Molecular Structure of Wlbb, a Bacterial N-Acetyltransferase Involved in the Biosynthesis †,‡ of 2,3-Diacetamido-2,3-Dideoxy-D-Mannuronic Acid James B

4644 Biochemistry 2010, 49, 4644–4653 DOI: 10.1021/bi1005738 Molecular Structure of WlbB, a Bacterial N-Acetyltransferase Involved in the Biosynthesis †,‡ of 2,3-Diacetamido-2,3-dideoxy-D-mannuronic Acid James B. Thoden and Hazel M. Holden* Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 Received April 14, 2010; Revised Manuscript Received April 29, 2010 ABSTRACT: The pathogenic bacteria Pseudomonas aeruginosa and Bordetella pertussis contain in their outer membranes the rare sugar 2,3-diacetamido-2,3-dideoxy-D-mannuronic acid. Five enzymes are required for the biosynthesis of this sugar starting from UDP-N-acetylglucosamine. One of these, referred to as WlbB, is an N-acetyltransferase that converts UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronic acid (UDP- GlcNAc3NA) to UDP-2,3-diacetamido-2,3-dideoxy-D-glucuronic acid (UDP-GlcNAc3NAcA). Here we report the three-dimensional structure of WlbB from Bordetella petrii. For this analysis, two ternary structures were determined to 1.43 A˚resolution: one in which the protein was complexed with acetyl-CoA and UDP and the second in which the protein contained bound CoA and UDP-GlcNAc3NA. WlbB adopts a trimeric quaternary structure and belongs to the LβH superfamily of N-acyltransferases. Each subunit contains 27 β-strands, 23 of which form the canonical left-handed β-helix. There are only two hydrogen bonds that occur between the protein and the GlcNAc3NA moiety, one between Oδ1 of Asn 84 and the sugar C-30 amino group and the second between the backbone amide group of Arg 94 and the sugar C-50 carboxylate. The sugar C-30 amino group is ideally positioned in the active site to attack the si face of acetyl-CoA. Given that there are no protein side chains that can function as general bases within the GlcNAc3NA binding pocket, a reaction mechanism is proposed for WlbB whereby the sulfur of CoA ultimately functions as the proton acceptor required for catalysis. N-Acetyltransferases catalyze the transfer of acetyl groups of UDP-2-acetamido-4-amino-2,4,6-trideoxy-D-glucose to yield 1 from acetyl-CoA to primary amine acceptors. They are dis- UDP-2,4-diacetamido-2,4,6-D-trideoxyglucose or UDP-Qui- tributed throughout nature where they play key roles in biolo- NAc4NAc as indicated in Scheme 1 (4-6). C. jejuni, itself, is a gical processes such as the sleep-wake cycles of vertebrates, the highly unusual Gram-negative bacterium that contains N-glyco- reversible modifications of histone proteins, and the inactivations sylated proteins, and QuiNAc4NAc serves as the bridge between of aminoglycoside antibiotics (1, 2). Substrates for these enzymes the asparagine residue of a given glycosylated protein and the range from simple small molecules to large proteins. Thus far, attached N-glycan moiety (4, 7). PglD functions as a trimer with two major classes of N-acyltransferases have been identified each subunit folding into two separate domains, an N-terminal and are referred to as the GNAT and LβH superfamilies. region containing a three-stranded parallel β-sheet flanked by Members of the GNAT superfamily adopt an overall fold built two R-helices and a C-terminal domain dominated by a left- around a central mixed β-sheet, which is typically composed of handed β-helix motif (5). From detailed structural and kinetic six β-strands (1, 2). As the name implies, proteins that belong to studies, it has been proposed that His 125 functions as an active the LβH superfamily have a structure dominated by a stunning site base to remove a proton from the amino group of the UDP- parallel β-helix with repeating isoleucine-rich hexapeptide motifs linked sugar as it attacks the carbonyl carbon of acetyl- and rare left-handed crossover connections (3). CoA (5, 6). The actual role of His 125 is still open to debate, Within the last two years, the molecular architectures of two however, given the recent biochemical data suggesting that while intriguing N-acetyltransferases that function on nucleotide-linked it is important for catalysis, it is not absolutely essential (8). sugars have been reported. The first of these was that of PglD, from The second N-acetyltransferase structure recently reported Campylobacter jejuni, which specifically catalyzes the N-acetylation was that of QdtC from Thermoanaerobacterium thermosacchar- olyticum E207-71 (9). As indicated in Scheme 1, QdtC catalyzes † This research was supported in part by National Institutes of Health the last step in the biosynthesis of dTDP-3-acetamido-3,6- Grant DK47814 to H.M.H. ‡X-ray coordinates have been deposited in the Protein Data Bank of dideoxy-D-glucose or Quip3NAc, an unusual dideoxysugar the Research Collaboratory for Structural Bioinformatics, Rutgers found in the O-antigens of some Gram-negative bacteria (10) University, New Brunswick, NJ (entries 3MQG and 3MQH). and in the S-layer glycoprotein glycans of some Gram-positive *To whom correspondence should be addressed. E-mail: [email protected]. Fax: (608) 262-1319. Phone: (608) bacteria (11). QdtC, like PglD, functions as a trimer. Each 262-4988. subunit of QdtC is dominated by 32 β-strands that form the 1 Abbreviations: CoA, coenzyme A; HEPES, 4-(2-hydroxyethyl)-1- canonical LβH motif. QdtC lacks, however, the N-terminal piperazineethanesulfonic acid; HEPPS, 3-[4-(2-hydroxyethyl)]-1-piper- azinepropanesulfonic acid; IPTG, isopropyl β-D-thiogalactopyrano- domain observed in PglD. Also, as opposed to PglD, there are side; LB, Luria-Bertani; MOPS, 3-(N-morpholino)propanesulfonic no potential catalytic bases located within the active site cleft of acid; NiNTA, nickel-nitrilotriacetic acid; PCR, polymerase chain reac- QdtC. Indeed, PglD and QdtC accommodate their nucleotide- tion; rms, root-mean-square; TB, Terrific broth; UDP, uridine dipho- sphate; UMP, uridine monophosphate; Tris, tris(hydroxymethyl)- linked sugars in completely different orientations as shown in aminomethane. Figure 1. Given the lack of a potential catalytic base in QdtC and pubs.acs.org/Biochemistry Published on Web 04/30/2010 r 2010 American Chemical Society Article Biochemistry, Vol. 49, No. 22, 2010 4645 Scheme 1 For the investigation described here, WlbB was crystallized in the presence of either acetyl-CoA and UDP or CoA and its substrate UDP-GlcNAc3NA. The structures were determined and refined to a nominal resolution of 1.43 A˚. The binding mode for the UDP-GlcNAc3NA ligand is similar to that observed for QdtC. WlbB is considerably smaller than QdtC, however, and thus, its LβH motif is shorter by nine β-strands. The pyranosyl moiety of UDP-GlcNAc3NA is accommodated within the active site region of WlbB via only two specific interactions: one between Oδ1 of Asn 84 and the sugar C-30 amino group and the second between the backbone amide group of Arg 94 and the sugar C-50 carboxylate. Importantly, the sugar C-30 amino nitrogen is in the proper position to attack the si face of acetyl- CoA. Details concerning the overall active site architecture of WlbB are presented, and implications for its catalytic mechanism are discussed. MATERIALS AND METHODS Cloning, Expression, and Purification. Genomic DNA from B. petrii (ATCC BAA-461) was isolated by standard procedures. The wlbB gene was PCR-amplified from genomic DNA such that the forward primer 50-AAACATATGGCCAC- TATCCATCCTACCGCCATCG and the reverse primer 50- AAAACTCGAGTCAGGCCAGTCGGCATACGCCGTCAG added NdeI and XhoI cloning sites, respectively. The purified PCR product was A-tailed and ligated into a pGEM-T (Promega) vector for screening and DNA sequencing. A WlbB-pGEM-T vector construct of the correct sequence was then appropriately digested and ligated into a pET28b(þ) (Novagen) plasmid that had been previously modified for the production of a protein with a TEV protease cleavable N-terminal hexahistidine tag (17). The WlbB-pET28jt plasmid was used to transform Rosetta- (DE3) Escherichia coli cells (Novagen). The culture in LB medium was grown at 37 °C with shaking until the absorbance at 600 nm reached 0.7. The cultures were subsequently cooled in an ice bath and induced with 1.0 mM IPTG, and the cells were allowed to express protein at 16 °C for 24 h after induction. WlbB in light of subsequent site-directed mutagenesis experiments and was purified by a modification to the standard procedures for enzymatic activity assays, a novel catalytic mechanism for it was Ni-NTA chromatography. Specifically, all buffers contained proposed (9). Specifically, the sulfur of acetyl-CoA ultimately 500 mM NaCl; the lysis buffer contained 10% glycerol, and all serves as the catalytic base by accepting a proton from the sugar steps, other than the initial sonication of the cell pellet at 4 °C, amino group as it attacks the carbonyl carbon of acetyl-CoA. were performed at room temperature. Following purification via Herein we report the molecular architecture of WlbB, an N- Ni-NTA chromatography, TEV protease was added to the acetyltransferase from Bordetella petrii. WlbB catalyzes the pooled protein (at a 1:50 TEV protease:WlbB molar ratio), and penultimate step in the biosynthesis of UDP-2,3-diacetamido- this mixture was dialyzed against 50 mM sodium phosphate, 2,3-dideoxy-D-mannuronic acid or UDP-ManNAc3NAcA 500 mM NaCl, 40 mM imidazole, and 1 mM DTT (pH 8.0) (Scheme 2). Specifically, as shown in Schemes 1 and 2, WlbB for 24 h. The cleaved and intact versions of WlbB, as well as catalyzes the N-acetylation of UDP-2-acetamido-3-amino- the TEV protease itself, were separated by passage through a 2,3-dideoxy-D-glucuronic acid or UDP-GlcNAc3NA to yield column of Ni-NTA resin. The cleaved protein was dialyzed UDP-GlcNAc3NAcA (12). Although a reasonably rare di-N- against 10 mM Tris and 400 mM NaCl at pH 8.0 and then acetylated sugar, ManNAc3NAcA is found not only in B.

Load more