Extensive RNA Editing in Transcripts from the Psbb Operon and Rpoa Gene of Plastids from the Enigmatic Moss Takakia Lepidozioides

Biosci. Biotechnol. Biochem., 70 (9), 2268–2274, 2006

Extensive RNA Editing in Transcripts from the PsbB Operon and RpoA Gene of Plastids from the Enigmatic Moss Takakia lepidozioides

y Mamoru SUGITA,1; Yuki MIYATA,1 Kaori MARUYAMA,1 Chika SUGIURA,1 Tomotsugu ARIKAWA,2 and Masanobu HIGUCHI3

1Center for Gene Research, Nagoya University, Chikusa-ku, Nagoya 464-8602, Japan 2Department of Biology, Keio University, 4-1-1 Hiyoshi, Kohoku-ku, Yokohama 223-8521, Japan 3Department of Botany, National Science Museum, Amakubo 4-1-1, Tsukuba 305-0005, Japan

Received April 10, 2006; Accepted May 18, 2006; Online Publication, September 7, 2006 [doi:10.1271/bbb.60204]

RNA editing is a post-transcriptional process that been found in plastid RNAs of A. angustus.11) Recently, changes individual nucleotides in transcripts, and potentially heavy RNA editing was predicted in the usually occurs in the plastids of land plants. The mitochondrial nad1 gene of the moss Takakia lepido- number of RNA editing sites in a plastid is significantly zioides.12) We also found possible RNA editing sites in divergent in bryophytes, ranging from zero in liver- the T. lepidozioides plastid genes, rpoA (encoding the worts to almost 1,000 sites in hornworts. In this study, subunit of plastid RNA polymerase) and petD (encod- we identified 132 RNA editing sites in the transcripts of ing the subunit IV of cytochrome b6=f complex), and six genes from the psbB operon and the rpoA of the moss RNA editing was predicted to generate new stop codons Takakia lepidozioides. This is the highest number of in the transcripts of these genes.13) This strongly RNA editing sites known in this region among land suggests that frequent RNA editing occurs in Takakia plant species. All were cytidine-to-uridine conversions. plastids. More than 91% of RNA editing occurred at the first or In this study, we identified 132 RNA editing sites in second codon positions, and it altered amino acid the transcripts from six genes containing rpoA and petD identity. Six editing sites created new translation of T. lepidozioides. This finding might help to resolve initiation codons or stop codons. Thirty-two sites were the phylogenetic position of the enigmatic bryophyte commonly observed in the hornwort Anthoceros angus- genus, Takakia. tus. This finding suggests that the enigmatic bryophyte Takakia is closely related to hornworts with respect to Materials and Methods RNA editing events. DNA extraction and analysis. Takakia lepidozioides Key words: cytidine-to-uridine conversion; moss; plas- S. Hatt. & Inoue was collected in the field in Yu-shan, tid; RNA editing; Takakia lepidozioides Taiwan. Total cellular DNA from a small amount of T. lepidozioides (10 mg wet weight) was extracted as RNA editing is a post-transcriptional modification of described previously14) and used as a template for the nuclear, mitochondrial, or plastid transcripts, and occurs polymerase chain reaction (PCR) using appropriate in a wide range of organisms.1–3) About 30 sites, mostly primers (Table 1). PCR was performed with an initial involving cytidine (C) to uridine (U) transitions, have denaturation step at 95 C for 5 min, followed by 25 been identified in plastid genomes of the major vascular cycles of denaturation at 94 C for 1 min, annealing at plants.4) In contrast, the number of RNA editing sites 48 C for 1 min, and extension at 72 C for 1 min, with a is significantly divergent among the plastid genomes of final extension at 72 C for 2 min. The amplified DNA bryophytes that have been sequenced: the liverwort fragments were cloned into pGEM-T Easy plasmids Marchantia polymorpha,5) the hornwort Anthoceros (Promega, Madison, WI), and their sequences were angustus (formerly A. formosae),6) and the moss Phys- determined using M13 universal primers and internal comitrella patens.7) RNA editing appears to be absent sequence primers designed from sequences determined from the mitochondria and plastids of M. polymorpha,8) in this study (Table 1). DNA sequencing was performed and only two editing sites have been identified in the using the DYEnamic ET Terminator Cycle Sequencing plastids of P. patens.9,10) Surprisingly, extensive RNA Kit (Amersham Bioscience, Piscataway, NJ) and ABI editing, 509 C-to-U and 433 U-to-C conversions, has 3100 DNA sequencer. Sequence processing and contig

y To whom correspondence should be addressed. Tel/Fax: +81-52-789-3080; E-mail: [email protected] Extensive RNA Editing in Takakia Plastids 2269 Table 1. Primers Used for Plastid DNA, and cDNA Amplification and Sequencing

DNA fragment Name of primer Sequence (50 ! 30) Ref. For amplification of plastid DNA Fragment 1 Tl-psbT AACCACCTAAAGTTCCCAGCAAAG AF193624 (3163 bp) petD-l GCCGGTTCACCAATCATGGA AB193121 Fragment 2 H-psbB-u CTGCTTTAGTTTCTGGTTGGG AB086179 (1676 bp) psbT-l TTTGCTCGGAACTTTAGGTGG This study Fragment 3 H-clpP-l CGTTTAGTAATCTCTCCTCCAG AB086179 (1754 bp) psbB-l CCGCATTAGTTACAGTTTCTCC This study For amplification of cDNA psbB cDNA-psbB/T-1 TTGTTTCGGATTTGGAGCATTC This study cDNA-pabB/T-2 GACTACTACGAAAAACGCCATC This study psbB-psbT cDNA-psbB-u GCGTAGTTATTAAATGCAAAAAAG This study cDNA-psbT-l AATGAACGGAATGAGACTTATC This study psbN cDNA-psbN-u CTATTATATCGGAAACAAACCATTA This study cDNA-psbN-l CCGAAAATTAAGGGAAGGTCAT This study psbH cDNA-psbH-u AACCACCTAAAGTTCCGAGCAAAG This study cDNA-psbH-l TCCTTTATTTGATTGATCGCAC This study petB cDNA-petB-u CGGAACCTTATAATTCTTCT This study cDNA-petB-l GACAGAAACTCGTGATAAGAAAC This study petD cDNA-petD-u TGAGAGAGAATGGATTATGGGAG This study cDNA-petD-l AGGAAGGAGAGGTGGCAGTC AB193121 rpoA cDNA-rpoA-u TGCTACGAAACAAATACTCCCTA AB193121 cDNA-rpoA-l ACCTCCCAAGAAAAGACGTGTATAA AB193121 For internal sequencing clpP-psbB-1 TTTTCAATGAGAGGTAATGTATC This study clpP-psbB-2 GGCTCCGTTAAACTTCCAGAC This study psbB-psbT TATCGCAGCAGGTATTCCAG This study psbT-u ATGCAATAAGTTCCACGGCT This study

assembly were performed using Genetyx-Mac 9.0 cDNA), AB254138 (petB cDNA), AB254139 (petD (Software Development, Tokyo, Japan) and Sequencer cDNA), and AB254140 (rpoA cDNA). 3.0 software (Gene Codes, Ann Arbor, MI). Results RNA extraction and reverse-transcription PCR. A small amount of T. lepidozioides was frozen and ground Prediction of RNA editing sites with a mortal and a pestle. The resulting powder was In a previous study, we found numerous possible treated with Isogen (Nippon Gene, Toyama, Japan), and RNA editing sites in the rpoA and petD genes of RNA was extracted according to the manufacturer’s Takakia,13) suggesting that a high frequency of RNA protocol. To remove residual DNA contamination, the editing occurs in Takakia plastids. To confirm this, we RNA preparation was treated with RNase-free DNase I amplified and sequenced three plastid DNA fragments (TaKaRa, Kyoto, Japan) at 37 C for 30 min, and then at that encompassed a 6.4 kb region from the second exon 70 C for 10 min. of clpP (encoding ATP-dependent protease proteolytic cDNA synthesis was carried out as described pre- subunit) to the 30-exon of petD (Fig. 1). The gene viously.9) Single-strand cDNA was prepared from arrangement from clpP to rpoA in Takakia is conserved DNase I-treated total cellular RNA using an AMV among most land plant species, except for P. patens. Reverse Transcriptase First-strand cDNA Synthesis Kit Based on alignment of the amino acid sequences (Life Sciences, Petersburg, Fl) and random primers (Life deduced from seven Takakia plastid genes with those Sciences). cDNA was amplified by PCR using appro- from the genes or cDNAs of M. polymorpha,5) A. an- priate primers (Table 1), as described previously,9) and gustus,6) P. patens,7) and the fern Adiantum capillus- subjected to direct sequencing. veneris,15) we predicted 124 RNA editing sites of C-to-U in the first or second codon positions. An U-to-C Identification of RNA editing sites. RNA editing was conversion was also predicted in the 253rd codon of analyzed by comparing each cDNA sequence with that rpoA (Table 2). To confirm the occurrence of RNA of genomic DNA. When the sequences did not match, editing in the psbB (encoding photosystem II (PSII) the genomic DNA and cDNA were reamplified and 47 kDa protein), psbT (encoding PSII T-protein), psbN reexamined. Nucleotide sequence data were deposited (encoding PSII N-protein), psbH (encoding PSII H- in the DDBJ/EMBL/GenBank databases, accession protein), petB (encoding cytochrome b6), petD, and nos. AB254134 (plastid DNA), AB254135 (psbB-psbT rpoA transcripts, cDNAs were amplified and their cDNA), AB254136 (psbH cDNA), AB254137 (psbN sequences were determined by direct sequencing. The 2270 M. SUGITA et al.

Fig. 1. Gene Arrangement of the Region Spanning clpP to rpoA in the Takakia Plastid Genome. The filled boxes indicate the translated regions of each gene and the open boxes represent introns. The psbB, psbT, psbH, petB, and petD genes were transcribed from left to right, and the rpoA, psbN, and clpP genes were transcribed in the opposite direction. RNA editing sites that generate translation initiation and stop codons are marked as open circles and stars respectively. The three fragments were amplified by PCR, and the sequences deposited in the DNA databases (AB193121 and AF193624) are indicated under the gene map.

Table 2. List of RNA Editing Sites in the Transcripts of T. lepidozioides Editing sites that were not predicted are indicated as ‘‘NP,’’ and those that did not alter the amino acid coding are indicated as ‘‘silent.’’ Double editing sites are indicated as ‘‘double.’’ Unedited sites that were predicted are indicated as ‘‘not edited.’’ The positions of edited codons were the same as those observed in other plant species, Anthoceros angustus (Ac),11) Adiantum capillus-veneris (Adiantum),15) or higher plants.4,17–19) Unedited or edited codons are indicated as ‘‘>’’ o r ‘‘ !’’ respectively.

Codon Genomic observed in other Gene cDNA Remarks Position DNA plant species 1 psbB 1 Thr(aCg) ! Met(aTg) Adiantum 2 psbB 5 Arg(Cgg) ! Trp(Tgg) Ac 3 psbB 13 Ser(tCa) ! Leu(tTa) Ac 4 psbB 19 Ser(tCa) ! Leu(tTa) 5 psbB 24 Ser(tCa) ! Leu(tTa) 6 psbB 29 Pro(cCa) ! Leu(cTa) 7 psbB 33 Arg(Cgg) ! Trp(Tgg) 8,9 psbB 45 Ser(tCC) ! Phe(tTT) double 10 psbB 56 Arg(Cgg) ! Trp(Tgg) 11 psbB 75 Arg(Cgg) ! Trp(Tgg) 12 psbB 93 Tyr(taC) ! Tyr(taT) NP, silent 13 psbB 103 Ser(tCa) ! Leu(tTa) Ac 14 psbB 109 Ser(tCg) ! Leu(tTg) 15 psbB 113 Arg(Cgg) ! Trp(Tgg) 16 psbB 115 Arg(Cgg) ! Trp(Tgg) 17 psbB 118 Arg(Cgg) ! Trp(Tgg) 18 psbB 120 Ser(tCg) ! Leu(tTg) Ac 19 psbB 133 Ser(tCa) ! Leu(tTa) Ac 20 psbB 139 Ser(tCt) ! Phe(tTt) 21 psbB 149 Pro(cCt) ! Leu(cTt) 22 psbB 150 Arg(Cgt) ! Cys(Tgt) 23 psbB 164 Pro(ccC) ! Pro(ccT) NP, silent 24 psbB 208 Pro(cCa) ! Leu(cTa) 25 psbB 215 Ser(tCc) ! Phe(tTc) 26,27 psbB 217 Pro(cCC) ! Leu(cTT) double 28 psbB 225 Ser(tCa) ! Leu(tTa) 29 psbB 238 Ser(tCa) ! Leu(tTa) 30 psbB 247 Leu(Ctc) ! Phe(Ttc) 31 psbB 280 Ser(tCc) ! Phe(tTc) 32 psbB 298 Ser(tCa) ! Leu(tTa) 33 psbB 311 Leu(Ctt) ! Phe(Ttt) 34 psbB 314 His(Cat) ! Tyr(Tat) 35 psbB 330 Thr(aCg) ! Met(aTg) 36 psbB 340 Arg(Cgg) ! Trp(Tgg) 37 psbB 346 Phe(ttC) ! Phe(ttT) NP, silent 38,39 psbB 362 Pro(CCt) ! Phe(TTt) double 40 psbB 363 Ser(tCt) ! Phe(tTt) Ac 41 psbB 366 Leu(Ctt) ! Phe(Ttt) 42 psbB 370 Ser(tCg) ! Leu(tTg) Ac 43 psbB 383 Ser(tCc) ! Phe(tTc) Ac Continued on next page. Extensive RNA Editing in Takakia Plastids 2271 Continued. 44 psbB 406 Pro(cCg) ! Leu(cTg) 45 psbB 430 Ser(tCt) ! Phe(tTt) Ac 46,47 psbB 432 Ser(tCC) ! Phe(tTT) double Ac 48 psbB 443 Ser(tCt) ! Phe(tTt) Ac 49 psbB 453 Ser(tCt) ! Phe(tTt) 50 psbB 461 Pro(cCc) ! Leu(cTc) Ac 51 psbB 463 Ser(tCt) ! Phe(tTt) Ac 52 psbB 468 Arg(Cgg) ! Trp(Tgg) 53 psbB 474 Ser(tCg) ! Leu(tTg) 1 psbB-psbT (106) tttCttgg ! tttTttgg intergenic spacer 2,3 psbB-psbT (29; 22) CccaataC ! TccaataT intergenic spacer 1 psbT 6 His(Cat) ! Tyr(Tat) 2 psbT 9 Ser(tCg) ! Leu(tTg) 3 psbT 22 Ser(tCt) ! Phe(tTt) 4 psbT 23 Leu(Ctc) ! Phe(Ttc) psbN 10 Ser(tCc) > Phe(tTc) not edited psbN 13 Arg(Cgt) > Cys(Tgt) not edited psbN 23 Pro(cCc) > Leu(cTc) not edited psbN 24 His(Cat) > Tyr(Tat) not edited 1 psbH 1 Thr(aCg) ! Met(aTg) 2 psbH 50 Ser(tCt) ! Phe(tTt) 3 psbH 58 Pro(cCg) ! Leu(cTg) 4 psbH 60 Pro(cCt) ! Leu(cTt) Ac psbH 71 Pro(Cct) > Ser(Tct) not edited 1 petB (6) Cggaat ! Tggaat 50-untranslated region of petB 2 petB 1 Thr(aCg) ! Met(aTg) 3,4 petB 8 Ser(tCC) ! Phe(tTT) double 5 petB 33 Ser(tCt) ! Phe(tTt) Ac 6 petB 34 His(Cat) ! Tyr(Tat) 7 petB 36 Ser(tCg) ! Leu(tTg) 8 petB 41 Ser(tCg) ! Leu(tTg) 9 petB 45 Ser(tCg) ! Leu(tTg) 10 petB 52 Ser(tCt) ! Phe(tTt) 11 petB 54 Thr(aCg) ! Met(aTg) 12 petB 56 Leu(Ctc) ! Phe(Ttc) 13 petB 58 His(Cat) ! Tyr(Tat) Ac 14 petB 68 Pro(Cct) ! Ser(Tct) 15 petB 95 Ser(tCa) ! Leu(tTa) Ac, Adiantum 16 petB 97 Thr(aCg) ! Met(aTg) 17 petB 99 Pro(cCg) ! Leu(cTg) Ac 18 petB 102 Ser(tCt) ! Phe(tTt) 19 petB 106 Pro(cCt) ! Leu(cTt) 20 petB 122 Ala(gCa) ! Val(gTa) 21 petB 124 Pro(cCa) ! Leu(cTa) Ac 22,23 petB 131 Pro(CCt) ! Phe(TTt) double 24 petB 140 Arg(Cgg) ! Trp(Tgg) 25 petB 145 His(Cac) ! Tyr(Tac) 26 petB 161 Thr(aCa) ! Ile(aTa) 27 petB 165 Ser(tCg) ! Leu(tTg) 28 petB 180 Ser(tCg) ! Leu(tTg) 29 petB 191 Ser(tCa) ! Leu(tTa) Ac 30 petB 193 Pro(cCt) ! Leu(cTt) Ac 31 petB 194 Pro(cCt) ! Leu(cTt) 32 petB 198 Ser(tCt) ! Phe(tTt) Ac 33 petB 199 Thr(aCg) ! Met(aTg) 34 petB 200 Ser(tCa) ! Leu(tTa) Ac, Adiantum, black pine 35 petB 204 Pro(cCa) ! Leu(cTa) tobacco, maize, sugarcane, deadly nightshade 36 petB 215 Ser(tCa) ! Leu(tTa) 37 petB 216 Gln(Caa) ! Stop(Taa) 1 petD 9 Ser(tCa) ! Leu(tTa) 2 petD 14 Ser(tCg) ! Leu(tTg) Continued on next page. 2272 M. SUGITA et al. Continued. 3 petD 37 Ser(tCg) ! Leu(tTg) Ac, Adiantum, black pine 4 petD 40 Ser(tCt) ! Phe(tTt) Ac 5 petD 45 Pro(cCa) ! Leu(cTa) 6 petD 73 Pro(cCg) ! Leu(cTg) 7 petD 82 Ser(tCt) ! Phe(tTt) 8 petD 85 Ser(tCt) ! Phe(tTt) Ac 9 petD 99 Pro(cCt) ! Leu(cTt) 10 petD 114 Pro(cCg) ! Leu(cTg) 11 petD 134 Pro(cCa) ! Leu(cTa) Ac petD 138 Ala(gCa) > Val(gTa) not edited 12 petD 141 Pro(cCt) ! Leu(cTt) 13 petD 142 Arg(Cgg) ! Trp(Tgg) 14 petD 157 Leu(ctC) ! Leu(ctT) NP, silent 15 petD 161 Arg(Cga) ! Stop(Tga) Ac, Adiantum, black pine 1 rpoA 35 Pro(Cct) ! Ser(Tct) Ac 2 rpoA 53 Ser(tCa) ! Leu(tTa) Ac 3 rpoA 67 Ser(tCc) ! Phe(tTc) 4 rpoA 88 Ser(tCa) ! Leu(tTa) Ac 5 rpoA 91 Ser(tCa) ! Leu(tTa) Adiantum 6 rpoA 123 Ser(tCa) ! Leu(tTa) rpoA 125 Pro(Cct) > Ser(Tct) not edited 7 rpoA 136 Thr(aCa) ! Ile(aTa) 8 rpoA 145 Ser(tCg) ! Leu(tTg) rpoA 162 Pro(cCa) > Leu(cTa) not edited 9 rpoA 170 Ser(tCt) ! Phe(tTt) Ac 10 rpoA 172 Ala(gCa) ! Val(gTa) 11 rpoA 182 Ala(gCa) ! Val(gTa) NP rpoA 253 Ser(Tcc) > Pro(Ccc) not edited (T->C) rpoA 254 Ser(tCt) > Phe(tTc) not edited 12,13 rpoA 288 Pro(cCC) ! Leu(cTT) double rpoA 293 Ala(gCa) > Val(gTa) not edited 14 rpoA 299 Pro(cCt) ! Leu(cTt) 15 rpoA 325 Ser(tCa) ! Leu(tTa) 16 rpoA 342 Gln(Caa) ! Stop(Taa)

plastid genome region containing the psbB to petD of the total nucleotides and 8.3% of all Cs in the genes is generally co-transcribed as a long precursor translated region. RNA and then processed into smaller mature mRNAs.16) Thus, RNA was extensively edited in the Takakia The psbN gene is transcribed as a monocistronic unit. plastids, and all RNA editing events occurred by C-to-U Hence, we amplified cDNAs from a co-transcript conversions. Reverse editing of U-to-C was not ob- containing the translated regions of psbB and psbT,or served in Takakia plastid transcripts. Six editing sites pre-RNA from the psbT and psbH coding regions. The generated new translation initiation codons for psbB, other cDNAs contained a monocistronic unit. The petB, and psbH transcripts, and new stop codons for cDNAs of petB and petD were amplified from the petB, petD, and rpoA transcripts. More than 91% of spliced mRNA molecules. RNA editing (121 out of 132 sites) occurred at the first or second codon positions, and altered amino acid Identification of RNA editing sites identity or converted a sense codon to a nonsense codon. A comparison of the genomic DNA and cDNA The most prominent of amino acid changes are Ser to sequences revealed 132 editing sites in the transcripts of Leu at 31 sites, followed by Ser to Phe at 23 sites, Pro to six genes (Table 2). No editing sites were found in the Leu at 22 sites, and Arg to Trp at 11 sites, with transcript of psbN. All sites were C-to-U edits. Fifty- modifications of hydrophilic to hydrophobic residues. three C-to-U conversions were observed in the protein- But three sites in the psbB transcript and one site in the coding region of the psbB transcript, and the editing petD transcript were silent conversions located at the frequency was 3.5% in the translated region of 1527 third codon positions, which did not alter the amino nucleotides. This corresponded to 17.2% of 309 Cs in acid. Double editing sites (CC to UU) that were not the translated region. Thirty-seven C-to-U changes were predicted also occurred in psbB, petB, and rpoA. identified in the mature transcript of petB, and the Thirty-two editing sites are commonly observed in editing frequencies were 5.7% of 648 nucleotides and A. angustus, and one of the most interesting is at the 25.2% of all Cs in the translated region. In contrast, the 204th codon (cCa) of petB mRNA, which is conserved editing frequency of the rpoA transcript was only 1.5% in several higher plants4,17–19) but not in A. angustus11) Extensive RNA Editing in Takakia Plastids 2273 or A. capillus-veneris.15) RNA editing was also detected tively unexplored at all levels of phylogenetic inquiry.29) in the 50-untranslated region of petB mRNA, and in RNA editing data may help to resolve the phylogenetic the intergenic spacer region between psbB and psbT. position of the enigmatic bryophyte genus Takakia.In Such RNA editing rarely occurs, but has been observed this study, we found extensive RNA editing in plastid in plastids of A. angustus,11) P. patens,9) A. capillus- transcripts of Takakia, with a high frequency similar to veneris,15) and higher plants.4,20) that seen in Anthoceros. Moreover, many RNA editing sites of Takakia are homologous to editing sites in the Discussion hornwort A. angustus. This suggests that Takakia and hornworts are closely related groups with respect to In the present study, we identified 132 RNA editing RNA editing events, but the U-to-C edits and repair of sites in the transcripts from six plastid genes of Takakia. stop codons by editing seen in Anthoceros were not This is the highest frequency of RNA editing in the observed in Takakia. This also suggests that the editing RNAs of this region reported in land plants. In the machinery is not exactly the same in the two bryophyte hornwort A. angustus, 107 editing sites have been plants. Further identification of RNA editing sites in identified in RNAs of the same plastid DNA region, plastids of bryophytes should help in understanding the and half of them were U-to-C changes.11) Similar biological significance of RNA editing in the diversity extensive RNA editing has also been observed in the and evolution of land plants. Takakia rbcL transcript encoding the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Ari- Acknowledgments kawa and Higuchi, unpublished). In addition, we also predicted seven editing sites in exon 1 and the 50-region This work was supported by Grants-in-Aid from the of exon 2 of clpP. Therefore, RNA editing events might Japan Society for the Promotion of Science (14340252 occur in most plastid gene transcripts of Takakia.We to MS, 13640707 to MH, and 17770073 to TA) and estimated the number of RNA editing sites to be more JSPS Research Fellowships for Young Scientists to YM. than 1,000, which is similar to the 942 sites found in the A. angustus plastid genome.11) Because most (91%) of References the predicted RNA editing sites in Takakia were confirmed and no partial edited transcripts were ob- 1) Benne, R., RNA editing: how a message is changed. served in this analysis, RNA editing probably occurs Curr. Opin. Genet. Dev., 6, 221–231 (1996). immediately after transcription of plastid genes and 2) Brennicke, A., Marchfelder, A., and Binder, S., RNA editing. FEMS Microbiol. Rev., 23, 297–316 (1999). precedes splicing or site-specific cleavage of pre-RNAs. 3) Bock, R., Sense from nonsense: how the genetic Five out of 19 predicted sites in rpoA were not edited in information of chloroplast gene expression. Biochimie, the transcript (Table 2). This might explain why the 82, 549–557 (2000). rpoA gene shows lower amino acid identity than highly 4) Tsudzuki, T., Wakasugi, T., and Sugiura, M., Compa- conserved photosynthesis-related genes, such as psbB, rative analysis of RNA editing sites in higher plant petB,orpetD, among different plant species. It is chloroplasts. J. Mol. Evol., 53, 327–332 (2001). possible that the mutated C nucleotides in the rpoA gene 5) Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, of Takakia do not require RNA editing, but we cannot T., Sano, S., Umezono, K., Shiki, Y., Takeuchi, M., exclude the possibility that RNA editing in rpoA occurs Chang, Z., Aota, S., Inokuchi, H., and Ozeki, H., at undetectable levels by direct sequencing of rpoA Chloroplast gene organization deduced from complete Marchantia polymorpha cDNA. sequence of liverwort chloro- plast DNA. Nature, 322, 572–574 (1986). Takakia is distributed disjunctively in the areas 6) Kugita, M., Kaneko, A., Yamamoto, Y., Takeya, Y., surrounding the North Pacific Ocean and also at high Matsumoto, T., and Yoshinaga, K., The complete altitudes in the Himalayas and Borneo, and it generally nucleotide sequence of the hornwort (Anthoceros for- grows on partially shaded vertical surfaces of rock, in mosae) chloroplast genome: insight into the earliest land rock-crevice or soil-covered rocks near snow patches. plants. Nucl. Acids Res., 31, 716–721 (2003). The Takakia genus comprises two species, T. lepido- 7) Sugiura, C., Kobayashi, Y., Aoki, S., Sugita, C., and zioides and T. ceratophylla, and is of somewhat un- Sugita, M., Complete chloroplast DNA sequence of the certain placement. It has been included with liverworts moss Physcomitrella patens: evidence for the loss and by some researchers,21,22) but others have considered it relocation of rpoA from the chloroplast to the nucleus. as an independent lineage at the same rank as liverworts, Nucl. Acids Res., 31, 5324–5331 (2003). mosses, and hornworts.23) The discovery of antheridia 8) Freyer, R., Kiefer-Meyer, M. C., and Ko¨ssel, H., Occurrence of plastid RNA editing in all major lineages and sporophytes in Takakia has revived the earlier idea 24) of land plants. Proc. Natl. Acad. Sci. USA, 94, 6285– that the genus Takakia is a moss. More recent 6290 (1997). molecular and morphological data have solidified the 9) Miyata, Y., and Sugita, M., Tissue- and stage-specific 25,26) placement of Takakia among mosses, but the exact RNA editing of rps14 transcripts in moss (Physcomi- placement of Takakia within mosses is still being trella patens) chloroplasts. J. Plant Physiol., 161, 113– debated.26–28) Similarly, hornworts have remained rela- 115 (2004). 2274 M. SUGITA et al. 10) Miyata, Y., Sugiura, C., Kobayashi, Y., Hagiwara, M., 19) Schmitz-Linneweber, C., Regel, R., Du, T. G., Hupfer, and Sugita, M., Chloroplast ribosomal S14 protein H., Herrmann, R. G., and Maier, R. M., The plastid transcript is edited to create a translation initiation chromosome of Atropa belladonna and its comparison codon in the moss Physcomitrella patens. Biochim. with that of Nicotiana tabacum: the role of RNA editing Biophys. Acta, 1576, 346–349 (2002). in generating divergence in the process of plant 11) Kugita, M., Yamamoto, Y., Fujikawa, T., Matsumoto, speciation. Mol. Biol. Evol., 19, 1602–1612 (2002). T., and Yoshinaga, K., RNA editing in hornwort 20) Kudla, J., and Bock, R., RNA editing in an untranslated chloroplasts makes more than half the genes functional. region of the Ginkgo chloroplast genome. Gene, 234, Nucl. Acids Res., 31, 2417–2423 (2003). 81–86 (1999). 12) Dombrovska, O., and Qiu, Y. L., Distribution of introns 21) Hattori, S., and Inoue, H., Preliminary report on Takakia in the mitochondrial gene ndh1 in land plants: phyloge- lepidoziodes. J. Hattori Bot. Lab., 19, 133–137 (1958). netic and molecular evolutionary implications. Mol. 22) Schuster, R. M., ‘‘The Hepaticae and Anthocerotae of Phylogen. Evol., 32, 246–263 (2004). North America’’ Vol. 1, Columbia University Press, New 13) Sugita, M., Sugiura, C., Arikawa, T., and Higuchi, M., York, p. 802 (1966). Molecular evidince of an rpoA gene in the basal moss 23) Crandall-Stotler, B., Morphogenesis, developmental chloroplast genomes: rpoA is a useful molecular marker anatomy and bryophyte phylogenetics: contraindications for phylogenetic analysis of mosses. Hikobia, 14, 171– of monophyly. J. Bryol., 14, 1–23 (1986). 175 (2004). 24) Smith, D. K., and Davison, P. G., Antheridia and 14) Arikawa, T., and Higuchi, M., Phylogenetic analysis of sporophytes in Takakia ceratophylla (Mitt.) Grolle: the Plagiotheciaceae (Musci) and its relatives based on evidence for reclassification among the mosses. J. rbcL gene sequences. Cryptogamie Bryol., 20, 231–245 Hattori Bot. Lab., 73, 263–271 (1993). (1999). 25) Cox, C. J., Goffinet, B., Shaw, J., and Boles, S., 15) Wolf, P. G., Rowe, C. L., and Hasebe, M., High levels Phylogenetic relationships among the mosses based on of RNA editing in a vascular plant chloroplast genome: heterogeneous Bayesian analysis of multiple genes from analysis of transcripts from the fern Adiantum capillus- multiple genomic compartments. System. Bot., 29, 234– veneris. Gene, 339, 89–97 (2004). 250 (2004). 16) Sugita, M., and Sugiura, M., Regulation of gene 26) Shaw, J., and Renzaglia, K., Phylogeny and diversifica- expression in chloroplasts of higher plants. Plant Mol. tion of bryophytes. Am. J. Bot., 91, 1557–1581 (2004). Biol., 32, 315–326 (1996). 27) Kenrick, P., and Crane, P. R., The origin and early 17) Maier, R. M., Neckermann, K., Igloi, G. H., and Ko¨ssel, evolution of plants on land. Nature, 389, 33–39 (1997). H., Complete sequence of the maize chloroplast genome: 28) Newton, A. E., Cox, C. J., Duckett, J. G., Wheeler, J. A., gene content, hotspots of divergence and fine tuning of Goffinet, B., Hedderson, T. A. J., and Mishler, B. D., genetic information by transcript editing. J. Mol. Biol., Evolution of major moss lineage phylogenetic analyses 251, 614–628 (1995). based on multiple gene sequences and morphology. 18) Calsa, T., Jr., Carraro, D. M., Benatti, M. R., Barbosa, A. Bryologist, 103, 187–211 (2000). C., Kitajima, J. P., and Carrer, H., Structural features and 29) Renzaglia, K., and Vaughn, K. C., Anatomy, develop- transcript-editing analysis of sugarcane (Saccharum ment and classification of hornworts. In ‘‘The Biology of officinarum L.) chloroplast genome. Curr. Genet., 46, Bryophytes,’’ eds. Shaw, J., and Goffinet, B., Cambridge 366–373 (2004). University Press, Cambridge, pp. 1–35 (2000).