DOCSLIB.ORG

WO 2012/054896 Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2012/054896 Al (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number ι (43) International Publication Date ¾ ί t 2 6 April 2012 (26.04.2012) WO 2012/054896 Al (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, C12N 5/00 (2006.01) C12N 15/00 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, C12N 5/02 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (21) International Application Number: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, PCT/US201 1/057387 ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (22) International Filing Date: NO, NZ, OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, 2 1 October 201 1 (21 .10.201 1) RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (25) Filing Language: English ZM, ZW. (26) Publication Language: English (84) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of regional protection available): ARIPO (BW, GH, 61/406,064 22 October 2010 (22.10.2010) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, 61/415,244 18 November 2010 (18.1 1.2010) US UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, (71) Applicant (for all designated States except US): BIO- DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, TIME INC. [US/US]; 1301 Harbor Bay Parkway, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, Alameda, California 94502 (US). SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG). (72) Inventors; and (75) Inventors/Applicants (for US only): WEST, Michael D. Published: [US/US]; 308 Ashton Lane, Mill Valley, California — with international search report (Art. 21(3)) 9494 1 (US). CHAPMAN, Karen B. [US/US]; 308 A sh ton Lane, Mill Valley, California 94941 (US). — before the expiration of the time limit for amending the claims and to be republished in the event of receipt of (74) Agent: SCHERER, David C ; Bozicevic, Field & Fran amendments (Rule 48.2(h)) cis LLP, 1900 University Avenue, Suite 200, East Palo Alto, California 94303 (US). — with sequence listing part of description (Rule 5.2(a)) (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, 0 0 © © (54) Title: METHODS OF MODIFYING TRANSCRIPTIONAL REGULATORY NETWORKS IN STEM CELLS (57) Abstract: A method of generating an isolated progenitor cell line is disclosed which involves modulating the activity of a ¾ transcriptional regulator in a pluripotent stem cell and inducing the differentiation of said pluripotent stem cell in vitro to generate a progenitor cell line. METHODS OF MODIFYING TRANSCRIPTIONAL REGULATORY NETWORKS IN STEM CELLS INTRODUCTION The comprehensive differentiation potential of human pluripotent stem cells such as human embryonic stem (hES) and human induced pluripotent stem (hiPS) cells opens new opportunities in research and cell-based therapy. Their potential to cascade through all of the somatic cell lineages and to display all of the transcriptional pathways of development has generated interest in the use of these cells to map the precise structure of the human transcriptional regulatory network and to generate cell-based therapies for a potential wide array of disorders. However, many in vitro differentiation technologies yield only partially purified cell formulations that may pose the risk of ectopic tissue formation at engraftment sites. Embryoid bodies, or other similar differentiation modalities in vitro contain dozens or hundreds of discrete cell types in a mixture. The clonal isolation and propagation of progenitors greatly facilitates the generation of highly purified and identified formulations for research and therapeutic purposes (see, e.g., West et al, 2008. Regen. Med. 3(3): 287-308; U.S. Patent applications 11/604,047, filed on November 21, 2006 (US Patent Pub. No. 2008/0070303) and 12/504,630, filed on July 16, 2009 (US Patent Pub. No. 2010/0184033), all of which are incorporated herein by reference). Nevertheless, other cell types have yet to be isolated and propagated from normal pluripotent and multipotent cells. Thus, methods of isolating such novel cell types, as well as methods for introducing perturbations into the transcriptional regulatory network in stem cells in order to construct a computer model of the entire human transcriptional regulatory network, would greatly benefit basic research as well as manufacturing technology for cell-based therapies. SUMMARY We have demonstrated that the long initial telomere length of hES cells, together with the robust proliferative capacity of primitive hES-derived progenitor cell types facilitates the industrial expansion and characterization of >140 diverse and scalable clonal lineages with diverse site and temporal-specific homeobox gene expression (West et al, 2008. Regen. Med. 3(3): 287-308; see also U.S. Patent application 11/604,047, filed on November 2 1, 2006 (US Patent Pub. No. 2008/0070303); U.S. Patent application 12/504,630, filed on July 16, 2009 (US Patent Pub. No. 2010/0184033); PCT Patent application serial no. PCT/US201 1/037969, filed on May 25, 2011 titled "Improved Methods of Screening Embryonic Progenitor Cell Lines"; and U.S. Provisional application 61/496,436, filed on June 13, 2011 titled "Methods and Compositions for Producing Endothelial Progenitor Cells From Pluripotent Stem Cells", each of which is incorporated herein by reference). We describe a technology to generate such novel and scalable cell lines through the exogenous or endogenous up or down-regulation of the activity of transcriptional regulators. Such exogenously or endogenously-introduced modifications to the activity of transcriptional regulators may include transcription factors constitutively expressed in pluripotent stem cells such as hES cells or somatic cells reprogrammed to pluripotency such as hiPS cells. Such transcriptional regulators can be introduced in a manner that allows the precise regulation of the level and timing of their expression including but not limited to the use of an inducible promoter driving the expression or inhibition of expression of a number of transcription factors. The exogenously-administered transcriptional regulators with precise control of level and timing of expression are introduced in pluripotent stem cells which also have inducible levels of expression of a gene capable of forcing cell proliferation (cell cycle driver). Also described herein are computer algorithms useful in assembling a computer model of the transcriptional regulatory network of human and other animal species. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: Constitutive expression of the transcription factor OCT4 in clonal iPS-derived progenitorprogenitor cell lines compared to normal hES-derived diverse clonal progenitorprogenitors and normal hES cells. Figure 2 : Graph of microarray data for LHX3 isoform 1 and RESP18 transcript levels in diverse clonal progenitorprogenitors, cultured somatic cell types, hES cells, and hiPS cells as well as clonal progenitors made from hiPS cells constitutively expressing the transcriptional regulator OCT4. Figure 3: Microarray gene expression analysis of the expression of IL19 (Accession number NM_013371.2) in diverse normal cultured cell types, diverse normal clonal progenitor cell lines derived from hES cells, hES and iPS cells, and select cell lines of the present invention including 14SM008X, 14PEND11X, and 14PEND20X. Figure 4 : Microarray gene expression analysis of the expression of Gastrin-releasing peptide (GRP) (Accession number NM_001012513.1) in diverse normal cultured cell types, diverse normal clonal progenitor cell lines derived from hES cells, hES and iPS cells, and select cell lines of the present invention including 14SKEL14Z, 14SKEL15Z, 14SKEL20Z, 14SKEL24Z, and 14PEND20X. Figure 5 : Microarray gene expression analysis of the expression of paraoxonase 3 (PON3) (Accession number NM_000940.1) in diverse normal cultured cell types, diverse normal clonal progenitor cell lines derived from hES cells, hES and iPS cells, and the select cell lines of the present invention 14PEND2X. DETAILED DESCRIPTION OF THE INVENTION Abbreviations AFP - Alpha fetoprotein BMP - Bone Morphogenic Protein BRL Buffalo rat liver BSA Bovine serum albumin CD Cluster Designation cGMP Current Good Manufacturing Processes CNS Central Nervous System DMEM Dulbecco's modified Eagle's medium DMSO Dimethyl sulphoxide DPBS Dulbecco's Phosphate Buffered Saline EBs Embryoid bodies EC Embryonal carcinoma EC Cells Embryonal carcinoma cells; hEC cells are human embryonal carcinoma cells ECAPCs Embryonic cutaneous adipocyte progenitor cells ECM Extracellular Matrix ED Cells Embryo-derived cells; hED cells are human ED cells EDTA Ethylenediamine tetraacetic acid EG Cells Embryonic germ cells; hEG cells are human EG cells EP Cells Embryonic progenitor cells are cells derived from primordial stem cells that are more differentiated than primordial stem cells, in that they no longer display markers such as SSEA4, TRAl-60 or TRA-1-81 seropositivity in the case of the human species, but have not fully differentiated. Embryonic progenitor cells correspond to the embryonic stages as opposed to the postnatal stage of development. ES Cells Embryonic stem cells; hES cells are human ES cells FACS Fluorescence activated cell sorting FBS Fetal bovine serum FCS Fetal calf serum FGF Fibroblast Growth Factor GFP Green Fluorescent Protein GMP Good Manufacturing Practices hED Cells Human embryo-derived cells hEG Cells Human embryonic germ cells are stem cells derived from the primordial germ cells of fetal tissue. hEP Cells Human embryonic progenitor cells are embryonic progenitor cells from the human species. hiPS Cells Human induced pluripotent stem cells. HSE Human skin equivalents are mixtures of cells and biological or synthetic matrices manufactured for testing purposes or for therapeutic application in promoting wound repair.
Load more

Recommended publications
  • ATRX Induction by Mutant Huntingtin Via Cdx2 Modulates Heterochromatin Condensation and Pathology in Huntington’S Disease
    Cell Death and Differentiation (2012) 19, 1109–1116 & 2012 Macmillan Publishers Limited All rights reserved 1350-9047/12 www.nature.com/cdd ATRX induction by mutant huntingtin via Cdx2 modulates heterochromatin condensation and pathology in Huntington’s disease J Lee1,2, YK Hong3, GS Jeon4, YJ Hwang4, KY Kim4, KH Seong4, M-K Jung4, DJ Picketts5, NW Kowall1,2, KS Cho3 and H Ryu*,1,2,4 Aberrant chromatin remodeling is involved in the pathogenesis of Huntington’s disease (HD) but the mechanism is not known. Herein, we report that mutant huntingtin (mtHtt) induces the transcription of alpha thalassemia/mental retardation X linked (ATRX), an ATPase/helicase and SWI/SNF-like chromatin remodeling protein via Cdx-2 activation. ATRX expression was elevated in both a cell line model and transgenic model of HD, and Cdx-2 occupancy of the ATRX promoter was increased in HD. Induction of ATRX expanded the size of promyelocytic leukemia nuclear body (PML-NB) and increased trimethylation of H3K9 (H3K9me3) and condensation of pericentromeric heterochromatin, while knockdown of ATRX decreased PML-NB and H3K9me3 levels. Knockdown of ATRX/dXNP improved the hatch rate of fly embryos expressing mtHtt (Q127). ATRX/dXNP overexpression exacerbated eye degeneration of eye-specific mtHtt (Q127) expressing flies. Our findings suggest that transcriptional alteration of ATRX by mtHtt is involved in pericentromeric heterochromatin condensation and contributes to the pathogenesis of HD. Cell Death and Differentiation (2012) 19, 1109–1116; doi:10.1038/cdd.2011.196; published
    [Show full text]
  • TGF-Β1 Signaling Targets Metastasis-Associated Protein 1, a New Effector in Epithelial Cells
    Oncogene (2011) 30, 2230–2241 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE TGF-b1 signaling targets metastasis-associated protein 1, a new effector in epithelial cells SB Pakala1, K Singh1,3, SDN Reddy1, K Ohshiro1, D-Q Li1, L Mishra2 and R Kumar1 1Department of Biochemistry and Molecular Biology and Institute of Coregulator Biology, The George Washington University Medical Center, Washington, DC, USA and 2Department of Gastroenterology, Hepatology and Nutrition, The University of Texas MD Anderson Cancer Center, Houston, TX, USA In spite of a large number of transforming growth factor b1 gene chromatin in response to upstream signals. The (TGF-b1)-regulated genes, the nature of its targets with TGF-b1-signaling is largely mediated by Smad proteins roles in transformation continues to be poorly understood. (Massague et al., 2005) where Smad2 and Smad3 are Here, we discovered that TGF-b1 stimulates transcription phosphorylated by TGF-b1-receptors and associate with of metastasis-associated protein 1 (MTA1), a dual master the common mediator Smad4, which translocates to the coregulator, in epithelial cells, and that MTA1 status is a nucleus to participate in the expression of TGF-b1-target determinant of TGF-b1-induced epithelial-to-mesenchymal genes (Deckers et al., 2006). Previous studies have shown transition (EMT) phenotypes. In addition, we found that that CUTL1, also known as CDP (CCAAT displacement MTA1/polymerase II/activator protein-1 (AP-1) co-activator protein), a target of TGF-b1, is needed for its short-term complex interacts with the FosB-gene chromatin and stimu- effects of TGF-b1 on cell motility involving Smad4- lates its transcription, and FosB in turn, utilizes FosB/histone dependent pathway (Michl et al.,2005).
    [Show full text]
  • Small Molecule Inhibitors of KDM5 Histone Demethylases Increase the Radiosensitivity of Breast Cancer Cells Overexpressing JARID1B
    molecules Article Small Molecule Inhibitors of KDM5 Histone Demethylases Increase the Radiosensitivity of Breast Cancer Cells Overexpressing JARID1B Simone Pippa 1, Cecilia Mannironi 2, Valerio Licursi 1,3, Luca Bombardi 1, Gianni Colotti 2, Enrico Cundari 2, Adriano Mollica 4, Antonio Coluccia 5 , Valentina Naccarato 5, Giuseppe La Regina 5 , Romano Silvestri 5 and Rodolfo Negri 1,2,* 1 Department of Biology and Biotechnology “C. Darwin”, Sapienza University of Rome, 00185 Rome, Italy; [email protected] (S.P.); [email protected] (V.L.); [email protected] (L.B.) 2 Institute of Molecular Biology and Pathology, Italian National Research Council, 00185 Rome, Italy; [email protected] (C.M.); [email protected] (G.C.); [email protected] (E.C.) 3 Institute for Systems Analysis and Computer Science “A. Ruberti”, Italian National Research Council, 00185 Rome, Italy 4 Department of Pharmacy, University “G. d’ Annunzio” of Chieti, Via dei Vestini 31, 66100 Chieti, Italy; [email protected] 5 Department of Drug Chemistry and Technologies, Sapienza University of Rome, Laboratory affiliated to Istituto Pasteur Italia Cenci Bolognetti Foundation, Sapienza University of Rome, 00185 Rome, Italy; [email protected] (A.C.); [email protected] (V.N.); [email protected] (G.L.R.); [email protected] (R.S.) * Correspondence: [email protected]; Tel.: +39-06-4991-7790 Academic Editors: Sergio Valente and Diego Muñoz-Torrero Received: 12 October 2018; Accepted: 1 May 2019; Published: 4 May 2019 Abstract: Background: KDM5 enzymes are H3K4 specific histone demethylases involved in transcriptional regulation and DNA repair. These proteins are overexpressed in different kinds of cancer, including breast, prostate and bladder carcinomas, with positive effects on cancer proliferation and chemoresistance.
    [Show full text]
  • Ovarian Gene Expression in the Absence of FIGLA, an Oocyte
    BMC Developmental Biology BioMed Central Research article Open Access Ovarian gene expression in the absence of FIGLA, an oocyte-specific transcription factor Saurabh Joshi*1, Holly Davies1, Lauren Porter Sims2, Shawn E Levy2 and Jurrien Dean1 Address: 1Laboratory of Cellular and Developmental Biology, NIDDK, National Institutes of Health, Bethesda, MD 20892, USA and 2Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN 37232, USA Email: Saurabh Joshi* - [email protected]; Holly Davies - [email protected]; Lauren Porter Sims - [email protected]; Shawn E Levy - [email protected]; Jurrien Dean - [email protected] * Corresponding author Published: 13 June 2007 Received: 11 December 2006 Accepted: 13 June 2007 BMC Developmental Biology 2007, 7:67 doi:10.1186/1471-213X-7-67 This article is available from: http://www.biomedcentral.com/1471-213X/7/67 © 2007 Joshi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Ovarian folliculogenesis in mammals is a complex process involving interactions between germ and somatic cells. Carefully orchestrated expression of transcription factors, cell adhesion molecules and growth factors are required for success. We have identified a germ-cell specific, basic helix-loop-helix transcription factor, FIGLA (Factor In the GermLine, Alpha) and demonstrated its involvement in two independent developmental processes: formation of the primordial follicle and coordinate expression of zona pellucida genes. Results: Taking advantage of Figla null mouse lines, we have used a combined approach of microarray and Serial Analysis of Gene Expression (SAGE) to identify potential downstream target genes.
    [Show full text]
  • Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed
    SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Podocyte specific knockdown of Klf15 in Podocin-Cre Klf15flox/flox mice was confirmed. (A) Primary glomerular epithelial cells (PGECs) were isolated from 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice and cultured at 37°C for 1 week. Real-time PCR was performed for Nephrin, Podocin, Synaptopodin, and Wt1 mRNA expression (n=6, ***p<0.001, Mann-Whitney test). (B) Real- time PCR was performed for Klf15 mRNA expression (n=6, *p<0.05, Mann-Whitney test). (C) Protein was also extracted and western blot analysis for Klf15 was performed. The representative blot of three independent experiments is shown in the top panel. The bottom panel shows the quantification of Klf15 by densitometry (n=3, *p<0.05, Mann-Whitney test). (D) Immunofluorescence staining for Klf15 and Wt1 was performed in 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice. Representative images from four mice in each group are shown in the left panel (X 20). Arrows show colocalization of Klf15 and Wt1. Arrowheads show a lack of colocalization. Asterisk demonstrates nonspecific Wt1 staining. “R” represents autofluorescence from RBCs. In the right panel, a total of 30 glomeruli were selected in each mouse and quantification of Klf15 staining in the podocytes was determined by the ratio of Klf15+ and Wt1+ cells to Wt1+ cells (n=6 mice, **p<0.01, unpaired t test). Supplementary Figure 2: LPS treated Podocin-Cre Klf15flox/flox mice exhibit a lack of recovery in proteinaceous casts and tubular dilatation after DEX administration.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Modes of Interaction of KMT2 Histone H3 Lysine 4 Methyltransferase/COMPASS Complexes with Chromatin
    cells Review Modes of Interaction of KMT2 Histone H3 Lysine 4 Methyltransferase/COMPASS Complexes with Chromatin Agnieszka Bochy ´nska,Juliane Lüscher-Firzlaff and Bernhard Lüscher * ID Institute of Biochemistry and Molecular Biology, Medical School, RWTH Aachen University, Pauwelsstrasse 30, 52057 Aachen, Germany; [email protected] (A.B.); jluescher-fi[email protected] (J.L.-F.) * Correspondence: [email protected]; Tel.: +49-241-8088850; Fax: +49-241-8082427 Received: 18 January 2018; Accepted: 27 February 2018; Published: 2 March 2018 Abstract: Regulation of gene expression is achieved by sequence-specific transcriptional regulators, which convey the information that is contained in the sequence of DNA into RNA polymerase activity. This is achieved by the recruitment of transcriptional co-factors. One of the consequences of co-factor recruitment is the control of specific properties of nucleosomes, the basic units of chromatin, and their protein components, the core histones. The main principles are to regulate the position and the characteristics of nucleosomes. The latter includes modulating the composition of core histones and their variants that are integrated into nucleosomes, and the post-translational modification of these histones referred to as histone marks. One of these marks is the methylation of lysine 4 of the core histone H3 (H3K4). While mono-methylation of H3K4 (H3K4me1) is located preferentially at active enhancers, tri-methylation (H3K4me3) is a mark found at open and potentially active promoters. Thus, H3K4 methylation is typically associated with gene transcription. The class 2 lysine methyltransferases (KMTs) are the main enzymes that methylate H3K4. KMT2 enzymes function in complexes that contain a necessary core complex composed of WDR5, RBBP5, ASH2L, and DPY30, the so-called WRAD complex.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]