DOCSLIB.ORG

Supplementary Figure 1. Expression of Wnt Genes in SC of Naïve

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Figure 1. Expression of Wnt Genes in SC of Naïve A Days after CCI Days after CCI Naive Sham 1 3 5 10 Naive Sham 1 3 5 10 500bp 400bp Wnt1 Wnt2 250bp 250bp 400bp 400bp Wnt2b Wnt3 250bp 250bp 400bp 400bp Wnt3a Wnt4 250bp 250bp 300bp 400bp Wnt5a Wnt5b 200bp 250bp 400bp 400bp Wnt6 Wnt7a 250bp 250bp 400bp 400bp Wnt7b Wnt8a 250bp 250bp 400bp 350bp Wnt8b Wnt9a 250bp 200bp 400bp 400bp Wnt9b Wnt10a 250bp 250bp 400bp 400bp Wnt10b Wnt11 250bp 250bp 400bp 400bp Wnt16 GAPDH 250bp 250bp B 5 Wnt1 5 Wnt2 5 Wnt3a ** 4 4 4 * ** ** 3 3 * 3 * * 2 2 * 2 1 1 1 0 0 0 NaïveSham 1 3 5 10 Naïve Sham 1 3 5 10 Naïve Sham 1 3 5 10 Days after CCI Days after CCI Days after CCI 5 Wnt5b 5 Wnt8b 4 4 ** 3 ** 3 ** Relative mRNA Expression (fold of change) ** 2 * 2 1 1 0 0 NaïveSham 1 3 5 10 NaïveSham 1 3 5 10 Days after CCI Days after CCI Supplementary Figure 1 A B Negative Weak Moderate Strong Negative Weak Moderate Strong Large-sized cells 100% 100% 80% 80% 60% 60% 40% 20% 40% 0% 20% Sham CCI-1d CCI-14d Medium-sized cells Wnt3a immunoreactivity cells 0% 100% CGRP(+) IB4(+) 80% Small cells 60% 40% 20% 0% Sham CCI-1d CCI-14d Wnt3a immunoreactivity cells Small cells 100% 80% 60% 40% 20% 0% Sham CCI-1d CCI-14d Fig. S2 4 Fz1 4 Fz3 4 Fz4 4 Fz5 ** 3 3 ** 3 3 2 ** 2 2 ** 2 * 1 1 1 1 0 0 0 0 NaïveSham 1 5 10 NaïveSham 1 5 10 Naïve Sham 1 5 10 NaïveSham 1 5 10 Days after CCI Days after CCI Days after CCI Days after CCI 4 Fz6 4 Fz7 4 Fz8 4 Fz9 (Fold of Change) of (Fold 3 3 3 ** 3 Relative mRNA Expression Expression mRNA Relative ** 2 2 2 ** 2 * 1 1 1 1 0 0 0 0 NaïveSham 1 5 10 NaïveSham 1 5 10 Naïve Sham 1d 5d 10d NaïveSham 1 5 10 Days after CCI Days after CCI Days after CCI Days after CCI A Days after CCI Sham 1 3 7 14 NeuN / Fz1 GFAP / Fz1 Iba1 / Fz1 B Days after CCI Sham 1 3 7 14 NeuN / Fz8 GFAP / Fz8 Iba1 / Fz8 Supplementary Figure 3 A Sham CCI-1d CCI-14d 800 m) 600 μ 2 400 Fz1 200 intensity (100 0 Mean immunofluorescence Sham CCI-1d CCI-14d BCNegative Weak Moderate Strong Fz1 CGRP Wnt3a/CGRP Large-sized cells 100% 80% 60% 40% 20% Fz1 IB4 Wnt3a/IB4 0% Sham CCI-1d CCI-14d Medium-sized cells 100% 80% 60% Negative Weak Moderate Strong 40% 100% 20% 80% Immunoreactivity cells 0% 60% Sham CCI-1d CCI-14d Small cells 40% 100% 20% 80% 0% Immunoreactivity cells 60% CGRP IB4 40% Small cells 20% 0% Sham CCI-1d CCI-14d Fig. S5 A Fz8 GFAP Fz8/GFAP B Fz1 GFAP Fz1/GFAP Fig. S6 A Active β-catenin PI Active β-catenin / PI Sham CCI-1d CCI-14d B 800 Active β-catenin m) 600 μ 2 400 200 intensity (100 Mean immunofluorescence 0 Sham CCI-1d CCI-14d Fig. S7 A Time after CCI (h) Sham 2 6 2412 48 72 kDa Wnt3a 40 Active 92 β-catenin β-catenin 92 GAPDH 37 B 4 Wnt3a ** ** ** 3 ** ** 2 1 Fold of change 0 Sham 2 6 12 24 48 72 Time after CCI (h) 4 Active β-catenin ** ** ** β-catenin ** ** ** ** ** 3 ** ** 2 1 Fold of change Figure S4 0 Sham 2 6 12 24 48 72 Time after CCI (h) A Sham+DMSO CCI+huamn Fc B CCI+DMSO CCI+Nsm CCI+DMSO CCI+IWP-2 CCI+IWR l 160 160 CCI+Fz-8/Fc 140 140 120 ** ** 120 ** **** ** ** 100 ** ** 100 ** ** * ** ** 80 80 * 60 60 * 40 40 (ipsilateral threshold, mN) Mechanical withdrawa Mechanical withdrawa 20 (ipsilateral thershold, mN) 20 -5-3-1135791113151719212 4 6 8 12 24 48 -5-3-1135791113151719212 4 6 8 12 24 48 Postoperative day After injection (h) Postoperative day After injection (h) Fig. S5 A Sham+DMSO CCI+human Fc B Sham+DMSO CCI+DMSO CCI+DMSO CCI+IWP-2 CCI+human Fc CCI+IWP-2 CCI+Fz-8/Fc CCI+Fz-8/Fc 14 14 ** 12 12 ** ** 10 ** 10 ** ** ** * **** ** 8 ** 8 **** 6 6 4 4 Thermal withdrawal Thermal withdrawal (ipsilateral latency,s) (ipsilateral latency,s) 2 2 0 0 -5-3-113579111315 -5-3-113579111315171921 Postoperative day Postoperative day C CCI+DMSO CCI+IWR D CCI+DMSO CCI+IWR CCI+Nsm 14 14 CCI+Nsm 12 ** ** ) 12 ** ** ** ** 10 ** 10 ** ** ** 8 ** 8 ** ** 6 6 4 4 Thermal withdrawal Thermal withdrawal Thermal (ipsilateral latency,s) 2 (ipsilateral latency,s 2 0 0 -5 -3 -1 1 3 5 7 9 11 13 15 -5 -3 -1 1 3 5 7 9 11 13 15 17 19 21 Postoperative day Postoperative day fig. S6 A Sham+IWP-2 (20 µM) CCI+PBS CCI+PBS CCI+IWP-2 (10 µM) CCI+IWP-2 (10 µM) CCI+IWP-2 (20 µM) CCI+IWP-2 (20 µM) CCI+IWP-2 (40 µM) 14 14 CCI+IWP-2 (40 µM) 12 12 ** ** ** 10 10 ** ** ** ** * 8 8 * ** ** * 6 6 4 4 Thermal withdrawal Thermal (ipsilateral latency, s) 2 2 0 0 -4 -2 0 2 4 6 8 10 12 14 -2024681012 Postoperative day Time after injection (h) B PBS DMSO IWP-2 180 Left 180 180 Right 160 160 160 140 140 140 120 120 120 100 100 100 02468 02468 02468 180 Fz-8/Fc 180 IWR 180 Nsm 160 160 160 140 140 140 120 120 120 Mechanical withdrawal (threshold,mN ) (threshold,mN withdrawal Mechanical 100 100 100 02468 02468 02468 Time (day) C IWP-2 PBS Left DMSO 14 14 14 Right 13 13 13 fig. S7 12 12 12 11 11 11 10 10 10 9 9 9 02468 02468 02468 14 Fz-8/Fc 14 IWR 14 Nsm 13 13 13 12 12 12 Thermal withdrawal (latency,s ) (latency,s withdrawal Thermal 11 11 11 10 10 10 9 9 9 02468 02468 02468 Time (day) A Pre-administration 20 Post-administration 16 12 8 Running timeRunning (min) 4 0 Sham DMSO IWP-2 Fz-8/Fc IWR Nsm B Pre-administration 80 Post-administration 60 40 Number of ES 20 0 Sham DMSO IWP-2 Fz-8/Fc IWR Nsm C Pre-administration 40 Post-administration 30 20 10 Maxium speed (m / min) 0 Sham DMSO IWP-2 Fz-8/Fc IWR Nsm Supplementary Table 1. The primers used to assess the expression of Wnt ligands. Amplicon Accession GENE FORWARD (5' -3') REVERSE (5' -3') size (bp) No. Wnt1 TCCTCCACGAACCTGCTGACA GTCGCAGGTGCAGGATTCGAT 339 NM_001105714 Wnt2 CTCCCTCTGCTCTTGACCTG GCTGAGGAGATGGCGTAAAC 317 XM_575397 Wnt2b AGGCAGCGTTTGTCTATGCTA CCACTCACACCATGACACTTG 319 XM_001066411 Wnt3 CCGAGGGAACCTCTACCATC GGCACTGTCGTACTTGTCCTT 329 NM_001105715 Wnt3a GGTGGTAGAGAAACACCGAGA CAGCTGACATAACAGCACCAG 294 XM_220546 Wnt4 TAGACGTCCGAGAGAGAAGC TCCGTATGTGGCTTGAACTG 292 NM_053402 Wnt5a TGGAGTGGTAAATGCCATGAG ACAGGCTACATCTGCCAGGTT 280 NM_022631 Wnt5b GCAAGCTGGAACTGACCAAC GTCCACGATCTCGGTGCATT 281 NM_001100489 Wnt6 ACGTGGAGATATCCGTGCTTT AATCGGCTGCGTAGAGGAGAT 287 NM_001108226 Wnt7a TACCGTAAGCCCATGGACACT ACGGTATCCTGCCTGTGATCT 309 NM_001100473 Wnt7b CAAGGAGAAGTACAACGCAGC CACTTGACGAAGCAACACCAG 324 NM_001009695 Wnt8a CTGACTACTGCAACCGCAATG CTCCACTGTCGTGCAACTAAG 318 NM_001106155 Wnt8b AACTGTGGCTGTGATGACTCC CGCTGCGTGATACTTCTCCTT 315 NM_001106359 Wnt9a GCTTTCCTCTACGCCATCTCT CACGAGGTTGTTGTGGAAGTC 239 NM_001105783 Wnt9b AGGAGACAGCCTTCCTGTACG CACTTGCAGGTTGTTCTCAGG 295 NM_001107055 Wnt10a CCGACCTGGTCTACTTTGAGA TCTTGAGACCCAGAGGAGCTT 283 NM_001108227 Wnt10b AGAGTGCGTTCTCCTTCTCCA TCTCCAAAGTCCATGTCGTGA 274 NM_001108111 Wnt11 CTGACCTCAAGACCCGCTAC TGACATCGCTCCACCACTCT 286 NM_080401 Wnt16 GTGCAAGAGGAAACCGTACCT GTCACAGGAACACTCGGTCAT 271 NM_001109223 GAPDH ACCACAGTCCATGCCATCAC GTCCTCAGTGTAGCCCAGGA 312 NM_017008 Supplementary Table 2. Quantitative Real-Time RT-PCR Primer Sequences GENE FORWARD (5' -3') REVERSE (5' -3') ACCESSION # Fzd1 CGTACTGAGTGGAGTGTGTTTTG TGAGCTTTTCCAGTTTCTCTGTC NM_021266 Fzd3 GGCCTGATTTCAATCATTTG AGATGCATTGCAGGCTACTC NM_153474 Fzd4 AGATGGGACCAAGACAGACA ATCCACATGCCTGAAGTGAT NM_022623 Fzd5 CCATCCTGAAGGAGTCACAC CCATGTCAATGAGGAAGGTC NM_173838 Fzd6 CTGCACAGAGCAAATTGATG GTGCTTTGGACACCAAAATC NM_001130536 Fzd7 ACGCCAATATTGTCCTCTTG CAGGTGACTGAGGAGCAAGT XM_002727202 Fzd8 CTACACCTACATGCCCAACC CTTGTAGTCCTCCAGGCAGA NM_001044251 Fzd9 CTGCGTCATTGTCTGCTATG TCTGCCAAGTCTGGAAAGTC NM_153305 IL-18 CAGACCACTTTGGCAGACTT ATCCTTCCATCCTTCACAG NM_019165 IL-18R CCAACGAAGAAGCCACAGACA CTCGTCTCTTTCTGCTACACG NM_001106905 IL-1β AGAGTGTGGATCCCAAACAA AGTCAACTATGTCCCGACCA NM_031512 TNF-a CCAGGAGAAAGTCAGCCTCCT TCATACCAGGGCTTGAGCTCA NM_012675 GAPDH AGACAGCCGCATCTTCTTGT CTTGCCGTGGGTAGAGTCAT NM_017008 Supplementary Table 3. Sequence of primers for ChIP assays. ChIP primers FORWARD (5' -3') REVERSE (5' -3') IL-18-Site A GTCTTCTTCAGTGGATCCTGAGTT ATGTGACAAATAACAGGCTAGGTG IL-18-Site B TGAGGATAAACATGTGTGCTTTCT TTGATCTGAAGTCTGGGTTGTCTA IL-18-Site C TGGTGCATAGACATGCATATAATC TTTCTTTGAAGTTGACACAAGAGC IL-1β-Site A GGAACCTTAAAGCTGAAAAACACT GTCTCTCAGGCAACATTTCTTTCT IL-1β-Site B TAGCTCAGACAGGACCTCTAGACT CTAATTTGGCTCACAGTGTCTCAC IL-1β-Site C AAGTCCAAGGAGGCAAGAGAGGTG AGAGCAAGGGGTGGCAGACTATGAC TNFα-Site A GTACCCCAGCAAACAGAATTCACTG GAAGGGGTACTGGGAGGAAAACAG TNFα-Site B GCTCCCAGTAACATGATGGATTC AACCCATAGCTCTATGTCTTCCA TNFα-Site C TTCAGCCACTTCCTCTAAGAACTC GAACTGAAACCCATTTCCTCTCT .
Load more

Recommended publications
  • Wnt Signaling in Vertebrate Neural Development and Function
    J Neuroimmune Pharmacol (2012) 7:774–787 DOI 10.1007/s11481-012-9404-x INVITED REVIEW Wnt Signaling in Vertebrate Neural Development and Function Kimberly A. Mulligan & Benjamin N. R. Cheyette Received: 18 June 2012 /Accepted: 10 September 2012 /Published online: 27 September 2012 # Springer Science+Business Media, LLC 2012 Abstract Members of the Wnt family of secreted signaling immature neurons migrate to populate different cortical proteins influence many aspects of neural development and layers, nuclei, and ganglia in the forebrain, midbrain, hind- function. Wnts are required from neural induction and axis brain, and spinal cord. Each mature neuron elaborates an formation to axon guidance and synapse development, and axon and numerous dendrites while forming hundreds to even help modulate synapse activity. Wnt proteins activate a thousands of synapses with other neurons, enabling electro- variety of downstream signaling pathways and can induce a chemical communication throughout the nervous system. similar variety of cellular responses, including gene tran- All these developmental processes must be coordinated to scription changes and cytoskeletal rearrangements. This re- ensure proper construction and function of the CNS, and view provides an introduction to Wnt signaling pathways this requires the coordinated developmental activity of a and discusses current research on their roles in vertebrate vast array of genes. neural development and function. Members of the Wnt family of secreted signaling proteins are implicated in every step of neural development men- Keywords Wnt signaling . Neural development . tioned above. Wnt proteins provide positional information CNS patterning . Axon guidance . Dendrite growth . within the embryo for anterior-posterior axis specification of Synapse formation .
    [Show full text]
  • A Commentary on WNT7A Implication in Cervical Cancer Development
    ndrom Sy es tic & e G n e e n G e f T o Artaza-Irigaray et al., J Genet Syndr Gene Ther 2015, 6:3 Journal of Genetic Syndromes h l e a r n a DOI: 10.4172/2157-7412.1000267 r p u y o J & Gene Therapy ISSN: 2157-7412 Commentary Open Access A Commentary on WNT7A Implication in Cervical Cancer Development Cristina Artaza-Irigaray1,2, Adriana Aguilar-Lemarroy1 and Luis F Jave-Suárez1* 1División de Inmunología, Centro de Investigación Biomédica de Occidente (CIBO), Instituto Mexicano del Seguro Social (IMSS), Guadalajara, Jalisco, Mexico 2Programa de Doctorado en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud (CUCS) - Universidad de Guadalajara, Jalisco, Mexico Cervical Cancer (CC) is the fourth leading cause of cancer Conversely, silencing Wnt7a in HaCaT cells induced an increase in cell deaths in women worldwide and is associated directly with Human proliferation and migration rates. These results suggest that the loss of papillomavirus (HPV) infection [1]. Many authors have reported Wnt7a expression probably contributes to increased cell proliferation that HPV can immortalize human cells without leading to cell and migration during cervical tumor development. transformation by itself [2,3]. Thus, cervical carcinogenesis is a As responses always lead to new questions, the next step was multistep process involving HPV infection and additional alterations. to elucidate the way in which Wnt7a ligand expression was being In 2005, canonical Wnt signaling pathway activation was proposed repressed. Wnt7a is known to possess tumor suppressor properties as a second hit during epithelial malignant transformation but this in several cancers and is frequently inactivated due to CpG-island hypothesis remains controversial [3,4].
    [Show full text]
  • EGFR Confers Exquisite Specificity of Wnt9a-Fzd9b Signaling in Hematopoietic Stem Cell Development
    bioRxiv preprint doi: https://doi.org/10.1101/387043; this version posted August 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Grainger, et al, 2018 EGFR confers exquisite specificity of Wnt9a-Fzd9b signaling in hematopoietic stem cell development Stephanie Grainger1, Nicole Nguyen1, Jenna Richter1,2, Jordan Setayesh1, Brianna Lonquich1, Chet Huan Oon1, Jacob M. Wozniak2,3,4, Rocio Barahona1, Caramai N. Kamei5, Jack Houston1,2, Marvic Carrillo-Terrazas3,4, Iain A. Drummond5,6, David Gonzalez3.4, Karl Willert#,¥,1, and David Traver¥,1,7. ¥co-corresponding authors: [email protected]; [email protected] #Lead contact 1Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, 92037, USA. 2Biomedical Sciences Graduate Program, University of California, San Diego, La Jolla, California, 92037, USA. 3Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, California, 92093, USA. 4Department of Pharmacology, University of California, San Diego, La Jolla, California, 92092 5Massachusetts General Hospital Nephrology Division, Charlestown, Massachusetts, 02129, USA. 6Harvard Medical School, Department of Genetics, Boston MA 02115 7Section of Cell and Developmental Biology, University of California, San Diego, La Jolla, California, 92037, USA. Running title: A mechanism for Wnt-Fzd specificity in hematopoietic stem cells Keywords: hematopoietic stem cell (HSC), Wnt, Wnt9a, human, zebrafish, Fzd, Fzd9b, FZD9, EGFR, APEX2 1 bioRxiv preprint doi: https://doi.org/10.1101/387043; this version posted August 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • A High-Fat/High-Sucrose Diet Induces WNT4 Expression in Mouse Pancreatic Β-Cells
    This is “Advance Publication Article” Kurume Medical Journal, 65, 00-00, 2018 Original Article A High-Fat/High-Sucrose Diet Induces WNT4 Expression in Mouse Pancreatic β-cells YAYOI KURITA, TSUYOSHI OHKI, ERI SOEJIMA, XIAOHONG YUAN, SATOMI KAKINO, NOBUHIKO WADA, TOSHIHIKO HASHINAGA, HITOMI NAKAYAMA, JUNICHI TANI, YUJI TAJIRI, YUJI HIROMATSU, KENTARO YAMADA* AND MASATOSHI NOMURA Division of Endocrinology and Metabolism, Department of Internal Medicine, Kurume University School of Medicine, Kurume 830-0011, Japan, *Diabetes Center of Asakura Medical Association Hospital, Asakura 838-0069, Japan Received 12 February 2018, accepted 1 May 2018 J-STAGE advance publication 11 March 2019 Edited by MAKOTO TAKANO Summary: Aims/Introduction: Several lines of evidence suggest that dysregulation of the WNT signaling pathway is involved in the pathogenesis of type 2 diabetes. This study was performed to elucidate the effects of a high-fat/high-sucrose (HF/HS) diet on pancreatic islet functions in relation to modulation of WNT ligand expression in β-cells. Materials and Methods: Mice were fed either standard mouse chow or a HF/HS diet from 8 weeks of age. At 20 weeks of age, intraperitoneal glucose tolerance tests were performed in both groups of mice, followed by euthanasia and isolation of pancreatic islets. WNT-related gene expression in islets and MIN6 cells was measured by quantitative real-time RT-PCR. To explore the direct effects of WNT signals on pancreatic β-cells, MIN6 cells were exposed to recombinant mouse WNT4 protein (rmWNT4) for 48 h, and glucose-induced insulin secre- tion was measured. Furthermore, Wnt4 siRNAs were transfected into MIN6 cells, and cell viability and insulin secretion were measured in control and Wnt4 siRNA-transfected MIN6 cells.
    [Show full text]
  • WNT4 and WNT3A Activate Cell Autonomous Wnt Signaling Independent of Secretion
    bioRxiv preprint doi: https://doi.org/10.1101/333906; this version posted September 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Running Title: Secretion-independent Wnt signaling Research article WNT4 and WNT3A activate cell autonomous Wnt signaling independent of secretion Deviyani M. Rao1, Rebecca L. Ferguson1, Tomomi M. Yamamoto2, Benjamin G. Bitler2, Matthew J. Sikora1 Affiliation: 1Dept. of Pathology, 2Dept. of Obstetrics and Gynecology, University of Colorado Anschutz Medical Campus Corresponding author: Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: @mjsikora Funding This work was supported by R00 CA193734 (MJS) and R00 CA194318 (BGB) from the National Institutes of Health, and by a grant from the Cancer League of Colorado, Inc (MJS). Authors' contributions DMR and MJS conceived of the project and experiments. DMR, RLF, and MJS designed and performed experiments. RLF, DMR, and TMY developed models for the project. DMR, RLF, BGB, and MJS contributed to data analysis and interpretation. DMR wrote the draft manuscript; all authors read and revised the manuscript, and have read and approved of this version of the manuscript. bioRxiv preprint doi: https://doi.org/10.1101/333906; this version posted September 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • WNT10A Gene Wnt Family Member 10A
    WNT10A gene Wnt family member 10A Normal Function The WNT10A gene is part of a large family of WNT genes, which play critical roles in development starting before birth. These genes provide instructions for making proteins that participate in chemical signaling pathways in the body. Wnt signaling controls the activity of certain genes and regulates the interactions between cells during embryonic development. The protein produced from the WNT10A gene plays a role in the development of many parts of the body. It appears to be essential for the formation of tissues that arise from an embryonic cell layer called the ectoderm. These tissues include the skin, hair, nails, teeth, and sweat glands. Researchers believe that the WNT10A protein is particularly important for the formation and shaping of both baby (primary) teeth and adult ( permanent) teeth. Health Conditions Related to Genetic Changes Hypohidrotic ectodermal dysplasia Several mutations in the WNT10A gene have been found to cause hypohidrotic ectodermal dysplasia, the most common form of ectodermal dysplasia. Starting before birth, ectodermal dysplasias result in the abnormal development of the skin, hair, nails, teeth, and sweat glands. Hypohidrotic ectodermal dysplasia is characterized by a reduced ability to sweat (hypohidrosis), sparse scalp and body hair (hypotrichosis), and several missing teeth (hypodontia) or teeth that are malformed. WNT10A gene mutations account for about 5 percent of all cases of hypohidrotic ectodermal dysplasia. Most of the WNT10A gene mutations associated with hypohidrotic ectodermal dysplasia change single protein building blocks (amino acids) in the WNT10A protein, which impairs its function. The resulting shortage of functional WNT10A protein disrupts Wnt signaling during the development of ectodermal tissues, particularly the teeth.
    [Show full text]
  • Dual Regulation of Planar Polarization by Secreted Wnts and Vangl2 in the Developing Mouse Cochlea Elvis Huarcaya Najarro1, Jennifer Huang1, Adrian Jacobo2, Lee A
    © 2020. Published by The Company of Biologists Ltd | Development (2020) 147, dev191981. doi:10.1242/dev.191981 RESEARCH ARTICLE Dual regulation of planar polarization by secreted Wnts and Vangl2 in the developing mouse cochlea Elvis Huarcaya Najarro1, Jennifer Huang1, Adrian Jacobo2, Lee A. Quiruz1, Nicolas Grillet1 and Alan G. Cheng1,* ABSTRACT on the other. Flamingo (Fmi/Celsr1, Fmi/Celsr2 and Fmi/Celsr3) is Planar cell polarity (PCP) proteins localize asymmetrically to instruct present on both poles of the cell. Defective PCP signaling cell polarity within the tissue plane, with defects leading to deformities represented by a lack of polarized PCP components leads to of the limbs, neural tube and inner ear. Wnt proteins are evolutionarily congenital heart and tracheal abnormalities, skeletal dysplasia, conserved polarity cues, yet Wnt mutants display variable PCP neural tube defects as well as cochlear deformities (Butler and defects; thus, how Wnts regulate PCP remains unresolved. Here, we Wallingford, 2017; White et al., 2018). Despite their crucial roles, have used the developing cochlea as a model system to show that our understanding of upstream signals orchestrating PCP signaling secreted Wnts regulate PCP through polarizing a specific subset of is rather limited. PCP proteins. Conditional deletion of Wntless or porcupine, both of Wnt proteins have been implicated as upstream polarity cues for which are essential for secretion of Wnts, caused misrotated sensory PCP signaling. For example, limb morphogenesis in mice requires a cells and shortened cochlea – both hallmarks of PCP defects. gradient of Wnt5a, which has been reported to act as an instructive Wntless-deficient cochleae lacked the polarized PCP components cue to establish PCP (Gao et al., 2018, 2011).
    [Show full text]
  • Wnt-Independent and Wnt-Dependent Effects of APC Loss on the Chemotherapeutic Response
    International Journal of Molecular Sciences Review Wnt-Independent and Wnt-Dependent Effects of APC Loss on the Chemotherapeutic Response Casey D. Stefanski 1,2 and Jenifer R. Prosperi 1,2,3,* 1 Department of Biological Sciences, University of Notre Dame, Notre Dame, IN 46617, USA; [email protected] 2 Mike and Josie Harper Cancer Research Institute, South Bend, IN 46617, USA 3 Department of Biochemistry and Molecular Biology, Indiana University School of Medicine-South Bend, South Bend, IN 46617, USA * Correspondence: [email protected]; Tel.: +1-574-631-4002 Received: 30 September 2020; Accepted: 20 October 2020; Published: 22 October 2020 Abstract: Resistance to chemotherapy occurs through mechanisms within the epithelial tumor cells or through interactions with components of the tumor microenvironment (TME). Chemoresistance and the development of recurrent tumors are two of the leading factors of cancer-related deaths. The Adenomatous Polyposis Coli (APC) tumor suppressor is lost in many different cancers, including colorectal, breast, and prostate cancer, and its loss correlates with a decreased overall survival in cancer patients. While APC is commonly known for its role as a negative regulator of the WNT pathway, APC has numerous binding partners and functional roles. Through APC’s interactions with DNA repair proteins, DNA replication proteins, tubulin, and other components, recent evidence has shown that APC regulates the chemotherapy response in cancer cells. In this review article, we provide an overview of some of the cellular processes in which APC participates and how they impact chemoresistance through both epithelial- and TME-derived mechanisms. Keywords: adenomatous polyposis coli; chemoresistance; WNT signaling 1.
    [Show full text]
  • The Sec14-Like Phosphatidylinositol Transfer Proteins Sec14l3/SEC14L2
    RESEARCH ARTICLE The Sec14-like phosphatidylinositol transfer proteins Sec14l3/SEC14L2 act as GTPase proteins to mediate Wnt/Ca2+ signaling Bo Gong, Weimin Shen, Wanghua Xiao, Yaping Meng, Anming Meng*, Shunji Jia* State Key Laboratory of Membrane Biology, Tsinghua-Peking Center for Life Sciences, School of Life Sciences, Tsinghua University, Beijing, China Abstract The non-canonical Wnt/Ca2+ signaling pathway plays important roles in embryonic development, tissue formation and diseases. However, it is unclear how the Wnt ligand-stimulated, G protein-coupled receptor Frizzled activates phospholipases for calcium release. Here, we report that the zebrafish/human phosphatidylinositol transfer protein Sec14l3/SEC14L2 act as GTPase proteins to transduce Wnt signals from Frizzled to phospholipase C (PLC). Depletion of sec14l3 attenuates Wnt/Ca2+ responsive activity and causes convergent and extension (CE) defects in zebrafish embryos. Biochemical analyses in mammalian cells indicate that Sec14l3-GDP forms complex with Frizzled and Dishevelled; Wnt ligand binding of Frizzled induces translocation of Sec14l3 to the plasma membrane; and then Sec14l3-GTP binds to and activates phospholipase Cd4a (Plcd4a); subsequently, Plcd4a initiates phosphatidylinositol-4,5-bisphosphate (PIP2) signaling, ultimately stimulating calcium release. Furthermore, Plcd4a can act as a GTPase-activating protein to accelerate the hydrolysis of Sec14l3-bound GTP to GDP. Our data provide a new insight into GTPase protein-coupled Wnt/Ca2+ signaling transduction. DOI: 10.7554/eLife.26362.001 *For correspondence: mengam@ mail.tsinghua.edu.cn (AM); jiasj@ mail.tsinghua.edu.cn (SJ) Competing interests: The Introduction authors declare that no Wnt ligands, a large family of secreted lipoglycoproteins, control a large number of developmental competing interests exist.
    [Show full text]
  • WNT16-Expressing Acute Lymphoblastic Leukemia Cells Are Sensitive to Autophagy Inhibitors After ER Stress Induction
    ANTICANCER RESEARCH 35: 4625-4632 (2015) WNT16-expressing Acute Lymphoblastic Leukemia Cells are Sensitive to Autophagy Inhibitors after ER Stress Induction MELETIOS VERRAS1, IOANNA PAPANDREOU2 and NICHOLAS C. DENKO2 1General Biology Laboratory, School of Medicine, University of Patra, Rio, Greece; 2Department of Radiation Oncology, Wexner Medical Center and Comprehensive Cancer Center, The Ohio State University, Columbus OH, U.S.A. Abstract. Background: Previous work from our group showed burden of proteins in the ER through decreased translation, hypoxia can induce endoplasmic reticulum (ER) stress and increased chaperone expression, and increased removal of the block the processing of the WNT3 protein in cells engineered malfolded proteins through degradation. If the cell is unable to express WNT3a. Acute lymphoblastic leukemia (ALL) cells to relieve the ER stress, then cellular death can ensue (3). with the t(1:19) translocation express the WNT16 gene, which The microenvironment of solid tumors is often poorly is thought to contribute to transformation. Results: ER-stress perfused, resulting in regions of hypoxia and nutrient blocks processing of endogenous WNT16 protein in RCH-ACV deprivation (4, 5). However, hypoxia has been also shown to and 697 ALL cells. Biochemical analysis showed an impact cancer of the bone marrow such as aggressive aggregation of WNT16 proteins in the ER of stressed cells. leukemia (6). In addition to inducing the hypoxia-inducible These large protein masses cannot be completely cleared by factor 1 (HIF1) transcription factor, severe hypoxia induces ER-associated protein degradation, and require for additional stress in the ER (7, 8). Cells with compromised ability to autophagic responses.
    [Show full text]
  • Evolutionarily Conserved Tbx5–Wnt2/2B Pathway Orchestrates Cardiopulmonary Development
    Evolutionarily conserved Tbx5–Wnt2/2b pathway orchestrates cardiopulmonary development Jeffrey D. Steimlea,b,c, Scott A. Rankind,e,f,g, Christopher E. Slagleh,i,j,k, Jenna Bekenya,b,c, Ariel B. Rydeena,b,c, Sunny Sun-Kin Chanl,m, Junghun Kweona,b,c, Xinan H. Yanga,b,c, Kohta Ikegamia,b,c, Rangarajan D. Nadadura,b,c, Megan Rowtona,b,c, Andrew D. Hoffmanna,b,c, Sonja Lazarevica,b,c, William Thomasn,o, Erin A. T. Boyle Andersonp, Marko E. Horbn,o, Luis Luna-Zuritaq,r, Robert K. Hom, Michael Kybal,m, Bjarke Jensens, Aaron M. Zornd,e,f,g, Frank L. Conlonh,i,j,k, and Ivan P. Moskowitza,b,c,1 aDepartment of Pediatrics, University of Chicago, Chicago, IL 60637; bDepartment of Pathology, University of Chicago, Chicago, IL 60637; cDepartment of Human Genetics, University of Chicago, Chicago, IL 60637; dCenter for Stem Cell and Organoid Medicine, Cincinnati Children’s Research Foundation, Cincinnati, OH 45229; eDepartment of Pediatrics, College of Medicine, University of Cincinnati, Cincinnati, OH 45229; fDivision of Developmental Biology, Perinatal Institute, Cincinnati Children’s Research Foundation, Cincinnati Children’s Hospital Medical Center, University of Cincinnati, Cincinnati, OH 45229; gDepartment of Pediatrics, College of Medicine, University of Cincinnati, Cincinnati, OH 45229; hDepartment of Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; iDepartment of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; jIntegrative Program for Biological and Genome Sciences, University of North
    [Show full text]
  • REVIEW ARTICLE the Genetics of Autism
    REVIEW ARTICLE The Genetics of Autism Rebecca Muhle, BA*; Stephanie V. Trentacoste, BA*; and Isabelle Rapin, MD‡ ABSTRACT. Autism is a complex, behaviorally de- tribution of a few well characterized X-linked disorders, fined, static disorder of the immature brain that is of male-to-male transmission in a number of families rules great concern to the practicing pediatrician because of an out X-linkage as the prevailing mode of inheritance. The astonishing 556% reported increase in pediatric preva- recurrence rate in siblings of affected children is ϳ2% to lence between 1991 and 1997, to a prevalence higher than 8%, much higher than the prevalence rate in the general that of spina bifida, cancer, or Down syndrome. This population but much lower than in single-gene diseases. jump is probably attributable to heightened awareness Twin studies reported 60% concordance for classic au- and changing diagnostic criteria rather than to new en- tism in monozygotic (MZ) twins versus 0 in dizygotic vironmental influences. Autism is not a disease but a (DZ) twins, the higher MZ concordance attesting to ge- syndrome with multiple nongenetic and genetic causes. netic inheritance as the predominant causative agent. By autism (the autistic spectrum disorders [ASDs]), we Reevaluation for a broader autistic phenotype that in- mean the wide spectrum of developmental disorders cluded communication and social disorders increased characterized by impairments in 3 behavioral domains: 1) concordance remarkably from 60% to 92% in MZ twins social interaction; 2) language, communication, and and from 0% to 10% in DZ pairs. This suggests that imaginative play; and 3) range of interests and activities.
    [Show full text]