Estrogen Receptor-<Alpha> Knockout Mice Exhibit Resistance To

Developmental Biology 238, 224–238 (2001) doi:10.1006/dbio.2001.0413, available online at http://www.idealibrary.com on View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Estrogen Receptor-␣ Knockout Mice Exhibit Resistance to the Developmental Effects of Neonatal Diethylstilbestrol Exposure on the Female Reproductive Tract

John F. Couse,*,† Darlene Dixon,‡ Mariana Yates,* Alicia B. Moore,‡ Liang Ma,§,1 Richard Maas,§ and Kenneth S. Korach*,2 *Receptor Biology Section, Laboratory of Reproductive and Developmental Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina 27709; †Department of Environmental and Molecular Toxicology, North Carolina State University, Raleigh, North Carolina 27695; ‡Comparative Pathobiology Section, Laboratory of Experimental Pathology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina 27709; and §Division of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School and Howard Hughes Medical Institute, Boston, Massachusetts 02115

Data indicate that estrogen-dependent and -independent pathways are involved in the teratogenic/carcinogenic syndrome that follows developmental exposure to 17␤-estradiol or diethylstilbestrol (DES), a synthetic estrogen. However, the exact role and extent to which each pathway contributes to the resulting pathology remain unknown. We employed the ␣ERKO mouse, which lacks estrogen receptor-␣ (ER␣), to discern the role of ER␣ and estrogen signaling in mediating the effects of neonatal DES exposure. The ␣ERKO provides the potential to expose DES actions mediated by the second known ER, ER␤, and those that are ER-independent. Wild-type and ␣ERKO females were treated with vehicle or DES (2 ␮g/pup/day for Days 1–5) and terminated after 5 days and 2, 4, 8, 12, and 20 months for biochemical and histomorphological analyses. Assays for uterine expression of the genes Hoxa10, Hoxa11, and Wnt7a shortly after treatment indicated signiﬁcant decreases in DES-treated wild-type but no effect in the ␣ERKO. In contrast, the DES effect on uterine expression of Wnt4 and Wnt5a was preserved in both genotypes, suggesting a developmental role for ER␤. Adult ␣ERKO mice exhibited complete resistance to the chronic effects of neonatal DES exposure exhibited in treated wild-type animals, including atrophy, decreased weight, smooth muscle disorganization, and epithelial squamous metaplasia in the uterus; proliferative lesions of the oviduct; and persistent vaginal corniﬁcation. Therefore, the lack of DES effects on gene expression and tissue differentiation in the ␣ERKO provides unequivocal evidence of an obligatory role for ER␣ in mediating the detrimental actions of neonatal DES exposure in the murine reproductive tract. © 2001 Academic Press Key Words: estrogen receptor; diethylstilbestrol; teratogenesis; uterus; Hox; Wnt.

INTRODUCTION dogenous and synthetic estrogens, respectively, as carcino- gens and teratogens in humans and laboratory animals Laboratory and epidemiological studies have clearly im- (IARC, 1979, 1987; Marselos and Tomatis, 1992, 1993).

plicated 17␤-estradiol (E2) and diethylstilbestrol (DES), en- Beginning in the 1940s, DES was prescribed during pregnancy to maintain placental steroid production and thereby 1 Present address: Tulane University, Department of Cell and Molecular Biology, 2000 Percival Stern Hall, 6400 Freret Street, New Orleans, LA 70118. 2 To whom correspondence should be addressed at National ogy, Receptor Biology Section, MD B3-02, P.O. Box 12233, Re- Institutes of Health, National Institute of Environmental Health search Triangle Park, NC 27709. Fax: (919) 541-0696. E-mail: Sciences, Laboratory of Reproductive and Developmental Toxicol- [email protected].

0012-1606/01 $35.00 Copyright © 2001 by Academic Press 224 All rights of reproduction in any form reserved. Effects of DES in the ␣ERKO Female Mouse 225 lessen the risk of spontaneous abortion or preterm parturi- classical ER (now termed ER␣) (Gigue`re et al., 1998); and (2) tion (Marselos and Tomatis, 1992). Despite a 1953 report of the unique ability of DES to suppress the transactivational the ineffectiveness of DES for this indication (Dieckmann activity of the orphan nuclear receptors ERR␣, ERR␤, and et al., 1953), clinical use increased in the years following ERR␥ (Tremblay et al., 2001). (Marselos and Tomatis, 1992). In 1971, following two re- Laboratory studies have also indicated that epigenetic ports of a causal link between vaginal clear-cell adenocar- mechanisms, independent of direct interaction with genetic cinoma, a rare cancer, and in utero DES exposure (Green- material but leading to permanent changes in gene expres- wald et al., 1971; Herbst et al., 1971), the U.S. FDA sion, may also contribute to the ultimate effects of DES proscribed the use of DES for pregnancy support (Herbst, (Liehr, 2000). Perinatal DES exposure in rodents causes 2000). To date, DES remains the only drug in which attenuated uterine responses to subsequent estrogen stimu- transplacental carcinogenesis in man has been proven lation during adulthood, characterized as decreased growth (Marselos and Tomatis, 1992). More prevalent than cancer and secretory activity and altered cellular differentiation are the multiple teratogenic effects attributed to in utero (Maier et al., 1985; Medlock et al., 1988, 1992). Similar DES DES exposure, including vaginal/cervical epithelial adeno- treatments in mice lead to constitutive up-regulation of sis and squamous metaplasia, transverse vaginal ridges, and lactoferrin expression in adult uteri (Nelson et al., 1994), structural malformations of the cervix and uterus (Herbst, seminal vesicle (Beckman et al., 1994), and the urethropros- 2000; Marselos and Tomatis, 1992; Mittendorf, 1995). In tatic complex (Salo et al., 1997). Moreover, Li et al. (1997) males, in utero DES exposure is associated with increased demonstrated distinct alterations in the methylation pat- risk of testicular cancer, epididymal cysts, cryptorchidism, tern of the lactoferrin gene promoter in uterine tissue of and testicular hypoplasia (Herbst, 2000; Marselos and mice neonatally exposed to DES, providing support for an Tomatis, 1992). epigenetic pathway by which DES permanently alters gene Over the past 30 years, rodent models that effectively expression. Similar changes in gene expression following assimilate the effects of developmental DES exposure in neonatal DES exposure are reported for epidermal growth humans have been thoroughly characterized, yet the under- factor (EGF), EGF-receptor, c-fos, c-jun, c-myc, bax, and lying mechanisms remain poorly understood (Marselos and bcl-2 in the reproductive tract of sexually mature mice and

Tomatis, 1992, 1993). It is widely accepted that E2 or DES hamsters (Falck and Forsberg, 1996; Nelson et al., 1994; exposure during critical developmental periods elicits dis- Zheng and Hendry, 1997). Once again, the role of the ER in tinct and permanent alterations in the Mu¨llerian-derived mediating this effect of DES remains unknown. structures of the female reproductive tract (oviduct, uterus, In contrast to the hormonal and epigenetic mechanisms, cervix, upper vagina) (Cunha et al., 1991). Interestingly, null there is evidence of direct genotoxic actions of DES and its mouse models have illustrated that a lack of estrogen metabolites, presumably independent of ER action. These signaling has little effect on reproductive tract development mechanisms are more often applied to explain the carcino- (Couse et al., 1999; Couse and Korach, 1999; Fisher et al., genic properties of DES and include the induction of DNA 1998), whereas aberrant estrogen exposure during develop- adducts, microsatellite instability, sequence deletions or ment is detrimental (Cunha et al., 1991). Hence, the under- insertions, and single-strand breaks in both in vitro and in lying mechanisms of developmental DES exposure likely vivo systems (Liehr, 2000). Furthermore, DES and its me- involve its ability to bind the nuclear estrogen receptor (ER) tabolites are reported to elicit aneuploidy and cell transfor- and mimic the broad spectrum of E2 actions (Korach et al., mation in Syrian hamster embryo cells lacking measurable 1978, 1989). This aberrant stimulation of estrogen signal- ER levels, possibly via interfering with microtubule func- ing by DES during development may disrupt the proper tion (Tsutsui et al., 1983). Supporting evidence of DES- expression of estrogen-regulated genes and the ultimate induced genetic instability is provided by descriptions of differentiation/proliferation proﬁle of cell populations. Re- aneuploid DNA in premalignant vaginal lesions in “DES ported alterations in the expression of Hoxa9, Hoxa10, daughters” (Welch et al., 1983) and DES-exposed mice Hoxa11 (Block et al., 2000; Ma et al., 1998), and Wnt7a (Hajek et al., 1993). (Miller et al., 1998a) in the developing murine female Therefore, existing evidence supports both ER-dependent reproductive tract following DES exposure support such a and -independent mechanisms as mediators of the develop- mechanism. Furthermore, null mouse models of the Hox mental and carcinogenic actions of DES. In this report, we (Dolle et al., 1991; Hsieh-Li et al., 1995; Satokata et al., describe our use of the estrogen receptor-␣ knockout mouse 1995) and Wnt (Miller et al., 1998a; Parr and McMahon, (␣ERKO), which lacks functional ER␣, to gain further 1998) gene families exhibit reproductive tract phenotypes insight into the role of this receptor in mediating the effects that are comparable to those elicited by developmental DES of neonatal DES exposure in the female reproductive tract. exposure. These data support disruption of developmental In brief, our results demonstrate that adult wild-type mice gene expression as a mechanism of DES; however, it re- neonatally exposed to DES exhibit the previously described mains unknown whether this action is dependent on ER. morphological defects throughout the reproductive tract, Further complexity has been introduced by two recent whereas their ␣ERKO littermates do not. Furthermore, the discoveries: (1) a second nuclear ER (ER␤) that exhibits E2- DES-elicited suppression of Hoxa10, Hoxa11, and Wnt7a and DES-induced in vitro activity comparable to that of the expression exhibited in the uteri of treated wild-type mice

Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved. 226 Couse et al. shortly after treatment was absent in the ␣ERKO uteri. the Vectastain ABC Kit (Vector Laboratories) according to the These data provide unequivocal evidence of an obligatory manufacturer’s protocol using 3,3Ј-diaminobenzidine tetrahydro- role for ER␣ in mediating the effects of neonatal DES chloride as a chromogen, followed by counterstain with hematoxylin. exposure in the murine female reproductive tract. Cloning of the Wnt4 and Wnt5a cDNA Probe Templates MATERIALS AND METHODS Riboprobe templates for the mouse Wnt4 and Wnt5a consisted Generation and Treatment of Animals of a reverse transcription–PCR generated (RT-PCR) cDNA fragment cloned into the pCRII-TOPO vector (Invitrogen, Carlsbad, All procedures were performed in accordance with the NIH CA) according to the manufacturer’s protocol. The Wnt4 template Guide for the Care and Use of Laboratory Animals and were consisted of 426 bp of the mouse Wnt4 cDNA (bp 230–655, preapproved by the NIEHS ICACU. All animals were maintained in GenBank Accession Number M89797) amplified from C57BL/6 plastic cages under a 12-h light/12-h dark schedule in a ovary RNA using the following primers: (forward) 5Ј-AGG- temperature-controlled room (21–22°C), fed NIH 31 mouse chow TGATGGACTCAGTGCGC, (reverse) 5Ј-CCCGCATGTGTGTC- and fresh water ad libutum. Mice were generated by breeding AAGATG. The Wnt5a template consisted of 253 bp of the mouse heterozygous (ER␣ϩ/Ϫ) animals in a continuous mating scheme. Wnt5a cDNA (bp 609–861, GenBank Accession Number M89798) Pregnant mice were single-housed and litters adjusted to 4–8 pups amplified from C57BL/6 lung RNA using the following primers: per dam upon delivery. Pups were treated with DES (Sigma Chemi- (forward) 5Ј-CCATGTCTTCCAAGTTCTTCC, (reverse) 5Ј-CAT- cals, St. Louis, MO) dissolved in corn oil at 2 ␮g/pup/day (s.c.) for TCCTTGATGCCTGTCTTC. All clones were confirmed by se- Days 1–5 (day of birth ϭ 1); controls were similarly treated with an quence analysis. equal volume (20 ␮l) of corn oil. Mice were weaned at 21–22 days of age and housed 2–4 per cage as described above. Prior to 60 days, Total RNA Isolation, RNase Protection Assay, mice were implanted with an implantable microidentification unit (IMI-1000; BioMedic Data Systems, Seaford, DE) and a tail biopsy and in Situ Hybridization collected for genomic DNA extraction as previously described Total RNA was isolated using Trizol reagent (Life Technologies, (Couse et al., 1994). Mice were selected and terminated at four Rockville, MD) according to the manufacturer’s protocol. Concen- predetermined ages designated as I (4–5 months), II (8–9 months), trations of the final preparations were calculated from an A260 III (12–13 months), and IV (18–22.7 months). On termination, reading (Beckman DU-7 spectrophotometer) and an aliquot ana- whole blood was collected and heparinized and the plasma was lyzed by gel electrophoresis to ensure integrity. Radiolabeled stored at Ϫ70°C; all tissues were fixed in 10% buffered formalin. antisense riboprobes for ribonuclease protection assays (RPAs) For gene expression analyses, animals were terminated at 5 days of were generated from linearized vectors using the Ambion Maxi- age (6 h after the final injection), and at 2–3 months of age, the Script Kit (Ambion, Austin, TX) and [32P]CTP (Amersham Pharma- reproductive tract was removed quickly and the ovary, oviduct, cia Biotech, Piscataway, NJ) according to the manufacturer’s pro- uterus, and vagina were separated, snap-frozen, and stored at tocol. Wnt4 and Wnt5a antisense riboprobes were generated from Ϫ70°C. Animals were ER␣-genotyped via polymerase chain reac- the templates described herein; Hoxa10 and Hoxa11 antisense tion (PCR) on genomic DNA using the following primers for riboprobes were described previously (Benson et al., 1995; Hsieh-Li detection of an untargeted ER␣ gene (forward) 5Ј-CGGTCTA- et al., 1995; Ma et al., 1998). The Hoxa10 antisense riboprobe CGGCCAGTCGGGCATC, (reverse) 5Ј-CAGGCCTTACACAGC- differentially detects the splice variants Hoxa10-1 and Hoxa10-2 GGCCACCC (281-bp amplimer from wild-type ER␣ exon 2); and (Benson et al., 1995). A cyclophilin antisense riboprobe was gener- for detection of the gene disruption (forward) 5Ј-GTGTTCC- ated from the pTRI–cyclophilin template (Ambion) and included in GGCTGTCAGCGCA, (reverse) 5Ј-GTCCTGATAGCGGTCCG- all assays for normalization. Sizes (nt) of the respective protected CCA (555-bp amplimer). fragments were as follows: cyclophilin ϭ 103, Wnt4 ϭ 426, Wnt5a ϭ 253, Hoxa10-1 ϭ 316, Hoxa10-2 ϭ 146, and Hoxa 11 ϭ Cyto- and Immunohistochemistry 237. RPAs were carried out on total RNA from tissue of individual animals using Hybspeed RPA reagents (Ambion) according to the Formalin-fixed tissues were paraffin-embedded and 6 ␮m sec- manufacturer’s protocol. All RPA samples were fractionated by tions mounted on ProbeOn Plus slides (Fisher Scientific, Pitts- electrophoresis on precast 6% bis-acrylamide/7 M urea/1ϫ Tris– burgh, PA). Sections were stained with hematoxylin and eosin borate gels (Invitrogen), which were then fixed, dried, and exposed (H&E) for routine light microscope evaluation. Immunohistochem- to a phosphorimager screen followed by analysis with a Storm 860 istry for ER␣ was performed as follows. Following standard depar- and ImageQuant Software (Molecular Dynamics, Sunnyvale, CA). affinization and hydration protocol, endogenous peroxidase was In situ hybridization for Hoxa10 mRNA in the neonatal uteri quenched by incubation in 3% H2O2 and antigen retrieval carried was carried out as previously described (Ma et al., 1998), using the out in 1ϫ citrate buffer in a decloaking chamber (BioCare Medical, above-described antisense riboprobe labeled with digoxigenin. Walnut Creek, CA) according to the manufacturer’s protocol. All ϫ washes were carried out in 1 Automation Buffer (AB) (Biomeda Semiquantitative RT-PCR for Wnt7a Corporation, Foster City, CA). Sections were blocked with 5% normal horse serum (Jackson ImmunoResearch Laboratories, West Repeated assays indicated the levels of Wnt7a mRNA in the Grove, PA) followed by incubation with a 1:50 dilution of mono- neonatal uterus to be below the levels of reproducible detection by clonal anti-ER␣ antibody (ER1D5) for 1 h (Beckman Coulter, Brea, RPA. Therefore, the following semiquantitative RT-PCR protocol CA), washed in 1ϫ AB, and incubated with a 1:500 dilution of was carried out for these analyses. PCR for Wnt7a and ␤-actin biotinylated horse anti-mouse IgG antibody (Vector Laboratories, transcripts was simultaneously carried out on cDNA preparations Burlingame, CA). Specific immunoreactivity was detected using from total RNA from tissue of individual animals. Primers for

Wnt7a mRNA detection amplified a 302-bp fragment (bp 539–840, RESULTS GenBank Accession Number M89801): (forward) 5Ј-TGAACTT- ACACAATAACGAGGC, (reverse) 5Ј-CTCTTCACAGTAATT- GGGTGAC. Primers for detection of the mouse ␤-actin mRNA The acute effects of DES exposure on developmental gene were purchased from Clontech (Palo Alto, CA). RT generation of expression were assessed via analysis of mRNA levels for cDNA was carried in a reaction of 2.5 ␮M random hexamers Hoxa10, Hoxa11, Wnt4, Wnt5a, and Wnt7a in uterine (Applied Biosystems, Foster City, CA), 0.2 mM (d)-NTPs each tissue collected on neonatal Day 5, approximately 6–8 h (Invitrogen), 25 U RNase inhibitor (Applied Biosystems), 62.5 U after the final treatment. As shown in Fig. 1, DES exposure ␮ MuLV reverse transcriptase (Applied Biosystems), and 0.5 gof elicited a significant decrease in the uterine levels of total RNA in a volume of 25 ␮l. Semiquantitative PCR reactions mRNAs encoding Hoxa10-1 (P Ͻ 0.01) and Hoxa11 (P Ͻ for each cDNA preparation were prepared as follows: 60 ␮l reaction consisting of 1ϫ Optimized PCR buffer F (Invitrogen), 8.0 ␮l cDNA 0.01) in the wild-type neonate when compared to that of preparation, 50 pmol of each Wnt7a primer, 5 pmol of each ␤-actin corn oil-treated controls. In contrast, uterine tissues from primer, 0.2 mM each deoxy (d)-NTPs (Invitrogen), and 3 U Plati- ␣ERKO neonates failed to exhibit this effect of DES expo- numTaq DNA polymerase (Life Technologies). This was then sure and possessed Hoxa10-1 and Hoxa11 mRNA levels in aliquoted at 15 ␮l per reaction to generate four identical reactions both treatment groups that were comparable to that of the per cDNA preparation, one for each of the four PCR termination corn oil-treated wild-type. These results were corroborated time points (20, 25, 30, and 35 cycles). Thermal cycling conditions by whole-mount in situ hybridization for Hoxa10, as shown consisted of an initial 95°C/2 min, 95°C/30 s, 58°C/45 s, 72°C/30 s, in Fig. 1b. There was no effect of genotype or treatment on and 72°C/7 min in a GeneAmp 9600 Thermal Cycler (Applied the levels of Hoxa10-2 transcripts, a previously described Biosystems). This process was carried out in duplicate for each splice variant of the mouse Hoxa10 gene with unknown cDNA preparation. All samples were electrophoresed in a gel of 1ϫ TBE/2% Nu- function (Benson et al., 1995) (Fig. 1). Seive Agarose/0.7% SeaKem Agarose (FMC Bioproducts, Rockland, The results of similar assays for Wnt7a, Wnt4, and Wnt5a ME), which was then transferred to BrightStar Nylon membrane transcripts in neonatal uterine tissue following corn oil or (Ambion) according the manufacturer’s protocol. All blots were UV DES treatment are shown in Figs. 2 and 3, respectively. A crosslinked (UV Stratalinker 1800; Stratagene, La Jolla, CA). For striking effect of DES exposure in the neonatal uterus was quantitation, blots were probed with oligos complementary to an over 80% decrease in Wnt7a mRNA levels compared to sequences nested within the RT-PCR primers and consisted of the that of corn oil-treated controls (P Ͻ 0.01) (Fig. 2). However, following oligos and their complements, which when annealed once again this effect of DES was exhibited only in the generated flanking 10-bp overlaps (indicated by “/”): Wnt7a, Ј wild-type neonates and completely lacking in the DES- 5 -GTCGAAACAA/GCGGCCCACCTTTCTGAAGA/TCAAGA- ␣ AGCC (bp 731–770, GenBank Accession Number M89801); ␤-actin, treated ERKO. In contrast to Wnt7a, the observed effects 5Ј-GCCCATCTAC/GAGGGCTATGCTCTCCCTCA/CGCCATC- of DES on uterine expression of the Wnt4 and Wnt5a genes CTG (bp 411–450, GenBank Accession Number M12481). The were observed in both wild-type and ␣ERKO mice (Fig. 3). overlapping sequences were filled-in in the presence of [32P]dCTP DES treatment elicited a significant decrease in uterine (Amersham Pharmacia Biotech) using Klenow DNA polymerase Wnt4 mRNA levels that exceeded 50% (P Ͻ 0.01) in the (Life Technologies) according the manufacturer’s protocol. All wild-type, while a less-robust decrease was observed in the hybridizations were carried out for 12–18 h at 55°C in a solution of DES-treated ␣ERKO mice. Interestingly, the basal levels of ϫ ϫ 1 SSC, 0.2 M NaH2PO4,5 Denhardt’s solution, 0.1% SDS, 0.5 Wnt4 transcripts in the uteri of the neonatal control Ͼ ϫ 8 mg/ml salmon-sperm DNA, and 1.0 10 cpm of each probe. ␣ERKO mice were increased compared to that of the Following hybridization, blots were washed at room temperature in wild-type, and although reduced following DES treatment, 6ϫ SCC followed by 0.5% SDS/0.1ϫ SSC at 55°C at 30 min per wash; then exposed to a phosphorimager screen followed by anal- the ultimate levels of Wnt4 mRNA in the DES-treated ␣ ysis with a Storm 860 and accompanying ImageQuant Software ERKO uteri remained similar to that of the corn oil- (Molecular Dynamics). treated wild-type. In contrast to the reducing effect of DES on Wnt4 expression, a trend toward increased uterine expression of Wnt5a was observed in the DES-treated Plasma E Radioimmunoassay (RIA) 2 wild-type (P Ͻ 0.1) and ␣ERKO neonates (P Ͻ 0.05).

Serum E2 was assayed on 200 ␮l aliquots per animal using the The permanent nature of the acute effects of neonatal ultrasensitive 17␤-estradiol double-antibody [125I]RIA (Diagnostic DES exposure on Hoxa10, Hoxa11, Wnt4, Wnt5a, and Systems Laboratories, Webster, TX) according to the manufactur- Wnt7a expression in the uterus was assessed on tissue er’s protocol and counted on a Packard Multi-Prias 2 Gamma collected from sexually mature females (2–3 months) that Counter. were exposed to either corn oil or DES as neonates. The DES-elicited reduction in Hoxa10–1 expression observed in Statistical Analysis the uteri of neonatal wild-type mice appeared to persist during sexual maturity, although it was no longer statisti- All data sets were first tested for homoscedasticity of variance using the Levine’s test. In cases where data were found to lack cally significant (Fig. 4). Once again the uterine levels of ␣ homoscedasticity of variance (P Ͻ 0.05), all data were log-transformed Hoxa10–1 mRNA in the adult ERKO females of both prior to further statistical analysis. In all cases, data sets were analyzed treatment groups were within the wild-type control range by two-way ANOVA followed by individual post hoc comparisons. and showed no effect of neonatal DES exposure. In contrast Statistical significance was assigned at P Ͻ 0.05. to the apparent permanent effect of DES exposure on

FIG. 1. Neonatal DES treatment reduces Hoxa10 and Hoxa11 expression in the uteri of wild-type but not ␣ERKO mice. (a) Representative ribonuclease protection assays (RPA) for Hoxa10 (splice variants -1 and -2) and Hoxa11 on 2 ␮g total RNA from individual uteri collected from animals at 5 days of age, approximately 6 h after the ﬁnal corn oil (CO) or diethylstilbestrol (DES) treatment. Assays for cyclophilin (cyc) mRNA were carried out for normalization. (b) Whole-mount in situ hybridization for Hoxa10 mRNA in the reproductive tracts of 5-day-old wild-type and ␣ERKO mice following treatment with corn oil (CO) or diethylstilbestrol (DES). (c) Quantitative analysis of the RPAs, showing the average percentage of cyclophilin (Ϯ SEM) for each experimental group. Sample sizes were as follows: wild-type-CO, n ϭ 5; wild-type-DES, n ϭ 5; ␣ERKO-CO, n ϭ 6; ␣ERKO-DES, n ϭ 6. **P Ͻ 0.01.

Hoxa10 expression in the uterus, the acute effects of DES the DES-exposed wild-type mice at all time points, reaching observed on Hoxa11, Wnt4, Wnt5a, and Wnt7a expression statistical signiﬁcance (P Ͻ 0.01) at age groups II–IV (Table were no longer apparent in the adult animals of either 1). Estrogen resistance in the uterus is innate to the ␣ERKO genotype (data not shown). mice (Couse and Korach, 1999), and no exacerbation of this The long-term morphological effects of neonatal DES phenotype was observed after DES treatment (Table 1). An exposure on the reproductive tract of wild-type and ␣ERKO additional observation was an increased body weight in females are summarized in Tables 1 and 2 and illustrated in DES-treated wild-type females compared to that of corn Fig. 5. A well-characterized effect of neonatal DES exposure oil-treated controls (Table 1), attributed predominantly to in rodents is a permanent attenuation of the estrogen- an excessive accumulation of white adipose tissue in the induced growth in the uterus, best illustrated as chronically inguinal and perimetrial fat pads. This DES effect was most reduced uterine weight exhibited by DES-treated females apparent in the treated wild-type mice of the I and II age relative to that of age-matched controls (Maier et al., 1985; groups (P Ͻ 0.01), whereas age-related increases in body Medlock et al., 1988). Herein, this effect was replicated in weight in the control groups lessened the difference at the

hyalinization (90.9%), squamous metaplasia of the luminal and glandular epithelium (46.8%), and endometrial hyperplasia (24.1%). Among the types of uterine lesions observed, only endometrial hyperplasia was also observed in corn oil-treated wild-type groups (56%). Immunohistochemical detection of ER␣ in a squamous metaplasia of the uterine epithelium from a DES-treated wild-type female (Figs. 5m– 5o) indicates the potential of this lesion to respond to endogenous estrogens. In the vagina, DES-exposed wild- type mice exhibited a 100% incidence of persistent epithelial cornification (Figs. 5j–5l) and a 2.5% incidence of vaginal adenosis, compared to an absence of these lesions in corn oil-treated wild-type females. In the oviduct, progressive proliferative lesions of the epithelium, a well- characterized lesion strongly associated with neonatal DES exposure in rodents (Newbold et al., 1985), was observed at an incidence of 94.5% in DES-exposed wild-type females (Figs. 5a–5c) compared to 0% in corn oil-treated controls. In stark contrast to the pathology observed in the reproductive tract tissues of DES-exposed wild-type females was a complete lack of incidence of these same lesions in similarly treated ␣ERKO mice (Table 2). Tissues collected from DES-exposed ␣ERKO females of all four age groups appeared similar at both the gross and microscopic levels to those collected from corn oil-treated ␣ERKO females and exhibited none of the characteristic effects of neonatal DES exposure (Fig. 5). Lesions that appeared to be unique to the ␣ERKO mice were those previously described and attrib- FIG. 2. Neonatal DES treatment reduces Wnt7a expression in the uted to the loss of ER␣ function (Couse and Korach, 1999), ␣ uteri of wild-type but not ERKO mice. (a) A representative including uterine hypoplasia and uncornified vaginal epi- Southern blot of semiquantitative RT-PCR for Wnt7a mRNA from thelium (Table 2). Neonatal DES exposure resulted in no individual uteri collected from animals at 5 days of age, approxi- observable effect on these phenotypes. mately 6 h after the final corn oil (CO) or diethylstilbestrol (DES) treatment. Assays for ␤-actin mRNA were carried out for normal- The only lesion type found to be common between the ␣ ization. (b) Quantitative analysis of the semiquantitative RT-PCR DES-treated wild-type and ERKO mice was the presence of reported as the average percentage of ␤-actin (Ϯ SEM) for each cystic follicles in the ovary, a condition likely related to experimental group. Sample sizes were as follows: wild-type-CO, DES exposure in the wild-type (Newbold, 1995) but innate n ϭ 5; wild-type-DES, n ϭ 5; ␣ERKO-CO, n ϭ 6; ␣ERKO-DES, n ϭ to the adult ␣ERKO female (Couse and Korach, 1999). 6. All data shown are from samples collected after 25 PCR cycles. Hypertrophy of the interstitium was observed in 97.5% of **P Ͻ 0.01. DES-exposed wild-type mice compared to a 12% incidence in corn oil-treated controls. However, neonatal DES expo-

sure had no profound effect on the basal levels of serum E2 in the wild-type and ␣ERKO mice (Table 3). Consistent latter time points. Consistent with previous descriptions, with previous descriptions of the ␣ERKO female (Couse and ␣ ERKO mice of both treatment groups exhibited elevated Korach, 1999), serum E2 levels were elevated compared to average body weights compared to that of wild-type females that of wild-type at all time points, regardless of neonatal (Couse and Korach, 1999; Heine et al., 2000), and at no time treatment (Table 3). Therefore, any possible ligand- exhibited a difference between treatment groups (Table 1). dependent signaling pathways of ER␤ are presumed to be Therefore, neonatal DES exposure results in an attenuation intact in both genotypes and treatment groups. of the physiological effects of estrogen action in the uterus and abdominal white adipose tissue in wild-type mice, resulting in a phenotype in each of these tissues that DISCUSSION partially mimics the innate effect of ER␣ gene disruption exhibited by the ␣ERKO female. Despite decades of research, the mechanisms by which As shown in Table 2 and Fig. 5, DES-treated wild-type developmental exposure to estrogens results in permanent mice exhibited a relatively high frequency of the multiple alterations in the growth, differentiation, and function of reproductive tract lesions known to be associated with reproductive tract tissues in rodents and man remain un- neonatal DES exposure. In the uterus, these included atro- clear. Studies to date indicate that both estrogen-dependent phy (61%), disorganization of the smooth muscle (87%), and -independent pathways are likely involved in the tera-

FIG. 4. Neonatal DES treatment leads to permanently reduced Hoxa10 expression in the uteri of adult wild-type but not ␣ERKO mice. (a) A representative ribonuclease protection assay (RPA) for Hoxa10 (splice variant -1)on5␮g total RNA from individual uteri collected from animals at 2–3 months of age, following neonatal exposure to corn oil (CO) or diethylstilbestrol (DES). Assays for cyclophilin (cyc) mRNA were carried out for normalization. (b) Quantitative analysis of the RPAs shows the average percentage of cyclophilin (Ϯ SEM) for each experimental group. Sample sizes were as follows: wild-type-CO, n ϭ 5; wild-type-DES, n ϭ 6; ␣ERKO-CO, n ϭ 5; ␣ERKO-DES, n ϭ 4. ns, not statistically signiﬁcant.

togenic and carcinogenic syndrome that occurs in the

reproductive tract following developmental exposure to E2, DES, or other estrogenics (Liehr, 2000). However, the exact role of the estrogen-dependent and -independent pathways, FIG. 3. Neonatal DES treatment effects Wnt4 and Wnt5a expres- and the extent to which each contributes to the resulting sion in the uteri of both wild-type and ␣ERKO mice. (a) Represen- pathology remains unknown. We employed the ␣ERKO tative ribonuclease protection assays (RPAs) for Wnt4 and Wnt5a female mouse to gain insight into the role of this receptor ␮ on 2 g total RNA from individual uteri collected from animals at and that of the estrogen signaling system in mediating the 5 days of age, approximately 6 h after the ﬁnal corn oil (CO) or effects of neonatal DES exposure. Use of the ␣ERKO mouse diethylstilbestrol (DES) treatment. Assays for cyclophilin (cyc) mRNA were carried out for normalization. (b) Quantitative analy- provides the potential to expose DES actions that are ␤ sis of the RPAs shows the average percentage of cyclophilin mediated by ER or other receptors as well as those actions (Ϯ SEM) for each experimental group. Sample sizes were as follows: that are independent of receptor-mediated estrogen signal- wild-type-CO, n ϭ 5; wild-type-DES, n ϭ 5; ␣ERKO-CO, n ϭ 6; ing. Our results provide unequivocal evidence of an obliga- ␣ERKO-DES, n ϭ 6. *P Ͻ 0.05; ns, not statistically signiﬁcant. tory role for ER␣ in mediating the effects of neonatal DES

TABLE 1 Sample Number and Whole Body and Uterine Weights in Adult Wild-Type (WT) and ␣ERKO Mice Following Neonatal Exposure to Corn Oil or Diethylstilbestrol (DES)

Age groupa

Treatment group I II III IV

Sample number WT—corn oil 12 23 19 18 WT—DES 12 27 27 20 ␣ERKO—corn oil 11 10 9 9 ␣ERKO—DES 9 14 15 10 Body weightb (g) WT—corn oil 23.3 (0.4) 25.1 (0.5) 29.1 (1.2) 31.6 (1.2) WT—DES 32.8 (2.1)** 32.3 (1.2)** 34.1 (1.0) 36.3 (2.1) ␣ERKO—corn oil 28.7 (0.9)† 33.8 (1.2)†† 31.1 (1.7) 32.1 (2.0) ␣ERKO—DES 30.5 (1.2) 31.6 (1.4) 34.6 (2.0) 30.4 (1.9) Uterine weightb,c WT—corn oil 0.42 (0.04) 0.46 (0.05) 0.65 (0.08) 0.93 (0.14) WT–DES 0.30 (0.04) 0.23 (0.02)** 0.26 (0.02)** 0.44 (0.09)** ␣ERKO—corn oil 0.26 (0.05) 0.09 (0.01)†† 0.20 (0.06)†† 0.33 (0.07)† ␣ERKO—DES 0.28 (0.03) 0.15 (0.03) 0.20 (0.06) 0.20 (0.04)

a Age groups (months): I ϭ 4–5, II ϭ 8–9, III ϭ 12–13, IV ϭ 18–22.7. b Data shown for body weight and uterine weight are average (SEM). c Uterine weight reported as percentage of body weight. * P Ͻ 0.05, **P Ͻ 0.01; corn oil vs DES within the same genotype. † P Ͻ 0.05, ††P Ͻ 0.01; wild-type vs ␣ERKO within the same treatment. exposure in the developing murine female reproductive leads to its syndrome of defects in the female reproductive tract. tract. Considerable efforts have focused on the clustered The sensitivity of the developing female reproductive homeobox genes Hoxa10 and Hoxa11, both of which are tract to the detrimental effects of DES has been well expressed in the paramesonephric ductal segments of the documented (Marselos and Tomatis, 1993). The complete Mu¨llerian duct that ultimately differentiate into the uterus lack of DES effects in the ␣ERKO female indicate this and cranial cervix (Kitajewski and Sassoon, 2000; Taylor et sensitivity is the result of the high levels of ER␣ present in al., 1997). The developmental expression pattern of Hoxa10 these tissues during late fetal and neonatal development and Hoxa11 is highly conserved in mice and humans (Greco et al., 1993; Korach et al., 1988; Yamashita et al., (Taylor et al., 1997), the importance of which has been 1989). None of the DES-exposed ␣ERKO females, including effectively illustrated by studies of null mice. Hoxa10 null animals exceeding 22 months of age, exhibited the distinct mice exhibit a partial anterior homeotic transformation in abnormalities that were apparent in DES-treated wild-type which the anterior 25% of the uterus resembles the struc- females. This included the absence of several lesions char- tural and molecular characteristics of the oviduct (Benson acteristic of neonatal DES exposure, such as progressive et al., 1996); Hoxa11 null mice exhibit thinner, shorter proliferative lesion of the oviduct (Newbold et al., 1985); uterine horns with a paucity of glands (Gendron et al., decreased weight, atrophy, smooth muscle disorganization, 1997). These phenotypes in Hoxa10 and Hoxa11 null mice and epithelial squamous metaplasia in the uterus (New- are somewhat similar to those described in mice following bold, 1995); and persistent cornification of the vaginal developmental DES exposure (Kitajewski and Sassoon, epithelium (Takasugi, 1976). Therefore, the absence of 2000). Therefore, a potential mechanism of DES may in- DES-induced abnormalities in the reproductive tract of the volve alterations in the developmental program required for ␣ERKO supports a predominant role of ER␣ in mediating proper uterine differentiation (Block et al., 2000; Kitajewski the detrimental effects of DES in female reproductive tract and Sassoon, 2000; Ma et al., 1998). By 6 h after the final development. The lack of apparent ER␤-mediated effects of neonatal DES treatment, a significant reduction in Hoxa10 neonatal DES exposure, despite the presence of elevated and Hoxa11 expression of Ͼ50% was observed in the uteri levels of endogenous E2, is consistent with previous diffi- of wild-type mice, consistent with previous reports (Block culty in detecting ER␤ mRNA or protein in uterine, ovi- et al., 2000; Ma et al., 1998). Based on reported gene–dosage duct, and vaginal tissue of newborn and adult mice (Couse effects following targeted disruption of the Hoxa11 and et al., 1997b; Jefferson et al., 2000). Hoxa13 genes (Hsieh-Li et al., 1995; Warot et al., 1997), this Recent molecular studies have begun to provide clues as level of reduction in gene expression could ostensibly elicit to the mechanisms by which developmental DES exposure an aberrant phenotype. More important, our studies illus-

FIG. 5. Characteristic morphological effects of neonatal DES exposure occur in the reproductive tract tissues of adult wild-type but not ␣ERKO. (a–l) Photomicrographs of H&E-stained tissue sections from representative wild-type corn oil (WT-CO; a, d, g, j), wild-type DES (WT-DES; b, e, h, k, m), and ␣ERKO-DES (c, f, i, l) females of the 8–9 months age group. (a–c) Sections of oviduct from WT-CO (a), WT-DES (b), and ␣ERKO-DES (c) females, illustrating the progressive proliferative lesions characteristic of neonatal DES exposure that occurs only in the exposed wild-type (compare b to a and c). This lesion is characterized by hyperproliferation of the oviductal epithelium, resulting in the formation of glands (arrows) within the duct. Low-magniﬁcation (d–f) and high-magniﬁcation (g–i) of sections of uterus from WT-CO

Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved. Effects of DES in the ␣ERKO Female Mouse 233 trate that the action of DES on Hoxa10 and Hoxa11 diameter, absence of glands, and a stratified vaginal-like expression in the neonatal uterus is dependent on the epithelium rather than the simple columnar epithelium presence of a functional ER␣. characteristic of the normal uterus (Parr and McMahon, The reducing effect of neonatal DES exposure on uterine 1998). As with the Hoxa genes, DES elicits an acute Hoxa10 expression remained detectable during adulthood reduction in Wnt7a expression of almost 90% in the neo- (Fig. 4) and is possibly significant, considering the critical natal wild-type mouse uterus (Fig. 2). These data are con- role of Hoxa gene expression in implantation and pregnancy sistent with a previously reported effect of prenatal DES (Benson et al., 1996; Hsieh-Li et al., 1995; Lim et al., 1999). exposure on Wnt7a expression (Miller et al., 1998a). More Furthermore, aberrant uterine Hoxa10 and Hoxa11 expres- important, the lack of a DES-elicited reduction in Wnt7a sion is reported in women with endometriosis (Taylor et al., expression in the ␣ERKO uteri provides definitive evidence 1999). Although an association between in utero DES of the requirement for ER␣ in this mechanism. Therefore, it exposure and reduced fertility or endometriosis in humans is likely that the loss of ER␣ function in the ␣ERKO female remains controversial (Golden et al., 1998), these data prevents the aberrant developmental defects of DES in the warrant further study of uterine HOX gene expression in reproductive tract by allowing for normal expression of DES daughters. Hoxa10, Hoxa11, and Wnt7a. Previous studies have provided indirect evidence of ste- The preservation of two immediate effects of DES in the roid receptor-mediated regulation of Hoxa10 and Hoxa11 neonatal ␣ERKO uterus, decreased Wnt4 and increased expression in the mouse and human uterus (Block et al., Wnt5a expression, suggests the existence of ER␣- 2000; Ma et al., 1998; Taylor et al., 1998). Furthermore, independent DES-activated pathways. A likely candidate multiple consensus binding sites for the ER and progester- for the maintenance of certain hormonal actions of DES in one receptor are present in the known genomic sequences the ␣ERKO uterus is ER␤, although it remains difficult to of Hoxa10 and Hoxa11 (Ma et al., 1998). However, whereas detect ER␤ mRNA or protein in uterine tissue of newborn

Ma et al. (1998) reported that E2 continues to reduce mice (Jefferson et al., 2000). Also possible is the activation Hoxa10 expression in the adult mouse uterus, Taylor and of apparent ER-independent pathways in the uterus, such as colleagues (Block et al., 2000; Taylor et al., 1998) report a those reported in ovariectomized ␣ERKO females following stimulatory effect of DES and E2 in multiple in vitro treatment with 4-hydroxy-E2, methoxychlor, or kepone systems but no discernable effect in human endometrial (Das et al., 1997; Ghosh et al., 1999). The recent report by tissue during periods of elevated serum estrogens (Taylor et Tremblay et al. (2001) that DES, and not E2, speciﬁcally al., 1998). Herein, no misregulation of Hoxa10 expression interacts with and suppresses the transactivational activity in the uteri of adult ␣ERKO mice was observed, despite the of the estrogen-related receptors ERR␣,-␤, and -␥ presents presence of elevated plasma E2. Therefore, our data indicate the possibility that these receptors may also be involved in that estrogen regulation of Hoxa10 and Hoxa11 expression Wnt4 and Wnt5a regulation. Nonetheless, the effects of in both the neonatal and adult uterus is predominantly DES on the uterine Wnt4 and Wnt5a expression were dependent on the presence of functional ER␣. transient, given that normal mRNA levels were detected in In addition to the homeobox genes, Wnt gene products the adult wild-type and ␣ERKO mice. also play critical roles in the regulation of tissue patterning Decreased uterine weight in sexually mature females is a during embryogenesis and adulthood (Kitajewski and Sas- characteristic effect of neonatal DES exposure in the rodent soon, 2000). At 6 days of age in the mouse uterus, Wnt4 and is attributed to an attenuation of the uterine estrogen expression is limited to the mesenchyme nearest the lu- response resulting from constitutive reduction in ER levels men, Wnt5a is limited to the stroma, and Wnt7a appears in (Maier et al., 1985; Medlock et al., 1988, 1992). Similarly, the luminal and glandular epithelium (Miller et al., 1998b). the prostate of the neonatal estrogenized rat exhibits re- Targeted deletion of the Wnt7a gene in mice results in a duced androgen receptor levels and an attenuated response multitude of uterine phenotypes that resemble the effects to endogenous androgens, leading to reduced prostate of neonatal DES exposure (Kitajewski and Sassoon, 2000), weight in the adult (Prins, 1992; Prins and Birch, 1995). including a disorganized myometrium, reduced uterine Herein, neonatal DES-exposed wild-type females exhibited

(d, g), WT-DES (e, h), and ␣ERKO-DES (f, i) females, illustrating the effects of neonatal DES exposure in the uterus, including an estrogenized luminal and glandular epithelium (short arrows) and disorganization/hyalinization of the inner circular smooth muscle (long arrows) that were apparent only in the WT-DES (e and h). Uterine tissue from ␣ERKO-DES (f, i) exhibited no effects of neonatal DES exposure, but only hypoplasia of the smooth muscle, endometrial stroma, and glandular epithelium, a phenotype innate to the loss of ER␣. (j–l) Sections of vagina from WT-CO (j), WT-DES (k), and ␣ERKO-DES (l) females, illustrating the excessive epithelial cornification characteristic of neonatal DES exposure that occurs only in the exposed wild-type (compare k to j and l). This effect was absent in the ␣ERKO-DES (l), which exhibited an uncornified vaginal epithelium, a phenotype innate to the loss of ER␣. (m–o) Illustration of early squamous metaplasia in the uterine epithelium of a WT-DES female, stained with H&E (m) or immunostained for ER␣ (n), illustrating specific nuclear ER␣ immunoreactivity in the cells of the epithelial lesion and underlying stroma (indicated by arrows). (o) Represention of a serial section in which the ER␣ antibody was excluded during immunohistochemistry and therefore serves as a negative control.

TABLE 2 Incidence of Pathology Observed in Wild-Type and ␣ERKO Female Mice Following Neonatal DES Exposure

Wild-type ␣ERKO

Tissue/Lesion I II III IV I II III IV

Uterus Hypoplasia 0/12 0/27 0/25 0/16 9/9a 14/14a 15/15a 9/9a Atrophy 0/12 22/26 12/25 13/16 0/9 0/14 0/15 0/9 Disorganization of smooth muscle 10/10 26/26 21/25 10/16 0/9 0/14 0/15 0/9 Hyalinization 10/10 25/26 23/25 12/16 0/9 0/14 0/15 0/9 Squamous metaplasia 3/10 9/26 15/25 2/16 0/9 0/14 0/15 0/9 Endometrial hyperplasia 0/12 2/26b 10/25c 7/16d 0/9 0/14 0/15 0/9 Stromal sarcoma 0/12 0/26 0/25 1/16 0/9 0/14 0/15 0/9 Vagina Persistent corniﬁcation 10/10 26/26 25/25 16/16 0/9 0/14 0/15 0/9 No corniﬁcation 0/10 0/26 0/25 0/16 8/8a 13/13a 15/15a 9/9a Adenosis 0/12 2/26 0/25 0/16 0/9 0/14 0/15 0/9 Ovary Interstitial hypertrophy 11/12e 27/27f 24/24g 15/16h 0/9 0/14 0/15 0/9 Cystic follicle(s) 5/12e 20/27i 0/25j 2/16k 9/9a 14/14a 13/15l 4/9m Granulosa cell tumor 0/12 0/27 0/25 0/16 0/9 1/14n 5/15o 5/11p Tubulostromal adenoma 0/12 0/27 0/25 0/16 0/9 0/14 0/15 2/9 Oviduct (PPL) Stage 1 5/12 1/23 0/24 0/14 0/9 0/14 0/15 0/9 Stage 2 3/12 11/23 4/24 0/14 0/9 0/14 0/15 0/9 Stage 3 3/12 9/23 11/24 3/14 0/9 0/14 0/15 0/9 Stage 4 0/12 2/23 6/24 11/14 0/9 0/14 0/15 0/9 Total 11/12 23/23 21/24 14/14 0/9 0/14 0/15 0/9

Notes. Age groups are the same as in Table 1. Unless otherwise noted there was a 0% incidence in corn oil-treated animals of the same genotype. PPL, progressive proliferative lesion; stages represent level of severity (4 ϭ most severe) as described by Newbold et al. (1985). a Exhibited in 100% of corn oil-exposed mice of the same genotype and age. b Exhibited in 8 of 23 corn oil-exposed wild-type mice. c Exhibited in 13 of 19 corn oil-exposed wild-type mice. d Exhibited in 9 of 12 corn oil-exposed wild-type mice. e Exhibited in 1 of 12 corn oil-exposed wild-type mice. f Exhibited in 1 of 23 corn oil-exposed wild-type mice. g Exhibited in 3 of 19 corn oil-exposed wild-type mice. h Exhibited in 3 of 12 corn oil-exposed wild-type mice. i Exhibited in 2 of 23 corn oil-exposed wild-type mice. j Exhibited in 1 of 19 corn oil-exposed wild-type mice. k Exhibited in 2 of 12 corn oil-exposed wild-type mice. l Exhibited in 6 of 8 corn oil-exposed ␣ERKO mice. m Exhibited in 3 of 4 corn oil-exposed ␣ERKO mice. n Exhibited in 1 of 10 corn oil-exposed ␣ERKO mice. o Exhibited in 4 of 8 corn oil-exposed ␣ERKO mice. p Exhibited in 4 of 9 corn oil-exposed ␣ERKO mice.

a reduced average uterine weight throughout adulthood and subsequent increases in whole body weight (Table 1). that was somewhat comparable to that of the innate phe- Remarkably similar increases in white adipose tissue and notype of the ␣ERKO mice (Table 1). Therefore, neonatal body weight are innate to the ␣ERKO female, as observed DES exposure partially mimics the effect of ER␣ gene here and recently reported by Heine et al. (2000). Further- disruption in the murine uterus. Estrogen resistance attrib- more, increases in white adipose tissue and body weight uted to developmental DES exposure also appeared to occur occur in rodents following postnatal ovariectomy (Dukes et in the regulation of white adipose tissue. Sexually mature al., 1994; Sibonga et al., 1998) or targeted disruption of the wild-type females neonatally exposed to DES exhibited an cyp19 gene and subsequent loss of E2 synthesis (Jones et al., excessive accumulation of abdominal white adipose tissue 2000), supporting an inhibitory role for ER␣ in adipogenesis.

TABLE 3 Serum Estradiol Levels in Adult Wild-Type and ␣ERKO Mice Following Neonatal Exposure to Corn Oil or Diethylstilbestrol

Estradiol (pg/ml)

Means Ϯ SEM

Treatment I II III IV Range

Corn oil Wild-type 21.37 Ϯ 5.9 22.48 Ϯ 2.5 23.47 Ϯ 2.7 22.24 Ϯ 2.7 3.07–59.41 ␣ERKO 69.48 Ϯ 16.5* 48.5 Ϯ 12.5 88.21 Ϯ 43.9 122.11 Ϯ 48.6* 11.74–383.32 Diethylstilbestrol Wild-type 33.27 Ϯ 5.4 32.59 Ϯ 4.4 17.23 Ϯ 1.6 23.95 Ϯ 3.9 4.72–63.31 ␣ERKO 47.56 Ϯ 9.4 85.25 Ϯ 47.6 42.07 Ϯ 7.3* 105.37 Ϯ 40.1* 9.51–511.62

Notes. Age groups are the same as in Table 1. Data shown are average Ϯ SEM. * P Ͻ 0.05; wild-type vs ␣ERKO within the same treatment.

Therefore, our observations indicate that neonatal DES gen replacement therapy. In fact, recent epidemiologic exposure in the wild-type mouse renders multiple tissues studies indicate the possibility of a second rise in DES- resistant to the physiological effects of endogenous estrogen associated vaginal clear-cell adenocarcinoma in women during sexual maturity, illustrated as a lack of estrogen over the age of 40 (Herbst, 2000). Furthermore, rodent stimulation in the uterus and estrogen inhibition in white studies indicate that certain effects of developmental DES adipose tissue. exposure are transmissible to future generations via either Current models of DES-related neoplasia follow the parent, potentially creating a second cohort of affected initiation–promotion paradigm of carcinogenesis (Liehr, individuals (Newbold et al., 1998; Turusov et al., 1992; 2000). It is widely accepted that increased endogenous Walker, 1984). Finally, numerous studies have illustrated estrogens during sexual maturation likely act in the promo- the induction of DES-like effects in laboratory animals tion of neoplasia; however, the role of genotoxic, epigenetic, following exposure to various other pharmaceutical, indus- and hormonal actions of DES in tumor initiation remains trial, or naturally occurring xenoestrogens (reviewed in unclear (Liehr, 2000). Supporting evidence of a promotional Golden et al., 1998; Miller and Sharpe, 1998). Therefore, role of endogenous estrogens in DES carcinogenesis in- further characterization of the DES model is certain to clude: (1) clear-cell vaginal adenocarcinoma in DES daugh- advance our knowledge of the potential carcinogenic and ters is predominantly diagnosed after menarche and prior to developmental risks associated with human exposure to a 20 years of age (Marselos and Tomatis, 1992); (2) DES- variety of xenoestrogens. Herein, we have demonstrated induced uterine adenocarcinoma in CD-1 mice is prevented that ER␣ is obligatory in mediating the multitude of mor- by prepubertal ovariectomy (Newbold et al., 1990); and (3) phological and biochemical aberrations that occur in the an accelerated appearance of DES-induced uterine adeno- reproductive tract of the female mouse following neonatal carcinoma in transgenic mice overexpressing ER␣ (Couse et DES exposure. al., 1997a). Therefore, if DES-mediated initiation of tumori- genesis is ER␣-independent, perhaps via genotoxic or epigenetic mechanisms, but dependent on ER␣ actions for ACKNOWLEDGMENTS manifestation, the ultimate lesions may not become appar- We acknowledge Dr. Jonathan Lindzey, Dr. Wayne Bocchinfuso, ent in the ␣ERKO. This limitation in the ␣ERKO model as Vickie Walker, Linwood Koonce, and Todd Washburn for their a tool to fully discern the mechanism of DES-related many contributions to these studies; Norris Flagler for his expertise carcinogenesis must be considered. Furthermore, C57BL/6 in digital imaging; the NIEHS Histology Laboratory for processing mice, the genetic background of the ␣ERKO used in this the large number of tissue samples; Dr. Lee Robinette for his study, were resistant to DES-induced neoplasms in the editorial comments; and Wendy Jefferson for her generous consul- female reproductive tract, consistent with previous reports tation throughout this study and editorial comments during manu- of C57BL/6 resistance to chemically induced carcinogenesis script preparation. in liver (Drinkwater and Ginsler, 1986) and lung (Festing et al., 1998). REFERENCES As generations of women exposed to DES approach menopause, little is known of the potential health risks Beckman, W. C., Jr., Newbold, R. R., Teng, C. T., and McLachlan, associated with in utero DES exposure and ovarian senes- J. A. (1994). Molecular feminization of mouse seminal vesicles by cence. This may be exacerbated by potential contraindica- prenatal exposure to diethylstilbestrol: Altered expression of tions of in utero DES exposure and pharmacological estro- messenger RNA. J. Urol. 151, 1370–1378.

Benson, G. V., Lim, H., Paria, B. C., Satokata, I., Dey, S. K., and chemical induction of lung adenomas in A/J x BALB/c mice. Maas, R. L. (1996). Mechanisms of reduced fertility in Hoxa-10 Genomics 53, 129–136. mutant mice: Uterine homeosis and loss of maternal Hoxa-10 Fisher, C. R., Graves, K. H., Parlow, A. F., and Simpson, E. R. (1998). expression. Development 122, 2687–2696. Characterization of mice deficient in aromatase (ArKO) because Benson, G. V., Nguyen, T. H., and Maas, R. L. (1995). The of targeted disruption of the cyp19 gene. Proc. Natl. Acad. Sci. expression pattern of the murine Hoxa-10 gene and the sequence USA 95, 6965–6970. recognition of its homeodomain reveal specific properties of Gendron, R. L., Paradis, H., Hsieh-Li, H. M., Lee, D. W., Potter, Abdominal B-like genes. Mol. Cell. Biol. 15, 1591–1601. S. S., and Markoff, E. (1997). Abnormal uterine stromal and Block, K., Kardana, A., Igarashi, P., and Taylor, H. S. (2000). In utero glandular function associated with maternal reproductive defects diethylstilbestrol (DES) exposure alters Hox gene expression in in Hoxa-11 null mice. Biol. Reprod. 56, 1097–1105. the developing mu¨llerian system. FASEB J. 14, 1101–1108. Ghosh, D., Taylor, J. A., Green, J. A., and Lubahn, D. B. (1999). Couse, J. F., Davis, V. L., Hanson, R. B., Jefferson, W. N., Methoxychlor stimulates estrogen-responsive messenger ribo- McLachlan, J. A., Bullock, B. C., Newbold, R. R., and Korach, nucleic acids in mouse uterus through a non-estrogen receptor K. S. (1997a). Accelerated onset of uterine tumors in transgenic (non-ER) alpha and non-ER beta mechanism. Endocrinology 140, mice with aberrant expression of the estrogen receptor after 3526–3533. neonatal exposure to diethylstilbestrol. Mol. Carcinog. 19, 236– Gigue`re, V., Tremblay, A., and Tremblay, G. B. (1998). Estrogen 242. receptor ␤: Re-evaluation of estrogen and antiestrogen signaling. Couse, J. F., Davis, V. L., Tally, W. C., and Korach, K. S. (1994). An Steroids 63, 335–339. improved method of genomic DNA extraction for screening Golden, R. J., Noller, K. L., Titus-Ernstoff, L., Kaufman, R. H., transgenic mice. Biotechniques 17, 1030–1032. Mittendorf, R., Stillman, R., and Reese, E. A. (1998). Environ- Couse, J. F., Hewitt, S. C., Bunch, D. O., Sar, M., Walker, V. R., mental endocrine modulators and human health: An assessment Davis, B. J., and Korach, K. S. (1999). Postnatal sex reversal of the of the biological evidence. Crit. Rev. Toxicol. 28, 109–227. ovaries in mice lacking estrogen receptors ␣ and ␤. Science 286, Greco, T. L., Duello, T. M., and Gorski, J. (1993). Estrogen recep- 2328–2331. tors, estradiol, and diethylstilbestrol in early development: The Couse, J. F., and Korach, K. S. (1999). Estrogen receptor null mice: mouse as a model for the study of estrogen receptors and estrogen What have we learned and where will they lead us? Endocr. Rev. sensitivity in embryonic development of male and female repro- 20, 358–417. ductive tracts. Endocr. Rev. 14, 59–71. Couse, J. F., Lindzey, J., Grandien, K., Gustafsson, J. Å., and Korach, Greenwald, P., Barlow, J. J., Nasca, P. C., and Burnett, W. S. (1971). K. S. (1997b). Tissue distribution and quantitative analysis of Vaginal cancer after maternal treatment with synthetic estro- estrogen receptor-␣ (ER␣) and estrogen receptor-␤ (ER␤) messen- gens. N. Engl. J. Med. 285, 390–392. ger ribonucleic acid in the wild-type and ER␣-knockout mouse. Hajek, R. A., Nguyen, T. V., Johnston, D. A., and Jones, L. A. (1993). Endocrinology 138, 4613–4621. In vivo induction of increased DNA ploidy of mouse cervicovagi- Cunha, G. R., Cooke, P. S., Bigsby, R., and Brody, J. R. (1991). nal epithelium by neonatal estrogen treatment. Biol. Reprod. 49, Ontogeny of sex steroid receptors in mammals. In “Nuclear 908–917. Hormone Receptors: Molecular Mechanisms, Cellular Func- Heine, P. A., Taylor, J. A., Iwamoto, G. A., Lubahn, D. B., and tions, Clinical Abnormalities” (M. G. Parker, Ed.), pp. 235–268. Cooke, P. S. (2000). Increased adipose tissue in male and female Academic Press, London. estrogen receptor-␣ knockout mice. Proc. Natl. Acad. Sci. USA Das, S. K., Taylor, J. A., Korach, K. S., Paria, B. C., Dey, S. K., and 97, 12729–12734. Lubahn, D. B. (1997). Estrogenic responses in estrogen receptor-␣ Herbst, A. L. (2000). Behavior of estrogen-associated female genital deficient mice reveal a distinct estrogen signaling pathway. Proc. tract cancer and its relation to neoplasia following intrauterine Natl. Acad. Sci. USA 94, 12786–12791. exposure to diethylstilbestrol (DES). Gynecol. Oncol. 76, 147– Dieckmann, W. J., Davis, M. E., Rynkiewicz, L. M., and Pottinger, 156. R. E. (1953). Does the administration of diethylstilbestrol during Herbst, A. L., Ulfelder, H., and Poskanzer, D. C. (1971). Adenocar- pregnancy have therapeutic value? Am. J. Obstet. Gynecol. 66, cinoma of the vagina. Association of maternal stilbestrol therapy 1062–1081. with tumor appearance in young women. N. Engl. J. Med. 284, Dolle, P., Izpisua-Belmonte, J. C., Brown, J. M., Tickle, C., and 878–881. Duboule, D. (1991). HOX-4 genes and the morphogenesis of Hsieh-Li, H. M., Witte, D. P., Weinstein, M., Branford, W., Li, H., mammalian genitalia. Genes Dev. 5, 1767–1776. Small, K., and Potter, S. S. (1995). Hoxa 11 structure, extensive Drinkwater, N. R., and Ginsler, J. J. (1986). Genetic control of antisense transcription, and function in male and female fertil- hepatocarcinogenesis in C57BL/6J and C3H/HeJ inbred mice. ity. Development 121, 1373–1385. Carcinogenesis 7, 1701–1707. International Association for Research on Cancer (IARC). (1979). Dukes, M., Chester, R., Yarwood, L., and Wakeling, A. E. (1994). “IARC Monographs on the Evaluation of the Carcinogenic Risk Effects of a non-steroidal pure antioestrogen, ZM 189,154, on of Chemicals to Humans: Sex Hormones (II).” IARC, Lyon, oestrogen target organs of the rat including bones. J. Endocrinol. France. 141, 335–341. IARC. (1987). “IARC Monographs on the Evaluation of the Carci- Falck, L., and Forsberg, J.-G. (1996). Immunohistochemical studies nogenic Risk of Chemicals to Humans: An Updating of IARC on the expression and estrogen dependency of EGF and its Monographs 1987, Vols. 1–42.” IARC, Lyon, France. receptor and c-fos proto-oncogene in the uterus and vagina of Jefferson, W. N., Couse, J. F., Banks, E. P., Korach, K. S., and normal and neonatally estrogen-treated mice. Anat. Rec. 245, Newbold, R. R. (2000). Expression of estrogen receptor beta is 459–471. developmentally regulated in reproductive tissues of male and Festing, M. F., Lin, L., Devereux, T. R., Gao, F., Yang, A., Anna, female mice. Biol. Reprod. 62, 310–317. C. H., White, C. M., Malkinson, A. M., and You, M. (1998). At Jones, M. E., Thorburn, A. W., Britt, K. L., Hewitt, K. N., Wreford, least four loci and gender are associated with susceptibility to the N. G., Proietto, J., Oz, O. K., Leury, B. J., Robertson, K. M., Yao,

S., and Simpson, E. R. (2000). Aromatase-deficient (ArKO) mice mental period of the mouse reproductive tract leads to persistent have a phenotype of increased adiposity. Proc. Natl. Acad. Sci. induction of two estrogen-regulated genes. Cell Growth Differ. 5, USA 97, 12735–12740. 595–606. Kitajewski, J., and Sassoon, D. (2000). The emergence of molecular Newbold, R. (1995). Cellular and molecular effects of developmen- gynecology: homeobox and wnt genes in the female reproductive tal exposure to diethylstilbestrol: Implications for other environ- tract. BioEssays 22, 902–910. mental estrogens. Environ. Health Perspect. 103, 83–87. Korach, K. S., Chae, K., Levy, L. A., Daux, W. L., and Sarver, P. J. Newbold, R. R., Bullock, B. C., and McLachlan, J. A. (1985). (1989). Diethylstilbestrol metabolites and analogs: Stereochemi- Progressive proliferative changes in the oviduct of mice follow- cal probes for the estrogen receptor binding site. J. Biol. Chem. ing developmental exposure to diethylstilbestrol. Teratog. Car- 264, 5642–5647. cinog. Mutagen 5, 473–480. Korach, K. S., Horigome, T., Tomooka, Y., Yamashita, S., Newbold, Newbold, R. R., Bullock, B. C., and McLachlan, J. A. (1990). Uterine R. R., and McLachlan, J. A. (1988). Immunodetection of estrogen adenocarcinoma in mice following developmental treatment receptor in epithelial and stromal tissues of neonatal mouse with estrogens: A model for hormonal carcinogenesis. Cancer uterus. Proc. Natl. Acad. Sci. USA 85, 3334–3337. Res. 50, 7677–7681. Korach, K. S., Metzler, M., and McLachlan, J. A. (1978). Estrogenic Newbold, R. R., Hanson, R. B., Jefferson, W. N., Bullock, B. C., activity in vivo and in vitro of some diethylstilbestrol metabo- Haseman, J., and McLachlan, J. A. (1998). Increased tumors but lites and analogs. Proc. Natl. Acad. Sci. USA 75, 468–471. uncompromised fertility in the female descendants of mice Li, S., Washburn, K. A., Moore, R., Uno, T., Teng, C., Newbold, exposed developmentally to diethylstilbestrol. Carcinogenesis R. R., McLachlan, J. A., and Negishi, M. (1997). Developmental 19, 1655–1663. exposure to diethylstilbestrol elicits demethylation of estrogen- Parr, B. A., and McMahon, A. P. (1998). Sexually dimorphic responsive lactoferrin gene in mouse uterus. Cancer Res. 57, development of the mammalian reproductive tract requires Wnt- 4356–4359. 7a. Nature 395, 707–710. Liehr, J. G. (2000). Is estradiol a genotoxic mutagenic carcinogen? Prins, G. S. (1992). Neonatal estrogen exposure induces lobe- Endocr. Rev. 21, 40–54. specific alterations in adult rat prostate androgen receptor ex- Lim, H., Ma, L., Ma, W. G., Maas, R. L., and Dey, S. K. (1999). pression. Endocrinology 130, 3703–3714. Hoxa-10 regulates uterine stromal cell responsiveness to proges- Prins, G. S., and Birch, L. (1995). The developmental pattern of terone during implantation and decidualization in the mouse. androgen receptor expression in rat prostate lobes is altered after Mol. Endocrinol. 13, 1005–1017. neonatal exposure to estrogen. Endocrinology 136, 1303–1314. Ma, L., Benson, G. V., Lim, H. J., Dey, S. K., and Maas, R. L. (1998). Salo, L. K., Makela, S. I., Stancel, G. M., and Santti, R. S. (1997). Abdominal B (AbdB) Hoxa genes: Regulation in adult uterus by Neonatal exposure to diethylstilbestrol permanently alters the estrogen and progesterone and repression in Mu¨llerian duct by the basal and 17␤-estradiol induced expression of c-fos proto- synthetic estrogen diethylstilbestrol (DES). Dev. Biol. 197, 141–154. oncogene in mouse urethroprostatic complex. Mol. Cell. Endo- Maier, D. B., Newbold, R. R., and McLachlan, J. A. (1985). Prenatal crinol. 126, 133–141. diethylstilbestrol exposure alters murine uterine responses to pre- Satokata, I., Benson, G., and Maas, R. (1995). Sexually dimorphic pubertal estrogen stimulation. Endocrinology 116, 1878–1886. sterility phenotypes in Hoxa10-deficient mice. Nature 374, 460– Marselos, M., and Tomatis, L. (1992). Diethylstilboestrol: I. Phar- 463. macology, toxicology and carcinogenicity in humans. Eur. J. Sibonga, J. D., Dobnig, H., Harden, R. M., and Turner, R. T. (1998). Cancer 28A, 1182–1189. Marselos, M., and Tomatis, L. (1993). Diethylstilboestrol: II. Phar- Effect of the high-affinity estrogen receptor ligand ICI 182,780 on macology, toxicology and carcinogenicity in experimental ani- the rat tibia. Endocrinology 139, 3736–3742. mals. Eur. J. Cancer 29A, 149–155. Takasugi, N. (1976). Cytological basis for permanent vaginal Medlock, K. L., Branham, W. S., and Sheehan, D. M. (1992). changes in mice treated neonatally with steroid hormones. Int. Long-term effects of postnatal exposure to diethylstilbestrol on Rev. Cytol. 44, 193–224. uterine estrogen receptor and growth. J. Steroid Biochem. Mol. Taylor, H. S., Arici, A., Olive, D., and Igarashi, P. (1998). HOXA10 Biol. 42, 23–28. is expressed in response to sex steroids at the time of implanta- Medlock, K. L., Sheehan, D. M., Nelson, C. J., and Branham, W. S. tion in the human endometrium. J. Clin. Invest. 101, 1379–1384. (1988). Effects of postnatal DES treatment on uterine growth, Taylor, H. S., Bagot, C., Kardana, A., Olive, D., and Arici, A. (1999). development, and estrogen receptor levels. J. Steroid Biochem. HOX gene expression is altered in the endometrium of women Mol. Biol. 29, 527–532. with endometriosis. Hum. Reprod. 14, 1328–1331. Miller, C., Degenhardt, K., and Sassoon, D. A. (1998a). Fetal Taylor, H. S., Vanden Heuvel, G. B., and Igarashi, P. (1997). A exposure to DES results in de-regulation of Wnt7a during uterine conserved Hox axis in the mouse and human female reproductive morphogenesis. Nat. Genet. 20, 228–230. system: Late establishment and persistent adult expression of the Miller, C., Pavlova, A., and Sassoon, D. A. (1998b). Differential Hoxa cluster genes. Biol. Reprod. 57, 1338–1345. expression patterns of Wnt genes in the murine female reproduc- Tremblay, G. B., Kunath, T., Bergeron, D., Lapointe, L., Champigny, tive tract during development and the estrous cycle. Mech. Dev. C., Bader, J.-A., Rossant, J., and Gigue`re, V. (2001). Diethylstilbes- 76, 91–99. trol regulates trophoblast stem cell differentiation as a ligand of Miller, W. R., and Sharpe, R. M. (1998). Environmental oestrogens orphan nuclear receptor ERR␤. Genes Dev. 15, 833–838. and human reproductive cancers. Endocr. Rel. Cancer 5, 69–96. Tsutsui, T., Maizumi, H., McLachlan, J. A., and Barrett, J. C. (1983). Mittendorf, R. (1995). Teratogen update: Carcinogenesis and tera- Aneuploidy induction and cell transformation by diethylstilbes- togenesis associated with exposure to diethylstilbestrol (DES) in trol: A possible chromosomal mechanism in carcinogenesis. utero. Teratology 51, 435–445. Cancer Res. 43, 3814–3821. Nelson, K. G., Sakai, Y., Eitzman, B., Steed, T., and McLachlan, J. Turusov, V. S., Trukhanova, L. S., Parfenov, Yu. D., and Tomatis, L. (1994). Exposure to diethylstilbestrol during a critical develop- (1992). Occurrence of tumours in the descendants of CBA male

mice prenatally treated with diethylstilbestrol. Int. J. Cancer 50, Yamashita, S., Newbold, R. R., McLachlan, J. A., and Korach, K. S. 131–135. (1989). Developmental pattern of estrogen receptor expression in Walker, B. E. (1984). Tumors of female offspring of mice exposed female mouse genital tracts. Endocrinology 125, 2888–2896. prenatally to diethylstilbestrol. J. Natl. Cancer Inst. 73, 133–140. Zheng, X., and Hendry III, W. J. (1997). Neonatal diethylstilbestrol Warot, X., Fromental-Ramain, C., Fraulob, V., Chambon, P., and treatment alters the estrogen-regulated expression of both cell Dolle, P. (1997). Gene dosage-dependent effects of the Hoxa-13 proliferation and apoptosis-related proto-oncogenes (c-jun, c-fos, and Hoxd-13 mutations on morphogenesis of the terminal parts c-myc, bax, bcl-2, and bcl-x) in the hamster uterus. Cell Growth of the digestive and urogenital tracts. Development 124, 4781– Differ. 8, 425–434. 4791. Welch, W. R., Fu, Y. S., Robboy, S. J., and Herbst, A. L. (1983). Received for publication May 1, 2001 Nuclear DNA content of clear cell adenocarcinoma of the vagina Revised July 18, 2001 and cervix and its relationship to prognosis. Gynecol. Oncol. 15, Accepted July 20, 2001 230–238. Published online September 7, 2001

Estrogen Receptor-&lt;Alpha&gt; Knockout Mice Exhibit Resistance To

Estrogen Receptor-<Alpha> Knockout Mice Exhibit Resistance To