sign in sign up
<<
Home , Picamilon

(19) TZZ_¥_Z_T

(11) EP 1 756 310 B1

(12) EUROPEAN PATENT SPECIFICATION

(45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12Q 1/68 (2006.01) A61K 31/485 (2006.01) 05.12.2012 Bulletin 2012/49 (86) International application number: (21) Application number: 05748517.9 PCT/EP2005/005194

(22) Date of filing: 12.05.2005 (87) International publication number: WO 2005/108605 (17.11.2005 Gazette 2005/46)

(54) Method for detecting polymorphisms in the ABCB1 gene associated with a lack of response to a CNS-active medicament and medicament comprising an ABCB1 inhibitor for use in the treatment of CNS related diseases. Verfahren zur Bestimmung von Polymorphismen im ABCB1 Gen, die mit dem Fehlen einer klinischen Reaktion auf im ZNS aktiven Arzneimittel assoziert sind, und Arzneimittel, das einen ABCB1 Inhibitor enthält zur Behandlung von Krankheiten im ZNS Procédé pour la détermination des polymorphismes qui prédirent une manque de réaction aux médicaments qui sont actives dans le système nerveux central et médicaments contenant un inhibiteur de ABCB1 pour le traitement des maladies du système nerveux central

(84) Designated Contracting States: (56) References cited: AT BE BG CH CY CZ DE DK EE ES FI FR GB GR WO-A-01/09183 US-A1- 2003 073 713 HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR US-A1- 2005 069 936

(30) Priority: 12.05.2004 US 570085 P • SIDDIQUIASRA ET AL: "Association of multidrug resistancein epilepsy witha polymorphismin the (43) Date of publication of application: drug-transporter gene ABCB1." THE NEW 28.02.2007 Bulletin 2007/09 ENGLAND JOURNAL OF MEDICINE. 10 APR 2003, vol. 348, no. 15, 10 April 2003 (2003-04-10), (73) Proprietor: Max-Planck-Gesellschaft zur pages 1442-1448, XP009054797 ISSN: 1533-4406 Förderung cited in the application der Wissenschaften e.V. • MARZOLINI CATIA ET AL: "Polymorphisms in 80539 München (DE) human MDR1 (P- glycoprotein): Recent advances and clinical relevance." CLINICAL (72) Inventors: PHARMACOLOGY& THERAPEUTICS, vol. 75, no. • UHR, Manfred 1, January 2004 (2004-01), pages 13-33, 82131 Stockdorf (DE) XP009054820 ISSN: 0009-9236 • HOLSBOER, Florian • DATABASE SNP [Online] 2001, XP002347791 80805 München (DE) retrieved from NCBI Database accession no. • BINDER, Elisabeth ss3189005 80336 München (DE) • ROBERTS R L ET AL: "A common P- glycoprotein • MÜLLER-MYHSOK, Bertram polymorphism is associated with nortriptyline- 80689 München (DE) induced postural hypotension in patients treated for major depression" PHARMACOGENOMICS (74) Representative: Weiss, Wolfgang et al JOURNAL, vol. 2, no. 3, 2002, pages 191-196, Weickmann & Weickmann XP009054808 ISSN: 1470-269X Patentanwälte Postfach 86 08 20 81635 München (DE)

Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). EP 1 756 310 B1

Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 1 756 310 B1

• KERB R ET AL: "ABC DRUG TRANSPORTERS: • ZIMPRICH F ET AL: "Association of an ABCB1 HEREDITARY POLYMORPHISMS AND gene haplotype with pharmacoresistance in PHARMACOLOGICAL IMPACT IN MDR1, MRP1 temporal lobe epilepsy." NEUROLOGY. 28 SEP AND MRP2" PHARMACOGENOMICS, ASHLEY 2004, vol. 63, no. 6, 28 September 2004 PUBLICATIONS, GB, vol. 2, no. 1, February 2001 (2004-09-28), pages 1087-1089, XP002347789 (2001-02), pages 51-64, XP009014717 ISSN: ISSN: 1526-632X 1462-2416 • ACKENHEIL M ET AL: "Differing response to Remarks: antipsychotic therapy in schizophrenia: Thefile contains technical information submitted after Pharmacogenomic aspects" DIALOGUES IN the application was filed and not included in this CLINICAL NEUROSCIENCE 2004 FRANCE, vol. 6, specification no. 1, 2004, pages 71-77, XP001207371 ISSN: 1294-8322

2 EP 1 756 310 B1

Description

[0001] The present invention relates to methods for determining the prognosis of a clinical response in a human patient to a medicament which acts in the central nervous system (CNS) and which is a substrate of the ABCB1 protein. Further, 5 the invention relates to a therapeutic composition and therapeutic kit for use in the treatment of human patients having specific polymorphisms in the ABCB1 gene. [0002] Depression is a very common medical disorder, with lifetime prevalences of up to 14%, thus affecting millions worldwide. While antidepressants are the most effective treatment for depressive disorders, there still is substantial need for improvement of therapy. So far there are no objective criteria for the choice of the optimal antidepressant treatment 10 for an individual patient. Depressed patients are therefore treated on a trial and error basis, resulting in a failure rate of a single treatment attempt in up to 30-40%, even in the presence of sufficiently high plasma levels1. Sufficient plasma drug levels considered to elicit a clinical response may, however, not translate into adequate intracerebral drug levels in all patients because of activities of transporter molecules expressed at the luminal membrane of the endothelial cells lining the small blood capillaries which form the blood- brain barrier. One of the most studied molecules of this the latter 15 class is p- glycoprotein2,3. P-glycoprotein is a member of the highly conserved superfamily of ATP- binding cassette (ABC) transporter proteins4. In humans, this 170-kDa glycoprotein is encoded on chromosome 7 by the ABCB1 gene, also known as the multidrug resistance 1 (MDR1) gene 5,6. This plasma membrane protein actively transports its substrates against a concentration gradient. P- glycoprotein acts as an active efflux pump for xenobiotics as well as for endogenous substrates such as some steroids7,8. 20 [0003] It was found that the ABCB1 protein is involved in the uptake of and into the brain of mice. It was speculated that inter-individual differences in the activity of the ABCB1 gene can account in part for the great variation in clinical response to antidepressants in psychiatric patients, even at comparable plasma levels 26. There is, however, no suggestion that there are polymorphisms in the ABCB1 gene which are associated with a lack of clinical response to medicaments. A further study showed different enhancement of penetration of the antidepressants , 25 and in the brain of mice with an abcb1ab knockout mutation29. Polymorphisms in the ABCB1 gene associated with a clinical response to medicaments are, however, not disclosed. [0004] An investigation of polymorphisms in the ABCB1 gene and antidepressant-induced mania showed that there was no association between antidepressant- induced mania and ABCB1 alleles or genotypes 30. These results seem to indicate that polymorphisms in the ABCB1 gene are not of clinical significance. Further, a recent review article indicates 30 that previously reported effects of polymorphisms in the ABCB1 gene have been inconsistent and in some cases conflicting 31. [0005] WO 01/09183 discloses polymorphisms in the human ABCB1 gene for the use in diagnostic tests to improve therapy of established drugs and help to correlate genotypes with drug activity and side effects. This document does not disclose polymorphisms associated with the clinical response to antidepressants. US 2001/0034023 generally relates 35 to methods for identifying sequence variations in different genes to assess efficacy and safety of medical therapies. Although, SNPs in the ABCB1 gene are mentioned, there is no evidence for specific polymorphisms associated with the clinical response to antidepressants. [0006] Thus, until now, no polymorphisms in the ABCB1 gene have been identified which have a clear and significant association with the clinical response to medicaments which act in the central nervous system and which are substrates 40 of the ABCB1 protein. [0007] In this study it was tested whether three commonly used antidepressants are substrates of glycoprotein,p- using transgenic mice lacking the homologues of ABCB1 and their wild- type littermates. Then the association of single nucleotide polymorphisms (SNPs) in the ABCB1 gene with clinical response to antidepressant drugs was investigated in 255 depressed patients. 45 [0008] Surprisingly, polymorphisms in the ABCB1 gene, particularly located in the introns of the genes, were identified which have a clear and statistically relevant association with an insufficient clinical response, e.g. a remission status of the six weeks of treatments with the antidepressants citalopram, paroxetine and/or venlafaxine. Genotyping of these polymorphisms allows to predict the clinical response to a substrate of ABCB1 with a certainty of over 75%, opening up a route towards genotype-based diagnostic and therapeutic methods. 50 [0009] A first aspect of the invention relates to an in vitro method for determining the prognosis of a clinical response in a human patient to a central nervous system (CNS)-active medicament which is a substrate of the ABCB1 protein wherein the presence of at least one polymorphism in the ABCB1 gene of said patient is determined wherein said polymorphism is associated with a delayed, partial sub- optimal or lacking clinical response to said medicament, wherein the polymorphism is located within exon 29, intron 5, 13, 21, 22 or 23 or the 3’UTR sequence of the human ABCB1 gene. 55 [0010] Also described is a diagnostic composition or kit for the prognosis of a clinical response in a human patient to aCNS- activemedicament which is a substrateof the ABCB1protein comprisingat leastone prime orprobe for determining at least one polymorphism in the ABCB1 gene in said patient wherein said polymorphism is associated with a delayed, partial sub-optimal or lacking clinical response to said medicament.

3 EP 1 756 310 B1

[0011] Further described is a microarray for the prognosis of a clinical response in a human patient to a CNS-active medicament which is a substrate of the ABCB1 protein comprising a carrier having immobilized thereto at least one probe for determining at least one polymorphism in the ABCB1 gene in said patient wherein said polymorphism is associated with a delayed, partial sub-optimal or lacking clinical response to said medicament. 5 [0012] Further described is a prime or probe for the prognosis of a clinical response in a human patient to a CNS- active medicament which is a substrate of the ABCB1 protein comprising a carrier having immobilized thereto at least one probe for determining at least one polymorphism in the ABCB1 gene in said patient wherein said polymorphism is associated with a delayed, partial sub-optimal or lacking clinical response to said medicament. [0013] Finally, a further aspect of the invention relates to a therapeutic composition or therapeutic kit as defined in 10 claim 14. [0014] The present invention discloses for the first time polymorphisms in the human ABCB1 gene which have a statistically significant association with a delayed, partial sub- optimal or lacking clinical response to medicaments which act in the central nervous system and which are substrates of the ABCB1 protein. A statistically significant association is preferably p < 0.05, more preferably p < 0.01 and most preferably p < 0.001. The polymorphisms are preferably single 15 nucleotide polymorphisms (SNPs). Surprisingly, it was found that polymorphisms associated with a delayed, partial sub- optimal or lacking clinical response to a medicament may occur in exons, introns and/or the 3’UTR sequence of the human ABCB1 gene, namely in exon 29, intron 5, 13, 21, 22 or 23 and/or the 3’UTR sequence of the human ABCB1 gene. [0015] Preferably, the polymorphisms are selected from the group consisting of rs 2235015, rs 2235040, rs 2235067, rs 2032583, rs 17064, rs 2032588, rs 1055302 and combinations thereof. More preferably, the polymorphism is rs 20 2235015 or rs 2235040. Most preferably, the polymorphism is rs 2235015. The sequence of the human ABCB1 gene including the introns is described in the human reference sequence of the National Center for Biotechnolgy Information (NCBI). The sequence is accessible gene databases such of NCBI, or Genomics Browser (UCSC) using the reg. sep # = ONM.000927 or the gene ID ABCB1. With regard to the nomenclature of the polymorphisms it is referred to ABCB1 at chr7:86731406-86940797 - (NM_000927) ATP-binding cassette, sub-family B (MDR/TAP), NM # = Reference Se- 25 quence Number, Localisation on genome according to The April 2003 human reference sequence (UCSC version hg15) based on NCBI Build 33. All polymorphisms have been selected from the public SNP database of SNP (www.nc- bi.nlm.nih.gov/SNP). The location of the SNPs within ABCB, is according to the April 2003 human reference sequence (UCSC version mg 15; www.genome.ucsc.edu). The more preferred polymorphisms as listed above are described in table 1. 30 Table 1. Polymorphism in the human ABCB1 Reference Nr. Position Sequence NM_000927 86797791 AACACNNNNAGAATT[A/T]TGAAGAGGTATCTGT 35 NM_000927 86763977 CTCCTTTCTACTGGT[G/A]TTTGTCTTAATTGGC NM_000927 86748149 WGTACAAGACCCT[G/A]AACTAAGGCAGGGAC NM_000927 86758788 TAGAGTAAAGTATTC[T/C]AATCAGTGTTATTTT NM_000927 86731697 AACACNNNNAGAATT[A/T]TGAAGAGGTATCTGT 40 NM_000927 86777670 GCGGTGATCAGCAGT[C/T]ACATTGCACATCTTT NM_000927 86731143 CCCAAMCACAGATC[G/A]ATAAGATTTTAGG

45 [0016] The CNS-active medicaments are preferably selected from the group consisting of antidepressants, , hypnotics, cognitive enhancers, antipsychotics, neuroprotective agents, antiemetics, antiepileptics, antibiotics, antican- cer agents, antimycetics, antiparkinson agents, antiviral agents, glucocorticoids, immunosuppressants, statins, neu- roleptics, and opioids. A preferred class of medicaments are antidepressants. Examples of CNS-active medicaments are described in Schatzberg and Nemeroff, "The American Psychiatric Publishing Textbook of Psychopharmacology", 50 Amer Psychiatric Pr, 2004. [0017] A preferred class of medicaments are antidepressants. Examples of antidepressants are imipramine, amitriptyl- ine, amitriptylinoxid, , citalopram, , doxepine, desipramine, , , , maprotiline, mirtazepine, mianserin, moclobemide, , nortriptyline, paroxetine, selegiline, , tranylcy- promine, trazodon, trimipramine and, venlafaxine. Prefered examples of antidepressants which are substrate of the 55 ABCB1 protein are , citalopram, doxepine, flesinoxan, nortriptyline, paroxetine, trimipramine, and venlafax- ine. Especially preferred examples of antidepressants are citalopram, venlafaxine or, paroxetine. [0018] Further preferred CNS-medicaments are anxiolytics, hypnotics, cognitive enhancers and, antipsychotics. Ex- amples of anxiolytics include but are not limited to , , clonazepam, , iorazepam,

4 EP 1 756 310 B1

, , , , , , biperiden and, kava. Examples of hyp- notics are secobarbital, pentobarbital, , ethchlorvynol, , mebrobamate. Examples of cog- nitive enhancers are acetyl L-carnitine (ALCAR), adrafinil, aniracetam, deprenyl, galantamine, hydergine, idebenone, modafinil, picamilon, piracetam, pyritinol, vasopressin and, vinpocetine. Examples of antipsychotics are risperidon, olan- 5 zapine, quetiapine and, ziprasidone, chlorpromazine, fluphenazine, trifluoperazine, perphenazine, thioridazine, holoperi- dol, thiothixene, molindone, loxapine, clozapine, olanzapine, quetiapine, risperidone, sertindole, ziprasidone, amisulpid, aripriprazol, benperidol, chlorpromazine, chlorprothixen, , fluspirilen, levomepromazin, benperidol, melperon, perazin, perphenazin, pimozid, pipamperon, sulpirid, triflupromazin, zotepin, zuclopenthixol. [0019] Further preferred examples of substrates of the ABCB1 protein are antiemetics such as domperidone or on- 10 dansetron, antiepileptics such as , felbamate, lamotrigin, phenobarbita and , antiparkinson agents such as budipin or L-Dopa, neuroleptics such as olanzapine, quetiapine, risperidone and sulpiride, or opioids such as fentanyl or . [0020] The patients to be tested are human patients suffering from a disorder which may be treated with a CNS- active medicament, e.g. a psychiatric disorder. Particularly, the patients have a depressive disorder, dysthymia and/or a bipolar 15 disorder. [0021] The present invention relates to the determination of the prognosis of a clinical response in a human patient. The term "a clinical response" in the present application with regard to antidepressants relates to a remission status after six weeks of treatment. Methods of assessing a remission status are well known in the art. For example, remission can be evaluated according to the Hamilton Depression Rating Scale (HAM-D; Hamilton, Br. J. Soc. Clin. Psychol. 6 20 (1967) 278-296). A. HAM- D score of 10 or below is regarded as remission of the depressive symptoms. Remission can also be assessed according to a normalisation of the hypothalamic- pituitary-adrenocortical (HPA) axis. The development and course of depression is causally linked to impairments in the central regulation of the HPA axis. Abnormalities in the HPA axis can be measured using the dexamethasone-suppression test (DST) or the combined dexamethasone/ corticotropin-releasing hormone (Dex/CRH) test. Changes in cortisol and/or adrenocorticotropic hormone (ACTH) meas- 25 urements during the DST or Dex/CRH test are indicative of HPA dysfunction while normalisation of cortisol and or ATCH is indicative of remission (Heuser et al, J. Psychiat. Res. 28 (1994) 341-356; Rybakowski and Twardowska, J. Psychiat. Res. 33 (1999) 363-370; Zobel et al, J. Psychiat. Res. 35 (2001) 83-94; Künzel et al, Neuropsychopharmacology 28 (2003) 2169-2178). Methods and conditions for performing the DST and Dex/CRH test are well known in the art, see for example Heuser et al, J. Psychiat. Res. 28 (1994) 341-356; Künzel et al, Neuropsychopharmacology 28 (2003) 30 2169-2178. Briefly, individuals may be pre-treated at 23:00 with an oral administration of 1.5 mg dexamethasone. For the DST test, a blood sample may be drawn at 8:00 prior to dexamethasone administration (i.e. pre-dexamethasone) and at 8:00 the morning following dexamethasone administration (i.e. post-dexamethasone). For the Dex/CRH test, a venous catheter may be inserted at 14: 30 the day following dexamethasone administration and blood may be collected at 15:00, 15:30, 15:45, 16:00, and 16:15 into tubes containing EDTA and trasylol (Bayer Inc., Germany). At 15:02, 100 35 mg of human CRH (Ferring Inc., Germany) may be administered intravenously. Measurement of plasma cortisol con- centrations may be done according to known methods, e.g. using a commercial radioimmunoassay kit (ICN Biomedicals, USA). Plasma ACTH concentrations may also be measured according to known methods, e.g. using a commercial immunometric assay (Nichols Institute, USA). With regard to other classes of medicaments, the term "clinical response" may be defined as a reduction of the severity of symptoms by over 50% from the severity of symptoms at the beginning 40 of treatment. [0022] The presence of a polymorphism associated with a delayed, partial, sub-optimal or lacking clinical response to a medicament is preferably determined by a genotyping analysis of the human patient. This genotyping analysis frequently comprises the use of polymorphism-specific primers and/or probes capable of hybridizing with the human ABCB1 gene and allowing a discrimination between polymorphisms, particularly SNPs at a predetermined position. For 45 example, the genotyping analysis may comprise a primer elongation reaction using polymorphism-specific primers as described in the examples. The determination of individual polymorphisms may be carried out by mass-spectrometric analysis as described in the examples. A further preferred embodiment comprises a microarray analysis which is par- ticularly suitable for the parallel determination of several polymorphisms. Suitable microarray devices are commercially available. 50 [0023] Based on the results of polymorphism determination a prognosis of a clinical response in a human patient to a CNS-active medicament which is a substrate of the ABCB1 protein can be made. Thus, on the one hand, if the patient to be tested does not have a polymorphism which is associated with an insufficient clinical response to the medicament, a favourable prognosis for a clinical response can be given and the medicament for obtaining the clinical response may be manufactured, prescribed and administered in a standard dose whereby a sufficient clinical response may be expected 55 with high probability. On the other hand, the patient to be tested may have one or a plurality of polymorphisms which are associated with an unfavourable prognosis for a clinical response of the medicament. If such an unfavourable prognosis for a clinical response is given, a modified therapeutic regimen for the patient may be used. For example, the medicament may be administered in a dose which is higher than the standard dose, e.g. by increasing the dose strength

5 EP 1 756 310 B1

and/or the number of doses to be adminsitered per time interval. Further, the formulation of the medicament may be manufactured and adminstered which shows an increased permeation through the blood- brain barrier, e.g. by including a blood-brain barrier permeation aid such as those indicated in Table 2.

5 Table 2. Inhibitors and modulators of ABCB1 Antiacids Maprotiline Statins Ginsenoide Lansoprazole Nefazodone Atorvastatin Grapefruit Omeprazol Paroxetine Lovastatin Green Tea 10 Pantoprazole Reboxetine Simvastatin Lidocaine Antiarrhythmics Sertraline Neuroleptics Lonafarnib (SCH66336) Trimipramine Chloropromazine Loratadine

15 Amiodarone Venlafaxine Droperidol Mefloquine Barnidipine Antiemetics Flupenthixol Midazolam Benidipine Antiepileptics Fluphenazine Nobilitin Bepridil Antihypertensive agents Haloperidol orange juice-Seville 20 Digitoxin Carvedilol Phenothiazine pipeline Digoxin Doxazosin Pimozide Probenecid Efonidipine Felodipine Prochlorpernazine Progesterone 25 Niguldipine Mibefradil Promethazine Quinacrine Nilvadipine Nifedipine Thioridazine Quinine Propafenone Trifluoperazine RU 486 Nitrendipine Triflupromazine Spironolactone 30 Quinidine Reserpine Opioids Terfenadine Verapamil Antimycotics Alfentanil Tetrandrine Antibiotics Itraconazole Fentanyl Thyroid Hormones 35 Ceftriaxone Ketoconazole Methadone TNF alpha Clarithromycin Antiparkinson Pentazocine Vandate Erythromycin Antiviral agents Sufentanil XR9576 Fucidine Indinavir Surfactants Yohimbin 40 Josamycin Lopinavir Cremophor EL Zosuquidar.3HCl Nelfinavir Triton X-100 Rifampin Anticancer agents Ritonavir Tween 80 GG918 45 Azidopine Saquinavir Others Topotecan Gramicidine Steroids Anti-CD19 antibody Puromycin Mitomycin C Progesterone Azelastine Mithramycin Quercetin Immunosuppressants Bromocriptine Mitomycin C 50 Valinomycin Cyclosporine A Chloroquine Calmodulin inhibitors Antidepressants FK 506 Indomethacin Amitriptyline Rapamycin Cyproheptadin Quinine 55 Citalopram Sirolimus Dipyridamole Melphalane Desipramine Tacrolimus E6 Econazol

6 EP 1 756 310 B1

(continued) Fluoxetine Tamoxifen Emetine Cholchicin Fluvoxamine Valspodar (PSC833) EP 51389 Actinomycin 5 Imipramine Vinblastine Flavinoids Taxones Garlic Anthracyclines GF120918 5’MHC

10 Reversin JS-2190 PGP-4008 WP631 15 Dihydropyridine Quinolines VX-710

20 S-9788

[0024] Further, the manufacture and administration of the medicament may be combined with the manufacture and adminsitration of a further medicament which is an inhibitor of the ABCB1 protein. Suitable inhibitors of the ABCB1 proteinare known and forexample described inUS 2003/0073713 A1 .FurtherABCB1 inhibitors are described inMarzolini 25 C, et al (2004), Clin Pharmacol Ther. 2004 Jan: 75(1):13-33 The inhibitors mentioned in these documents are incorporated into the present disclosure by reference. [0025] As outlined above, the present document also describes diagnostic compositions and kits for the prognosis of a clinical response in a human patient to a CNS-active medicament which is a substrate of the ABCB1 protein. A diagnostic composition or kit preferably comprises at least one primer and/or probe for determining at least one poly- 30 morphism which is associated with a lack of clinical response to the CNS- active medicament. The primers and/or probes may be nucleic acid molecules such as a DNA, an RNA or nucleic acid analogues such as peptide nucleic acids (PNA) or a locked nucleic acids (LNA). The primer and/or probes are selected such that they can discriminate between poly- morphisms at the position to be analyzed. Usually, the primers and probes have a length of at least 10, preferably at least 15 up to 50, preferably up to 30 nucleic acid building blocks, e.g. nucleotides. The composition or kit may comprise 35 at least one primer which hybridizes to the human ABCB1 gene under predetermined conditions, e.g. of temperature, buffer, strength and/or concentration of organic solvent, and which allows a specific determination of the polymorphism to be tested. Preferred examples of such primers are indicated in Table 3 and Table 4 for genotyping with a mass array system and in Table 5 for genotyping rs2235015 with hybridisation probes."

40 Table 3. Primer sequence for SNP amplification and sequencing SNP PCR Forward PCR Reversed rs2235015 ACGTTGGATGCACCTAGACCACCACAAAAC ACGTTGGATGAAAACTGAGTCAGTTCGACC rs2235040 ACGTTGGATGACTGGAGCATTGACTACCAG ACGTTGGATGTTAGTTTCATGCTGGGGTCC 45 rs2235067 ACGTTGGATGAGTGGAGAAAGTGCTCGAAG ACGTTGGATGTTCTACCTCAGAGATGTCCC rs2032583 ACGTTGGATGCTGGGAAGGTGAGTCAAAC ACGTTGGATGGCATAGTAAGCAGTAGGGAG rs 17064 ACGTTGGATGGACTCTGAACTTGACTGAGG ACGTTGGATGGTGAACTCTGACTGTATGAG 50 rs2032588 ACGTTGGATGTGATGCAGAGGCTCTATGAC ACGTTGGATGGGCAACATCAGAAAGATGTG rs1055302 ACGTTGGATGTCCACATTAAGGTGGCTCTC ACGTTGGATGTCATAATTGTGCCTCACCCC

55

7 EP 1 756 310 B1

Table 4. Primer sequence for primer extension systems SNP Extension Primer Stop Mix rs2235015 ACCACCACAAAACAAACATA CGT 5 rs2235040 TGCCTCCTTTCTACTGGT ACT rs2235067 AGAGAAAGTACAAGACCCT ACT rs2032583 AATTAAGTAGAGTAAAGTATTC ACG

10 rs17064 AATGTTAAACAGATACCTCTTCA CGT rs2032588 CTGCGGTGATCAGCAGT ACG rs1055302 CAAACCCAAAACACAGATC ACT

15 Table 5. Primers used for genotyping with hybridisation probes for rs2235015 Description Hybridisation probes PCR Primer Forward ABCB1 CAATTAAAACTgAgTCAgTTCg 20 PCR Primer Reverse ABCB1 TTTTAAACATTTCTACAACTTgATg Anchor probe rs2235015 TgTATCATTgATATCACCTAgACCACCAC-FL Sensor probe Sensor [G] LCRed640-AAACAAACATACCATTTATgTCTCT--PH

25 [0026] The use of the hybridisation probes disclosed in Table 5 enables sequence- specific detection of PCR products. These hybridisation probes consist of two different oligonucleotides that hybridize to an internal sequence of the amplified fragment during the annealing phase of PCR. One probe is labeled at the 5’ end with a fluorophore. The other probe is labeled at the 3’ end with e.g. fluorescein. After hybridization to the target sequence, the two probes produce Fluorescence

30 Resonance Energy Transfer (FRET). The emitted fluorescence is measured. This technique can be used for quantification and genotyping. For example, genotyping can be performed with melting curve analysis. Table 5 shows the PCR primer and the dyes labeled hybridisation probes for a genotyping test of rs2235015. [0027] The composition or kit preferably further comprises an enzyme for primer elongation such as a DNA polymerase, nucleotides, e.g. chain elongation nucleotides such as deoxide nucleoside triphosphates (dNTPs) or chain termination

35 nucleotides such as didesoxynucleoside triphosphates (ddNTPs) and/or labelling groups, e.g. fluorescent or chromogenic labelling groups. [0028] A microarray for the prognosis of a clinical response to a CNS-active medicament comprises a carrier, e.g. a planar carrier or a microchannel device, having immobilized thereto at least one probe which allows a determination of a polymorphism to be tested. Preferably, the microarray carrier has immobilized thereto a plurality of different probes

40 located at different areas on the carrier which are designed such that they can bind nucleic acid molecules, e.g. RNA molecules or DNA molecules, amplification products, primer elongation products, etc. containing the sequence in which the polymorphism to be tested is located. Thus, an identification of the polymorphism to be analyzed by detection of a site-specific binding events of the nucleic acid sample molecule to the probe immob ilized on the carrier may be accom- plished.

45 [0029] Finally, the present invention relates to a therapeutic composition or therapeutic kit as defined in claim 14, comprising a CNS-active medicament which is a substrate of the ABCB1 protein in a therapeutically effective dose and a further medicament which is an inhibitor of the ABCB1 protein in a therapeutically effective dose for treating a human patient having at least one polymorphism in the ABCB1 gene associated with a lack of clinical response to said CNS- active medicament. The medicaments may be present as a single formulation or as separate formulations, if desired.

50 Pharmaceutically acceptable carriers, diluents or adjuvants may be included. The composition or kit may be administered by any suitable route, e.g. by oral or parenteral administration or any other suitable means. [0030] The schedule of administration and dose of a CNS- active medicament such as, for example an antidepressant drug can vary between patients and are well know in the medical art, see, for example Benkert and Hippius, "Kompendium der Psychiatrischen Pharmakotherapie", Springer Verlag Publishing, 2000; Albers, "Handbook of Psychiatric Drugs:

55 2001-2002 Edition", Current Clinical Strategies Publishing, 2000. For antidepressants, there are three therapeutic pos- sibilities for individuals that have been genotyped with a SNPs in the ABCB1 gene.

1. The dosage of an antidepressant that is a substrate of ABCB1 would be increased. Examples of such antide-

8 EP 1 756 310 B1

pressants are, between 10 mg and 100 mg per day, preferably 40 mg, citalopram; between 10 mg and 80 mg per day, preferably 20 mg, paroxetine; between 50 mg and 500 mg per day, preferably 150 mg, venlafaxine; between 25 mg and 300 mg per day, preferably 75 mg, amitriptyline; between 25 mg and 400 mg per day, preferably 75 mg, nortriptyline; between 50 mg and 400 mg per day, preferably 200 mg, fluvoxamine; between 2 mg and 15 mg per 5 day, preferably 10 mg, reboxetine.

2. An alternative antidepressant that is not a substrate of ABCB1 would be administered. Preferred examples include between 15 mg and 100 mg per day, preferably 30 mg, ; between 5 mg and 80 mg per day, preferably 20 mg, fluoxetine. 10 3. An antidepressant that is a substrate of ABCB1 would be combined with an inhibitor or modulator of ABCB1. Examples of inhibitors or modulators of ABCB1 are disclosed in Table 2 and the dosage would be determined according to the manufactures recommendations.

15 [0031] Furthermore, the present invention shall be explained by the following Tables and Figures as well as Examples:

Table and Figure legend:

[0032] 20 Table 6 Location according to the April 2003 human reference sequence (UCSC version hg15) (http: //genome.ucsc.edu/), heterozygosity and p-values of the Hardy-Weinberg equilibrium of ABCB1 SNPs. * the frequency of the rare third allele A = 4.8%, present either as GA (3.2%) or TA (1.6%), the frequency of the GT genotype is 49.2 %. 25 location within SNP ID function location hg15 Heterocygosity p-value HWE gene rs1055305 3’ 3’ 86730918 0.00 NA

30 rs1055302 3’ 3’ 86731143 0.23 0.79 rs17064 exon 29 3’UTR 86731697 0.11 0.71 rs2235051 exon 29 3’UTR 86731882 0.00 NA rs1045642 exon 27 Ile/Ile 86736872 0.50 1.00 35 rs2235045 intron intronic 86743871 0.00 NA rs2235044 exon 25 Pro/Pro 86744052 0.00 NA rs2235067 Intron 23 intronic 86748149 0.20 0.53

40 rs4148744 intron intronic 86749001 0.08 1.00 rs4148743 intron intronic 86749317 0.53 0.049 rs2032583 Intron 22 intronic 86758788 0.18 0.34 rs2032582 exon 22 Ala/Ser/Thr* 86758845 0.54 0.53 45 rs2032581 intron intronic 86759037 0.00 NA rs2235040 Intron 21 intronic 86763977 0.20 0.57 rs2235039 exon 21 Val/Met 86764081 0.00 NA

50 rs1922242 intron intronic 86771894 0.53 0.06 rs2235035 intron intronic 86777313 0.47 0.67 rs2032588 Intron 13 intronic 86777670 0.1 1.00 rs2229109 exon 12 Ser/Asn 86778036 0.1 0.69 55 rs2235030 intron intronic 86778153 0.00 NA

9 EP 1 756 310 B1

(continued)

location within SNP ID function location hg15 Heterocygosity p-value HWE gene 5 rs2235029 intron intronic 86778162 0.00 NA rs2235023 intron intronic 86788679 0.13 0.51 rs2235022 exon 9 Glu/Glu 86788904 0.00 NA

10 rs1202168 intron intronic 86794189 0.48 0.75 rs1202167 intron intronic 86795286 0.51 0.32 rs2235019 intron intronic 0.02 1.00 rs2235018 intron intronic 86797592 <0.01 1.00 15 rs2235017 intron intronic 86797600 <0.01 1.00 rs2235016 intron intronic 86797639 0.00 NA rs2235015 intron 5 intronic 86797791 0.28 1.00

20 rs2235014 intron intronic 86797842 0.00 NA rs1202179 intron intronic 86802506 0.44 0.41 rs1989831 intron intronic 86803706 0.43 0.34 rs1202172 intron intronic 86809201 0.39 1.00 25 rs1202171 intron intronic 86809272 0.43 0.41 rs4148733 intron intronic 86811459 0.27 0.12 rs1202186 intron intronic 86811485 0.45 0.41

30 rs1202185 intron intronic 86811611 0.43 0.42 rs1202183 exon 5 Asn/Ser 86813210 0.00 NA rs1202182 intron intronic 86813531 0.44 0.42 rs1202181 intron intronic 86814377 0.42 0.89 35 rs2235074 intron intronic 86823273 0.08 0.34 rs2214102 exon 3 TLI 86827728 0.13 0.26 rs3213619 exon 2 5’UTR 86828420 0.00 NA

40 rs2188524 intron intronic 86828662 0.00 NA rs4148731 intron intronic 86837556 0.06 1.00 rs4148730 intron intronic 86837578 0.06 0.49 rs4604363 intron intronic 86852423 0.00 NA 45 rs2157928 intron intronic 86856631 0.00 NA rs4148729 intron intronic 86860613 0.06 0.041 rs2157926 intron intronic 86868727 0.12 1.00

50 rs4148728 intron intronic 86869044 0.00 NA rs916715 intron intronic 86925156 0.00 NA rs2188529 intron intronic 86930698 0.04 0.33 rs3747802 promoter intronic 86940813 0.00 NA 55 rs4148727 promoter promoter 86942971 0.06 0.041

10 EP 1 756 310 B1

Table 7 p-values of the association of ABCB1 SNPs with remission status after 6 weeks of treatment in all patients, patients treated with citalopram/venlafaxine/paroxetine and patients treated with mirtazapine (Abbreviation: n.s. = not 5 significant). patients treated with patients treated with SNP ID all patients citalopram/venlafaxin / mirtazapine paroxetin 10 *rs1055302 n.s 0.045 n.s * rs17064 n.s 0.025 n.s rs1045642 n.s n.s n.s *rs2235067 n.s 0.009 n.s 15 rs4148744 n.s n.s n.s rs4148743 n.s n.s n.s *rs2032583 n.s 0.017 n.s 20 rs2032582 n.s n.s n.s rs2235040 n.s 0.002 n.s rs1922242 n.s n.s n.s

25 rs2235035 n.s n.s n.s rs2032588 n.s 0.028 n.s rs2229109 n.s n.s n.s rs2235023 n.s n.s n.s 30 rs1202168 n.s n.s n.s rs1202167 n.s n.s n.s rs2235019 n.s n.s n.s

35 rs2235018 n.s n.s n.s rs2235017 n.s n.s n.s rs2235015 0.015 0.00007 n.s rs1202179 n.s n.s n.s 40 rs1989831 n.s n.s n.s rs1202172 n.s n.s n.s rs1202171 n.s n.s n.s

45 rs4148733 n.s n.s n.s rs1202186 n.s n.s n.s rs1202185 n.s n.s n.s rs1202183 n.s n.s n.s 50 rs1202182 n.s n.s n.s rs1202181 n.s n.s n.s rs2235074 n.s n.s n.s

55 rs2214102 0.02 n.s n.s rs3213619 n.s n.s n.s

11 EP 1 756 310 B1

(continued)

patients treated with patients treated with SNP ID all patients citalopram/venlafaxin / mirtazapine 5 paroxetin rs2188524 n.s n.s n.s rs4148731 n.s n.s n.s rs4148730 n.s n.s n.s 10 rs4604363 n.s n.s n.s rs2157928 n.s n.s n.s rs4148729 n.s n.s n.s

15 rs2157926 n.s n.s n.s rs4148728 n.s n.s n.s rs916715 n.s n.s n.s rs2188529 n.s n.s n.s 20 rs3747802 n.s n.s n.s rs4728711 n.s n.s n.s * For these SNPs the association was performed in a larger sample (284 total patients; 98 treated with citalopram/

25 venlafaxine/paroxetine; 74 treated with mirtazapin).

Table 8 Description of the experimental procedures of the animal experiments. 30 Citalopram Mirtazapine Venlafaxine Animals Gender male male male Group size [n] 8 9 8 35 Age [weeks] 16-24 15-17 12-15 Weight abcb1 ab(-/-) 31.2 6 0.6 28.6 6 0.3 30.6 6 0.5 Weight abcb1 ab(+/+) 29.8 6 1.0 28.3 6 0.6 29.9 6 1.0 Experimental procedures s.c. administerion via osmotic pumps 60 mg/day 60 mg/day 300 mg/day 40 Extraction procedure Isoamylalcohol (plasmaextraction) 0% 0% 0.5% Isoamylalcohol (orqanextraction) 0% 0% 0.5% High-performance liquid chromatography 45 Mobile phase gradient [% B] 5-25 0-25 0-30 Detection UV [nm] 214 214 214 Detection fluorescence ex/em [nm] 230/300 295/370 225/305

50 Figure 1 Cerebrum/plasma ratios of drug concentration in abcb1ab (-/-) mice compared to wild-type controls. After 11 day continuous sub-cutaneous administration of venlafaxine, mirtazapine and citalopram, no differences in plasma levels of these drugs, including d-venlafaxine the major metabolite of venlafaxine, were found between abcb1ab (-/-) mutant and their wildtype littermates. Drug and metabolite concentrations were also not different 55 between mutant and wiltype littermates in those organs that do not have a blood- organ barrier. These include liver, spleen, kidney and lung (data not shown). There were, however, significant differences in the cerebrum/plasma ratios of citalopram, venlafaxine and its metabolite d- venlafaxine but not in the cerebrum/ plasma ratios of mirtazapine.

12 EP 1 756 310 B1

For citalopram (F6,9 = 39.1; p < 0.001) there was a 3 fold higher concentration in the brain of abcb1ab (-/-) mutant compared to wildtype animals. For venlafaxine (F 6,9 = 32,1; p <0,001) and its metabolite d- venlafaxine (F6,9 = 3,8; p = 0,035) abcb1ab (-/-) mutant presented 1.7 and 4.1 fold higher concentrations in the brain. For mirtazapine, no significant differences in cerebrum/ plasma ratios were observed. Significant but smaller drug- dependent differences 5 similar to those in the brain were observed for testes, another organ with a blood/ organ barrier (data not shown). * = p<0.05; ** = p<0.001.

Figure 2 Representation of linkage disequilibirium (LD) structure in ABCB1 using D’ as a measure for the strength of LD. 10 Figure 3 % of patients in remitters (grey bars) and non- remitters (white bars) according to the rs2235015 genotype for patients treated with citalopram/venlafaxine/paroxetine (substrates) (3B) and mirtazapine (3A).

15 Figure 4 Drug dose and plasma levels of antidepressants according to rs2235015 genotype.

Part A: administered mean drug dose administered in weeks 4-6 of antidepressant treatment in mg.

20 Part B: mean plasma levels of administered antidepressants for weeks 4-6 of antidepressant treatment in ng/ml. For GG homozygotes, plasma venlafaxine levels were 356,5 ng/ml (SEM=51,6). Mirtazapine N=65, citalopram N=35, paroxetine N=29, venlafaxine N=22.

1. Methods 25 1.1 Experiments using transgenic animals

Materials

30 [0033] Venlafaxine and o-desmethylvenlafaxine (d-venlafaxine) was obtained from Wyeth-Pharma GmbH (Münster, Germany). Mirtazapine was obtained from Thiemann Arzneimittel GMBH (Waltrop, Germany) and citalopram from Lun- dbeck (Copenhagen, Denmark). Protriptyline was purchased from RBI (Massachusetts, USA). All other chemicals were obtained in the purest grade available from Merck (Darmstadt, Germany).

35 Animals

[0034] All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the Government of Bavaria, Germany. [0035] Male abcb1ab(-/-) mice and FVB/N wildtype mice were housed individually and maintained on a 12: 12 h light/ 40 dark cycle (lights on at 07:00), with food and water ad libitum. Abcb1ab double knockout mice, originally created by A. Schinkel by sequential gene targeting in 129/Ola E14 embryonic stem cells28 and backcrossed seven times (N7) to FVB/N from the C57BU6 x 129 chimera, and FVB/N wildtype mice were received from Taconic (Germantown, USA; FVB/Tac-[KO]Pgy2 N7). A homozygous colony is maintained at the Max- Planck Institute of Psychiatry on the N7 FVB/N background through intercrossing of homozygous mice. Age, weight and group size of the used mice are shown in Table 3. 45 1.2 Experimental and Extraction procedures

[0036] Experimental and extraction procedures were performed as described before12,26. Citalopram, mirtazapine and venlafaxine dissolved in 0.9% sodium chloride and 0.5% ethanol was administered subcutaneously in the nape of 50 the neck through surgically implanted osmotic infusion pumps (Alzet™ micro- osmotic pump, Alza corporation, Palo Alto, USA), which continuously delivered the drugs in the scheduled concentrations (table1). After 11 days, the mice were anesthetized and sacrificed. The dissected organs were homogenized and a liquid- liquid extraction procedure has been carried out with n-hexan/isoamylalcohol (Table 3) in the first step and phosphoric acid in the second. The extraction recoveries were > 90% for citalopram, mirtazapine, venlafaxine and 36% for d- venlafaxine. 55 1.3 High-performance liquid chromatography

[0037] HPLC measurements were performed as described before12,26. A Beckman gradient pump, autoinjector, UV

13 EP 1 756 310 B1

detector and a Merck fluorescence detector, were used for the high-performance liquid chromatography analysis. Sep- arations were made on a reversed phase Luna 5 m C18(2) 250 x 4.6 mm column (Phenomenex, Torrance, USA), 60°C, mobile phase flow 1 ml/min. A mobile phase gradient with acetonitrile was used for the chromatography analysis (Table 3). The substances were determined by UV absorption and fluorescence at the described wavelength (Table 3). 5 1.4 Human genetics

Patients

10 [0038] 255 patients admitted to our psychiatric hospital for treatment of a depressive disorder presenting with a single or recurrent major depressive episode, dysthymia or bipolar disorder as their primary psychiatric diagnoses were recruited for the study. Patients were included in the study within 1-3 days of admission to our hospital and the diagnosis was ascertained by trained psychiatrists according to the Diagnostic and Statistical Manual of Mental Disorders (DSM) IV criteria. Depressive disorders due to a medical or neurological condition were an exclusion criterion. Ethnicity was 15 recorded using a standardized self-report sheet for perceived nationality, mother language and ethnicity of the subject itself and all 4 grandparents. All included patients were Caucasian and 92% of German origin. The study has been approved by the local ethical committee. Written informed consent was obtained from all subjects.

Controls: 20 [0039] 339 healthy, age-, sex- and ethnicity- matched controls were selected randomly from a Munich- based community sample and their genotypes used in the construction of a linkage disequilibrium map of ABCB1. Recruitment of controls was also approved by the local ethics committee and written informed consent was obtained from all subjects.

25 Psychopathology and definition of response to antidepressant drug treatment:

[0040] In 255 patients severity of psychopathology was assessed using the 21 items Hamilton Depression Rating Scale (HAM-D) by trained raters. Ratings were performed within 3 days of admission and then in weekly intervals until discharge. Remission of depressive symptoms was defined as reaching an overall HAM-D score ≤ 8. Patients were 30 subdivided according to their remission status after 6 weeks of hospitalization. All patients were treated with antidepres- sant drugs within a few days of admission. The type antidepressant medication was not influence by the participation in the study, but chosen freely by the responsible psychiatrist. For all patients plasma concentration of antidepressant medication was monitored to assure clinically efficient drug levels. For patients treated with citalopram, paroxetine, venlafaxine or mirtazapine the mean administered drug dose in mg and drug plasma concentration in ng/ml over treatment 35 weeks 4-6 were calculated.

Plasma concentration of antidepressant drugs:

[0041] Plasma citalopram, mirtazapine, and paroxetine were extracted with a liquid-liquid extraction procedure and 40 than measured after HPLC with UV absorption and fluorescence. For this 100 ml internal standard (protriptyline 2 mg/ml), 1000 ml sodium hydrogencarbonate (2M, pH 10.5, and 5 ml n-hexan with 1,5% isoamylalcohol was add to 1000m l plasma. After shaking for 20 min and centrifugation 15 min 4000 r.p.m. the organic phase were transferred in 250m l 0,85% phosphoric acid. The sample were again shaken for 20 min, centrifugated 15 min 4000 r.p.m., and the lower watery phase analyzed in the HPLC. 45 [0042] We used a reversed phase Luna 5 m C18(2) 250 x 4.6 mm column (Phenomenex, Torrance, USA), 60°C, mobile phase flow 1ml/min. A mobile phase gradient with acetonitrile and phosphoric acid (1.5 ml 85% H 3PO4/l, pH=3.5, adjusted with NaOH) was used for the chromatography analysis (mirtazapine 5-33 % acetonitrile in 30 min; citalopram and paroxetine 28-35 % acetonitrile in 45 min). The substances were determined by UV absorption (214 nm) and fluorescence at the suitable wavelength (citalopram 235/300 nm, mirtazapine 295/370 nm, paroxetine 295/365 nm, protriptyline 50 295/420 nm). The extraction recovery was >90%, and the intra and inter day variation coefficient was < 10%.

DNA preparation:

[0043] On enrollment in the study, 40 ml of EDTA blood were drawn from each patient and DNA was extracted from 55 fresh blood using the Puregene® whole blood DNA-extraction kit (Gentra Systems Inc; MN).

14 EP 1 756 310 B1

SNP selection and genotyping:

[0044] 26 ABCB1 SNPs were selected from dbSNP (http://www.ncbi.nlm.nih.gov:80/). The SNP search tool at hftp: //ihg.gsf.de/ihg/snps.html was used to download SNP sequences from public databases. Genotyping was performed on 5 a MALDI-TOF mass-spectrometer (MassArray® system) employing the Spectrodesigner software (Sequenom™; CA) forprimer selection and multiplexing and the homogeneous mass- extension(hMe) process for producingprimer extension products. All primer sequences are available upon request. The tri-allelic SNP rs2032582 was measured in the light- cycler using allele-specific hybe-probes (primer sequences available on request.

10 1.3 Statistical analysis

Animal experiments:

[0045] Statistical analysis was carried out the statistic software SPSS 10.0 for windows (Chicago, Illinoi). Significance 15 was tested by one-factorial multivariate analyses of variance (MANOVAs). Univariate F-tests followed to identify the variables whose differences between the two groups contributed significantly to the global group effect. As a nominal level of significance α=0.05 was accepted and corrected (reduced according to the Bonferroni procedure) for all a posteriori tests (univariate F-tests) in order to keep the type I error less than or equal to 0.05.

20 Human genetics:

[0046] All analyses for binary outcomes were performed using logistic regression using both R and SPSS (version 11), as well as by exact contingency table analyses using SPSS. The tables were constructed as tests per genotype, i.e. for a given binary outcome and a single SNP we analyzed a 2*3 table with 2 d.f. For the tri-allelic SNP rs2032582 25 (G/T/A) a 2*5 table with 4 d.f. was used. To detect any genotype dependent differences in antidepressant dose or plasma level, we used a one-way ANOVA with the genotype of rs2235015 as factor. [0047] For haplotype analyses individual haplotype assignments were determined using SNPHAP (hftp://www- gene.cimr.cam.ac.uk/clayton/software/snphap.txt). Only haplotype assignments with an uncertainty of less than five percent and a frequency of over five percent were included in the analyses. For the analysis of the LD pattern and 30 computing of pairwise D’ values from genotype data of our sample of cases and controls, we used the R package "genetics" (http://lib.stat.cmu.edu/R/CRAN/). Haplotype block definition was done using the |D’| method (Lewontin R.C., On Measures of Gametic Disequilibrium, Genetics 120: 849-852 (November, 1988)) with a threshold of 0.75. For graphical depiction of LD we used GOLD (http: //www.sph.umich.edu/csg/abecasis/publications/10842743.html), GOLD--graphical overview of linkage disequilibrium. Abecasis GR and Cookson WO. Bioinformatics (2000) 16:182-3). SNPs with a fre- 35 quency of the minor allele less than 0.1 were omitted from the LD analysis.

2. Results

2.1Differential regulation ofintracerebral levelsof mirtazapine, venlafaxineand citalopram inabcb1a andabcb1b 40 double knock-out mice.

[0048] While p-glycoprotein is encoded by a single gene in humans (ABCB1) there are two homologues in mice, the abcb1a (also called mdr1a or mdr3) and abcb1b (also called mdr1b or mdr1) genes 9. Although abcb1a and abcb1b are not always expressed in the same organs, the overall distribution of these genes in mouse tissue coincides roughly with 45 that of the single ABCB1 gene in humans, suggesting that abcb1a and abcb1b together function in the same manner as human ABCB1 10.11. We could previously show that several antidepressants are substrates of p- glycoprotein following a singe drug administration12.26.27. We selected three of them to test whether this substrate-specificity remains after subchronic treatment, which is more relevant for the clinical situation. Using transgenic mice lacking abcb1 a and abcb1b, we could show that following administration for 11 days the intracerebral concentrations of the antidepressant drugs 50 citalopram (belonging to the class of selective serotonin reuptake inhibitors) and venlafaxine (a combined serotonin and norepinephrine reuptake inhibitor) and its active metabolite desmethyl- venlafaxine, are regulated by p- glycoprotein. This is not the case for mirtazapine, an antidepressant drug mainly targeting serotonin (5-HT)2C and alpha2A-adrenergic receptors (see Figure 1).

55 2.2 ABCB1 SNPs are associated with remission to antidepressant treatment

[0049] Since p-glycoprotein regulates access to the brain for some antidepressants, functional polymorphisms in this gene might influence intracerebral antidepressant concentration and thus clinical response to antidepressant drugs. If

15 EP 1 756 310 B1

certain polymorphisms were to alter intracerebral concentrations of specific antidepressants, prior knowledge of the patients’ relevant p-glycoprotein genotypes could prevent the administration of a drug that fails to reach therapeutic intracerebral levels despite a plasma concentration that is regarded as clinically sufficient. To test this hypothesis, we first investigated whether SNPs in the ABCB1 gene are associated with clinical drug response. Secondly we analyzed 5 if the association of ABCB1 SNP genotypes with antidepressant response depends on whether or not the drug is a substrate of the ABCB1 gene product. The latter distinction was based on cerebral drug concentrations in mice lacking the respective drug transporter encoding genes. Citalopram, venlafaxine and paroxetine but not mirtazapine were con- sidered as substrates of p-glycoprotein (see data presented in this manuscript and 12 where paroxetine is identified as a substrate of p-glycoprotein). 10 [0050] Of 56 investigated SNPs in ABCB1, 38 turned out to be polymorphic in our sample (Table 6). SNPs were initially spaced with an average intermarker distance of 8.3 kb spanning 209 kb of the gene from the promoter region to exon 29. The average intermarker distance of the informative SNPs was 11.7 kb, spanning 199 kb of the gene (intron 1 to exon 29). All polymorphic SNPs were then tested for association with remission status at 6 weeks in all 255 depressed patients. Remission was defined as reaching a total score smaller or equal to 8 on the Hamilton Depression Rating scale 15 (see method for more detail). We found a significant association with remission (p < 0.05) for 7 SNPs: rs 1055302, rs 17064, rs 2235067, rs 2032583, rs 2235040, rs 2032588 and rs2235015 (see Table 7). To investigate if the association with remission status depends on whether the antidepressant drug received by the patients was a potential substrate of the human ABCB1, we subgrouped patients according to their antidepressant medication in the first 6 weeks of treatment. The first group of patients had received substrates of abcb1ab: citalopram, paroxetine or venlafaxine as 20 antidepressant treatment within the first 6 weeks (n = 86) and the second mirtazapine (n = 65), which intracerebral concentration was not found to be regulated by abcb1ab in the mouse knockout model. An association analysis with remission status in the first group of patients revealed significant associations with rs 2235015, rs2235040, rs2235067, rs2032583, rs17064, rs2032588, and rs1055302, the first SNP showing the strongest association (p < 0.00008). In the patient group receiving mirtazapine no significant association with any of the tested SNPs could be detected (see Table 25 7). The odds ratios for the association for remission within six weeks with rs2235015 genotype, were 2.056 (95% Cl = 1.27-3.32) for all patients, 6.15 (95% Cl = 2.54-14.67) for patients treated with citalopram/paroxetine/venlafaxine and 1.83 (95% Cl = 0.73-4.55) for patients treated with mirtazapine.

2.3 Haplotype analysis and linkage disequilibrium mapping 30 [0051] We then constructed all possible haplotypes for polymorphic SNPs genotyped within ABCB1 and repeated the association analysis with remission status for the three patient groups (all patients, patients receiving substrates of abcb1ab and patients receiving mirtazapine). Even though some haplotypes showed a higher OR in the first two patient groups, the association was not statistically significantly different from rs2235015, as the confidence intervals overlapped, 35 suggesting that most of the association is carried by this SNP. Paralleling the single SNP data, no haplotype association was found in the patient group having received mirtazapine. To possibly narrow down the region of ABCB1 containing the causal variant, we analyzed the linkage disequilibrium (LD) block structure of the investigated SNPs within ABCB1 using genotypes of all cases as well as 339 healthy controls. Similar to previous reports in the literature13,14, we only detected one haplotype block, spanning the examined region of ABCB1 (see figure 2). It is thus difficult to pinpoint 40 rs2235015 or any other SNP as the potential causal mutation. Careful characterisation of the functional consequences of the investigated SNPs and the resulting haplotypesin vitro and in vivo are warranted in order to narrow in on the potential causal polymorphism or combination of polymorphisms.

2.4 Use of rs2235015 genotype for prediction of remission to antidepressant treatment 45 [0052] To evaluate whether the knowledge of the ABCB1 SNP genotypes would allow predicting remission after six weeks of treatment, a discriminant analysis of rs2235015 genotype (group variable) and the remission status at six weeks (independent variable) in patients treated with citalopram/paroxetine/venlafaxine was employed, which showed an overall significant discriminant power of this SNP; Wilks lambda = 0,792; X 2 = 19.4; df = 1; p = 1.0 x 10 -5. Using this 50 polymorphism, 75.6 % of patients receiving substrates of ABCB1 were correctly classified in remitters and non- remitters, remission being defined as having reached a HAM- D score equal to or smaller than 8 after 6 weeks of treatment. In the patient group treated with mirtazapine, no significant discriminant power of this SNP could be detected. To test whether the discriminant power could be increased by adding the genotypes of rs2235040, the second strongest associated SNP, we included this polymorphism in the analysis. While both SNPs contributed significantly to the discriminant power 55 (rs2235015: Wilks lambda = 0,792, p = 1.0 3 10-5 and rs2235040: Wilks lambda = 0,875, p = 0.0008), the addition of the second genotype did not increase the number of correctly classified patients in the citalopram/ paroxetine/venlafaxine group. This would indicate that genotyping rs2235015 is sufficient to predict remission status with a certainty of over 75% in patients receiving ABCB1 substrates. Figure 3 shows a distribution of rs2235015 genotype among remitters and

16 EP 1 756 310 B1

non-remitters for patients treated with mirtazapine vs. citalopram/paroxetine/venlafaxine.

2.5 rs2235015 genotype is not associated with differences in drug plasma levels

5 [0053] SNPs in ABCB1 have been reported to influence intestinal uptake and thus plasma levels of drugS15,16 . Differences in plasma levels may also lead to differences in the tolerance of the drug and thus potentially to differences in drug dosing. To exclude that the effect we are seeing is solely based on differences in intestinal uptake, we compared plasma levels and administered doses of citalopram (N=35), paroxetine (N=29), venlafaxine (N=22) and mirtazapine (N=65) according to the genotype of rs2235015. During the course of the study, routine evaluation of plasma venlafaxine 10 levels was only available after half of the patients were recruited, so that for this drug only plasma levels for GG ho- mozygotes were measured. No significant, genotype-dependent difference could be found for the mean plasma levels and administered dose of all four antidepressants over the first six weeks of treatment (see figure 4A and 4B). The possibility that the association of remission status with rs2235015 genotype is related to differences in plasma levels can thus be rejected, supporting the hypothesis that genotype-related differences in treatment response are linked to 15 differences in intracerebral drug concentrations. In addition, we did not observe any differences in rs2235015 genotype distribution among the four drugs, indicating that the genotype did not influence the choice of the administered antide- pressant.

3. Discussion 20 [0054] This study shows for the first time that antidepressant-induced remission of depressive symptoms can be predicted by a SNP, particularly by rs2235015 in the ABCB1 gene. This association between clinical course and the ABCB1 polymorphism is found in depressed patients treated with drugs that are a substrate of the ABCB1 encoded p- glycoprotein. To identify whether or not the antidepressants administered to patients are substrates of the p- glycoprotein, 25 mouse mutants were studied lacking the mouse homologues of the ABCB1 gene. These findings underscore the need to classify antidepressants according to their property as p- glycoprotein substrate. [0055] So far, it has not been possible to predict the affinity of a substrate to p- glycoprotein from the chemical structure, from hydrophobicity, lipophilicity or charge. Structural characteristics that allow to explain why venlafaxine, citalopram and paroxetine are substrates, but mirtazapine is not, have not been identified. Therefore, an animal model, in this case 30 mouse mutants lacking ABCB1 homologues are helpful in assessing whether a given antidepressant is a substrate of p-glycoprotein. These results suggest a similar substrate- specificity between mouse and man, supporting that mice with abcb1a and abcb1b null-mutations are appropriate models for human ABCB1 loss of function. [0056] Numerous papers describe polymorphisms in this ABCB117-24 and over 230 SNPs are listed in public SNP databases for ABCB1. The most studied polymorphism is a silent SNP, rs1045642 in exon 26 (27 according to the 35 human reference sequence; UCSC version hg15), often referred to as C3435T 14,16 found an association between this C3435T polymorphism and drug-resistant epilepsy, suggesting possible effects of this polymorphism on intracerebral concentrations of antiepileptic drugs. In this study, however, no distinction was made according to the p-glycoprotein substrate status of the used anticonvulsants. Only one study investigated ABCB1 polymorphisms, more specifically C3435T, in relation to antidepressant-induced clinical effects25. In this study, patients were treated with nortriptyline, 40 substrate of p-glycoprotein or fluoxetine, which is not substrate of p-glycoprotein26.27. No significant association was found between the C3435T genotype and antidepressant response to either drug, which is in agreement with the lack of association with remission status at 6 weeks that we observe with this same polymorphism. [0057] In conclusion, the herein reported finding that genotyping specific polymophisms, such as rs2235015 would allow to predict clinical response to a distinct class of antidepressants is a further step towards differential therapy 45 according to individual genetic background. Substrates of p-glycoprotein could be drug of choice in patients with the GT or TT genotypes of rs2235015 (see figure 3). Furthermore, patients with the GG genotype, presumably associated with insufficient intracerebral concentrations of antidepressants substrates of p- glycoprotein may benefit from co- medication with a drug that by blocking the ABCB1-transporter enhances intracerebral antidepressant concentrations. Beside the benefit for the individual patient receiving drugs customised to his or her genotype, the prediction of response by genotype 50 poses important questions for the recruitment and enrolment of trial participants. Once a difference in substrate specificity for p-glycoprotein is established for two comparative drugs the current findings call for appropriate stratification of clinical study samples, to avoid sampling biases. Such a bias can have serious consequences as the drug-response profiles will not reflect those of the general population.

55 References

[0058]

17 EP 1 756 310 B1

1. Thase, M.E. Overview of antidepressant therapy. Manag. Care 10, 6-9, Discussion 18-22 (2001).

2. Cordon-Cardo, C., O’Brien, J.P., Casals, D., Rittman-Grauer, L., Biedler, J.L., Melamed, M.R. & Bertino, J.R. Multidrug-resistance gene (P-glycoprotein) is expressed by endothelial cells at blood- brain barrier sites. Proc. Natl. 5 Acad. Sci. USA 86, 695-698 (1989).

3. Thiebaut, F., Tsuruo, T., Hamada, H., Gottesman, M.M., Pastan, I. & Willingham, M.C. Cellular localization of the multidrug-resistance gene product P- glycoprotein in normal human tissues. Proc. Natl. Acad. Sci. USA 84, 7735-7738 (1987). 10 4. Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I. & Gottesman, M.M. Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu. Rev. Pharmacol. Toxicol. 39, 361-398 (1999).

5. Callen, D.F., Baker, E., Simmers, R.N., Seshadri, R. & Roninson, I.B. Localization of the human multiple drug 15 resistance gene, MDR1, to 7q21.1. Hum. Genet. 77, 142-144 (1987).

6. Chin, J.E., Soffir, R., Noonan, K.E., Choi, K. & Roninson, I.B. Structure and expression of the human MDR (P- glycoprotein) gene family. Mol. Cell Biol 9, 3808-3820 (1989).

20 7. Schinkel, A.H., Wagenaar, E., Mol, C.A. & van Deemter, L. P-glycoprotein in the blood-brain barrier of mice influences the brain penetration and pharmacological activity of many drugs. J. Clin. Invest. 97, 2517-2524 (1996).

8. Uhr, M., Holsboer, F. & Müller, M.B. Penetration of endogenous steroid hormones corticosterone, cortisol, aldos- terone and progesterone into the brain is enhanced in mice deficient for both mdr1a and mdr1b P- glycoproteins. J. 25 Neuroendocrinol. 14, 753-759 (2002).

9. Devault, A. & Gros, P. Two members of the mouse mdr gene family confer multidrug resistance with overlapping but distinct drug specificities. Mol. Cell Biol. 10, 1652-1663 (1990).

30 10. Meijer, O.C., de Lange, E.C., Breimer, D.D., de Boer, A.G., Workel, J.O. & de Kloet, E.R. Penetration of dex- amethasone into brain glucocorticoid targets is enhanced in mdr1A P-glycoprotein knockout mice. Endocrinology 139, 1789-1793 (1998).

11. van de Vrie, W., Marquet, R.L., Stoter, G., de Bruijn, E.A. & Eggermont, A.M. In vivo model systems in P- 35 glycoprotein-mediated multidrug resistance. Crit. Rev. Clin. Lab. Sci. 35, 1-57 (1998).

12. Uhr, M., Grauer, M.T. & Holsboer, F. Differential enhancement of antidepressant penetration into the brain in mice with abcb1ab (mdr1ab) P-glycoprotein gene disruption. Biol. Psychiatry 54, 840-846 (2003).

40 13. Kroetz, D.L., Pauli- Magnus, C., Hodges, L.M., Huang, C.C., Kawamoto, M., Johns, S.J., Stryke, D., Ferrin, T.E., DeYoung, J., Taylor, T., Carlson, E.J., Herskowitz, I., Giacomini, K.M. & Clark, A.G. Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene. Pharmacogenetics 13, 481-494 (2003).

45 14. Siddiqui, A., Kerb, R., Weale, M.E., Brinkmann, U., Smith, A., Goldstein, D.B., Wood, N.W. & Sisodiya, S.M. Association of multidrug resistance in epilepsy with a polymorphism in the drug-transporter gene ABCB1. N. Engl. J. Med. 348, 1442-1448 (2003).

15. Sakaeda, T., Nakamura, T. & Okumura K. Pharmacogenetics of MDR1 and its impact on the 50 and pharmacodynamics of drugs. Pharmacogenomics 4, 397-410 (2003).

16. Brinkmann, U. Functional polymorphisms of the human multidrug resistance (MDR1) gene: correlation with P glycoprotein expression and activity in vivo. Novartis Found. Symp. 243, 207-212. (2002).

55 17. Kioka, N., Tsubota, J., Kakehi, Y., Komano, T., Gottesman, M.M., Pastan, I. & Ueda, K. P-glycoprotein gene (MDR1) cDNA from human adrenal: normal P-glycoprotein carries Gly185 with an altered pattern of multidrug resistance. Biochem. Biophys. Res Commun. 162, 224-231 (1989).

18 EP 1 756 310 B1

18. Stein, U., Walther, W. & Wunderlich, V. Point mutations in the mdr1 promoter of human osteosarcomas are associated with in vitro responsiveness to multidrug resistance relevant drugs. Eur. J. Cancer 30A, 1541-1545 (1994).

19. Mickley, L.A., Lee, J.S., Weng, Z., Zhan, Z., Alvarez, M., Wilson, Bates, S.E. & Fojo, T. Genetic polymorphism 5 in MDR-1: a tool for examining allelic expression in normal cells, unselected and drug- selected cell lines, and human tumors. Blood 91, 1749-1756 (1998).

20. Hoffmeyer, S., Burk, O., von Richter, O., Arnold, H.P., Brockmoller, J., Johne, A., Cascorbi, I., Gerloff, T., Roots, I., Eichelbaum, M. & Brinkmann, U. Functional polymorphisms of the human multidrug-resistance gene: multiple 10 sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc. Natl. Acad. Sci. USA 97, 3473-3478 (2000).

21. Ito, S., leiri, I., Tanabe, M., Suzuki, A., Higuchi, S. & Otsubo, K. Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects. Pharmacogenetics 11, 175-184 (2001). 15 22. Cascorbi, I., Gerloff, T., Johne, A., Meisel, C., Hoffmeyer, S., Schwab, M., Schaeffeler, E., Eichelbaum, M., Brinkmann, U. & Roots, I. Frequency of single nucleotide polymorphisms in the glycoproteinP- drug transporter MDR1 gene in white subjects. Clin. Pharmaco/. Ther. 69, 169-174 (2001).

20 23. Tanabe, M., leiri, I., Nagata, N., Inoue, K., Ito, S., Kanamori, Y., Takahashi, M., Kurata, Y., Kigawa, J., Higuchi, S., Terakawa, N. & Otsubo, K. Expression of P-glycoprotein in human placenta: relation to genetic polymorphism of the multidrug resistance (MDR)-1 gene. J. Pharmacol. Exp. Ther. 297, 1137-1143 (2001).

24. Kim, R.B., Leake, B.F., Choo, E.F., Dresser, G.K., Kubba, S.V., Schwarz, U.I., Taylor, A., Xie, H.G., McKinsey, 25 J., Zhou, S., Lan, L.B. , Schuetz, J.D., Schuetz, E.G. & Wilkinson, G.R. Identification of functionally variant MDR1 alleles among European Americans and African Americans. Clin. Pharmacol. Ther. 70, 189-199 (2001).

25. Roberts, R.L., Joyce, P.R., Mulder, R.T., Begg, E. & Kennedy, M.A. A common P-glycoprotein polymorphism is associated with nortriptyline-induced postural hypotension in patients treated for major depression. Pharmacog- 30 enomics J. 2, 191-196 (2002).

26. Uhr, M. & Grauer, M.T. abcb1ab P- glycoprotein is involved in the uptake of citalopram and trimipramine into the brain of mice. J. Psychiatric Res. 37, 179-185 (2003).

35 27. Uhr, M., Steckler, T., Yassouridis, A. & Holsboer, F. Penetration of amitriptyline, but not of fluoxetine, into brain is enhanced in mice with blood-brain-barrier deficiency due to Mdr1a P-glycoprotein gene disruption. Neuropsy- chopharmacology 22, 380-387 (2000).

28. Schinkel, A.H., Mayer, U., Wagenaar, E., Mol, C.A., van Deemter, L., Smit, J.J., van der Valk, M.A., Voordouw, 40 A.C., Spits, H., van Tellingen, O., Zijlmans, J.M., Fibbe, W.E. & Borst, P. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins. Proc. Natl. Acad. Sci. USA 94, 4028-4033 (1997).

29. Uhr, M., Grauer, M.T. & Holsboer, F., Differentiqal Enhancement of Antidepressant Penetration into the Brain of Mice with abcb1ab (mdr1ab) P-Glycoprotein Disruption, Biol. Psych. 34, 840-846 (2003). 45 30. De Luca, V., Mundo, E., Trakalo, J., Wong, G.W.M. & Kennedy, J.L. Investigation of polymorphism in the MDR1 gene and antidepressant-induced mania. Pharmacogenomics J. 3, 297-299 (2003).

31.Marzolini, C., Pans, E., Buchin, T.& Kim,R.B. Polymorphisms inhuman MDR1 (P- glycoprotein): Recent advances 50 and clinical relevance. Clin. Pharmacol. Ther. 75, 13-33 (2004).

SEQUENCE LISTING

[0059] 55 <110> Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V.

<120> Polymorphisms in ABCB1 associated with a lack of clinical res

19 EP 1 756 310 B1

ponse to medicaments

<130> 32791PUS

5 <140> US 60/570, 085 <141> 2004-05-12

<160> 32

10 <170> PatentIn version 3.1

<210> 1 <211> 31 <212> DNA 15 <213> Homo sapiens

<220> <221> misc feature <222> (6)..(9) 20 <223> NM_000927; 86797791 n = a or c or g or t, unknown, or other w = a or t

<400> 1

25

<210> 2 <211> 31 30 <212> DNA <213> Homo sapiens

<220> <221> misc_feature 35 <223> NM_000927; 86763977 r = g or a

<400> 2

40

<210> 3 <211> 31 45 <212> DNA <213> Homo sapiens

<220> <221> misc_feature 50 <223> NM_000927; 86748149 r = g or a

<400> 3

55

<210> 4

20 EP 1 756 310 B1

<211> 31 <212> DNA <213> Homo sapiens

5 <220> <221> misc_feature <223> NM_000927; 86758788 Y = t or c

<400> 4 10

15 <210> 5 <211> 31 <212> DNA <213> Homo sapiens

20 <220> <221> misc_feature <222> (6)..(9) <223> NM_000927; 86731697 n = a or c or g or t, unknown, or other w = a or t

25 <400> 5

30 <210> 6 <211> 31 <212> DNA <213> Homo sapiens 35 <220> <221> misc_feature <223> NM_000927; 86777670 Y = t or c

40 <400> 6

45 <210> 7 <211> 31 <212> DNA <213> Homo sapiens 50 <220> <221> misc_feature <223> NM_000927; 86731143 r = g or a

55 <400> 7

21 EP 1 756 310 B1

5 <210> 8 <211> 30 <212> DNA <213> Artificial

10 <220> <221> misc_feature <223> rs2235015; PCR Primer Forward

<400> 8 15

20 <210> 9 <211> 30 <212> DNA <213> Artificial

25 <220> <221> misc_feature <223> rs2235015; PCR Primer Reversed

<400> 9 30

35 <210> 10 <211> 30 <212> DNA <213> Artificial

40 <220> <221> misc_feature <223> rs2235040; PCR Primer Forward

<400> 10 45

50 <210> 11 <211> 30 <212> DNA <213> Artificial

55 <220> <221> misc_feature <223> rs2235040; PCR Primer Reversed

22 EP 1 756 310 B1

<400> 11

5

<210> 12 <211> 30 <212> DNA 10 <213> Artificial

<220> <221> misc_feature <223> rs2235067; PCR Primer Forward 15 <400> 12

20 <210> 13 <211> 30 <212> DNA <213> Artificial 25 <220> <221> misc_feature <223> rs2235067; PCR Primer Reversed

30 <400> 13

35 <210> 14 <211> 29 <212> DNA <213> Artificial

40 <220> <221> misc_feature <223> rs2032583; PCR Primer Forward

<400> 14 45

50 <210> 15 <211> 30 <212> DNA <213> Artificial

55 <220> <221> misc_feature <223> rs2032583; PCR Primer Reversed

23 EP 1 756 310 B1

<400> 15

5

<210> 16 <211> 30 <212> DNA 10 <213> Artificial

<220> <221> misc_feature <223> rs17064; PCR Primer Forward 15 <400> 16

20

<210> 17 <211> 30 <212> DNA 25 <213> Artificial

<220> <221> misc_feature <223> rs17064; PCR Primer Reversed 30 <400> 17

35 <210> 18 <211> 30 <212> DNA <213> Artificial 40 <220> <221> misc_feature <223> rs2032588; PCR Primer Forward

45 <400> 18

50 <210> 19 <211> 30 <212> DNA <213> Artificial 55 <220> <221> misc_feature <223> rs2032588; PCR Primer Reversed

24 EP 1 756 310 B1

<400> 19

5

<210> 20 <211> 30 <212> DNA 10 <213> Artificial

<220> <221> misc_feature <223> rs1055302; PCR Primer Forward 15 <400> 20

20

<210> 21 <211> 30 <212> DNA 25 <213> Artificial

<220> <221> misc_feature <223> rs1055302; PCR Primer Reversed 30 <400> 21

35

<210> 22 <211> 20 <212> DNA 40 <213> Artificial

<220> <221> misc_feature <223> rs2235015; Extension Primer 45 <400> 22

50

<210> 23 <211> 18 <212> DNA 55 <213> Artificial

<220> <221> misc_feature

25 EP 1 756 310 B1

<223> rs2235040; Extension Primer

<400> 23

5

<210> 24 10 <211> 19 <212> DNA <213> Artificial

<220> 15 <221> misc_feature <223> rs2235067; Extension Primer

<400> 24

20

<210> 25 25 <211> 22 <212> DNA <213> Artificial

<220> 30 <221> misc_feature <223> rs2032583; Extension Primer

<400> 25

35

<210> 26 40 <211> 23 <212> DNA <213> Artificial

<220> 45 <221> misc_feature <223> rs17064; Extension Primer

<400> 26

50

<210> 27 55 <211> 17 <212> DNA <213> Artificial

26 EP 1 756 310 B1

<220> <221> misc_feature <223> rs2032588; Extension Primer

5 <400> 27

10 <210> 28 <211> 19 <212> DNA <213> Artificial 15 <220> <221> misc_feature <223> rs1055302; Extension Primer

20 <400> 28

25 <210> 29 <211> 22 <212> DNA <213> Artificial

30 <220> <221> misc_feature <223> ABCB1; PCR Primer Forward

<400> 29 35

40 <210> 30 <211> 25 <212> DNA <213> Artificial

45 <220> <221> misc_feature <223> ABCB1; PCR Primer Reverse

<400> 30 50

55 <210> 31 <211> 29 <212> DNA <213> Artificial

27 EP 1 756 310 B1

<220> <221> misc_feature <223> rs2235015; Anchor probe

5 <400> 31

10 <210> 32 <211> 25 <212> DNA <213> Artificial 15 <220> <221> misc_feature <223> Sensor [G]; Sensor probe

20 <400> 32

25

Claims 30 1. An in vitro method for determining the prognosis of a clinical response in a human patient to a central nervous system (CNS)-active medicament which is a substrate of the ABCB1 protein wherein the presence of at least one polymorphism in the ABCB1 gene of said patient is determined wherein said polymorphism is associated with a delayed, partial, sub-optimal or lacking clinical response to said medicament, wherein the polymorphism is located 35 within exon 29, intron 5, 13, 21, 22 or 23 or the 3’UTR sequence of the human ABCB1 gene.

2. The method of claim 1, wherein the polymorphism is selected from the group consisting of rs 2235015, rs 2235040, rs 2235067, rs 2032583, rs 17064, rs2032588, rs 1055302 and combinations thereof.

40 3. The method of claim 2 wherein the polymorphism is rs 2235015 or rs 2235040.

4. The method of claim 3 wherein the polymorphism is rs 2235015.

5. The method of any one of claims 1-4 wherein the polymorphism is determined by a genotyping analysis. 45 6. The method of claim 5 wherein the genotyping analysis comprises the use of polymorphism- specific primers and/or probes.

7. The method of claim 6 wherein the genotyping analysis comprises a primer extension reaction. 50 8. The method of claim 6 or 7, wherein the primers and/or probes comprise at least one sequence as shown in Tables 3, 4 and 5.

9. The method of any one of claims 6-8 wherein the genotyping analysis comprises a microarray analysis. 55 10. The method of any one of claims 6-8 wherein the genotyping analysis comprises a mass- spectrometric analysis.

11. The method of any one of claims 1-10 wherein the medicament selected from the group consisting of antidepressants,

28 EP 1 756 310 B1

anxiolytics, hypnotics, cognitive enhancers, antipsychotics, neuroprotective agents, antiemetics, antiepileptics, an- tibiotics, anticancer agents, antimycotics, antiparkinson agents, antiviral agents, glucocorticoids, immunosuppres- sants, statins, neuroleptics, and opioids.

5 12. The method of claim 11 wherein the medicament is an antidepressant.

13. The method of claim 12 wherein the antidepressant is citalopram, venlafaxine and/or paroxetine.

14. A therapeutic composition or therapeutic kit for use in a method of treatment of a human patient having at least one 10 polymorphism in the ABCB1 gene, which is associated with a delayed, partial,sub-optimal or lacking clinical response to a CNS-active medicament and wherein the polymorphism is located within exon 29, intron 5, 13, 21-23 or the 3’UTR sequence of the human ABCB1 gene, and wherein the method of treatment comprises:

determining the prognosis of a clinical response in the human patient according to the method of claim 1, 15 and wherein the therapeutic composition or therapeutic kit comprises:

(a) a CNS-active medicament which is a substrate of the ABCB1 protein selected from antidepressants, anxiolytics,hypnotics, cognitive enhancers, antipsychotics, antiemetics, antiepileptics, antparkinson agents, neuroleptics, and opioids; and 20 (b) a further medicament which is an inhibitor of the ABCB1 protein.

15. The therapeutic composition or therapeutic kit according to claim 14, wherein antidepressants are selected from amitriptyline, citalopram, doxepine, flesinoxan, nortriptyline, paroxetine, trimipramine, and venlafaxine, anxiolytics are selected from alprazolam, bromazepam, clonazepam, diazepam, iorazepam, halazepam, chlordiazepoxide, 25 buspirone, azapirone, pagoclone, prazosin, biperiden and kava kava, hypnotics are selected from secobarbital, pentobarbital, methaqualone, ethchlorvynol, chloral hydrate and mebrobamate, cognitive enhancers are selected from acetyl L-carnitine, adrafinil, aniracetam, deprenyl, galantamine, hydergine, idebenone, modafinil, picamilon, piracetam, pyritinol, vasopressin and vinpocetine, antipsychotics are selected from risperidon, olanzapine, quetiap- ine, ziprasidone, chlorpromazine, fluphenazine, trifluoperazine, perphenazine, thioridazine, holoperidol, thiothixene, 30 molindone, loxapine, clozapine, olanzapine, quetiapine, risperidone, sertindole, ziprasidone, amisulpid, aripriprazol, benperidol, chlorpromazine, chlorprothixen, flupentixol, fluspirilen, levomepromazin, benperidol, melperon, perazin, perphenazin, pimozid, pipamperon, sulpirid, triflupromazin, zotepin and zuclopenthixol, antiemetics are selected from domperidone and ondansetron, antiepileptics are selected from carbamazepine, felbamate, lamotrigin, phe- nobarbita and phenytoin, antiparkinson agents are selected from budipin and L-Dopa, neuroleptics are selected 35 from olanzapine, quetiapine, risperidone and sulpiride, and/or opioids are selected from fentanyl and morphine.

Patentansprüche

40 1. In vitro-Verfahren zur Bestimmung der Prognose von einem klinischen Ansprechen in einem humanen Patienten auf ein Zentralnervensystem (ZNS)-aktives Medikament, welches ein Substrat von dem ABCB1- Protein ist, wobei die Gegenwart von mindestens einem Polymorphismus in dem ABCB1- Gen von diesem Patienten bestimmt wird, wobei der Polymorphismus mit einem verspäteten, teilweisen, suboptimalen oder fehlenden klinischen Ansprechen auf das Medikament verbunden ist, wobei der Polymorphismus innerhalb von Exogen 29, Intron 5, 13, 21, 22 oder 45 23 oder der 3’-UTR-Sequenz des humanen ABCB1-Gens lokalisiert ist.

2. Verfahren nach Anspruch 1, wobei der Polymorphismus von der Gruppe bestehend aus rs 2235015, rs 2235040, rs 2235067, rs 2032583, rs 17064, rs 2032588, rs 1055302 und Kombinationen davon ausgewählt wird.

50 3. Verfahren nach Anspruch 2, wobei der Polymorphismus rs 2235015 oder rs 2235040 ist.

4. Verfahren nach Anspruch 3, wobei der Polymorphismus rs 2235015 ist.

5. Verfahren nach einem der Ansprüche 1-4, wobei der Polymorphismus durch eine Genotypisierungsanalyse bestimmt 55 wird.

6. Verfahren nach Anspruch 5, wobei die Genotypisierungsanalyse die Verwendung von Polymorphismus- spezifischen Primern und/oder Sonden umfasst.

29 EP 1 756 310 B1

7. Verfahren nach Anspruch 6, wobei die Genotypisierungsanalyse eine primer extension reaction umfasst.

8. Verfahren nach Anspruch 6 oder 7, wobei die Primer und/ oder Sonden mindestens eine Sequenz, wie in den Tabellen 3, 4 und 5 gezeigt, umfasst. 5 9. Verfahren nach einem der Ansprüche 6-8, wobei die Genotypisierungsanalyse eine Mikroarrayanalyse umfasst.

10. Verfahren nach einem der Ansprüche 6-8, wobei die Genotypisierungsanalyse eine massenspektrometrische Ana- lyse umfasst. 10 11. Verfahren nach einem der Ansprüche 1-10, wobei das Medikament ausgewählt wird aus der Gruppe bestehend aus Antidepressiva, Anxiolytika, Hypnotika, kognitiven Verstärker (cognitive enhancer), Antipsychotika, neuropro- tektiven Mitteln, Antiemetika, Antiepileptika, Antibiotika, Antikrebsmittel, Antimykotika, Anti-Parkinson-Mitteln, anti- viralen Mitteln, Glucocorticoiden, Immunosuppressiva, Statinen, Neuroleptika und Opioiden. 15 12. Verfahren nach Anspruch 11, wobei das Medikament ein Antidepressivum ist.

13. Verfahren nach Anspruch 12, wobei das Antidepressivum Citalopram, Venlafaxin und/ oder Paroxetin ist.

20 14. Therapeutische Zusammensetzung oder therapeutisches Kit zur Verwendung in einem Verfahren zur Behandlung von einem humanen Patienten, welcher mindestens einen Polymorphismus in dem ABCB1- Gen aufweist, welcher mit einem verspäteten, teilweisen, suboptimalen oder fehlenden klinischen Ansprechen auf ein ZNS- aktives Medi- kament verbunden ist, und wobei der Polymorphismus innerhalb von Exon 29, Intron 5, 13, 21-23 oder der 3’- UTR- Sequenz von dem humanen ABCB1-Gen lokalisiert ist und wobei das Verfahren zur Behandlung umfasst: 25 Bestimmen der Prognose von einem klinischen Ansprechen in dem humanen Patienten nach dem Verfahren von Anspruch 1, und wobei die therapeutische Zusammensetzung oder das therapeutische Kit umfasst:

30 (a) ein ZNS-aktives Medikament, welches ein Substrat von dem ABCB1- Protein ist, ausgewählt aus Anti- depressiva, Anxiolytika, Hypnotika, kognitiven Verstärker, Antipsychotika, Antiemetika, Antiepileptika, Anti- Parkinson-Mitteln, Neuroleptika und Opioiden; und (b) ein weiteres Medikament, welches ein Inhibitor von dem ABCB1- Protein ist.

35 15. Therapeutische Zusammensetzung oder therapeutisches Kit nach Anspruch 14, wobei Antidepressiva ausgewählt werden aus Amitriptylin, Citalopram, Doxepin, Flesinoxan, Nortriptylin, Paroxetin, Trimipramin und Venlafaxin, An- xiolytika ausgewählt werden aus Alprazolam, Bromazepam, Clonazepam, Diazepam, , Halazepam, Chl- ordiazepoxid, Buspiron, Azapiron, Pagoclon, Prazosin, Biperiden und Kava Kava, Hypnotika ausgewählt werden aus Secobarbital, Pentobarbital, Methaqualon, Ethchlorvynol, Chloralhydrat und Mebrobamat, kognitive Verstärker 40 ausgewählt werden aus Acetyl-L-Carnitin, Adrafinil, Aniracetam, Deprenyl, Galantamin, Hydergin, Idebenon, Mo- dafinil, Picamilon, Piracetam, Pyritinol, Vasopressin und Vinpocetin, Antipsychotika ausgewählt werden aus Rispe- ridon, Olanzapin, Quetiapin, Ziprasidon, Chlorpromazin, Fluphenazin, Trifluoperazin, Perphenazin, Thioridazin, Hol- operidol, Thiothixen, Molindon, Loxapin, Clozapin, Olanzapin, Quetiapin, Risperidon, Sertindol, Ziprasidon, Amisul- pid, Aripriprazol, Benperidol, Chlorpromazin, Chlorprothixen, Flupentixol, Fluspirilen, Levemepromazin, Benperidol, 45 Melperon, Perazin, Perphenazin, Pimozid, Pipamperon, Sulpirid, Triflupromazin, Zotepin und Zuclopenthixol, An- tiemetika ausgewählt werden aus Domperidon und Ondansetron, Antieleptika ausgewählt werden aus Carbama- zepin, Felbamat, Lamotrigin, Phenobarbita und Phenytoin, Anti-Parkinson-Mittel ausgewählt werden aus Budipin und L-Dopa, Neuroleptika ausgewählt werden aus Olanzapin, Quetiapin, Risperidon und Sulpirid und/ oder Opioide ausgewählt werden aus Fentanyl und Morphin. 50

Revendications

1. Procédé in vitro pour la détermination du pronostic d’une réponse clinique chez un patient humain à un médicament 55 actif au niveau du système nerveux central (SNC) qui est un substrat de la protéine ABCB1 dans lequel la présence d’au moins un polymorphisme dans le gène ABCB1 dudit patient est déterminé dans lequel ledit polymorphisme est associé à une réponse clinique retardée, partielle, sous- optimale ou absente audit médicament, dans lequel le polymorphisme est localisé dans l’exon 29, l’intron 5, 13, 21, 22 ou 23 ou la séquence 3’UTR du gène humain ABCB1.

30 EP 1 756 310 B1

2. Procédé selon la revendication 1, dans lequel le polymorphisme est sélectionné dans le groupe constitué de rs 2235015, rs 2235040, rs 2235067, rs 2032583, rs 17064, rs 2032588, rs 1055302 et des combinaisons de ceux- ci.

3. Procédé selon la revendication 2, dans lequel le polymorphisme est rs 2235015 ou rs 2235040. 5 4. Procédé selon la revendication 3, dans lequel le polymorphisme est rs 2235015.

5. Procédé selon l’une quelconque des revendications 1-4, dans lequel le polymorphisme est déterminé par une analyse de génotypage. 10 6. Procédé selon la revendication 5, dans lequel l’analyse de génotypage comprend l’utilisation d’amorces et/ou de sondes spécifiques du polymorphisme.

7. Procédé selon la revendication 6, dans lequel l’analyse de génotypage comprend une réaction d’extension d’amorce. 15 8. Procédé selon la revendication 6 ou 7, dans lequel les amorces et/ou sondes comprennent au moins une séquence comme montrée dans les tableaux 3, 4 et 5.

9. Procédé selon l’une quelconque des revendications 6-8, dans lequel l’analyse de génotypage comprend une analyse 20 de microréseau.

10. Procédé selon l’une quelconque des revendications 6-8, dans lequel l’analyse de génotypage comprend une analyse de spectrométrie de masse.

25 11. Procédé selon l’une quelconque des revendications 1-10, dans lequel le médicament est sélectionné dans le groupe constitué des antidépresseurs, des anxiolytiques, des hypnotiques, des stimulants des fonctions cognitives, des antipsychotiques, des agents neuroprotecteurs, des antiémétiques, des antiépileptiques, des antibiotiques, des agents anticancéreux, des antimycotiques, des agents antiparkinsoniens, des agents antiviraux, des glucocorticoï- des, des immunosuppresseurs, des statines, des neuroleptiques et des opioïdes. 30 12. Procédé selon la revendication 11 dans lequel le médicament est un antidépresseur.

13. Procédé selon la revendication 12 dans lequel l’antidépresseur est le citalopram, la venlafaxine et/ou la paroxétine.

35 14. Composition thérapeutique ou trousse thérapeutique pour l’utilisation dans un procédé de traitement d’un patient humain ayant au moins un polymorphisme dans le gène ABCB1, qui est associé à une réponse clinique retardée, partielle, sous-optimale ou absente à un médicament actif au niveau du SNC et dans laquelle le polymorphisme est localisé dans l’exon 29, l’intron 5, 13, 21-23 ou la séquence 3’UTR du gène humain ABCB1, et dans laquelle le procédé de traitement comprend : 40 la détermination du pronostic d’une réponse clinique chez le patient humain selon le procédé de la revendication 1, et dans laquelle la composition thérapeutique ou la trousse thérapeutique comprend :

45 (a) un médicament actif au niveau du SNC qui est un substrat de la protéine ABCB1 sélectionné parmi des antidépresseurs, des anxiolytiques, des hypnotiques, des stimulants des fonctions cognitives, des antip- sychotiques, des antiémétiques, des antiépileptiques, des agents antiparkinsoniens, des neuroleptiques et des opioïdes ; et (b) un autre médicament qui est un inhibiteur de la protéine ABCB1. 50 15. Composition thérapeutique ou la trousse thérapeutique selon la revendication 14 dans laquelle les antidépresseurs sont sélectionnés parmi l’amitriptyline, le citalopram, la doxépine, le flésinoxan, la nortriptyline, la paroxétine, la trimipramine et la venlafaxine, les anxiolytiques sont sélectionnés parmi l’alprazolam, le bromazépam, le clonazé- pam, le diazépam, l’iorazépam, l’halazépam, le chlordiazépoxide, la buspirone, l’azapirone, le pagoclone, la prazo- 55 sine, le bipéridène et le kava kava, les hypnotiques sont sélectionnés parmi le sécobarbital, le pentobarbital, la méthaqualone, l’ethchlorvynol, l’hydrate de chloral et le méprobamate, les stimulants des fonctions cognitives sont sélectionnés parmi l’acétyle L-carnitine (ALCAR), l’adrafinil, l’aniracétam, le déprényl, la galantamine, l’hydergine, l’idébénone,le modafinil,le picamilon, lepiracétam, le pyritinol,la vasopressine etla vinpocétine,les antipsychotiques

31 EP 1 756 310 B1

sont sélectionnés parmi la rispéridone, l’olanzapine, la quétiapine, la ziprasidone, la chlorpromazine, la fluphénazine, la trifluopérazine, la perphénazine, la thioridazine, l’holopéridol, le thiothixène, la molindone, la loxapine, la clozapine, l’olanzapine, la quétiapine, la rispéridone, le sertindole, la ziprasidone, l’amisulpride, l’aripriprazol, le benpéridol, la chlorpromazine, le chlorprothixène, le flupentixol, le fluspirilène, la lévomépromazine, le benpéridol, le melpéron, 5 la pérazine, la perphénazine, le pimozide, le pipampéron, le sulpiride, la triflupromazine, la zotépine et le zuclopen- thixol, les antiémétiques sont sélectionnés parmi la dompéridone et l’ondansétron, des antiépileptiques sont sélec- tionnés parmi la carbamazépine, le felbamate, la lamotrigine, le phénobarbital et la phénytoïne, les agents antipar- kinsoniens sont sélectionnés parmi la budipine et la L- dopa, les neuroleptiques sont sélectionnés parmi l’olanzapine, la quétiapine, la rispéridone et le sulpiride, et/ou les opioïdes sont sélectionnés parmi le fentanyle et la morphine. 10

15

20

25

30

35

40

45

50

55

32 EP 1 756 310 B1

33 EP 1 756 310 B1

34 EP 1 756 310 B1

35 EP 1 756 310 B1

36 EP 1 756 310 B1

REFERENCES CITED IN THE DESCRIPTION

This list of references cited by the applicant is for the reader’s convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description

• WO 0109183 A [0005] • US 20030073713 A1 [0024] • US 20010034023 A [0005] • US 60570085 A [0059]

Non-patent literature cited in the description

• SCHATZBERG ; NEMEROFF. The American Psy- • AMBUDKAR, S.V.; DEY, S.; HRYCYNA, C.A. ; chiatric Publishing Textbook of Psychopharmacolo- RAMACHANDRA, M. ; PASTAN, I. ; GOTTESMAN, gy. Amer Psychiatric Pr, 2004 [0016] M.M. Biochemical, cellular, and pharmacological as- • HAM-D ; HAMILTON. Br. J. Soc. Clin. Psychol., pects of the multidrug transporter. Annu. Rev. Phar- 1967, vol. 6, 278-296 [0021] macol. Toxicol., 1999, vol. 39, 361-398 [0058] • HEUSER et al. J. Psychiat. Res., 1994, vol. 28, • CALLEN, D.F. ; BAKER, E. ; SIMMERS, R.N. ; SE- 341-356 [0021] SHADRI, R. ; RONINSON, I.B. Localization of the • RYBAKOWSKI ; TWARDOWSKA. J. Psychiat. human multiple drug resistance gene, MDR1, to Res., 1999, vol. 33, 363-370 [0021] 7q21.1. Hum. Genet., 1987, vol. 77, 142-144 [0058] • ZOBEL et al. J. Psychiat. Res., 2001, vol. 35, 83-94 • CHIN, J.E. ; SOFFIR, R. ; NOONAN, K.E. ; CHOI, [0021] K. ; RONINSON, I.B. Structure and expression of the • KÜNZEL et al. Neuropsychopharmacology, 2003, human MDR (P-glycoprotein) gene family. Mol. Cell vol. 28, 2169-2178 [0021] Biol, 1989, vol. 9, 3808-3820 [0058] • HEUSER et al. J. Psychiat. Res, 1994, vol. 28, • SCHINKEL, A.H. ; WAGENAAR, E. ; MOL, C.A. ; 341-356 [0021] VAN DEEMTER, L. P-glycoprotein in the blood-brain • MARZOLINI C et al. Clin Pharmacol Ther., January barrier of mice influences the brain penetration and 2004, vol. 75 (1), 13-33 [0024] pharmacological activity of many drugs. J. Clin. In- • BENKERT ; HIPPIUS. Kompendium der Psychia- vest., 1996, vol. 97, 2517-2524 [0058] trischen Pharmakotherapie. Springer Verlag Publish- • UHR, M. ; HOLSBOER, F. ; MÜLLER, M.B. Pene- ing, 2000 [0030] tration of endogenous steroid hormones corticoster- • ALBERS. Handbook of Psychiatric Drugs: one, cortisol, aldosterone and progesterone into the 2001-2002 Edition. Current Clinical Strategies Pub- brain is enhanced in mice deficient for both mdr1a lishing, 2000 [0030] and mdr1b P-glycoproteins.J. Neuroendocrinol., • LEWONTIN R.C. On Measures of Gametic Disequi- 2002, vol. 14, 753-759 [0058] librium. Genetics, November 1988, vol. 120, 849-852 • DEVAULT, A. ; GROS, P. Two members of the [0047] mouse mdr gene family confer multidrug resistance • ABECASIS GR ; COOKSON WO. GOLD--graphical with overlapping but distinct drug specificities.Mol. overview of linkage disequilibrium.Bioinformatics, Cell Biol., 1990, vol. 10, 1652-1663 [0058] 2000, vol. 16, 182-3 [0047] • MEIJER, O.C. ; DE LANGE, E.C. ; BREIMER, D.D. ; • THASE, M.E. Overview of antidepressant therapy. DE BOER, A.G. ; WORKEL, J.O. ; DE KLOET, E.R. Manag. Care, 2001, vol. 10, 6-915-22 [0058] Penetration of dexamethasone into brain glucocorti- • CORDON-CARDO, C. ; O’BRIEN, J.P. ; CASALS, coid targets is enhanced in mdr1A P-glycoprotein D. ; RITTMAN-GRAUER, L. ; BIEDLER, J.L. ; knockout mice. Endocrinology, 1998, vol. 139, MELAMED, M.R. ; BERTINO, J.R. Multidrug-resist- 1789-1793 [0058] ance gene (P-glycoprotein) is expressed by endothe- • VAN DE VRIE, W. ; MARQUET, R.L. ; STOTER, G. ; lial cells at blood-brain barrier sites. Proc. Natl. Acad. DE BRUIJN, E.A. ; EGGERMONT, A.M. In vivo mod- Sci. USA, 1989, vol. 86, 695-698 [0058] el systems in P-glycoprotein-mediated multidrug re- • THIEBAUT, F. ; TSURUO, T. ; HAMADA, H. ; sistance. Crit. Rev. Clin. Lab. Sci., 1998, vol. 35, 1-57 GOTTESMAN, M.M. ; PASTAN, I. ; WILLINGHAM, [0058] M.C. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tis- sues. Proc. Natl. Acad. Sci. USA, 1987, vol. 84, 7735-7738 [0058]

37 EP 1 756 310 B1

• UHR, M. ; GRAUER, M.T. ; HOLSBOER, F. Differ- • CASCORBI, I. ; GERLOFF, T. ; JOHNE, A. ; MEI- ential enhancement of antidepressant penetration in- SEL, C. ; HOFFMEYER, S. ; SCHWAB, M. ; to the brain in mice with abcb1ab (mdr1ab) P-glyco- SCHAEFFELER, E. ; EICHELBAUM, M. ; BRINK- protein gene disruption. Biol. Psychiatry, 2003, vol. MANN, U. ; ROOTS, I. Frequency of single nucle- 54, 840-846 [0058] otidepolymorphisms in theP-glycoprotein drug trans- • KROETZ, D.L. ; PAULI-MAGNUS, C. ; HODGES, porter MDR1 gene in white subjects. Clin.Pharmaco/. L.M. ; HUANG, C.C. ; KAWAMOTO, M. ; JOHNS, Ther., 2001, vol. 69, 169-174 [0058] S.J. ; STRYKE, D. ; FERRIN, T.E. ; DEYOUNG, J. ; • TANABE, M. ; LEIRI, I. ; NAGATA, N. ; INOUE, K. ; TAYLOR, T. Sequence diversity and haplotype struc- ITO, S. ; KANAMORI, Y. ; TAKAHASHI, M. ; KURA- ture in the human ABCB1 (MDR1, multidrug resist- TA, Y. ; KIGAWA, J. ; HIGUCHI, S. Expression of ance transporter) gene. Pharmacogenetics, 2003, P-glycoprotein in human placenta: relation to genetic vol. 13, 481-494 [0058] polymorphism of the multidrug resistance (MDR)-1 • SIDDIQUI, A. ; KERB, R. ; WEALE, M.E. ; BRINK- gene. J. Pharmacol. Exp. Ther., 2001, vol. 297, MANN,U. ; SMITH, A. ; GOLDSTEIN,D.B. ; WOOD, 1137-1143 [0058] N.W. ; SISODIYA, S.M. Association of multidrug re- • KIM, R.B. ; LEAKE, B.F. ; CHOO, E.F. ; DRESSER, sistance in epilepsy with a polymorphism in the G.K. ; KUBBA, S.V. ; SCHWARZ, U.I. ; TAYLOR, drug-transporter gene ABCB1. N. Engl. J. Med., A. ; XIE, H.G. ; MCKINSEY, J. ; ZHOU, S. Identifi- 2003, vol. 348, 1442-1448 [0058] cationof functionally variant MDR1alleles among Eu- • SAKAEDA, T. ; NAKAMURA, T. ; OKUMURA K. ropean Americans and African Americans.Clin. Pharmacogenetics of MDR1 and its impact on the Pharmacol. Ther., 2001, vol. 70, 189-199 [0058] pharmacokinetics and pharmacodynamics of drugs. •ROBERTS,R.L.; JOYCE, P.R. ; MULDER, R.T. ; Pharmacogenomics, 2003, vol. 4, 397-410 [0058] BEGG, E. ; KENNEDY, M.A. A common P-glycopro- • BRINKMANN, U. Functional polymorphisms of the tein polymorphism is associated with nortriptyline-in- human multidrug resistance (MDR1) gene: correla- duced postural hypotension in patients treated for tion with P glycoprotein expression and activity in vi- major depression. Pharmacogenomics J., 2002, vol. vo. Novartis Found. Symp., 2002, vol. 243, 207-212 2, 191-196 [0058] [0058] • UHR, M. ; GRAUER, M.T. abcb1ab P-glycoprotein is • KIOKA, N. ; TSUBOTA, J. ; KAKEHI, Y. ; involved in the uptake of citalopram and trimipramine KOMANO, T. ; GOTTESMAN, M.M. ; PASTAN, I. ; into the brain of mice. J. Psychiatric Res., 2003, vol. UEDA, K. P-glycoprotein gene (MDR1) cDNA from 37, 179-185 [0058] human adrenal: normal P-glycoprotein carries• UHR, M.; STECKLER, T. ; YASSOURIDIS, A. ; Gly185 with an altered pattern of multidrug resist- HOLSBOER, F. Penetration of amitriptyline, but not ance. Biochem. Biophys. Res Commun., 1989, vol. of fluoxetine, into brain is enhanced in mice with 162, 224-231 [0058] blood-brain-barrier deficiency due to Mdr1a P-glyco- •STEIN,U.; WALTHER, W. ; WUNDERLICH, V. protein gene disruption. Neuropsychopharmacology, Point mutations in the mdr1 promoter of human os- 2000, vol. 22, 380-387 [0058] teosarcomas are associated with in vitro responsive- • SCHINKEL, A.H. ; MAYER, U. ; WAGENAAR, E. ; ness to multidrug resistance relevant drugs. Eur. J. MOL, C.A. ; VAN DEEMTER, L. ; SMIT, J.J. ; VAN Cancer, 1994, vol. 30A, 1541-1545 [0058] DER VALK, M.A. ; VOORDOUW, A.C. ; SPITS, H. ; • MICKLEY, L.A. ; LEE, J.S. ; WENG, Z. ; ZHAN, Z. ; VAN TELLINGEN, O. Normal viability and altered ALVAREZ, M. ; WILSON, BATES, S.E. ; FOJO, T. pharmacokinetics in mice lacking mdr1-type Genetic polymorphism in MDR-1: a tool for examining (drug-transporting) P-glycoproteins. Proc. Natl. allelic expression in normal cells, unselected and Acad. Sci. USA, 1997, vol. 94, 4028-4033 [0058] drug-selected cell lines, and human tumors. Blood, • UHR, M. ; GRAUER, M.T. ; HOLSBOER, F. Differ- 1998, vol. 91, 1749-1756 [0058] entiqal Enhancement of Antidepressant Penetration • HOFFMEYER, S. ; BURK, O. ; VON RICHTER, O. ; into the Brain of Mice with abcb1ab (mdr1ab) P-Glyc- ARNOLD, H.P. ; BROCKMOLLER, J. ; JOHNE, A. ; oprotein Disruption. Biol. Psych., 2003, vol. 34, CASCORBI, I. ; GERLOFF, T. ; ROOTS, I. ; 840-846 [0058] EICHELBAUM, M. Functional polymorphisms of the • DE LUCA, V. ; MUNDO, E. ; TRAKALO, J. ; WONG, human multidrug-resistance gene: multiple se- G.W.M. ; KENNEDY, J.L. Investigation of polymor- quence variations and correlation of one allele with phism in the MDR1 gene and antidepressant-induced P-glycoprotein expression and activity in vivo. Proc. mania. Pharmacogenomics J., 2003, vol. 3, 297-299 Natl.Acad. Sci. USA, 2000, vol. 97, 3473-3478 [0058] [0058] •ITO,S.; LEIRI, I. ; TANABE, M.; SUZUKI, A. ; • MARZOLINI, C. ; PANS, E. ; BUCHIN, T. ; KIM, R.B. HIGUCHI, S. ; OTSUBO, K. Polymorphism of the Polymorphisms in human MDR1 (P-glycoprotein): ABC transporter genes, MDR1, MRP1 and Recent advances and clinical relevance. Clin. Phar- MRP2/cMOAT, in healthy Japanese subjects. Phar- macol. Ther., 2004, vol. 75, 13-33 [0058] macogenetics, 2001, vol. 11, 175-184 [0058]

38