACA CTGGAAAGAAACCCTATGATTGTAAGGAATGTGGAAAAACCTTCAGTTCTCCTGGAAACCTTCGAAGACA TATGGTAGTAAAAGGTGGAGATGGACCTTATAAATGTGAATTGTGTGGGAAAGCCTTTTTTTGGCCCAGT
    [Show full text]
  • Accumulation of Rare Coding Variants in Genes Implicated in Risk of Human Cleft Lip with Or Without Cleft Palate
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Am J Med Manuscript Author Genet A. Author Manuscript Author manuscript; available in PMC 2020 July 01. Published in final edited form as: Am J Med Genet A. 2019 July ; 179(7): 1260–1269. doi:10.1002/ajmg.a.61183. Accumulation of Rare Coding Variants in Genes Implicated in Risk of Human Cleft Lip with or without Cleft Palate Nicholas J. Marini1,*, Kripa Asrani1, Wei Yang2, Jasper Rine1, Gary M Shaw2 1California Institute for Quantitative Biosciences, Department of Molecular and Cellular Biology, University of California, Berkeley, CA 94720, USA 2Department of Pediatrics, Stanford University School of Medicine, Stanford, CA 94305, USA Abstract Cleft lip with/without cleft palate (CLP) is a common craniofacial malformation with complex etiologies, reflecting both genetic and environmental factors. Most of the suspected genetic risk for CLP has yet to be identified. To further classify risk loci and estimate the contribution of rare variants, we sequenced the exons in 49 candidate genes in 323 CLP cases and 211 non-malformed controls. Our findings indicated that rare, protein-altering variants displayed markedly higher burdens in CLP cases at relevant loci. First, putative loss-of-function mutations (nonsense, frameshift) were significantly enriched among cases: 13 of 323 cases (~4%) harbored such alleles within these 49 genes, versus one such change in controls (p = 0.01). Second, in gene-level analyses, the burden of rare alleles showed greater case-association for several genes previously implicated in cleft risk. For example, BHMT displayed a 10-fold increase in protein-altering variants in CLP cases (p = 0.03), including multiple case occurrences of a rare frameshift mutation (K400fs).
    [Show full text]
  • Mathiomica: an Integrative Platform for Dynamic Omics George I
    MathIOmica: An Integrative Platform for Dynamic Omics George I. Mias1,*, Tahir Yusufaly2, Raeuf Roushangar1, Lavida R. K. Brooks1, Vikas V. Singh1, and Christina Christou3 1Michigan State University, Biochemistry and Molecular Biology, East Lansing, MI 48824, USA 2University of Southern California, Department of Physics and Astronomy, Los Angeles, CA, 90089, USA 3Mercy Cancer Center, Department of Radiation Oncology, Mason City, IA 50401, USA *[email protected] SUPPLEMENTARY NOTE 1 1 1 MathIOmica: Omics Analysis Tutorial Loading the MathIOmica Package Metabolomic Data Data in MathIOmica Combined Data Clustering Transcriptome Data Visualization Proteomic Data Annotation and Enrichment MathIOmica is an omics analysis package designed to facilitate method development for the analysis of multiple omics in Mathematica, particularly for dynamics (time series/longitudinal data). This extensive tutorial follows the analysis of multiple dynamic omics data (transcriptomics, proteomics, and metabolomics from human samples). Various MathIOmica functions are introduced in the tutorial, including additional discussion of related functionality. We should note that the approach methods are simply an illustration of MathIOmica functionality, and should not be considered as a definitive appoach. Additionally, certain details are included to illustrate common complications (e.g. renaming samples, combining datasets, transforming accessions from one database to another, dealing with replicates and Missing data, etc.). After a brief discussion of data in MathIOmica, each example data (transcriptome, proteome and metabolome) are imported and preprocessed. Next a simulation is carried out to obtain datasets for each omics used to assess statistical significance cutoffs. The datasets are combined, and classified for time series patterns, followed by clustering. The clusters are visualized, and biological annotation of Gene Ontology (GO) and pathway analysis (KEGG: Kyoto Encyclopedia of Genes and Genomes) are finally considered.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia
    ARTICLE DOI: 10.1038/s41467-018-05379-y OPEN Evaluation of chromatin accessibility in prefrontal cortex of individuals with schizophrenia Julien Bryois 1, Melanie E. Garrett2, Lingyun Song3, Alexias Safi3, Paola Giusti-Rodriguez 4, Graham D. Johnson 3, Annie W. Shieh13, Alfonso Buil5, John F. Fullard6, Panos Roussos 6,7,8, Pamela Sklar6, Schahram Akbarian 6, Vahram Haroutunian 6,9, Craig A. Stockmeier 10, Gregory A. Wray3,11, Kevin P. White12, Chunyu Liu13, Timothy E. Reddy 3,14, Allison Ashley-Koch2,15, Patrick F. Sullivan 1,4,16 & Gregory E. Crawford 3,17 1234567890():,; Schizophrenia genome-wide association studies have identified >150 regions of the genome associated with disease risk, yet there is little evidence that coding mutations contribute to this disorder. To explore the mechanism of non-coding regulatory elements in schizophrenia, we performed ATAC-seq on adult prefrontal cortex brain samples from 135 individuals with schizophrenia and 137 controls, and identified 118,152 ATAC-seq peaks. These accessible chromatin regions in the brain are highly enriched for schizophrenia SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. We identify few differences in chromatin accessibility between cases and controls, in contrast to thousands of age-related differential accessible chromatin regions. Altogether, we characterize chromatin accessibility in the human prefrontal cortex, the effect of schizophrenia and age on chromatin accessibility, and provide evidence that our dataset will allow for fine mapping of risk variants. 1 Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, SE-17177 Stockholm, Sweden.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • FOXE1-Dependent Regulation of Macrophage Chemotaxis by Thyroid Cells in Vitro and in Vivo
    International Journal of Molecular Sciences Article FOXE1-Dependent Regulation of Macrophage Chemotaxis by Thyroid Cells In Vitro and In Vivo Sara C. Credendino 1,2, Marta De Menna 1,3, Irene Cantone 1 , Carmen Moccia 1 , Matteo Esposito 1, Luigi Di Guida 1, Mario De Felice 1,2 and Gabriella De Vita 1,* 1 Department of Molecular Medicine and Medical Biotechnology, University of Naples Federico II, 80131 Naples, Italy; [email protected] (S.C.C.); [email protected] (M.D.M.); [email protected] (I.C.); [email protected] (C.M.); [email protected] (M.E.); [email protected] (L.D.G.); [email protected] (M.D.F.) 2 Institute of Experimental Endocrinology and Oncology “G. Salvatore”, National Research Council (CNR), 80131 Naples, Italy 3 DBMR-Department for BioMedical Research, University of Bern, 3012 Bern, Switzerland * Correspondence: [email protected]; Tel.: +39-081-746-3240 Abstract: Forkhead box E1 (FOXE1) is a lineage-restricted transcription factor involved in thyroid cancer susceptibility. Cancer-associated polymorphisms map in regulatory regions, thus affecting the extent of gene expression. We have recently shown that genetic reduction of FOXE1 dosage modifies multiple thyroid cancer phenotypes. To identify relevant effectors playing roles in thyroid cancer development, here we analyse FOXE1-induced transcriptional alterations in thyroid cells that do not express endogenous FOXE1. Expression of FOXE1 elicits cell migration, while transcriptome analysis reveals that several immune cells-related categories are highly enriched in differentially Citation: Credendino, S.C.; expressed genes, including several upregulated chemokines involved in macrophage recruitment. De Menna, M.; Cantone, I.; Moccia, C.; Accordingly, FOXE1-expressing cells induce chemotaxis of co-cultured monocytes.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • A Novel DFNB31 Mutation Associated with Usher Type 2 Syndrome Showing Variable Degrees of Auditory Loss in a Consanguineous Portuguese Family
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central Molecular Vision 2011; 17:1598-1606 <http://www.molvis.org/molvis/v17/a178> © 2011 Molecular Vision Received 21 March 2011 | Accepted 10 June 2011 | Published 15 June 2011 A novel DFNB31 mutation associated with Usher type 2 syndrome showing variable degrees of auditory loss in a consanguineous Portuguese family. Isabelle Audo,1,2,3,4,5 Kinga Bujakowska,1,2,3 Saddek Mohand-Saïd,1,2,3,4 Sophie Tronche,4,6 Marie-Elise Lancelot,1,2,3 Aline Antonio,1,2,3,4 Aurore Germain,1,2,3 Christine Lonjou,7 Wassila Carpentier,7 José-Alain Sahel,1,2,3,4,5,8 Shomi Bhattacharya,1,2,3,5,9 Christina Zeitz1,2,3 1INSERM, U968, Paris, France; 2CNRS, UMR_7210, Paris, France; 3UPMC Univ Paris 06, UMR_S 968, Department of Genetics, Institut de la Vision, Paris, France; 4Centre Hospitalier National d'Ophtalmologie des Quinze-Vingts, INSERM-DHOS CIC 503,Paris, France; 5Department of Molecular Genetics, Institute of Ophthalmology, London, UK; 6Commission Expertise et Evaluation de la SFORL, Paris, France; 7Plate-forme Post-Génomique P3S, Hôpital Pitié Salpêtrière UPMC, Faculté de Médecine, Paris, France; 8Fondation Ophtalmologique Adolphe de Rothschild, Paris, France; 9Department of Cellular Therapy and Regenerative Medicine, Andalusian Molecular Biology and Regenerative Medicine Centre (CABIMER), Seville, Spain Purpose: To identify the genetic defect of a consanguineous Portuguese family with rod-cone dystrophy and varying degrees of decreased audition. Methods: A detailed ophthalmic and auditory examination was performed on a Portuguese patient with severe autosomal recessive rod-cone dystrophy.
    [Show full text]