DOCSLIB.ORG

Extensive RNA Editing in Transcripts from the Psbb Operon and Rpoa Gene of Plastids from the Enigmatic Moss Takakia Lepidozioides

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Extensive RNA Editing in Transcripts from the Psbb Operon and Rpoa Gene of Plastids from the Enigmatic Moss Takakia Lepidozioides Biosci. Biotechnol. Biochem., 70 (9), 2268–2274, 2006 Extensive RNA Editing in Transcripts from the PsbB Operon and RpoA Gene of Plastids from the Enigmatic Moss Takakia lepidozioides y Mamoru SUGITA,1; Yuki MIYATA,1 Kaori MARUYAMA,1 Chika SUGIURA,1 Tomotsugu ARIKAWA,2 and Masanobu HIGUCHI3 1Center for Gene Research, Nagoya University, Chikusa-ku, Nagoya 464-8602, Japan 2Department of Biology, Keio University, 4-1-1 Hiyoshi, Kohoku-ku, Yokohama 223-8521, Japan 3Department of Botany, National Science Museum, Amakubo 4-1-1, Tsukuba 305-0005, Japan Received April 10, 2006; Accepted May 18, 2006; Online Publication, September 7, 2006 [doi:10.1271/bbb.60204] RNA editing is a post-transcriptional process that been found in plastid RNAs of A. angustus.11) Recently, changes individual nucleotides in transcripts, and potentially heavy RNA editing was predicted in the usually occurs in the plastids of land plants. The mitochondrial nad1 gene of the moss Takakia lepido- number of RNA editing sites in a plastid is significantly zioides.12) We also found possible RNA editing sites in divergent in bryophytes, ranging from zero in liver- the T. lepidozioides plastid genes, rpoA (encoding the worts to almost 1,000 sites in hornworts. In this study, subunit of plastid RNA polymerase) and petD (encod- we identified 132 RNA editing sites in the transcripts of ing the subunit IV of cytochrome b6=f complex), and six genes from the psbB operon and the rpoA of the moss RNA editing was predicted to generate new stop codons Takakia lepidozioides. This is the highest number of in the transcripts of these genes.13) This strongly RNA editing sites known in this region among land suggests that frequent RNA editing occurs in Takakia plant species. All were cytidine-to-uridine conversions. plastids. More than 91% of RNA editing occurred at the first or In this study, we identified 132 RNA editing sites in second codon positions, and it altered amino acid the transcripts from six genes containing rpoA and petD identity. Six editing sites created new translation of T. lepidozioides. This finding might help to resolve initiation codons or stop codons. Thirty-two sites were the phylogenetic position of the enigmatic bryophyte commonly observed in the hornwort Anthoceros angus- genus, Takakia. tus. This finding suggests that the enigmatic bryophyte Takakia is closely related to hornworts with respect to Materials and Methods RNA editing events. DNA extraction and analysis. Takakia lepidozioides Key words: cytidine-to-uridine conversion; moss; plas- S. Hatt. & Inoue was collected in the field in Yu-shan, tid; RNA editing; Takakia lepidozioides Taiwan. Total cellular DNA from a small amount of T. lepidozioides (10 mg wet weight) was extracted as RNA editing is a post-transcriptional modification of described previously14) and used as a template for the nuclear, mitochondrial, or plastid transcripts, and occurs polymerase chain reaction (PCR) using appropriate in a wide range of organisms.1–3) About 30 sites, mostly primers (Table 1). PCR was performed with an initial involving cytidine (C) to uridine (U) transitions, have denaturation step at 95 C for 5 min, followed by 25 been identified in plastid genomes of the major vascular cycles of denaturation at 94 C for 1 min, annealing at plants.4) In contrast, the number of RNA editing sites 48 C for 1 min, and extension at 72 C for 1 min, with a is significantly divergent among the plastid genomes of final extension at 72 C for 2 min. The amplified DNA bryophytes that have been sequenced: the liverwort fragments were cloned into pGEM-T Easy plasmids Marchantia polymorpha,5) the hornwort Anthoceros (Promega, Madison, WI), and their sequences were angustus (formerly A. formosae),6) and the moss Phys- determined using M13 universal primers and internal comitrella patens.7) RNA editing appears to be absent sequence primers designed from sequences determined from the mitochondria and plastids of M. polymorpha,8) in this study (Table 1). DNA sequencing was performed and only two editing sites have been identified in the using the DYEnamic ET Terminator Cycle Sequencing plastids of P. patens.9,10) Surprisingly, extensive RNA Kit (Amersham Bioscience, Piscataway, NJ) and ABI editing, 509 C-to-U and 433 U-to-C conversions, has 3100 DNA sequencer. Sequence processing and contig y To whom correspondence should be addressed. Tel/Fax: +81-52-789-3080; E-mail: [email protected] Extensive RNA Editing in Takakia Plastids 2269 Table 1. Primers Used for Plastid DNA, and cDNA Amplification and Sequencing DNA fragment Name of primer Sequence (50 ! 30) Ref. For amplification of plastid DNA Fragment 1 Tl-psbT AACCACCTAAAGTTCCCAGCAAAG AF193624 (3163 bp) petD-l GCCGGTTCACCAATCATGGA AB193121 Fragment 2 H-psbB-u CTGCTTTAGTTTCTGGTTGGG AB086179 (1676 bp) psbT-l TTTGCTCGGAACTTTAGGTGG This study Fragment 3 H-clpP-l CGTTTAGTAATCTCTCCTCCAG AB086179 (1754 bp) psbB-l CCGCATTAGTTACAGTTTCTCC This study For amplification of cDNA psbB cDNA-psbB/T-1 TTGTTTCGGATTTGGAGCATTC This study cDNA-pabB/T-2 GACTACTACGAAAAACGCCATC This study psbB-psbT cDNA-psbB-u GCGTAGTTATTAAATGCAAAAAAG This study cDNA-psbT-l AATGAACGGAATGAGACTTATC This study psbN cDNA-psbN-u CTATTATATCGGAAACAAACCATTA This study cDNA-psbN-l CCGAAAATTAAGGGAAGGTCAT This study psbH cDNA-psbH-u AACCACCTAAAGTTCCGAGCAAAG This study cDNA-psbH-l TCCTTTATTTGATTGATCGCAC This study petB cDNA-petB-u CGGAACCTTATAATTCTTCT This study cDNA-petB-l GACAGAAACTCGTGATAAGAAAC This study petD cDNA-petD-u TGAGAGAGAATGGATTATGGGAG This study cDNA-petD-l AGGAAGGAGAGGTGGCAGTC AB193121 rpoA cDNA-rpoA-u TGCTACGAAACAAATACTCCCTA AB193121 cDNA-rpoA-l ACCTCCCAAGAAAAGACGTGTATAA AB193121 For internal sequencing clpP-psbB-1 TTTTCAATGAGAGGTAATGTATC This study clpP-psbB-2 GGCTCCGTTAAACTTCCAGAC This study psbB-psbT TATCGCAGCAGGTATTCCAG This study psbT-u ATGCAATAAGTTCCACGGCT This study assembly were performed using Genetyx-Mac 9.0 cDNA), AB254138 (petB cDNA), AB254139 (petD (Software Development, Tokyo, Japan) and Sequencer cDNA), and AB254140 (rpoA cDNA). 3.0 software (Gene Codes, Ann Arbor, MI). Results RNA extraction and reverse-transcription PCR. A small amount of T. lepidozioides was frozen and ground Prediction of RNA editing sites with a mortal and a pestle. The resulting powder was In a previous study, we found numerous possible treated with Isogen (Nippon Gene, Toyama, Japan), and RNA editing sites in the rpoA and petD genes of RNA was extracted according to the manufacturer’s Takakia,13) suggesting that a high frequency of RNA protocol. To remove residual DNA contamination, the editing occurs in Takakia plastids. To confirm this, we RNA preparation was treated with RNase-free DNase I amplified and sequenced three plastid DNA fragments (TaKaRa, Kyoto, Japan) at 37 C for 30 min, and then at that encompassed a 6.4 kb region from the second exon 70 C for 10 min. of clpP (encoding ATP-dependent protease proteolytic cDNA synthesis was carried out as described pre- subunit) to the 30-exon of petD (Fig. 1). The gene viously.9) Single-strand cDNA was prepared from arrangement from clpP to rpoA in Takakia is conserved DNase I-treated total cellular RNA using an AMV among most land plant species, except for P. patens. Reverse Transcriptase First-strand cDNA Synthesis Kit Based on alignment of the amino acid sequences (Life Sciences, Petersburg, Fl) and random primers (Life deduced from seven Takakia plastid genes with those Sciences). cDNA was amplified by PCR using appro- from the genes or cDNAs of M. polymorpha,5) A. an- priate primers (Table 1), as described previously,9) and gustus,6) P. patens,7) and the fern Adiantum capillus- subjected to direct sequencing. veneris,15) we predicted 124 RNA editing sites of C-to-U in the first or second codon positions. An U-to-C Identification of RNA editing sites. RNA editing was conversion was also predicted in the 253rd codon of analyzed by comparing each cDNA sequence with that rpoA (Table 2). To confirm the occurrence of RNA of genomic DNA. When the sequences did not match, editing in the psbB (encoding photosystem II (PSII) the genomic DNA and cDNA were reamplified and 47 kDa protein), psbT (encoding PSII T-protein), psbN reexamined. Nucleotide sequence data were deposited (encoding PSII N-protein), psbH (encoding PSII H- in the DDBJ/EMBL/GenBank databases, accession protein), petB (encoding cytochrome b6), petD, and nos. AB254134 (plastid DNA), AB254135 (psbB-psbT rpoA transcripts, cDNAs were amplified and their cDNA), AB254136 (psbH cDNA), AB254137 (psbN sequences were determined by direct sequencing. The 2270 M. SUGITA et al. Fig. 1. Gene Arrangement of the Region Spanning clpP to rpoA in the Takakia Plastid Genome. The filled boxes indicate the translated regions of each gene and the open boxes represent introns. The psbB, psbT, psbH, petB, and petD genes were transcribed from left to right, and the rpoA, psbN, and clpP genes were transcribed in the opposite direction. RNA editing sites that generate translation initiation and stop codons are marked as open circles and stars respectively. The three fragments were amplified by PCR, and the sequences deposited in the DNA databases (AB193121 and AF193624) are indicated under the gene map. Table 2. List of RNA Editing Sites in the Transcripts of T. lepidozioides Editing sites that were not predicted are indicated as ‘‘NP,’’ and those that did not alter the amino acid coding are indicated as ‘‘silent.’’ Double editing sites are indicated as ‘‘double.’’ Unedited sites that were predicted are indicated as ‘‘not edited.’’ The positions of edited codons were
Load more

Recommended publications
  • 1. TAKAKIACEAE S. Hattori & Inoue
    1. TAKAKIACEAE S. Hattori & Inoue John R. Spence Wilfred B. Schofield Stems erect, arising sympodially from creeping pale or white stolons bearing clusters of beaked slime cells, rhizoids absent, stem in cross section differentiated into outer layer of smaller, thick- walled cells and cortex of larger thin-walled cells, sometimes with small central cells, these often with trigones, outer cells with simple oil droplets. Leaves typically 3-ranked, terete, forked, of (1–)2–4 terete segments, segments sometimes connate at base, in cross section of 3–5 cells, one or more larger central cells surrounded by smaller cells, oil droplets present in all cells, 2-celled slime hairs with enlarged apical cell present in axils of leaves. Specialized asexual reproduction by caducous leaves or stems. Sexual condition dioicous, gametangia naked. Seta with foot, persistent, elongating prior to capsule maturation. Capsule erect, symmetric, well-defined neck region absent, stomates absent, dextrorsely spiralled at maturity, columella ephemeral, basifixed, not penetrating the archesporial tissue, peristome absent, dehiscence by longitudinal helical slit. Calyptra fugacious to rarely persistent, typically mitrate. Spores 3-radiate, slightly roughened to papillose. Genus 1, species 2 (2 in the flora): North America, se Asia (including Borneo). Takakiaceae are plants of cool, cold-temperate to arctic-alpine oceanic climates. They were first collected in the Himalayas by J. D. Hooker and placed in the hepatic genus Lepidozia as L. ceratophylla by W. Mitten. The consensus has been that it was a highly unusual liverwort with affinity to the Calobryales. Distinctive features include erect shoots arising from a stolon, terete leaves, sometimes fused at or near the base and thus of 2–4 segments, naked lateral gametangia, slime cells, oil droplets, and chromosome numbers of n = 4 or 5.
    [Show full text]
  • Early Evolution of the Land Plant Circadian Clock
    Research Early evolution of the land plant circadian clock Anna-Malin Linde1,2*, D. Magnus Eklund1,2*, Akane Kubota3*, Eric R. A. Pederson1,2, Karl Holm1,2, Niclas Gyllenstrand1,2, Ryuichi Nishihama3, Nils Cronberg4, Tomoaki Muranaka5, Tokitaka Oyama5, Takayuki Kohchi3 and Ulf Lagercrantz1,2 1Department of Plant Ecology and Evolution, Evolutionary Biology Centre, Uppsala University, Norbyv€agen 18D, SE-75236 Uppsala, Sweden; 2The Linnean Centre for Plant Biology in Uppsala, Uppsala, Sweden; 3Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan; 4Department of Biology, Lund University, Ecology Building, SE-22362 Lund, Sweden; 5Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan Summary Author for correspondence: While angiosperm clocks can be described as an intricate network of interlocked transcrip- Ulf Lagercrantz tional feedback loops, clocks of green algae have been modelled as a loop of only two genes. Tel: +46(0)18 471 6418 To investigate the transition from a simple clock in algae to a complex one in angiosperms, we Email: [email protected] performed an inventory of circadian clock genes in bryophytes and charophytes. Additionally, Received: 14 December 2016 we performed functional characterization of putative core clock genes in the liverwort Accepted: 18 January 2017 Marchantia polymorpha and the hornwort Anthoceros agrestis. Phylogenetic construction was combined with studies of spatiotemporal expression patterns New Phytologist (2017) 216: 576–590 and analysis of M. polymorpha clock gene mutants. doi: 10.1111/nph.14487 Homologues to core clock genes identified in Arabidopsis were found not only in bryophytes but also in charophytes, albeit in fewer copies. Circadian rhythms were detected Key words: bryophyte, circadian clock, for most identified genes in M.
    [Show full text]
  • JUDD W.S. Et. Al. (2002) Plant Systematics: a Phylogenetic Approach. Chapter 7. an Overview of Green
    UNCORRECTED PAGE PROOFS An Overview of Green Plant Phylogeny he word plant is commonly used to refer to any auto- trophic eukaryotic organism capable of converting light energy into chemical energy via the process of photosynthe- sis. More specifically, these organisms produce carbohydrates from carbon dioxide and water in the presence of chlorophyll inside of organelles called chloroplasts. Sometimes the term plant is extended to include autotrophic prokaryotic forms, especially the (eu)bacterial lineage known as the cyanobacteria (or blue- green algae). Many traditional botany textbooks even include the fungi, which differ dramatically in being heterotrophic eukaryotic organisms that enzymatically break down living or dead organic material and then absorb the simpler products. Fungi appear to be more closely related to animals, another lineage of heterotrophs characterized by eating other organisms and digesting them inter- nally. In this chapter we first briefly discuss the origin and evolution of several separately evolved plant lineages, both to acquaint you with these important branches of the tree of life and to help put the green plant lineage in broad phylogenetic perspective. We then focus attention on the evolution of green plants, emphasizing sev- eral critical transitions. Specifically, we concentrate on the origins of land plants (embryophytes), of vascular plants (tracheophytes), of 1 UNCORRECTED PAGE PROOFS 2 CHAPTER SEVEN seed plants (spermatophytes), and of flowering plants dons.” In some cases it is possible to abandon such (angiosperms). names entirely, but in others it is tempting to retain Although knowledge of fossil plants is critical to a them, either as common names for certain forms of orga- deep understanding of each of these shifts and some key nization (e.g., the “bryophytic” life cycle), or to refer to a fossils are mentioned, much of our discussion focuses on clade (e.g., applying “gymnosperms” to a hypothesized extant groups.
    [Show full text]
  • Extant Diversity of Bryophytes Emerged from Successive Post-Mesozoic Diversification Bursts
    ARTICLE Received 20 Mar 2014 | Accepted 3 Sep 2014 | Published 27 Oct 2014 DOI: 10.1038/ncomms6134 Extant diversity of bryophytes emerged from successive post-Mesozoic diversification bursts B. Laenen1,2, B. Shaw3, H. Schneider4, B. Goffinet5, E. Paradis6,A.De´samore´1,2, J. Heinrichs7, J.C. Villarreal7, S.R. Gradstein8, S.F. McDaniel9, D.G. Long10, L.L. Forrest10, M.L. Hollingsworth10, B. Crandall-Stotler11, E.C. Davis9, J. Engel12, M. Von Konrat12, E.D. Cooper13, J. Patin˜o1, C.J. Cox14, A. Vanderpoorten1,* & A.J. Shaw3,* Unraveling the macroevolutionary history of bryophytes, which arose soon after the origin of land plants but exhibit substantially lower species richness than the more recently derived angiosperms, has been challenged by the scarce fossil record. Here we demonstrate that overall estimates of net species diversification are approximately half those reported in ferns and B30% those described for angiosperms. Nevertheless, statistical rate analyses on time- calibrated large-scale phylogenies reveal that mosses and liverworts underwent bursts of diversification since the mid-Mesozoic. The diversification rates further increase in specific lineages towards the Cenozoic to reach, in the most recently derived lineages, values that are comparable to those reported in angiosperms. This suggests that low diversification rates do not fully account for current patterns of bryophyte species richness, and we hypothesize that, as in gymnosperms, the low extant bryophyte species richness also results from massive extinctions. 1 Department of Conservation Biology and Evolution, Institute of Botany, University of Lie`ge, Lie`ge 4000, Belgium. 2 Institut fu¨r Systematische Botanik, University of Zu¨rich, Zu¨rich 8008, Switzerland.
    [Show full text]
  • Volume 1, Chapter 2-4: Bryophyta
    Glime, J. M. 2017. Bryophyta - Takakiopsida. Chapt. 2-4. In: Glime, J. M. Bryophyte Ecology. Volume 1. Physiological Ecology. 2-4-1 Ebook sponsored by Michigan Technological University and the International Association of Bryologists. Last updated 9 April 2021 and available at <http://digitalcommons.mtu.edu/bryophyte-ecology/>. CHAPTER 2-4 BRYOPHYTA – TAKAKIOPSIDA TABLE OF CONTENTS Phylum Bryophyta .............................................................................................................................................. 2-4-2 Class Takakiopsida...................................................................................................................................... 2-4-2 Summary ........................................................................................................................................................... 2-4-10 Acknowledgments............................................................................................................................................. 2-4-10 Literature Cited ................................................................................................................................................. 2-4-10 2-4-2 Chapter 2-4: Bryophyta - Takakiopsida CHAPTER 2-4 BRYOPHYTA – TAKAKIOPSIDA Figure 1. Mt. Daisetsu from Kogan Spa, Hokkaido, Japan. The foggy peak of Mt. Daisetsu is the home of Takakia lepidozioides. Photo by Janice Glime. the Bryopsida, Andreaeopsida, and Sphagnopsida (Crum 1991). However, as more evidence from genetic and biochemical relationships
    [Show full text]
  • Morphology Supports the Setaphyte Hypothesis: Mosses Plus Liverworts Form a Natural Group
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/329947849 Morphology supports the setaphyte hypothesis: mosses plus liverworts form a natural group Article · December 2018 DOI: 10.11646/bde.40.2.1 CITATION READS 1 713 3 authors: Karen S Renzaglia Juan Carlos Villarreal Southern Illinois University Carbondale Laval University 139 PUBLICATIONS 3,181 CITATIONS 64 PUBLICATIONS 1,894 CITATIONS SEE PROFILE SEE PROFILE David J. Garbary St. Francis Xavier University 227 PUBLICATIONS 3,461 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Ultrastructure and pectin composition of guard cell walls View project Integrating red macroalgae into land-based marine finfish aquaculture View project All content following this page was uploaded by Karen S Renzaglia on 27 December 2018. The user has requested enhancement of the downloaded file. Bry. Div. Evo. 40 (2): 011–017 ISSN 2381-9677 (print edition) DIVERSITY & http://www.mapress.com/j/bde BRYOPHYTEEVOLUTION Copyright © 2018 Magnolia Press Article ISSN 2381-9685 (online edition) https://doi.org/10.11646/bde.40.2.1 Morphology supports the setaphyte hypothesis: mosses plus liverworts form a natural group KAREN S. RENZAGLIA1, JUAN CARLOS VILLARREAL A.2,3 & DAVID J. GARBARY4 1 Department of Plant Biology, Southern Illinois University, Carbondale, Illinois, USA 2Département de Biologie, Institut de Biologie Intégrative et des Systèmes (IBIS), Université Laval, Québec, Canada 3 Smithsonian Tropical Research Institute, Panama, Panama 4 St. Francis Xavier University, Antigonish, Nova Scotia, Canada The origin and early diversification of land plants is one of the major unresolved problems in evolutionary biology.
    [Show full text]
  • BRYOPHYTES .Pdf
    Diversity of Microbes and Cryptogams Bryophyta Geeta Asthana Department of Botany, University of Lucknow, Lucknow – 226007 India Date of submission: May 11, 2006 Version: English Significant Key words: Bryophyta, Hepaticopsida (Liverworts), Anthocerotopsida (Hornworts), , Bryopsida (Mosses). 1 Contents 1. Introduction • Definition & Systematic Position in the Plant Kingdom • Alternation of Generation • Life-cycle Pattern • Affinities with Algae and Pteridophytes • General Characters 2. Classification 3. Class – Hepaticopsida • General characters • Classification o Order – Calobryales o Order – Jungermanniales – Frullania o Order – Metzgeriales – Pellia o Order – Monocleales o Order – Sphaerocarpales o Order – Marchantiales – Marchantia 4. Class – Anthocerotopsida • General Characters • Classification o Order – Anthocerotales – Anthoceros 5. Class – Bryopsida • General Characters • Classification o Order – Sphagnales – Sphagnum o Order – Andreaeales – Andreaea o Order – Takakiales – Takakia o Order – Polytrichales – Pogonatum, Polytrichum o Order – Buxbaumiales – Buxbaumia o Order – Bryales – Funaria 6. References 2 Introduction Bryophytes are “Avascular Archegoniate Cryptogams” which constitute a large group of highly diversified plants. Systematic position in the plant kingdom The plant kingdom has been classified variously from time to time. The early systems of classification were mostly artificial in which the plants were grouped for the sake of convenience based on (observable) evident characters. Carolus Linnaeus (1753) classified
    [Show full text]
  • Bryological Times
    The Bryological Times Volume 146 President’s Message – In This Issue – Bernard Goffinet | University of President’s Message ........................................ 1 Connecticut | Storrs, U.S.A. | Fieldwork in the Cook Islands of the [email protected] South Pacific ....................................................... 2 News from the Hattori Botanical Every day important contributions to our Laboratory .......................................................... 4 understanding of the biology of bryophytes are Bryophytes at the IBC, Shenzhen, China ..... disseminated through peer-review publications. Although bryology could benefit from more ................................................................................. 5 researchers devoted to it, bryophytes are not Paroicous inflorescence of a liverwort, understudied per se, but are widely overlooked or Liochlaena lanceolata Nees. .......................... 9 one could say transparent to a large part of the News from the IAB council ............................ 9 public and also our fellow colleague botanists. Hence it is important that bryologists engage in The joint social event of IAB and the activities promoting an awareness of bryophytes Bryological Society of China ...................... 10 and advances unraveling their evolutionary history Review of Bryophyte Ecology, Vol. 1 ....... 12 and diversity, the genetic networks underlying their Peru bryology travel log.............................. 12 ontogeny, their unique physiological properties and their interactions
    [Show full text]
  • Phytochrome Diversity in Green Plants and the Origin of Canonical Plant Phytochromes
    ARTICLE Received 25 Feb 2015 | Accepted 19 Jun 2015 | Published 28 Jul 2015 DOI: 10.1038/ncomms8852 OPEN Phytochrome diversity in green plants and the origin of canonical plant phytochromes Fay-Wei Li1, Michael Melkonian2, Carl J. Rothfels3, Juan Carlos Villarreal4, Dennis W. Stevenson5, Sean W. Graham6, Gane Ka-Shu Wong7,8,9, Kathleen M. Pryer1 & Sarah Mathews10,w Phytochromes are red/far-red photoreceptors that play essential roles in diverse plant morphogenetic and physiological responses to light. Despite their functional significance, phytochrome diversity and evolution across photosynthetic eukaryotes remain poorly understood. Using newly available transcriptomic and genomic data we show that canonical plant phytochromes originated in a common ancestor of streptophytes (charophyte algae and land plants). Phytochromes in charophyte algae are structurally diverse, including canonical and non-canonical forms, whereas in land plants, phytochrome structure is highly conserved. Liverworts, hornworts and Selaginella apparently possess a single phytochrome, whereas independent gene duplications occurred within mosses, lycopods, ferns and seed plants, leading to diverse phytochrome families in these clades. Surprisingly, the phytochrome portions of algal and land plant neochromes, a chimera of phytochrome and phototropin, appear to share a common origin. Our results reveal novel phytochrome clades and establish the basis for understanding phytochrome functional evolution in land plants and their algal relatives. 1 Department of Biology, Duke University, Durham, North Carolina 27708, USA. 2 Botany Department, Cologne Biocenter, University of Cologne, 50674 Cologne, Germany. 3 University Herbarium and Department of Integrative Biology, University of California, Berkeley, California 94720, USA. 4 Royal Botanic Gardens Edinburgh, Edinburgh EH3 5LR, UK. 5 New York Botanical Garden, Bronx, New York 10458, USA.
    [Show full text]
  • Paraphyly of Bryophytes and Close Relationship
    Arctoa (2002) 11: 31-43 PARAPHYLY OF BRYOPHYTES AND CLOSE RELATIONSHIP OF HORNWORTS AND VASCULAR PLANTS INFERRED FROM ANALYSIS OF CHLOROPLAST rDNA ITS (cpITS) SEQUENCES ÏÀÐÀÔÈËÅÒÈ×ÍÎÑÒÜ ÌÎÕÎÎÁÐÀÇÍÛÕ È ÁËÈÇÊÎÅ ÐÎÄÑÒÂÎ ÀÍÒÎÖÅÐÎÒÎÂÛÕ È ÑÎÑÓÄÈÑÒÛÕ ÐÀÑÒÅÍÈÉ: ÄÀÍÍÛÅ ÀÍÀËÈÇÀ ÏÎÑËÅÄÎÂÀÒÅËÜÍÎÑÒÅÉ ÕËÎÐÎÏËÀÑÒÍÛÕ ÑÏÅÉÑÅÐΠðÄÍÊ T.KH.SAMIGULLIN1, S.P.YACENTYUK1, G.V.DEGTYARYEVA2, K.M.VALIEHO- ROMAN1, V.K.BOBROVA1, I.CAPESIUS3, W.F.MARTIN4, A.V.TROITSKY1, V.R.FILIN2, A.S.ANTONOV1 Ò.Õ.ÑÀÌÈÃÓËËÈÍ1, Ñ.Ï.ßÖÅÍÒÞÊ1, Ã.Â.ÄÅÃÒßÐÅÂÀ2, Ê.Ì.ÂÀËÜÅÕÎ- ÐÎÌÀÍ1, Â.Ê.ÁÎÁÐÎÂÀ1, È.ÊÀÏÅÑÈÓÑ3, Â. Ô. ÌÀÐÒÈÍ4, À.Â.ÒÐÎÈÖÊÈÉ1, Â.Ð.ÔÈËÈÍ2, À.Ñ.ÀÍÒÎÍÎÂ1 Abstract Phylogenetic analysis of nucleotide sequences of chloroplast rDNA internal transcribed spacer (cpITS) regions (cpITS2-4) of 14 species of liverworts, 4 species of hornworts, 20 species of mosses, 7 species of lycopods and 2 species of algae was carried out. Phylogenetic trees constructed by maximum parsimony, maximum likelihood and neighbour-joining methods indicated that bryophytes are not monophyletic. The cpITS data suggest that the hepatic lineage branches most deeply in the land plant topology and that mosses are monophyletic, forming the sister group of lycopods and hornworts. Within the mosses, a conspicuous deletion with distinct phylogenetic distribution was observed in the cpITS3 region. This deletion is absent in other land plants, including the enigmatic genus Takakia, and marks Takakia as an evolutionary lineage distinct from mosses. Ðåçþìå Ïðîâåäåí ôèëîãåíåòè÷åñêèé àíàëèç íóêëåîòèäíûõ ïîñëåäîâàòåëüíîñòåé ñïåéñåðîâ õëîðîïëàñòíîé ðÄÍÊ (cpITS2-4) ó 14 âèäîâ ïå÷åíî÷íèêîâ, 4 âèäîâ àíòîöåðîòîâûõ, 20 âèäîâ ìõîâ, 7 âèäîâ ïëàóíîâèäíûõ è 2 âèäîâ õàðîâûõ âîäîðîñëåé.
    [Show full text]
  • TAS3 Mir390-Dependent Loci in Non-Vascular Land Plants: Towards a Comprehensive Reconstruction of the Gene Evolutionary History
    TAS3 miR390-dependent loci in non-vascular land plants: towards a comprehensive reconstruction of the gene evolutionary history Sergey Y. Morozov1, Irina A. Milyutina1, Tatiana N. Erokhina2, Liudmila V. Ozerova3, Alexey V. Troitsky1 and Andrey G. Solovyev1,4 1 Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, Russia 2 Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Science, Moscow, Russia 3 Tsitsin Main Botanical Garden, Russian Academy of Science, Moscow, Russia 4 Institute of Molecular Medicine, Sechenov First Moscow State Medical University, Moscow, Russia ABSTRACT Trans-acting small interfering RNAs (ta-siRNAs) are transcribed from protein non- coding genomic TAS loci and belong to a plant-specific class of endogenous small RNAs. These siRNAs have been found to regulate gene expression in most taxa including seed plants, gymnosperms, ferns and mosses. In this study, bioinformatic and experimental PCR-based approaches were used as tools to analyze TAS3 and TAS6 loci in transcriptomes and genomic DNAs from representatives of evolutionary distant non-vascular plant taxa such as Bryophyta, Marchantiophyta and Anthocero- tophyta. We revealed previously undiscovered TAS3 loci in plant classes Sphagnopsida and Anthocerotopsida, as well as TAS6 loci in Bryophyta classes Tetraphidiopsida, Polytrichopsida, Andreaeopsida and Takakiopsida. These data further unveil the evolutionary pathway of the miR390-dependent TAS3 loci in land plants. We also identified charophyte alga sequences coding for SUPPRESSOR OF GENE SILENCING 3 (SGS3), which is required for generation of ta-siRNAs in plants, and hypothesized that the appearance of TAS3-related sequences could take place at a very early step in Submitted 19 February 2018 evolutionary transition from charophyte algae to an earliest common ancestor of land Accepted 28 March 2018 plants.
    [Show full text]
  • Sporophytes of Takakia Ceratophylla Found in China
    J Hattori Bot. Lab. No. 84: 57- 69 (July 1998) SPOROPHYTES OF TAKAKIA CERATOPHYLLA FOUND IN CHINA MASANOBU H!GUCHI 1 AND DA-CHENG ZHA a2 ABSTRACT . Results of morphological and anatomical studies of the sporophytes of Takakia cerato­ phy/la are presented based on Chinese plants. Taxonomic relationship of Takakia is discussed. Takakia ceratophylla has a unique capsule-wall thickening which functionally causes the incurve of valves. There is a regular spiral line of dehiscence on the capsule which is derived from two rows of epidermal cells less incra ssate at maturity and also on the green capsule. Spiral twisting of the cap­ sule and seta seems to be useful for more efficient spore dispersal. In several features the sporophytes of Chinese populations of this species are larger than those of the Aleutians. Takakia ceratophylla (Mitt.) Grolle has been known from Sikkim (Grolle 1963), East Nepal (Hattori et al. I973) and the Aleutian Islands (Sharp & Hattori 1967, Persson 1968, Smith 1978). In 1994, we made field researches in the north-western part of Yunnan Province, China. Fortunately we could find sporophytes and antheridial plants of Takakia ceratophylla at Mt. Meilixueshan, situated on the boundary between Yunnan and Tibet (Higuchi & Zhang 1994). This is the second discovery of the sporophytes of T ceratophyl­ la following the report from Atka Island, Aleutian Islands (Smith 1990, Smith & Davison 1993). It seems that Takakia has a higher level of sexual reproduction than was previously considered (cf. Hattori et al. 1974). D ESCRIPTION OF SPOROPHYTES Takakia ceratophylla (Mitt.) Grolle, Osterr. Bot. Zeitschr. 110 (4): 445, 1963.
    [Show full text]