Biosci. Biotechnol. Biochem., 70 (9), 2268–2274, 2006 Extensive RNA Editing in Transcripts from the PsbB Operon and RpoA Gene of Plastids from the Enigmatic Moss Takakia lepidozioides y Mamoru SUGITA,1; Yuki MIYATA,1 Kaori MARUYAMA,1 Chika SUGIURA,1 Tomotsugu ARIKAWA,2 and Masanobu HIGUCHI3 1Center for Gene Research, Nagoya University, Chikusa-ku, Nagoya 464-8602, Japan 2Department of Biology, Keio University, 4-1-1 Hiyoshi, Kohoku-ku, Yokohama 223-8521, Japan 3Department of Botany, National Science Museum, Amakubo 4-1-1, Tsukuba 305-0005, Japan Received April 10, 2006; Accepted May 18, 2006; Online Publication, September 7, 2006 [doi:10.1271/bbb.60204] RNA editing is a post-transcriptional process that been found in plastid RNAs of A. angustus.11) Recently, changes individual nucleotides in transcripts, and potentially heavy RNA editing was predicted in the usually occurs in the plastids of land plants. The mitochondrial nad1 gene of the moss Takakia lepido- number of RNA editing sites in a plastid is significantly zioides.12) We also found possible RNA editing sites in divergent in bryophytes, ranging from zero in liver- the T. lepidozioides plastid genes, rpoA (encoding the worts to almost 1,000 sites in hornworts. In this study, subunit of plastid RNA polymerase) and petD (encod- we identified 132 RNA editing sites in the transcripts of ing the subunit IV of cytochrome b6=f complex), and six genes from the psbB operon and the rpoA of the moss RNA editing was predicted to generate new stop codons Takakia lepidozioides. This is the highest number of in the transcripts of these genes.13) This strongly RNA editing sites known in this region among land suggests that frequent RNA editing occurs in Takakia plant species. All were cytidine-to-uridine conversions. plastids. More than 91% of RNA editing occurred at the first or In this study, we identified 132 RNA editing sites in second codon positions, and it altered amino acid the transcripts from six genes containing rpoA and petD identity. Six editing sites created new translation of T. lepidozioides. This finding might help to resolve initiation codons or stop codons. Thirty-two sites were the phylogenetic position of the enigmatic bryophyte commonly observed in the hornwort Anthoceros angus- genus, Takakia. tus. This finding suggests that the enigmatic bryophyte Takakia is closely related to hornworts with respect to Materials and Methods RNA editing events. DNA extraction and analysis. Takakia lepidozioides Key words: cytidine-to-uridine conversion; moss; plas- S. Hatt. & Inoue was collected in the field in Yu-shan, tid; RNA editing; Takakia lepidozioides Taiwan. Total cellular DNA from a small amount of T. lepidozioides (10 mg wet weight) was extracted as RNA editing is a post-transcriptional modification of described previously14) and used as a template for the nuclear, mitochondrial, or plastid transcripts, and occurs polymerase chain reaction (PCR) using appropriate in a wide range of organisms.1–3) About 30 sites, mostly primers (Table 1). PCR was performed with an initial involving cytidine (C) to uridine (U) transitions, have denaturation step at 95 C for 5 min, followed by 25 been identified in plastid genomes of the major vascular cycles of denaturation at 94 C for 1 min, annealing at plants.4) In contrast, the number of RNA editing sites 48 C for 1 min, and extension at 72 C for 1 min, with a is significantly divergent among the plastid genomes of final extension at 72 C for 2 min. The amplified DNA bryophytes that have been sequenced: the liverwort fragments were cloned into pGEM-T Easy plasmids Marchantia polymorpha,5) the hornwort Anthoceros (Promega, Madison, WI), and their sequences were angustus (formerly A. formosae),6) and the moss Phys- determined using M13 universal primers and internal comitrella patens.7) RNA editing appears to be absent sequence primers designed from sequences determined from the mitochondria and plastids of M. polymorpha,8) in this study (Table 1). DNA sequencing was performed and only two editing sites have been identified in the using the DYEnamic ET Terminator Cycle Sequencing plastids of P. patens.9,10) Surprisingly, extensive RNA Kit (Amersham Bioscience, Piscataway, NJ) and ABI editing, 509 C-to-U and 433 U-to-C conversions, has 3100 DNA sequencer. Sequence processing and contig y To whom correspondence should be addressed. Tel/Fax: +81-52-789-3080; E-mail: [email protected] Extensive RNA Editing in Takakia Plastids 2269 Table 1. Primers Used for Plastid DNA, and cDNA Amplification and Sequencing DNA fragment Name of primer Sequence (50 ! 30) Ref. For amplification of plastid DNA Fragment 1 Tl-psbT AACCACCTAAAGTTCCCAGCAAAG AF193624 (3163 bp) petD-l GCCGGTTCACCAATCATGGA AB193121 Fragment 2 H-psbB-u CTGCTTTAGTTTCTGGTTGGG AB086179 (1676 bp) psbT-l TTTGCTCGGAACTTTAGGTGG This study Fragment 3 H-clpP-l CGTTTAGTAATCTCTCCTCCAG AB086179 (1754 bp) psbB-l CCGCATTAGTTACAGTTTCTCC This study For amplification of cDNA psbB cDNA-psbB/T-1 TTGTTTCGGATTTGGAGCATTC This study cDNA-pabB/T-2 GACTACTACGAAAAACGCCATC This study psbB-psbT cDNA-psbB-u GCGTAGTTATTAAATGCAAAAAAG This study cDNA-psbT-l AATGAACGGAATGAGACTTATC This study psbN cDNA-psbN-u CTATTATATCGGAAACAAACCATTA This study cDNA-psbN-l CCGAAAATTAAGGGAAGGTCAT This study psbH cDNA-psbH-u AACCACCTAAAGTTCCGAGCAAAG This study cDNA-psbH-l TCCTTTATTTGATTGATCGCAC This study petB cDNA-petB-u CGGAACCTTATAATTCTTCT This study cDNA-petB-l GACAGAAACTCGTGATAAGAAAC This study petD cDNA-petD-u TGAGAGAGAATGGATTATGGGAG This study cDNA-petD-l AGGAAGGAGAGGTGGCAGTC AB193121 rpoA cDNA-rpoA-u TGCTACGAAACAAATACTCCCTA AB193121 cDNA-rpoA-l ACCTCCCAAGAAAAGACGTGTATAA AB193121 For internal sequencing clpP-psbB-1 TTTTCAATGAGAGGTAATGTATC This study clpP-psbB-2 GGCTCCGTTAAACTTCCAGAC This study psbB-psbT TATCGCAGCAGGTATTCCAG This study psbT-u ATGCAATAAGTTCCACGGCT This study assembly were performed using Genetyx-Mac 9.0 cDNA), AB254138 (petB cDNA), AB254139 (petD (Software Development, Tokyo, Japan) and Sequencer cDNA), and AB254140 (rpoA cDNA). 3.0 software (Gene Codes, Ann Arbor, MI). Results RNA extraction and reverse-transcription PCR. A small amount of T. lepidozioides was frozen and ground Prediction of RNA editing sites with a mortal and a pestle. The resulting powder was In a previous study, we found numerous possible treated with Isogen (Nippon Gene, Toyama, Japan), and RNA editing sites in the rpoA and petD genes of RNA was extracted according to the manufacturer’s Takakia,13) suggesting that a high frequency of RNA protocol. To remove residual DNA contamination, the editing occurs in Takakia plastids. To confirm this, we RNA preparation was treated with RNase-free DNase I amplified and sequenced three plastid DNA fragments (TaKaRa, Kyoto, Japan) at 37 C for 30 min, and then at that encompassed a 6.4 kb region from the second exon 70 C for 10 min. of clpP (encoding ATP-dependent protease proteolytic cDNA synthesis was carried out as described pre- subunit) to the 30-exon of petD (Fig. 1). The gene viously.9) Single-strand cDNA was prepared from arrangement from clpP to rpoA in Takakia is conserved DNase I-treated total cellular RNA using an AMV among most land plant species, except for P. patens. Reverse Transcriptase First-strand cDNA Synthesis Kit Based on alignment of the amino acid sequences (Life Sciences, Petersburg, Fl) and random primers (Life deduced from seven Takakia plastid genes with those Sciences). cDNA was amplified by PCR using appro- from the genes or cDNAs of M. polymorpha,5) A. an- priate primers (Table 1), as described previously,9) and gustus,6) P. patens,7) and the fern Adiantum capillus- subjected to direct sequencing. veneris,15) we predicted 124 RNA editing sites of C-to-U in the first or second codon positions. An U-to-C Identification of RNA editing sites. RNA editing was conversion was also predicted in the 253rd codon of analyzed by comparing each cDNA sequence with that rpoA (Table 2). To confirm the occurrence of RNA of genomic DNA. When the sequences did not match, editing in the psbB (encoding photosystem II (PSII) the genomic DNA and cDNA were reamplified and 47 kDa protein), psbT (encoding PSII T-protein), psbN reexamined. Nucleotide sequence data were deposited (encoding PSII N-protein), psbH (encoding PSII H- in the DDBJ/EMBL/GenBank databases, accession protein), petB (encoding cytochrome b6), petD, and nos. AB254134 (plastid DNA), AB254135 (psbB-psbT rpoA transcripts, cDNAs were amplified and their cDNA), AB254136 (psbH cDNA), AB254137 (psbN sequences were determined by direct sequencing. The 2270 M. SUGITA et al. Fig. 1. Gene Arrangement of the Region Spanning clpP to rpoA in the Takakia Plastid Genome. The filled boxes indicate the translated regions of each gene and the open boxes represent introns. The psbB, psbT, psbH, petB, and petD genes were transcribed from left to right, and the rpoA, psbN, and clpP genes were transcribed in the opposite direction. RNA editing sites that generate translation initiation and stop codons are marked as open circles and stars respectively. The three fragments were amplified by PCR, and the sequences deposited in the DNA databases (AB193121 and AF193624) are indicated under the gene map. Table 2. List of RNA Editing Sites in the Transcripts of T. lepidozioides Editing sites that were not predicted are indicated as ‘‘NP,’’ and those that did not alter the amino acid coding are indicated as ‘‘silent.’’ Double editing sites are indicated as ‘‘double.’’ Unedited sites that were predicted are indicated as ‘‘not edited.’’ The positions of edited codons were