DOCSLIB.ORG

Protein Phosphatase 2A Interactions in Islet and Human Skeletal Muscle in Diabetes Divyasri Damacharla Wayne State University

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein Phosphatase 2A Interactions in Islet and Human Skeletal Muscle in Diabetes Divyasri Damacharla Wayne State University Wayne State University Wayne State University Dissertations 1-1-2017 Protein Phosphatase 2a Interactions In Islet And Human Skeletal Muscle In Diabetes Divyasri Damacharla Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_dissertations Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Damacharla, Divyasri, "Protein Phosphatase 2a Interactions In Islet And Human Skeletal Muscle In Diabetes" (2017). Wayne State University Dissertations. 1794. https://digitalcommons.wayne.edu/oa_dissertations/1794 This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. PROTEIN PHOSPHATASE 2A INTERACTIONS IN ISLET AND HUMAN SKELETAL MUSCLE IN DIABETES by DIVYASRI DAMACHARLA DISSERTATION Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY 2017 MAJOR: PHARMACEUTICAL SCIENCES Approved By: Advisor Date © COPYRIGHT BY DIVYASRI DAMACHARLA 2017 All Rights Reserved DEDICATION This work is dedicated to my father Dr. Srinivas Rao Damacharla, who has been selflessly working very hard for the past 26 years and dreaming about our future (my brother and me). I am forever indebted to him. ii ACKNOWLEDGEMENTS I would like to first thank the department of pharmaceutical sciences for accept- ing me into this program and giving me a chance to discover my strengths through this program. I would also like to thank my advisor Dr.Zhengping Yi for believing in me by accepting me into his lab and assigning me a great project that contributes to the progress in science. I am grateful to work under Dr.Anjan Kowluru, my co-mentor. His confidence in me has always been a huge support. Working with his lab members has broadened my exposure and that will always be a added strength to my career. I will also cherish the support from my committee members Dr.Fei Chen and Dr.Kyle Burghardt for their constant support throughout the program, for their sugges- tions that helped strengthen my project. This project wouldn’t have been possible without the support of my lab mem- bers Dr.Xiangmin Zhang, Dr.Danjun Ma, Dr.Michael Caruso, Yue Qi, and many oth- ers. Their suggestions and guidance throughout helped me progress one step at a time. I would like to specially thank Dr.Xiangmin Zhang who has always been my mentor for the past 5 years and for inspiring me to work hard every day. I am very much indebted for the love and affection of my mother, Padmavathy Damacharla and my brother, Sivaram Damacharla Lastly, my heartfelt thanks to all my friends who helped. Achieving this degree wouldn’t have been possible without my seniors, Anusha Mannepalli and Rahul Guru- raj. They have supported me in all possible ways ever since I came to USA and continue to do so even now. I would also like to specially thank my friend Ratna Karthik who has been the pillar of my strength during the tough times I had and for just standing with me no matter what. iii TABLE OF CONTENTS DEDICATION……………………………………………………………………………..…ii ACKNOWLEDGEMENT…………………………………………………………….…….iii LIST OF FIGURES…………………………………………………………..……….…....vii LIST OF TABLES………………………………………………………….….……....…..viii CHAPTER 1 INTRODUCTION……………………………………………………….……1 1.1 INTRODUCTION TO DIABETES AND INSULIN SIGNALING PATHWAY........1 1.1.1 INTRODUCTION TO DIABETES……………………..……………...…......1 1.1.2 NORMAL GLUCCOSE HOMEOSTASIS….…………………….….….…...2 1.1.3 INSULIN PRODUCTION AND RELEASE INPANCREAS………………..3 1.1.4 INSULIN SIGNALING PATHWAYS……………………………………….4 1.1.5 PATHOGENESIS OF TYPE 2 DIABETES………………………………….6 1.2 KINASE AND PHOSPHATASES………………....……………………..….…….....9 1.3 PROTEIN PHOSPHATASE 2A (PP2A), REGULATION AND EFFECT OF INSU- LIN……………………………………………………….….....................................11 1.3.1 SUBUNITS OF PP2A……………………………………...…….……........ 11 1.3.2 REGULATION OF PP2A……………………………..…..……...…..……..13 1.3.3 INHIBITORS OF PP2A………………………………………………..…....14 1.3.4 ROLE OF PP2A………………………………………………………..…….14 1.3.5 PP2A IN DIABETES……..……………….....................................................15 1.4 INSULIN SENSITIVITY; PROTEIN INTERACTIONS AND MASS SPEC- TROMTRY...............................................................................................…..............17 1.4.1 METHODS TO MEASURE INSULIN SENSITIVITY…………..………...17 1.4.2 IMPORTANCE OF PROTEIN-PROTEIN INTERACTIONS………..….…17 1.4.3 MASS SPECTROMETRY…………………………………………………..18 1.5 SPECIFIC AIMS…………………………………………………………………….20 1.5.1 SPECIFIC AIM 1: INS-1 832/13 CELLS…………………………………...20 1.5.2 SPECIFIC AIM 2: HUMAN SKELETAL MUSCLE BIOPSY……………..20 iv CHAPTER 2 RESEARCH DESIGN AND METHODS.....................................................21 2.1 REAGENTS………………………………………………………………………….21 2.2 SPECIFIC AIM 1: INS-1 832/13 CELLS…………………………………………...21 2.2.1 CELL CULTURE AND HIGH GLUCOSE TREATMENT………...…...... 21 2.2.2 PROTEOMICS SAMPLE PREPARATION AND ANALYSIS……………22 2.2.3 STATISTICAL ANALYSIS………………………………………………..22 2.2.4 VALIDATION THROUGH WESTERN BLOT ANALYSIS……………...23 2.3 SPECIFIC AIM 2 : HUMAN SKELETAL MUSCLE BIOPSIES…………………..23 2.3.1 SUBJECTS………………………………………………………………….23 2.3.2 HYPERINSULENEMIC EUGLYCEMIC CLAMP WITH MUSCLE BIOP- SIES...…………………………………………………………………….....23 2.3.3 OUTLINE...………………………………………………………………...24 2.3.4 PROTEOMIC SAMPLE PREPARATION…………………………………25 2.3.5 STATISTICAL ANALYSIS FOR PP2A……………………...……………27 CHAPTER 3 RESULTS…………………………………………………………………….29 3.1 SPECIFIC AIM 1: DETERMINE THE INTERACTION PARTNERS OF PP2AC IN HUMAN Β-ISLET CELLS UNDER BASAL AND HYPERGLYCEMIC CONDI- TIONS…..…………………………………………………………………………….….29 3.1.1 PP2AC INTERACTION PARTNERS IN INS-1 832/13 CELLS……………...29 3.1.2 GLUCOSE RESPONSIVE PP2AC INTERACTION PARTNERS…………...30 3.1.3 GLUCOSE RESPONSIVE PP2AC INTERACTION PARTNERS RELATED TO INSULIN SECRETION…………………………………………………………31 3.1.4 EXPERIMENTAL VALIDATION OF PPP22R1B AS A GLUCOSE RESPON- SIVE PP2AC INTERACTION PARTNER………………………………………….32 3.2 SPECIFIC AIM 2: DETERMINE INTERACTION PARTNERS OF PP2A IN HU- MAN SKELETAL MUSCLE UNDER BASAL AND HYPERINSULENEMIC CONDI- TIONS IN LEAN, OBESE/OVERWEIGHT NON-DIABETICS AND TYPE 2 DIA- BETIC SUBJECTS………………………………………………………………………32 3.2.1 PP2AC INTERACTION PARTNERS IN SKELETAL MUSCLE FROM LEAN, OVERWEIGHT/OBESE, AND TYPE 2 DIABETIC HUMAN PARTICIPANTS…32 3.2.2 PARTNERS WITH SIGNIFICANT DIFFERENCE AMONG LEAN CON TROL, OBESE/OVERWEIGHT CONTROL, AND TYPE 2 DIABETIC GROUPS..……………………………………………………………………………34 v CHAPTER 4 DISCUSSION……………………………………….………………….…….36 4.1 SPECIFIC AIM 1: DETERMINE THE INTERACTION PARTNERS OF PP2AC IN HUMAN Β-ISLET CELLS UNDER BASAL AND HYPERGLYCEMIC CONDI- TIONS………………………………………………………………………..………….36 4.1.1 PP2AC INTERACTION WITH SIGNALING PROTEINS IMPORTANT FOR PHYSIOLOGICAL INSULIN SECRETION……………………………………….36 4.1.2 PP2AC INTERACTION WITH KEY PROTEINS THAT REGULATE CELL DYSFUNCTION AND APOPTOSIS………………………………………...……..37 4.2 SPECIFIC AIM 2: DETERMINE INTERACTION PARTNERS OF PP2A IN HU- MAN SKELETAL MUSCLE UNDER BASAL AND HYPERINSULENEMIC CONDI- TIONS IN LEAN, OBESE/OVERWEIGHT NON-DIABETICS AND TYPE 2 DIA- BETIC SUBJECTS………………………………………………………………………38 4.2.1 PP2AC INTERACTION PARTNERS IN SKELETAL MUSCLE……………38 4.2.2 KNOWN PARTNERS………………………………………………………....39 4.2.3 PROTEINS INVOLVED IN INSULIN RECEPTOR AND MTORSIGNAL- ING………………………………………………………………………………..…42 4.2.4 INTERACTION PARTNERS WITH SIGNIFICANT CHANGES IN THEIR IN- TERACTION TO PP2AC IN SKELETAL MUSCLE IN LEAN, OVER- WEIGHT/OBESE, AND TYPE 2 DIABETIC HUMAN PARTICIPANTS………...45 4.2.5 PARTNERS WITH SIGNIFICANT CHANGE BETWEEN TYPE 2 DIABETIC AND LEAN SUBJECTS…...……………………………………………………..…46 4.2.6 PARTNERS WITH SIGNIFICANT CHANGE BETWEEN OBESE AND LEAN SUBJECTS.……………………………………………………………….…52 4.2.7 PARTNERS WITH SIGNIFICANT CHANGE BETWEEN TYPE 2 DIABETIC AND OBESE……………………………………………………………………..….55 4.3 SUMMARY AND FUTURE DIRECTIONS ………………………...……..............60 REFERENCES……………………………………………………………….................…146 ABSTRACT……………………………………………………………………………......173 AUTOBIOGRAPHICAL STATEMENT………………………………………………...175 vi LIST OF FIGURES Figure 1 Glucose homeostasis involving major tissues………………………………………..62 Figure 2 Insulin signaling pathway showing the signaling molecules involved and various ef- fects seen …………………………………………………………….……………………….63 Figure 3 Negative regulators of insulin signaling pathway ……...............................................64 Figure 4 Insulin signaling regulation by inhibitory serine/threonine phosphorylation ………………………………………………………………………………………………...65 Figure 5 Diagrammatic representation of heterotrimeric PP2A complex …....……………….66 Figure 6 Main steps in mass spectrometry-based proteomics studies ………………................67 Figure 7 Cell culture, proteomics data acquisition, and data analysis ……………....................68 Figure 8 Proteomic data analysis (INS-1 832/13 CELLS)…………………………................69 Figure 9 Summary of glucose-responsive PP2Ac interaction partners ……………………….70 Figure 10 Experimental validation of PPP2R1B as a glucose responsive PP2Ac interaction part- ner......………………………………………………………………………………………...71 Figure 11 Clinical and proteomics data acquisition and data analysis ………………………...72 Figure 12 Proteomic data analysis (Human skeletal muscle)………………………………….73 Figure 13 The significantly enriched pathway, Insulin Receptor signaling, for the 211 PP2Ac interaction partners and PP2Ac in human skeletal muscle ………………...............................74
Load more

Recommended publications
  • I HIGH MASS ACCURACY COUPLED to SPATIALLY-DIRECTED
    HIGH MASS ACCURACY COUPLED TO SPATIALLY-DIRECTED PROTEOMICS FOR IMPROVED PROTEIN IDENTIFICATIONS IN IMAGING MASS SPECTROMETRY EXPERIMENTS By David Geoffrey Rizzo Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Chemistry August, 2016 Nashville, Tennessee Approved: Richard M. Caprioli, Ph.D. Kevin L. Schey, Ph.D. John A. McLean, Ph.D. Michael P. Stone, Ph.D. i Copyright © 2016 by David Geoffrey Rizzo All Rights Reserved ii This work is dedicated to my family and friends, who have shown nothing but support for me in all of life’s endeavors. iii ACKNOWLEDGEMENTS “As we express our gratitude, we must never forget that the highest appreciation is not to utter words, but to live by them.” - John F. Kennedy – There are many people I must thank for showing kindness, encouragement, and support for me during my tenure as a graduate student. First and foremost, I would like to thank my research advisor, Richard Caprioli, for providing both ample resources and guidance that allowed me to grow as a scientist. Our discussions about my research and science in general have helped me become a much more focused and discerning analytical chemist. I must also thank my Ph.D. committee members, Drs. Kevin Schey, John McLean, and Michael Stone, who have brought valuable insight into my research and provided direction along the way. My undergraduate advisor, Dr. Facundo Fernández, encouraged me to begin research in his lab and introduced me to the world of mass spectrometry.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Faith and the Human Genome
    Plenary Presenters Faith and the Human Genome Faith and the Human Genome Francis S. Collins Despite the best efforts of the American Scientific Affiliation to bridge the gap between science and faith, few gatherings of scientists involved in biology include any meaningful discussion about the spiritual significance of the current revolution in genetics and genomics. Most biologists and geneticists seem to have concluded that science and faith are incompatible, but few who embrace that conclusion seem to have seriously considered the evidence. From my perspective as director of the Human Genome Project, the scientific and religious world views are not only compatible but also inherently complementary. Hence the profound polarization of the scientific and religious perspectives, now glaringly apparent in the fields of biology and genetics, is a source of great distress. Hard-liners in either camp paint increasingly uncompromising pictures that force sincere seekers to choose one view over the other. How all of this must break God’s heart! The elegance and complexity of the human genome is a source of profound wonder. That wonder only strengthens my faith, as it provides glimpses of aspects of From my humanity, which God has known all along, but which we are just now beginning to discover. perspective as e are just on the edge of a whole You made him a little lower than the heav- director of the Whost of developments spurred on enly beings and crowned him with glory by genetics that are going to and honor. You made him ruler over the Human require careful and deliberative thought.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Anti-IDH3A Antibody (ARG42205)
    Product datasheet [email protected] ARG42205 Package: 100 μl anti-IDH3A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes IDH3A Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name IDH3A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 28-366 of Human IDH3A (NP_005521.1). Conjugation Un-conjugated Alternate Names Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial; EC 1.1.1.41; NAD; Isocitric dehydrogenase subunit alpha; + Application Instructions Application table Application Dilution ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Raji Calculated Mw 40 kDa Observed Size ~ 40 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw www.arigobio.com 1/3 cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol IDH3A Gene Full Name isocitrate dehydrogenase 3 (NAD+) alpha Background Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate.
    [Show full text]
  • Table S3: Subset of Zebrafish Early Genes with Human And
    Table S3: Subset of Zebrafish early genes with human and mouse orthologs Genbank ID(ZFZebrafish ID Entrez GenUnigene Name (zebrafish) Gene symbo Human ID Humann ortholog Human Gene description AW116838 Dr.19225 336425 Aldolase a, fructose-bisphosphate aldoa Hs.155247 ALDOA Fructose-bisphosphate aldola BM005100 Dr.5438 327026 ADP-ribosylation factor 1 like arf1l Hs.119177||HsARF1_HUMAN ADP-ribosylation factor 1 AW076882 Dr.6582 403025 Cancer susceptibility candidate 3 casc3 Hs.350229 CASC3 Cancer susceptibility candidat AI437239 Dr.6928 116994 Chaperonin containing TCP1, subun cct6a Hs.73072||Hs.CCT6A T-complex protein 1, zeta sub BE557308 Dr.134 192324 Chaperonin containing TCP1, subun cct7 Hs.368149 CCT7 T-complex protein 1, eta subu BG303647 Dr.26326 321602 Cyclin-dependent kinase 9 (CDC2-recdk9 Hs.150423 CDK9 Cell division protein kinase 9 AB040044 Dr.8161 57970 Coatomer protein complex, subunit zcopz1 Hs.37482||Hs.Copz2 Coatomer zeta-2 subunit BI888253 Dr.20911 30436 Eyes absent homolog 1 eya1 Hs.491997 EYA4 Eyes absent homolog 4 AI878758 Dr.3225 317737 Glutamate dehydrogenase 1a glud1a Hs.368538||HsGLUD1 Glutamate dehydrogenase 1, AW128619 Dr.1388 325284 G1 to S phase transition 1 gspt1 Hs.59523||Hs.GSPT1 G1 to S phase transition prote AF412832 Dr.12595 140427 Heat shock factor 2 hsf2 Hs.158195 HSF2 Heat shock factor protein 2 D38454 Dr.20916 30151 Insulin gene enhancer protein Islet3 isl3 Hs.444677 ISL2 Insulin gene enhancer protein AY052752 Dr.7485 170444 Pbx/knotted 1 homeobox 1.1 pknox1.1 Hs.431043 PKNOX1 Homeobox protein PKNOX1
    [Show full text]
  • Genome-Wide Sirna Screen for Mediators of NF-Κb Activation
    Genome-wide siRNA screen for mediators SEE COMMENTARY of NF-κB activation Benjamin E. Gewurza, Fadi Towficb,c,1, Jessica C. Marb,d,1, Nicholas P. Shinnersa,1, Kaoru Takasakia, Bo Zhaoa, Ellen D. Cahir-McFarlanda, John Quackenbushe, Ramnik J. Xavierb,c, and Elliott Kieffa,2 aDepartment of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; bCenter for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114; cProgram in Medical and Population Genetics, The Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142; dDepartment of Biostatistics, Harvard School of Public Health, Boston, MA 02115; and eDepartment of Biostatistics and Computational Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02115 Contributed by Elliott Kieff, December 16, 2011 (sent for review October 2, 2011) Although canonical NFκB is frequently critical for cell proliferation, (RIPK1). TRADD engages TNFR-associated factor 2 (TRAF2), survival, or differentiation, NFκB hyperactivation can cause malig- which recruits the ubiquitin (Ub) E2 ligase UBC5 and the E3 nant, inflammatory, or autoimmune disorders. Despite intensive ligases cIAP1 and cIAP2. CIAP1/2 polyubiquitinate RIPK1 and study, mammalian NFκB pathway loss-of-function RNAi analyses TRAF2, which recruit and activate the K63-Ub binding proteins have been limited to specific protein classes. We therefore under- TAB1, TAB2, and TAB3, as well as their associated kinase took a human genome-wide siRNA screen for novel NFκB activa- MAP3K7 (TAK1). TAK1 in turn phosphorylates IKKβ activa- tion pathway components. Using an Epstein Barr virus latent tion loop serines to promote IKK activity (4).
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • The TRAX, DISC1, and GSK3 Complex in Mental Disorders and Therapeutic Interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2*
    Weng et al. Journal of Biomedical Science (2018) 25:71 https://doi.org/10.1186/s12929-018-0473-x REVIEW Open Access The TRAX, DISC1, and GSK3 complex in mental disorders and therapeutic interventions Yu-Ting Weng1,2, Ting Chien1, I-I Kuan1 and Yijuang Chern1,2* Abstract Psychiatric disorders (such as bipolar disorder, depression, and schizophrenia) affect the lives of millions of individuals worldwide. Despite the tremendous efforts devoted to various types of psychiatric studies and rapidly accumulating genetic information, the molecular mechanisms underlying psychiatric disorder development remain elusive. Among the genes that have been implicated in schizophrenia and other mental disorders, disrupted in schizophrenia 1 (DISC1) and glycogen synthase kinase 3 (GSK3) have been intensively investigated. DISC1 binds directly to GSK3 and modulates many cellular functions by negatively inhibiting GSK3 activity. The human DISC1 gene is located on chromosome 1 and is highly associated with schizophrenia and other mental disorders. A recent study demonstrated that a neighboring gene of DISC1, translin-associated factor X (TRAX), binds to the DISC1/GSK3β complex and at least partly mediates the actions of the DISC1/GSK3β complex. Previous studies also demonstrate that TRAX and most of its interacting proteins that have been identified so far are risk genes and/or markers of mental disorders. In the present review, we will focus on the emerging roles of TRAX and its interacting proteins (including DISC1 and GSK3β) in psychiatric disorders and the potential implications for developing therapeutic interventions. Keywords: TRAX, DISC1, GSK3β, Mental disorders, DNA damage, DNA repair, Oxidative stress, A2AR, PKA Background DNA repair) by interacting with various proteins [4–12].
    [Show full text]
  • PTEN, and KCTD13 and RAF1) That Significantly Enhanced Or Suppressed Cell Proliferation Phenotypes
    bioRxiv preprint doi: https://doi.org/10.1101/185355; this version posted September 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Pervasive epistasis modulates neurodevelopmental defects of the autism-associated 16p11.2 deletion Janani Iyer1,9, Mayanglambam Dhruba Singh1,9, Matthew Jensen1,2,9, Payal Patel1,9, Lucilla Pizzo1, Emily Huber1, Haley Koerselman3, Alexis T. Weiner1, Paola Lepanto4, Komal Vadodaria1, Alexis Kubina1, Qingyu Wang1,2, Abigail Talbert1, Sneha Yennawar1, Jose Badano4, J. Robert Manak3,5, Melissa M. Rolls1, Arjun Krishnan6,7, and Santhosh Girirajan1,2,8* 1. Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802 2. Bioinformatics and Genomics Program, Huck Institute of Life Sciences, The Pennsylvania State University, University Park, PA 16802 3. Departments of Biology, University of Iowa, Iowa City, IA 52242 4. Human Molecular Genetics Laboratory, Institut Pasteur de Montevideo, Montevideo, Uruguay 5. Department of Pediatrics, University of Iowa, Iowa City, IA 52242 6. Department of Computational Mathematics, Science and Engineering, Michigan State University, East Lansing, MI 48824 7. Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824 8. Department of Anthropology, The Pennsylvania State University, University Park, PA 16802 9. These authors contributed equally to this work. Correspondence to: Santhosh Girirajan 205A Life Sciences Building The Pennsylvania State University University Park, PA 16802 E-mail: [email protected] Phone: 814-865-0674 1 bioRxiv preprint doi: https://doi.org/10.1101/185355; this version posted September 20, 2017.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]