Appendix B Characterization of the Thp-1 Cell Line with Respect to Hiv-1

FUNCTIONAL GENOMIC AND PROTEOMIC PROFILES OF MACROPHAGE RESERVOIRS FOR HUMAN IMMUNODEFICIENCY VIRUS TYPE-1

JOSEPH NICHOLS BROWN

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007

To my fiancée, Roslyn Frank, my mother, Darnell Brown, and my father, George Brown.

ACKNOWLEDGMENTS

I have had an outstanding graduate experience at the University of Florida College of

Medicine, and for this I must thank my excellent mentor, Dr. Maureen M. Goodenow. Through

her guidance, I learned much, especially to enjoy learning and science. Great thanks should also

be given to all of my committee members Dr. Henry Baker, Dr. Ayalew Mergia, Dr. William

Farmerie, Dr. David Ostrov, Dr. Gregory Schultz, and Dr. Peggy Wallace, who have always

been available and supportive. Dr. James Kohler, a former post-doc in the lab, has been

instrumental in much of the work presented here, and has been an outstanding mentor, providing

training, encouragement, and friendship during my graduate career. Dr. Li Yin, an assistant professor in the lab, has provided invaluable support and guidance. I would also like to acknowledge Cecilia Lopez who helped me with the microarrays and functional genomics. I greatly appreciate Bhavna Bhardwaj and Neal Benson at the UF Flow Cytometry Core for all their help and patience. Dr. Jeremiah Tipton at Scripps Florida deserves many thanks for his work performing the iTRAQ experiments and the many hours he provided teaching about mass spectrometry. I would also like to thank Brian Krastins and Dr. David Sarracino at Harvard

University Proteomics Core for their helpfulness and work performing the mass spectrometry on the 1D gel slices. Lauren McIntyre deserves great thanks for all her work performing the statistical analyses on the gp120 microarrays. Finally, I would like to thank UF Shand’s Cancer

Center for providing a generous amount of funding that made much of this research possible.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES...... 9

LIST OF FIGURES ...... 11

CHAPTER

1 INTRODUCTION ...... 15

1.1 Rationale ...... 15 1.2 Specific Aims...... 16 1.2.1 Analyze the Global Genetic and Proteomic Networks Perturbed by HIV-1 Infection in Macrophages ...... 16 1.2.2 Determine Functional Impact of Viral Envelope-mediated Coreceptor Usage on Macrophages...... 17 1.3 Background...... 17 1.3.1 Physical Characteristics of the Human Immunodeficiency Virus Type-1 (HIV-1) Virion...... 17 1.3.2 Differences in the HIV-1 Lifecycle between T-lymphocytes and Macrophages...... 19 1.3.2.1 HIV-1 entry ...... 19 1.3.2.2 Reverse transcription and nuclear translocation...... 20 1.3.2.3 Proviral integration and expression...... 22 1.3.2.4 Viral assembly and release...... 22 1.3.3 Phenotypic Characterization of HIV-1 Isolates ...... 23 1.3.4 Cellular Signal Transduction Cascades Activated by HIV...... 24 1.3.5 Influence of Cellular Factors on HIV infection ...... 26 1.3.6 Acquired Immunodeficiency Syndrome and Related Malignancies ...... 27 1.3.7 Functional Genomics and HIV ...... 28 1.3.8 Proteomics and HIV...... 30

2 IMPACT ON GENETIC NETWORKS IN HUMAN MACROPHAGES BY HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 ...... 37

2.1 Introduction...... 37 2.2 Experimental Design...... 38 2.3 Results...... 38 2.3.1 Viral Replication and Spread in Monocyte-derived Macrophage (MDM) Cultures...... 38 2.3.2 Temporal Expression of Genes in HIV-treated Macrophage Cultures...... 39 2.3.3 Genes Expressed Exclusively in Virus-treated or Mock-treated Macrophage Cultures...... 40 2.3.4 Functional Categories of Genes Modulated by HIV...... 40

2.3.5 HIV Impacts Similar Genes in Lymphocytes and Macrophages...... 41 2.3.6 HIV-1 Impact on Genes Involved in Regulation of the Cell Cycle in Macrophage Cultures...... 42 2.3.7 Qualitative Identification of Genes Involved in Cell Cycle Regulation Checkpoints...... 42 2.3.8 Altered Protein Expression in Macrophages Treated with Virus...... 43 2.4 Discussion...... 44

3 NETWORK ANALYSIS REVEALS HIV-1 ACTIVATES MACROPHAGES INDEPENDENT OF TOLL-LIKE RECEPTORS ...... 59

3.1 Introduction...... 59 3.2 Experimental Design...... 60 3.3 Results...... 61 3.3.1 Temporal Expression of Genes in HIV-treated Macrophages...... 61 3.3.2 HIV Activates Genes Involved in Calcium Signaling...... 62 3.3.3 Temporal Activation of Apoptotic Signaling Pathways by HIV in Macrophages...... 63 3.3.4 HIV Activates the Mitogen-activated Protein Kinase (MAPK) Pathway...... 63 3.3.5 HIV Induces Expression and Secretion of Type-2 Cytokines/Chemokines in Macrophages...... 64 3.3.6 Activation of Macrophages is Independent of Cell Proliferation...... 65 3.3.7 HIV Activates Macrophages Independent of Toll-like Receptors (TLR)...... 65 3.4 Discussion...... 67

4 COMPARATIVE METHODS OF PROTEOMIC PROFILING of PRIMARY MACROPHAGES: IDENTIFICATION OF THE MACROPHAGE ANTIVIRAL FACTOR...... 83

4.1 Introduction...... 83 4.2 Experimental Design...... 84 4.3 Results...... 85 4.3.1 Lipopolysaccharide Stimulation of Macrophages Inhibits HIV Replication.....85 4.3.2 Lipopolysaccharide-primed Macrophages Secrete Products Important in Controlling Virus...... 85 4.3.3 Tandem Mass Spectrometry Identification of a Unique High Molecular Weight Band in Lipopolysaccharide-primed Macrophage Supernatants...... 87 4.3.4 Quantitative Intracellular Proteome Analysis of Macrophages via Isotope- coded Labeling of Peptides...... 88 4.3.5 Quantitative Intracellular Proteome Analysis of Unlabeled Macrophage Proteins...... 89 4.3.5.1 Proteins altered by lipopolysaccharide within 24 hours...... 90 4.3.5.2 Proteins altered by interferon-γ within 24 hours...... 90 4.4 Discussion...... 90

5 DISTINCT GENE EXPRESSION PROFILES IN MACROPHAGES IN RESPONSE TO PHENOTYPICALLY DIFFERENT VIRAL ENVELOPES...... 101

5.1 Introduction...... 101 5.2 Experimental Design...... 102 5.3 Results...... 102 5.3.1 Quality Control of GeneChip Experiments...... 102 5.3.2 Macrophage Gene Expression Profile Altered by Macrophage-tropic Chemokine (C-C motif) Receptor 5-utilizing Virus-treated within 15 Hours...... 104 5.3.3 Identification of a unique gene altered in expression by viral envelope...... 104 5.4 Discussion...... 105

6 SUMMARY AND CONCLUSIONS...... 111

6.1 Project Summary...... 111 6.2 Functional Genomic and Proteomic Characterization of Macrophage Reservoirs for HIV-1...... 114 6.3 Insights and Future Directions...... 117 6.3.1 Cell Cycle Proliferation and Culture Microenvironments in Primary Macrophages and HIV-1 Infection ...... 117 6.3.2 HIV-1 Evasion or Suppression of MyD-88 Independent Toll-like Receptor Signaling ...... 120

APPENDIX

A METHODS AND MATERIALS ...... 123

A.1 Preparation of Viral Stocks...... 123 A.2 Preparation of RosetteSep-isolated Monocytes...... 123 A.3 Preparation of Elutriated Monocytes ...... 125 A.5 Preparation of THP-1 cells...... 125 A.6 Treatment of Cells...... 126 A.7 RNA Isolation and Hybridization...... 126 A.8 RNA Data Analysis...... 127 A.9 Protein Extraction and PowerBlot Screening...... 128 A.10 Western Blots...... 129 A.11 Secreted Cytokine Determination...... 129 A.12 Cell Proliferation Assays...... 130 A.13 Envelope Treatment of Monocyte-derived Macrophages...... 130 A.14 RNA Isolation and Hybridization from gp120-treated Monocyte-derived Macrophages...... 131 A.15 Harvesting of Lipopolysaccharide-primed Monocyte-derived Macrophage Supernatant Proteins ...... 132 A.16 Single-cycle Viral Infections in Lipopolysaccharide-primed Monocyte- derived Macrophage Supernatants...... 132 A.17 Precipitation and Separation of Lipopolysaccharide-primed Supernatant Proteins...... 133 A.18 Coomassie Staining of Protein Gel...... 133 A.19 Preparation of Proteins for iTRAQ Labeling...... 133

A.20 Preparation of Proteins for 1-Dimensional Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis Tandem Mass Spectrometry Analysis...... 137 A.20.1 Reduction and alkylation ...... 138 A.20.2 In-gel digestion and peptide extraction...... 138 A.20.3 Mass spectrometry ...... 139

B CHARACTERIZATION OF THE THP-1 CELL LINE WITH RESPECT TO HIV-1...... 147

B.1 Introduction...... 147 B.2 Experimental Design...... 148 B.3 Results...... 148 B.3.1 THP-1 lacks T-Lymphocyte-specific Signaling Molecule, p56Lck ...... 148 B.3.2 THP-1 and Monocyte-derived Macrophages Both Progress through the Cell Cycle with Similar Kinetics but Blocked before Mitosis...... 149 B.3.3 Differentiated THP-1 Cells are Susceptible to D-X4 and M-R5 Viral Infection and Resistant to T-X4 Viruses...... 150 B.3.4 Replication-competent M-R5 Virus use CCR5 for Entry and Spreads in Differentiated THP-1 Culture with Similar Kinetics to Monocyte-derived Macrophages...... 150 B.3.5 JAK-STAT Signaling in THP-1 cells ...... 151 B.3.6 Supernatant Cytokine Expression Profiles Following gp120 Treatment...... 151 B.3.7 THP-1 Cells Possess the T-X4 Viral Post-entry Restriction Observed in Monocyte-derived Macrophages...... 152 B.4 Discussion...... 153

C PROTEINS ALTERED BY LPS TREATMENT ...... 169

D PROBE SETS DISTINGUISHING ENVELOPE TREATMENTS...... 190

E PROGRAMS AND DATA SOURCES...... 274

LIST OF REFERENCES...... 280

BIOGRAPHICAL SKETCH ...... 306

LIST OF TABLES

Table page

1-1 Description of HIV-1 biological phenotypes...... 35

2-1 Functional categories of genes with altered gene expression in macrophage following viral treatment...... 52

2-2 Genes increased or decreased in expression by viral treatment...... 53

2-3 Differentially expressed genes involved in cell signaling...... 55

3-1 Induced cytokine profile...... 77

4-1 Proteins with molecular weight between 130 and 200 kilodaltons assigned a role in immune response...... 96

4-2 Proteins identified by mass spectrometry from the 150-200 kilodaltons gel slice of untreated and lipopolysaccharide-treated macrophage supernatants of >95% probability...... 97

4-3 Magnitude of unique proteins identified through gel separation and subsequent tandem mass-spectrometry analysis...... 99

4-4 Magnitude of β-actin expression detected in unlabeled quantitative proteomic analysis...... 100

A-1 Molecular weight regions of 1-dimensional gel slices analyzed by mass spectrometry...... 141

A-2 Protein concentrations in mg/mL of cell lysate as determined at 280 nm with a NanoDrop ND-100 spectrometer...... 142

A-3 Sample names associated with isotopic labels: biological sample 1...... 143

A-4 Sample names associated with isotopic labels: biological sample 2...... 144

A-5 Normalization of protein concentration. Each volume was brought up to 20 μl...... 145

A-6 Sample names associated with isotopic labels: mixed biological samples...... 146

B-1 Distribution of mononuclear phagocytes...... 156

C-1 Proteins increased ≥ 2-fold difference in expression by 24 hours of LPS treatment in 2 out of 3 donors...... 169

C-2 Proteins with ≤ 2-fold difference in expression by 24 hours of LPS treatment in 2 out of 3 donors ...... 174

C-3 Proteins increased ≥ 2-fold difference in expression by 24 hours of interferon-gamma treatment in 2 out of 3 donors...... 181

C-4 Proteins increased ≤ 2-fold difference in expression by 24 hours of interferon-gamma treatment in 2 out of 3 donors...... 187

D-1 Probe sets incorporated in Fig. 5-3 cluster analysis. The table includes the ratio of average treated signal intensity value across donors to average untreated signal intensity value over 6, 15, and 24 hours of treatment...... 190

E-1 Free and commercial software and data sources used to perform pathway analysis...... 277

LIST OF FIGURES

Figure page

1-1 Adults and children estimated to be living with HIV in 2006 according to the World Health Organization...... 32

1-2 Viral particle...... 33

1-3 Organization of HIV-1 genome and position in virion particle...... 34

1-4 Dissertation organization...... 36

2-1 Kinetics of viral replication and spread in macrophages...... 49

2-2 Clustering of genes perturbed by HIV infection of macrophage...... 50

2-3 Functional categories for genes expressed exclusively in virus-treated or in mock- treated macrophage cultures...... 51

2-4 Impact of viral infection on cell cycle genes in macrophages...... 56

2-5 Altered protein expression in macrophages...... 57

2-6 Summary of viral impact on cell cycle regulators in macrophages...... 58

3-1 Clustering of genes perturbed by viral treatment of macrophages...... 72

3-2 Viral directed effects on calcium release pathways...... 73

3-3 Viral treatment affects expression patterns of members of the apoptotic pathway in primary macrophages...... 74

3-4 Factors of MAPK pathway altered in expression by virus...... 75

3-5 Induction and suppression of secreted cytokines...... 78

3-6 Macrophage activation by virus is independent of cell proliferation...... 79

3-7 Altered expression of few TLR-specific factors...... 80

3-8 Virus fails to activate innate immune receptors in macrophages...... 81

3-9 Summary of signaling pathways altered or evaded by virus...... 82

4-1 Lipopolysaccharide-primed macrophages resist viral replication...... 93

4-2 Macrophages secrete antiviral factors in response to lipopolysaccharide treatment...... 94

4-3 Lipopolysaccharide-primed macrophages produce and secrete a factor unique to untreated MDM that separate out approximately 150 kilodaltons...... 95

4-4 Covariance and retention time for peptides detected by isotopic-tag labeling...... 98

5-1 Distribution of GeneChip data...... 108

5-2 Variability across GeneChips...... 109

5-3 Macrophage-tropic virus envelope treatment alters macrophage gene expression profiles within 15 hours...... 110

6-1 Proposed models of HIV evasion of innate immune response...... 122

B-1 Macrophage-like cell line fails to express p56Lck...... 157

B-2 Western blot of whole cell lysate derived from both primary and cell line lysate for p56Lck...... 158

B-3 Porbol 12-myristate 13-acetate (PMA)-differentiated THP-1 cells and MDM were fixed with ethanol and stained with propidium iodide (PI)...... 159

B-4 Aphidicolin-mediated G1 arrest of suspension THP-1 cells...... 160

B-5 Cell proliferation of PMA-differentiated THP-1...... 161

B-6 Entry of pseudotyped single-cycle viruses in undifferentiated (Suspension) and PMA-differentiated (Adherent) THP-1 cells...... 162

B-7 Viral spread in a differentiated THP-1 cell culture...... 163

B-8 Viral spread in differentiated THP-1 cells requires recognition of chemokine (C-C) motif receptor 5 (CCR5) on surface of target cell...... 164

B-9 Suppressed HIV replication in differentiated THP-1 cell culture by TAK-779, a small molecule inhibitor specific for CCR5...... 165

B-10 Western blot for STAT1 and pSTAT1 from THP-1 whole cell lysate...... 166

B-11 Cytokine profiles of monocyte-derived macrophages and THP-1 cell supernatants following treatment...... 167

B-12 Spread of chimeric viruses in differentiated THP-1 model...... 168

E-1 Example of extensible markup language (XML) files downloaded from human protein reference database (HPRD)...... 278

E-2 ProteomicFileHandler formats raw data files generated by the Harvard Proteomic Core facility...... 279

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

FUNCTIONAL GENOMIC AND PROTEOMIC CHARACTERIZATION OF MACROPHAGE RESERVOIRS FOR HUMAN IMMUNODEFICIENCY VIRUS TYPE-1

Joseph Nichols Brown

May 2007

Chair: Maureen M. Goodenow Major: Medical Sciences--Genetics

Human immunodeficiency virus type-1 (HIV-1) is a member of the retrovirus family,

Retroviridae, and the causative agent of acquired immune deficiency syndrome (AIDS).

Although treatment has been successful at controlling viral spread, HIV-1 establishes latent

reservoirs providing a continuous source of virus, which further complicates treatment efforts.

Patients must adhere to therapy for several decades to reduce the viral burden to undetectable

levels. The current study focuses on the functional genomic and proteomic profiles that result in

macrophage reservoirs during HIV-1 spread and to distinguish between genomic responses to

viral envelopes of different functional phenotypes.

Factors altered in expression during viral treatment were organized into functional

pathways which interfaced through hub proteins forming complex interconnected networks.

Multiple signaling pathways were temporally regulated by HIV-1 treatment, with the greatest affect observed within 48 hours of virus treatment. HIV-1 increases the expression of genes and

proteins involved in blocking cellular proliferation, contributing to long-term survival of host

cells. HIV-1 impacted the expression of factors involved in several signal transduction cascades,

such as calcium, apoptosis, mitogen-activated protein kinase (MAPK), and cytokine/chemokine

pathways. In contrast, very few factors involved in toll-like receptor (TLR) signaling were

altered in expression and further analysis confirmed HIV-1 completely evades TLR recognition

through MyD88-dependent pathway and type I interferon response. TLR are important regulators

of HIV-1 spread, therefore to identify global proteomic differences in macrophages upon TLR

activation, we initiated two different preliminary proteomic screening methods to increase both coverage of the proteome and accuracy of relative intracellular protein quantification from whole cell lysate. Preliminary studies on the effect of envelope gp120 on macrophages identified a unique gene altered by M-R5 only whose functional role in the cell remains unknown.

In summary, discovery-based approaches have led our studies in unexpected directions, which we may not have investigated otherwise, resulting in important findings. Future discovery- based studies will lead to broader, high-resolution understanding of viral pathogenesis.

14 CHAPTER 1 INTRODUCTION

1.1 Rationale

The Human immunodeficiency virus type-1 (HIV-1) is the causative agent of acquired immune deficiency syndrome (AIDS). HIV-1 is a blood-borne pathogen that can be transmitted through sexual intercourse, maternal-to-child (MTC), needle sharing, and contaminated blood products. Tragically, this disease can also be transmitted from mother to newborn during gestation, childbirth, and through breast milk. The Centers for Disease Control (CDC) defines

AIDS as a low CD4+ T-lymphocyte count (<200 CD4+ T-lymphocytes/μl) or low CD4% (<14%)

in an HIV-infected individual (Castro KG et al., 1992). The loss of CD4+ T-cells results in

immunodeficiency which eventually leads to death caused by opportunistic infection and

immune system failure. According to the latest World Health Organization (WHO) figures, an

estimated 39.5 million people are living with HIV (Fig. 1-1) (Joint United Nations Programme

on HIV/AIDS and World Health Organization, 2006). There is currently no cure for AIDS and

no vaccine is available.

Anti-retroviral Therapy (ART), which specifically targets viral factors, has remarkably reduced HIV-related mortality. While ART has shown great success in reducing HIV-1 RNA levels in plasma to undetectable levels (Furtado et al., 1999) and favorable immunoreconstitution during ART is observed (Sleasman et al., 1999), the emergence and transmission of HIV multi- drug resistance (HIVMDR) remains a major concern with the rapid scaling up of ART (World

Health Organization, 2007). The high mutation rate of HIV coupled with its replicative capacity contributes to the emergence of viruses with drug resistance. In addition, individuals that do not adhere to drug regiments are more likely to develop viruses resistant to anti-HIV drugs.

Although HIV-1 establishes infections in both CD4+ T-lymphocytes and macrophages,

these two cellular compartments provide distinct environments for the viral pathogen. The HIV-1

life cycle differs greatly between these two cellular targets (Verani et al., 1997). Moreover, signal transduction pathways are inherently different in macrophages compared to T- lymphocytes (Kohler et al., 2003;Cicala et al., 2002;Sleasman et al., 1996;Goodenow et al.,

2003). In contrast to lymphocytes, macrophages also provide a long-lived reservoir for HIV-1 infection (Aquaro et al., 1997;Balestra et al., 2001;Fischer-Smith et al., 2001;Garbuglia et al.,

2001;Khati et al., 2001;Williams et al., 2001).

Cellular factors that influence the process of HIV infection in macrophages represent a stable target for anti-HIV therapeutics because host genes are considerably less prone to mutations than viral genes. Analysis of high-throughput functional genomic and proteomic data using a global network approach to identify interconnected pathways perturbed in expression by viral treatment and how these pathways participate in the viral life cycle will provide insight into important pathways involved in the pathogenesis of HIV-1. A long-term objective of this study is the development of therapeutic agents that prevent HIV from hijacking or evading cellular signaling pathways to promote viral infection.

1.2 Specific Aims

1.2.1 Analyze the Global Genetic and Proteomic Networks Perturbed by HIV-1 Infection in Macrophages

Macrophages are a long-lived reservoir for HIV-1 infection that reside in nearly all tissues throughout an individual (Aquaro et al., 1997;Balestra et al., 2001;Aquaro et al.,

2002;Goodenow et al., 2003). The impact of HIV-1 on macrophage gene and protein expression is not well defined. High-throughput functional genomic and proteomic approaches will identify

novel therapeutic targets responsible for maintenance of HIV-1 reservoirs within macrophages.

Results for specific aim 1 are addressed in chapters 2-4.

1.2.2 Determine Functional Impact of Viral Envelope-mediated Coreceptor Usage on Macrophages.

HIV-1 targets host cells for infection by probing the cellular surface, with its envelope protein (gp120), for receptor (CD4) and coreceptor (CXCR4 and/or CCR5). The interaction between viral gp120 and host receptor complex initiates signal transduction cascades that alter the intracellular milieu and effectively prime the host cell to support viral infection (Alfano et al., 1999;Arthos et al., 2000;Guntermann et al., 1999;Kinter et al., 1998;Popik and Pitha,

2000b;Stantchev and Broder, 2001). Specific aim 2 is addressed in chapter 5.

1.3 Background

1.3.1 Physical Characteristics of the Human Immunodeficiency Virus Type-1 (HIV-1) Virion

HIV-1 is an enveloped, diploid, ssRNA retrovirus classified in the Retroviridae family and

Lentivirus genus. The spherical viral particle is approximately 100-125 nm in diameter (Briggs et al., 2006;Briggs et al., 2003;Takasaki et al., 1997). The lipid bilayer surface contains incorporated cellular- and virally-encoded proteins (Fig. 1-2). The surface glycoprotein, gp120, is a virally-encoded protein tethered to the envelope through non-covalent interactions with the transmembrane protein, gp41, in a homotrimeric conformation composed of 3 gp120s and 3 gp41s (Levy JA, 1998). A virion particle contains between 8-10 copies of the gp120/gp41 trimers on the surface (Zhu et al., 2006;Zhu et al., 2003;Chertova et al., 2002). HLA-DR is perhaps the most well studied cellular factor on the viral surface, with approximately 50-63 complexes per virion (Trubey et al., 2003;Chertova et al., 2006).

The lipid bilayer’s shape and integrity are maintained by the viral matrix protein, p17MA

(MA), which forms a protective shell attached to the inner surface of the envelope (Gottlinger et

al., 1989;Nermut et al., 1994). MA forms a homotrimeric structure tethered to the plasma membrane of the virus by an N-terminal myristoyl group. A single viral particle contains approximately 2000 copies of MA (~700 trimers) (Turner and Summers, 1999). HIV-1 matrix

protein directly interacts with the cytoplasmic domain of gp41 (Cosson, 1996), and this

interaction is thought to be necessary for targeting of MA to lipid rafts for viral budding

(Fiorentini et al., 2006).

Within the matrix shell of mature virion particles is a cone-shaped core that encases the

RNA genome and replication proteins. The core is composed of ~2000 copies of the capsid

(p24CA) protein (Turner and Summers, 1999). The fullerene-like cone-shaped structure is 56 nm

in diameter at the fat end and 27 nm in diameter at the narrow end with an angle of 19.6° at the

tip of the cone (Briggs et al., 2006). Each virion contains 14-18 copies of Vpr, an accessory viral

protein, which are typically present between the matrix shell and the capsid core (Singh et al.,

2001).

The capsid core houses ~80 copies of reverse transcriptase (RT) (Gelderblom H, 1997) and

likely equal numbers of protease (PR) and integrase (IN). The viral genome is composed of two

positive-sense ssRNA molecules, each ~10,000 nucleotides. The length of each strand has been

determined by Takasaki et al. (1997) by two methods: by estimation from micrograph the length

of a single RNA strand is 1756.2 Angstrom, and by inference from the number of bases the

physical length is 2028 Angstrom. The RNA genome is tightly bound to ~2000 copies of

nucleocapsid (NC) (Turner and Summers, 1999), approximately 1 molecule of NC for every 4

nucleotides (You and McHenry, 1993). Nef, a viral accessory protein, associates with the viral

core and contributes to viral pathogenesis (Kotov et al., 1999).

The HIV-1 genome encodes nine genes, all driven by a single promoter: the 5’ long

terminal repeat (5’ LTR) (Fig. 1-3). These nine genes can be organized into early and late genes.

The early genes, tat, rev, and nef, are expressed in a Rev-independent manner. In contrast,

mRNAs encoding the late genes, gag, pol, env, vpr, vpu, and vif, require Rev to localize in the

cytoplasm where the messages are translated (Pandori et al., 1996;Schwartz et al., 1995).

1.3.2 Differences in the HIV-1 Lifecycle between T-lymphocytes and Macrophages

Lentiviruses are unique among the Retroviridae in that they are capable of infecting and

replicating in non-dividing cells, including cells of the monocyte/macrophage lineage. Many

nonprimate lentiviruses, such as caprine arthritis-encephalitis virus (CAEV), equine infectious

anemia virus (EIAV), and visna/maedi virus (VMV), are restricted to infecting macrophages

(Coffin et al., 1997;Coffin et al., 1997). In contrast, all primate lentiviruses, such as HIV-1,

target two major cellular lineages for infection: CD4+ T lymphocytes and macrophages.

Macrophages serve an important role in the innate immune response to pathogens, and contribute

to the interface between innate and adaptive immunity.

1.3.2.1 HIV-1 entry

The earliest step of HIV-1 infection is viral entry into target cell. For CD4+ T-lymphocytes

infection, entry requires recognition between the viral envelope protein, gp120, and the cellular

receptor CD4. The interaction between gp120 and CD4 induces a conformation change in the

viral envelope protein that exposes the V3 loop of gp120 that makes the loop accessible to

interaction with a cellular chemokine receptor, either CCR5 or CXCR4. CXCR4 is expressed as

a monomer on the surface of both macrophages and T-lymphocytes, but is primarily a species of

higher molecular weight on the surface of macrophages (Lapham et al., 1999). Co-

immunoprecipitation experiments revealed CD4 associates with CXCR4 monomers, but not with

the high molecular weight CXCR4 form (Lapham et al., 1999). Noncovalent interactions

between viral envelope and the cellular receptor and coreceptor complex spreads the gp120

trimer open on the surface of the virion promoting the extension of gp41 piercing into the target

cells membrane. The viral and cellular lipid bilayer membranes are pulled into close proximity

by gp41 retraction, inducing fusion of the membranes and entry of the viral pre-integration

complex (PIC) into the cytosol of target cell. Binding of gp120 to the receptor/coreceptor complex is the primary route of viral entry in macrophages.

In addition, electron microscopy revealed HIV-1 virions in several intracellular locations shortly after viral exposure (Marechal et al., 2001). Macrophages use macropinocytosis to constantly sample the extracellular environment, suggesting the existence of alternative viral entry routes in macrophages. The acquisition of HIV-1 particles by macropinocytosis is independent of gp120-receptor interactions as virions are brought into intracellular compartments called macropinosomes. Although most virions within macropinosomes are degraded and viral fragments presented on the surface of the macrophage via MHC class II molecules, a small fraction of the virions internalized by macropinocytosis escape destruction and lead to productive infection (Marechal et al., 2001).

1.3.2.2 Reverse transcription and nuclear translocation

Once inside the cytosol, the HIV-1 viral genome must be reverse transcribed to dsDNA

and transported towards the nucleus. Differences in cell size between macrophages (~100 μm)

and T lymphocytes (~10 μm) also represent a significant obstacle during translocation due to the

high viscosity of the cytosol and presence of innate immune factors (Janeway et al., 2001;Abbas

AK et al., 2000). Reverse transcription occurs within the reverse transcription complex (RTC),

which is composed of virion core proteins, cellular proteins and the RNA genome (McDonald et

al., 2002). RTC migration towards the nucleus requires the use of cellular motors, such as dynein

and microtubules, to move along the cell cytoskeleton (McDonald et al., 2002;Bukrinskaya et

al., 1998).

Upon completion of DNA synthesis, the RTC matures into the preintegration complex

(PIC). Although in T-lymphocytes reverse transcription completes in only a few hours, the

process is much slower in macrophages (36-48 hours), for reasons that may include, in part,

nucleoside availability (Collin et al., 1994;O'Brien et al., 1994). CD4+ T-lymphocytes must be

activated and proliferating prior to viral exposure for successfully reverse transcription,

translocation, and integration to occur. In contrast, macrophages are terminally differentiated cells, indicating PIC translocation involves migration across the nuclear envelope. Previous studies have suggested that only macrophages that maintain proliferative capacity can support productive HIV-1 infection (Schuitemaker et al., 1994a;Kootstra and Schuitemaker, 1998;Wang and Lewis, 2001). The proliferative capacity requirement has been attributed to the need for cellular activation to complete reverse transcription. Perhaps macrophage activation creates an intracellular milieu, with increased nucleosides and cellular cofactors, which optimizes RNA to

DNA conversion. Mitosis in not believed to be required for the provirus to access the host’s genome (Schuitemaker et al., 1994a). Traversing the double lipid bilayer of the nuclear envelope represents a major obstacle for the PIC, with a Stokes diameter of 56 nm, as the nuclear pore complex (NPC) studding the surface of the nuclear envelope forms only a 25 nm central aqueous channel (Sherman et al., 2002). In fact, more recent reports suggest the diameter of the PIC may be even larger (McDonald et al., 2002;Nermut and Fassati, 2003). An unusual feature of the lentiviral genome, the central DNA flap, plays an important role in transporting the PIC through the NPC.

1.3.2.3 Proviral integration and expression

The double-stranded vDNA form of the viral genome, called the provirus, integrates,

preferentially into the upstream coding regions of actively transcribing genes or near DNAase-

hypersensitive sites, by the viral-encoded, Integrase (IN) (Rohdewohld et al., 1987). In addition to IN, the cellular factor, LEDGF, associates with IN and is required for efficient viral integration (Cherepanov et al., 2003). The integrated provirus serves as a template for the

transcription of viral genes, a process that heavily depends on cellular transcription machinery.

The process of viral transcription is regulated in a cell-type dependent manner, with cellular transcriptional machinery differing between T-lymphocytes and macrophages (Rohr et al.,

2003). For instance, different isoforms of CCAAT/enhancer-binding protein β (C/EBPβ) are

produced by alternative translational initiation. The 30-37-kDa activating isoform is required for

HIV replication in monocytes/macrophages but not in CD4+ T-lymphocytes (Henderson and

Calame, 1997). Nuclear factor of activated T-cells (NFAT) is a transcription factor expressed in activated T-lymphocytes, but absent from macrophages. NFAT binds to the NF-κB sites of the

viral LTR and synergizes with NF-κB and Tat in transcriptional activation and HIV-1 replication

(Kinoshita et al., 1998).

1.3.2.4 Viral assembly and release

Progeny virions are produced through the assembly of HIV genomic RNA and viral

proteins, and by the release of viral particles by budding from an infected cell (Levy JA, 1998).

Viral assembly and budding are regulated and promoted by the Gag polyprotein, which is

targeted to membranes by the myristylated NH2-terminus of MA (Freed, 1998). The subcellular

localization of viral budding differs between macrophages and T-lymphocytes. In T-

lymphocytes, HIV virions bud from the plasma membrane at sites of cholesterol- and

sphingolipid-rich regions known as lipid rafts (Nguyen and Hildreth, 2000;Esser et al., 2001). In

contrast, new virions bud primarily into late endosomes/multivesicular bodies (MVB) in

macrophages (Raposo et al., 2002;Pelchen-Matthews et al., 2003). MVBs then fuse with the

plasma membrane and release virus particles into the extracellular space (Nydegger et al., 2003).

Macrophage-derived viruses display low amounts of cell surface markers and lack some lipid-

raft-associated proteins, such as CD14, but share similar protein patterns with macrophage- derived exosomes (CD63, MHC-II, Lamp1) (Nguyen and Hildreth, 2000;Pelchen-Matthews et

al., 2003;Raposo et al., 2002;Nguyen and Hildreth, 2003). CD63 plays an important role in

infection of macrophages with R5 HIV, but not T cells (von Lindern et al., 2003). The budding

of HIV particles into MVB within infected macrophages may render the virus inaccessible to

antiviral inhibitors, such as RNAi, and enable the virus to persist in macrophages, contributing to

macrophages serving as a viral reservoir (Verani et al., 2005). Furthermore, exosomes may aid in

viral escape of immune surveillance during cell-to-cell transmission (Gould et al., 2003).

1.3.3 Phenotypic Characterization of HIV-1 Isolates

The biological phenotype HIV-1 strains are defined by a dual parameter nomenclature

system: target cell tropism and coreceptor use. Both characteristics are typically used to describe

a viral strain, with tropism preceding coreceptor use separated by a hyphen. Target cell tropism

refers to the ability of a viral envelope to mediate entry into or for virus to replicate within a

particular host cell type. Five established tropism designations for HIV-1 are used to define viral

tropism: [1] Macrophage (M), [2] T cell line (T), [3] Dual (D), [4] Lymphocyte (L), and (5)

Macrophage-restricted (Mr) (Goodenow and Collman, 2006). There is a relationship between

target cell tropism and coreceptor use (Table 1-1). For example, macrophage-tropic viruses tend

to use CCR5 to enter the host, and are therefore categorized as M-R5. In contrast, a virus that

uses either CCR5 or CXCR4 to enter macrophages, lymphocytes or T cell lines is called a D-

R5X4 virus, reflecting its dual cell tropism (macrophages and T cell lines).

Despite the route of transmission (sexual, mother-to-child or intravenous), R5 viruses are almost exclusively associated with transmission and acute infection (Margolis and Shattock,

2006;van't Wout et al., 1994;Zhu et al., 1993). Availability of CXCR4+ target cells is not the major restricting factor of X4 viruses during transmission (Poles et al., 2001). Although CCR5- usage is typically associated with M-tropic viruses, the ability to use CCR5 is neither necessary nor sufficient for M-tropism (Gorry et al., 2001;Li et al., 1999). Macrophages play key regulator roles in HIV disease progression, and their ability to secrete products in response to HIV contribute to the paththogenesis of the virus (Gorry et al., 2004;Gorry et al., 2005). Evolution of

R5 viruses to X4 viruses is associated with accelerated loss of CD4+ T lymphocytes and progression towards AIDS, indicating the increased pathogenicity of X4 viruses compared to R5

(Fenyo et al., 1988;Scarlatti et al., 1997;Connor et al., 1997;Fouchier et al., 1996;Koot et al.,

1999;Margolis and Shattock, 2006). However, the vast majority of HIV-positive individuals that progress to AIDS harbor M-R5 variants, without any evidence of switching coreceptor preference, indicating CCR5-utilizing viruses are pathogenic (Bjorndal et al., 1997;Connor et al.,

1997).

1.3.4 Cellular Signal Transduction Cascades Activated by HIV

Signal transduction cascades are initiated within the host cell by HIV-1 upon the earliest events in the virus lifecycle. Engagement of gp120 with the cellular receptor complex on the surface of the host triggers multiple signaling pathways within the cell. The three HIV-1 receptor proteins, CD4, CCR5, and CXCR4, have signaling functions in healthy, uninfected T-cells. In lymphocytes, CD4 provides a costimulatory signal in antigen-specific T-cell receptor-major histocompatibility complex II interaction (Garcia, 1999). This signaling is mediated by

association with the Src-related protein tyrosine kinase, p56Lck, which functions to phosphorylate tyrosine residues in the T cell antigen receptor complex (Rudd et al., 1988;Veillette et al., 1988).

In contrast to lymphocytes, CD4 functions as a receptor for interleukin 16 in macrophages

(Cruikshank et al., 2000;Van et al., 2000). Macrophages do not express p56Lck, however CD4

engagement initiates a complex inositol polyphosphate and Ca2+ flux (Guse et al., 1992), PLC-γ

(Graziani-Bowering et al., 2002), PKC (Parada et al., 1996), PI-3K (Graziani-Bowering et al.,

2002), JAK-STAT (Kohler et al., 2003), and activation of SAPK and p38 MAPK (Krautwald,

1998).

The chemokine coreceptors, CCR5 and CXCR4, are 7-transmembrane G-protein coupled receptors (GPCR), and as their name implies they activate and signal through G-proteins as well as a number of other secondary messenger systems, including calcium (Lee et al., 2003).

Signaling patterns generated by cells activated by HIV-1 or the HIV-1 envelope compared to the chemokine receptor natural ligands have found distinct differences between the natural ligand and HIV’s molecular mimicry (Lee et al., 2003;Melar et al., 2007). There are two schools of thought relating to the potential importance of HIV-1 envelope signaling in viral infection: one that believes envelope signaling is necessary to establish an optimal intracellular milieu that promotes establishment of viral infection (Alfano et al., 1999;Arthos et al., 2000;Guntermann et al., 1999;Popik and Pitha, 2000a;Stantchev and Broder, 2001;Stantchev et al., 2007) and another group that supports the idea that gp120-mediated signaling is dispensable for infection (Alkhatib et al., 1997;Amara et al., 2003;Aramori et al., 1997;Atchison et al., 1996). Signaling events initiated by gp120 interaction with the receptor complex on the surface of macrophages are distinct from signals initiated upon stimulation with natural ligands for either chemokine coreceptor (Lee et al., 2003;Melar et al., 2007). The studies presented in this dissertation analyze

the result of activated signal transduction cascades within primary macrophages following

treatment with whole virus and then we focused in on the effect of envelope glycoprotein alone.

1.3.5 Influence of Cellular Factors on HIV infection

The hunt for host cellular factors that interact with or regulate HIV viral proteins or

replication cycle has been under intense investigation by researchers since the initial

characterizations of the virus (Komano et al., 2005). An online comprehensive list of cellular

factors that interact with HIV-1 is maintained and constantly updated by the NIAID HIV-1

Human Protein Interaction Project (http://www.ncbi.nlm.nih.gov/RefSeq/HIVInteractions/

index.html). Every protein encoded by the HIV-1 genome interacts with at least one cellular

protein, and typically several interaction partners have been identified. The restriction of a

retroviral infection involves either the presence of a factor that blocks viral replication or the

absence of a factor that promotes viral replication (Bieniasz, 2003;Towers and Goff, 2003).

Perhaps the best known cellular restriction factor is the CCR5Δ32 allele. The deletion of a

32 base-pair region within the CCR5 gene results in a missense mutation producing a truncated

form of CCR5 that does not traffic to the cell surface or function in viral recognition (Rana et al.,

1997;Yi et al., 1998). Individuals homozygous for CCR5Δ32 display a strong resistance to HIV-

1 infection even when exposed to X4 virus, supporting the role of R5 virus in transmission

(Margolis and Shattock, 2006) and suggesting that the functions of CCR5 are dispensable for the human well-being (Komano et al., 2005). Therefore, CCR5 represents an ideal cellular target for anti-HIV drug therapy.

APOBEC3G is another host restriction factor that has recently gained much attention, especially in the field of retrovirology. In 2002, a cellular factor was discovered through a subtractive hybridization approach between two closely related cell lines that rendered either

permissive or restrictive to infection by a Vif-deficient HIV-1 (HIVΔVif) (Sheehy et al., 2002).

This factor was later identified to be the DNA-deaminase, APOBEC3G (Harris et al., 2003).

HIV-1 evades APOBEC3G regulation through interaction with Vif. Vif binds to APOBEC3G

and mediates its exclusion from the viral particle. If Vif is absent, as is the case for HIVΔVif,

APOBEC3G is packaged in the virion particle and asserts its antiviral function during second

round infection. Following entry into a target cell, reverse transcription of the RNA genome is

immediately initiated. APOBEC3G functions on the first-strand synthesized deaminating

cytosine residues to uracils. The effect of deamination is realized upon second-strand synthesis when C-G bonding is replaced by U-A. Numerous deamination events throughout the viral genome effectively prevents viral spread (Huthoff and Malim, 2005).

Several other host factors that either promote or inhibit HIV-1 infection and spread with the host have been identified. For a complete review see (Sorin and Kalpana, 2006). A few pro- or anti-HIV host factors that have been elucidated in macrophages through high-throughput

genomic or proteomic analyses will be discussed in following sections.

1.3.6 Acquired Immunodeficiency Syndrome and Related Malignancies

The Centers for Disease Control define AIDS in HIV-seropositive adults and adolescents by CD4 percentage, a spectrum of opportunistic infections or by a heterogenous group of malignancies. Approximately 40% of persons with HIV/AIDS have some type of malignancy

(Berretta et al., 2003). HIV-1 may have either a direct or an indirect contribution to cancer. Less

frequently, HIV directly contributes to development of malignancy in some T-cell lymphomas

and macrophages in non-T-cell lymphomas by insertional mutagenesis into a region of c-fes proto-oncogene (Ng and McGrath, 1998). In contrast, HIV primarily contributes indirectly to malignancy. Although HIV-positive may patients present a number of different tumor types,

Kaposi’s sarcoma (KS) and non-Hodgkin’s lymphoma (NHL) are the two principal AIDS- defining malignancies (Boyle et al., 1993). Herpesviruses are the major etiological agents of human AIDS-defining malignancies, namely Human herpesvirus-8 (HHV-8) and Epstein-Barr virus (EBV), which contribute to increased risk for KS and NHL, respectively. HIV-infected individuals are also at increased risk of coinfection by other oncogenic viruses, such as human papilloma virus (HPV) and hepatitis C virus (HCV), which leads to increased risk of invasive cervical carcinoma (ICC) and hepatic carcinoma, respectively.

HIV-1 modulates signal transduction cascades within host cells, altering cytokine expression profiles, which ultimately results in exhaustion of the immune system. In this project,

I focus on the global effect of HIV-1 on primary macrophages, which serve as a long-lived reservoir important in driving the pace of disease progression towards AIDS through viral production as wells as secretory products (Gorry et al., 2004). Furthermore, macrophages are found in nearly all malignant tumors, and the products secreted by these tumor-associated macrophages (TAM) significantly contribute to the course of tumor disease progression (Zuk and

Walker, 1987;Burke B and Lewis CE, 2002;Mantovani et al., 1992). In this study, HIV-1 was used as a molecular probe to facility a broader understanding of the global effect of whole virus on primary macrophage culture and how macrophage response to retrovirus may prime immune cells for opportunistic pathogens and cancer.

1.3.7 Functional Genomics and HIV

Since 2000, numerous studies have used microarrays to identify gene expressions in cell lines and primary cells altered by HIV-1 or a single viral factor. The earliest of these reports to use peripheral blood mononuclear cells (PBMCs) and monocyte-derived macrophages (MDM) studied the effect of soluble gp120 on cellular gene expression (Cicala et al., 2002). As with many microarray publications at that time, the Cicala et al. study produced a large list of genes

whose expressions were altered by gp120 treatment along with a few genes that were also

impacted at the protein level, and highlighted a few they may play an important role during HIV-

1 infection. During the next few years, microarray researchers began using two very different

approaches to analyze the data and interprete the results generated from these high-throughput

methods: the ‘localist’ (‘particularist’) and the ‘globalist’ (‘generalist’) (Huang, 2004).

In the ‘localist’ camp, researchers would analytically search through the large lists to

identify a single factor that may be important during HIV-1 infection. In one particular study,

researchers found a gene, p21Cip1, altered by HIV-1 infection of MDM that is an important

regulator of the cell cycle (Vazquez et al., 2005). Our lab had previously identified p21Cip1 increased in expression within MDM by HIV-1 through western blot analysis (Coberley et al.,

2004). Vazquez et al. identified the requirement of p21Cip1 during HIV-1 infection of MDM by knocking-down the gene expression or chemically inhibiting the protein’s function and discovering that the virus lost its ability to spread in MDM culture (Vazquez et al., 2005). In

contrast, other researchers have used the localist approach to identify factors that restrict viral

spread. By studying the gene expression profiles of CD4+ T cell lines and primary CD4+ T

lymphocytes, Corbeil’s group focused on a single factor called nuclear factor I-B2 (NFI-B2)

because of its high level of expression (Sheeter et al., 2003). Instead of knocking-down

expression, Sheeter et al. generated Jurkat T cells that over-expressed NFI-B2 and again

discovered high levels of NFI-B2 inhibited viral spread. As opposed to p21Cip1 which promotes viral replication, Sheeter et al. discovered an immune responsive factor that probably functions to prevent viral transcription.

In contrast to the localist view, globalists use a network-centric view by organizing genes/proteins into pathways which then form networks that interface at hub proteins. Globalists

generally have the philosophy that the whole is different from the sum of its parts, and therefore

take a holistic approach to identify global dynamics of a network (Huang, 2004). We used a

globalist approach to investigate the dynamics of networks involved in cell cycle regulation

within MDM during HIV-1 treatment, and identify potential therapeutic targets (Coberley et al.,

2004). I also applied the globalist approach to studying signal transduction cascades that regulate

the immune response in primary macrophages following HIV-1 treatment (Chapter 3). The

globalist’s top-down approach begins by asking questions regarding the importance of particular

networks, and funnels down to individual pathways and finally distinct components of a

particular pathway.

1.3.8 Proteomics and HIV

Proteomic approaches have been undertaken to study several aspects of HIV-1 biology,

including viral particle composition, structure, protein-protein interactions with the host, modulations of host protein levels, and many others. Although several groups have studied the

incorporation of cellular proteins into HIV-1 virions produced from lymphocytes and epithelial

cell model systems (Cantin et al., 2005;Tremblay et al., 1998;Ott, 2002), a recent proteomic

study has determined that virion particles produced from macrophages contain unique cellular

proteins, such as HLA class II, ICAM-1, and tetraspanins (Chertova et al., 2006), that increases

viral infectivity towards CD4+ T lymphocytes (Cantin et al., 2005;Martin et al., 2005).

An initial proteomic study of MDM treated with HIV-1 used surface enhanced laser desorption/ionization (SELDI)-time of flight (TOF) ProteinChip technology to identify alterations in cellular proteins following 7 days of viral infection. Between two donors, the investigators identified 367 proteins and 58 of these were either up- or down-regulated following

HIVADA infection (Carlson et al., 2004). David Ho’s group also used the SELDI-TOF technology

to identify a new class of cellular anti-HIV factors, α-defensins 1, 2, and 3 (Zhang et al., 2002).

SELDI-TOF is a technology that has been commercialized by a company called Ciphergen

(http://www.ciphergen.com/), but the ProteinChips are now available through BioRad

(http://www.Bio-Rad/proteinchip/). The technique is similar to MALDI-TOF, but the surface of

the chip is enhanced by one of several different substances, such as hydrophobic or hydrophilic

residue, immunoglobulins, DNA or RNA, or anionic or cationic.

The work presented in subsequent chapters extends the knowledge previously mentioned,

to identify the global effect of primary macrophages exposed to HIV-1 or HIV envelope protein

at both the functional genomic and proteomic levels (Fig. 1-4). HIV has a broad effect on

macrophages, impacting factors involved in several different functional categories as determined

by Gene Ontology (GO), as described in chapter 2. To facilitate comprehension of large datasets

generated by high-throughput analysis, we have organized the data into functional modules

which focus on particular pathways or networks of interest. For example, in chapter 2 we focus

on the virus’s effect on factors that regulate cell cycle, and in chapter 3 we concentrate on

interconnected signal transduction cascades and cytokine/chemokine pathways. Methods and

materials are similar in all chapters; therefore, this information is included in Appendix A. A

brief overview of the methods used in each chaptered is mentioned in each section, called

Experimental Design, with a reference to the detailed explanation in Appendix A complete with

section.

Figure 1-1. Adults and children estimated to be living with HIV in 2006 according to the World Health Organization. The total number is estimated to be 39.5 (34.1 – 47.1) million.

Figure 1-2. Viral particle. A) 2D cross-sectional representation of an HIV virion particle. The lipid bilayer (yellow outer circle) is studded with both cellular (HLA-DR) and viral (gp120/gp41) proteins. The underside of the viral plasma membrane is supported by p17MA (blue). Vpr freely diffuses between p17MA and p24CA (green) fullerene-like structure. The two ssRNA molecules are housed within the fullerene-like structure p24CA structure and bound to p7NC. The capsid also houses Nef (yellow) and all three HIV enzymatic proteins: RT (purple), PR (pink), and IN (dark green). B) 3D cross- sectional view of the HIV virion. The p17MA homotrimers are visible on the inner surface of the viral envelope. A single gp120 trimer is visible on the surface on the lower side of the virion (Stowell D, 2007).

Figure 1-3. Organization of HIV-1 genome and position in virion particle.

Table 1-1. Description of HIV-1 biological phenotypes. Tropism Designation Tropism for CD4+ primary cells and T Relationship to cell lines coreceptor use

Macrophage (M) Macrophages and lymphocytes Typically R5

T cell line (T) Lymphocytes & CD4+ T cell lines Typically X4

Dual (D) Macrophages, lymphocytes & CD4+ T cell May be R5X4 or lines X4

Lymphocyte (L) Lymphocytes only Typically R5

Macrophage-restricted Macrophages only Typically R5 (Mr)

Figure 1-4. Dissertation organization. Chapters 2, 3, and 4 describe the effect of whole virus on macrophages, while chapter 5 deals with viral gp120 on macrophages. Functional genomic studies were performed on macrophages treated with whole virus (chapters 2 and 3) or with gp120 (chapter 5, in blue).Alterations in both intracellular and extracellular proteome expression profiles in response to whole virus is discussed in chapters 2, 3, and 4. Results from whole virus were analyzed with respect to cell cycle (chapter 2), calcium, apoptosis, MAPK, and TLR signaling pathways (chapter 3), in that order.

CHAPTER 2 IMPACT ON GENETIC NETWORKS IN HUMAN MACROPHAGES BY HUMAN IMMUNODEFICIENCY VIRUS TYPE 1

2.1 Introduction

Human immunodeficiency virus type 1 (HIV-1) pathogenesis results from perturbations in complex cellular networks leading to global immune dysfunction and a spectrum of AIDS- defining illnesses. HIV-1 infection of macrophages, which are long-lived cells, can also lead to establishment of reservoirs for virus production and spread to other cell types and compartments

(Aquaro et al., 1997;Aquaro et al., 2002;Balestra et al., 2001;Fischer-Smith et al.,

2001;Garbuglia et al., 2001;Gendelman et al., 1989;Gendelman et al., 1988;Khati et al.,

2001;Williams et al., 2001). Viral infection of macrophages produces a global impact on macrophage physiology, including alterations in the cell cycle (Wainberg et al., 1997;Wang and

Lewis, 2001), chemotaxis (Albini et al., 1998;Del et al., 1999), levels of tumor necrosis factor alpha (TNF-α) and other Th2-type cytokines (Cicala et al., 2002;Fantuzzi et al., 2000;Fantuzzi et al., 2001;Poli and Fauci, 1992), phagocytosis (Biggs et al., 1995;Crowe et al., 1994;Koziel et al.,

1998;Reardon et al., 1996), and antigen presentation (Knight and Macatonia, 1991;Macatonia et al., 1992). In particular, HIV-1 or envelope gp120 activates multiple signal transducer and activator of transcription (STAT) proteins that modulate the expression of multiple receptors and/or cytokines contributing to generalized immune dysfunction in hematopoietic cells

(Bovolenta et al., 2001;Kohler et al., 2003;Shrikant et al., 1996).

Discerning interactive networks through analysis of single pathways has limitations. In contrast, global analysis of gene expression profiles provides a comprehensive approach to developing an integrated picture of the complex perturbations of cellular gene expression by virus treatment. Initial genomic approaches to the study of HIV-1 infection have examined interactions between prototypic T-cell-tropic CXCR4 strains of HIV-1 and proliferating T-cell

lines or primary peripheral blood mononuclear cells (PBMC) (Geiss et al., 2000;Ryo et al.,

1999a;Scheuring et al., 1998;Vahey et al., 2002) or between gp120 and PBMC or monocyte-

derived macrophages (MDM) (Cicala et al., 2002). We designed a unique study using the

Affymetrix Gene-Chip system in combination with high-throughput Western blot analysis to

develop a genetic profile of virus treatment by a prototypic macrophage-tropic CCR5 virus, HIV-

1JR-FL, over the course of 7 days in human macrophages from multiple donors. A primary

objective of using a systems biology approach was to identify sentinel genetic events that would

distinguish between virus and mock treatment of macrophages. Subsequent analysis focused on

the expression of networks of genes involved in cell cycle regulation (Goh et al., 1998;Kootstra

et al., 2000;Schuitemaker et al., 1994a;Wahl et al., 2003;Wang and Lewis, 2001). The work

presented in this chapter is published in the Journal of Virology (Coberley et al., 2004).

2.2 Experimental Design

HIVJR-FL stocks were prepared as described in Appendix A.1, and used to infect monocyte-

derived macrophages (MDM) from 4 donors (Appendix A.2). A mock-treatment was also

applied to MDMs to serve as background control (Appendix A.1). Cells were lysed 2, 4, and 7

days post-treatment, and RNA was isolated, prepared for hybridization to Affymetrix

GeneChips, and imaged to determine signal intensity values (Appendix A.7). Signal intensity values were imported into a custom designed database and analyzed to identify altered in virus- treated samples (Appendix A.8). Protein was extracted from 2 of the 4 donors and used for immunoblot analysis (Appendix A.9).

2.3 Results

2.3.1 Viral Replication and Spread in Monocyte-derived Macrophage (MDM) Cultures.

To relate gene expression to viral replication kinetics, the supernatant p24 antigen production and number of gag DNA copies were measured in MDM cultures over the course of

7 days (Fig. 1). In general, peak levels of supernatant p24 antigen (100 ng/ml) developed

between days 4 and 7 following HIVJR-FL infection (Fig. 2-1A). Production of supernatant p24 levels paralleled virus spread based on cell-associated virus DNA copies (Fig. 2-1B). By 2 days post-treatment, ~0.2% of MDM harbored virus, based on one gag copy per cell, while at day 7,

~10% of macrophages were infected (Fig. 2-1B). Maximal infection of 10% of MDM by HIV-

1JR-FL was consistent with other data from our laboratory and indicated that nearly 90% of

macrophages in virus-treated cultures remained uninfected. An impact of virus treatment on

genetic networks in MDM, including both infected and uninfected cells, was compared to gene

expression by uninfected cells in mock-treated MDM cultures. A 7-day time course was

analyzed to provide an overview of genetic networks during the course of spreading virus

infection.

2.3.2 Temporal Expression of Genes in HIV-treated Macrophage Cultures.

Approximately 900 genes with defined functions had higher or lower levels of expression

by >4-fold between HIV-treated and mock-treated cultures from any donor at any time point.

Based on hierarchical agglomerative cluster analysis of expression patterns over time, the genes

fell into nine clusters (Fig. 2-2A, A through I). Median induction or repression for the entire data set was ~4-fold.

Approximately 800 of the 900 functionally annotated genes fell into six major clusters (B,

C, D, E, H, and I). Patterns of expression over time for clusters of genes were represented as waveforms that displayed the median change for the population of genes within each cluster

(Fig. 2-2B). More than 50% of the genes (465 of 808) had higher levels of expression as early as

2 days following HIV-1 treatment and were included in clusters C, H, and I (Fig. 2-2B). About

28% of the genes (231 of 808; clusters B and E) had higher levels of expression at the

intermediate day 4 time point, while 14% of the genes (112 of 808; cluster D) had higher levels

of expression late, by day 7 following treatment (Fig. 2-2B). Although the genes were classified

by temporal patterns of increased steady-state levels of expression relative to mock, distinct

patterns of decreased levels of expression over time were also apparent.

2.3.3 Genes Expressed Exclusively in Virus-treated or Mock-treated Macrophage Cultures.

Temporal analysis required that genes be expressed in both virus- and mock-treated MDM cultures and excluded genes that were expressed only under one or the other condition. To determine if genes might be expressed exclusively in virus- or mock-treated MDM, a series of statistical filters was applied to the data set and the results were summarized using Venn diagrams (Fig. 2-3A). Analysis identified 372 genes that were expressed exclusively in virus- treated macrophage cultures at all time points, 321 genes that were expressed exclusively in mock-treated cultures, and 127 genes that were expressed by MDM independent of treatment.

A second set of queries examined mutually exclusive gene expression on different days of treatment (Fig. 2-3B). A dramatic difference in the number of genes expressed exclusively by

HIV- or mock-treated cultures was apparent as early as day 2 (Fig. 2-3B). The number of genes expressed exclusively in virus-treated cultures gradually decreased from 260 to 130 over 7 days

(Fig. 2-3B). Simultaneously, the number of genes that were expressed exclusively in mock-

treated cultures increased from <50 to 190 (Fig. 2-3B).

2.3.4 Functional Categories of Genes Modulated by HIV.

More than 800 genes that were summarized by temporal expression (Fig. 2-2) were

subsequently classified into 21 functional categories as defined by the Gene Ontology

Consortium. About 17% of the genes (142 of 808) were classified in the energy or protein

metabolism category (Table 2-1). More than 30% (258 of 808) were grouped into categories with

related functions, such as apoptosis, cell proliferation, cytoskeletal and cell motility, signal

transduction, or transcription, while 11% of the genes (89 of 808) were classified into the

hematopoietic, immune response, or inflammation category.

Similar analysis of mutually exclusive expression profiles (Fig. 2-3) identified genes from

multiple functional categories (data not shown). In particular, HIV-1 treatment altered the

expression of genes in a subset of functional categories related to immune function, cell cycle proliferation, and cell stress. In contrast, macrophages in mock-treated cultures expressed few, if any, genes in these categories. Patterns of mutually exclusive expression of genes provided a signature for virus treatment.

2.3.5 HIV Impacts Similar Genes in Lymphocytes and Macrophages.

To determine if similar target genes were altered by HIV-1 treatment in different cell types, we compared our data from primary macrophages with those of other studies that analyzed an impact of HIV-1 on gene expression in transformed monocytic or lymphoid cell lines (Table

2-2) (Bartz and Emerman, 1999;Biggs et al., 1995;Brooks and Zack, 2002;Clark et al.,

2000;Furtado et al., 1999;Geiss et al., 2000;Geleziunas et al., 1994;Gendelman et al., 1988;Goh et al., 1998;Khati et al., 2001;Knight and Macatonia, 1991;Kuhn et al., 2001;Michie et al.,

1992;Piedimonte et al., 1999;Ryo et al., 1999a;Scheuring et al., 1998;Schuitemaker et al.,

1994a;Selliah and Finkel, 2001;Sleasman et al., 1996;Wainberg et al., 1997;Wang et al.,

1999;Williams et al., 2001;Xaus et al., 2001). Twenty genes, including 4 exact matches and 16 that were similar based on function or alternate isoforms of the same gene product, were induced following virus treatment (Table 2-2). In addition, treatment with HIV-1 repressed 38 genes, including 11 that were exact matches and 27 that were similar by function (Table 2-2). For example, both CD4 mRNA levels and CD4 cell surface expression were down regulated by virus treatment in cell lines and MDM (13, 73). In addition, HIV-1-treated samples contained increased steady-state expression levels of ERF, BCL2, and IFRD2 genes involved in regulation

of the cell cycle in both monocytic and lymphocytic cells, as well as macrophages (Table 2-2).

Therefore, we focused our subsequent analysis to determine the extent to which cell cycle

mediators might be impacted by virus in macrophages.

2.3.6 HIV-1 Impact on Genes Involved in Regulation of the Cell Cycle in Macrophage Cultures.

Database queries were performed to focus analysis on genes in the cell cycle category that were preferentially impacted by HIV-1 in MDM. Twelve genes involved in regulating cell cycle

transitions were expressed exclusively in mock-treated MDM cultures (Table 2-3). Seventeen

other genes that are implicated in transitions through cell cycle checkpoints were expressed

uniquely in HIV-treated cultures (Table 2-3). When ratios for expression of cell cycle genes in

HIV- and mock-treated MDM cultures were evaluated, temporal patterns were apparent. Sixteen

genes involved in cell cycling were increased in virus-treated cultures by day 2 (early) and

subsequently decreased in expression dropping to baseline or below (Table 2-3). Ten genes were

expressed exclusively in virus-treated by day 4 (intermediate time point), while four genes had

higher levels of expression in virus-treated by day 7 (late).

2.3.7 Qualitative Identification of Genes Involved in Cell Cycle Regulation Checkpoints.

A number of genes involved in regulating G1/S or G2/M checkpoints in the cell cycle were

detected exclusively in mock-treated MDM cultures (Fig. 2-4). For example, CDC2, CDKN1B,

and GAS1 genes are implicated in G1/S transition, while CDC2 and PCTAIRE1 (a gene

homologous to the CDC2 gene), CDC2-like kinase (CLK2), and cyclin B2 (CCNB2) genes are

required for G2/M transition. In contrast, none of these genes was expressed in virus-treated

cultures. Expression by only four genes that are involved in the maintenance of G1 (G1/S

transitioning) was detected uniquely in virus-treated cultures. Most of the genes uniquely

expressed following virus treatment, including protein phosphatase 2A (PP2A), breast cancer 1

(BRCA1), and growth arrest and DNA-damage-inducible (GADD45) genes, were involved in

arresting cell cycling at the G2/M checkpoint (Fig. 2-4).

2.3.8 Altered Protein Expression in Macrophages Treated with Virus.

To determine the effect(s) on protein expression in MDM of treatment with a CCR5 strain of HIV-1, >1,000 proteins from virus- or mock-treated cultures were assayed and ranked based on changes. High-throughput Western blot screening with monoclonal antibodies evaluated levels rather than posttranslational modifications, including phosphorylation, which can be critical determinants of function for some proteins. Overall, 300 proteins had detectable differences of ≥1.5-fold in expression in virus-treated MDM from each donor, including ~50 proteins that can have a functional role in regulation of the cell cycle or cell proliferation. A subset of proteins is presented in Fig. 2-5. For example, ubiquitination protein (UbcH6 and

UbcH7) levels were reduced, while the levels of retinoblastoma binding protein 4 (RBBP) and interferon-induced protein kinases (p38 MAPK and ERK) and a related signal transducer and activator of transcription factor, STAT 5A, were induced. Cell cycle control was modified following virus treatment of macrophages through increased levels of MCC (a negative regulator of cell cycling) (Chan and Yen, 2003;Sudakin et al., 2001), in combination with repression of

PP2A catalytic alpha subunit, the nuclear Dbf2-related (Ndr) family of protein serine-threonine kinases (negative regulators of CDK1 required for completion of the cell cycle) (Tamaskovic et al., 2003), and BM28 (a protein associated with cell division) (Todorov et al., 1994).

The overall effects of HIV-1 in MDM non-specific networks of cellular mRNA and

proteins that promote transition from G1 to G2 from our data are integrated in Fig. 2-6. Global

effects include G2 arrest and suppression of mitosis through two pathways. One pathway, as expected, involved the PP2A complex, presumably through a Vpr-dependent mechanism (Elder

et al., 2002;Elder et al., 2001;Goh et al., 1998). Both induction of the PP2A regulatory subunit and repression of the catalytic subunit can promote the enzymatic activity of Wee1 and inhibit the phosphatase CDC25 (Kinoshita et al., 1993), resulting in hyperphosphorylation of CDC2 that leads to G2/M arrest (Krek and Nigg, 1991;Norbury et al., 1991). Inactivation of CDC25 prevents dephosphorylation of CDC2, thus inhibiting mitosis (Goh et al., 2004;Kinoshita et al.,

1993). Induction of mRNA and protein levels of tyrosine 3-monooxygenase/tryptophan 5-

monooxygenase-activation protein, epsilon polypeptide (YWHAE), which locks CDC25, also

promotes G2 arrest (Fig. 2-6). The alternate pathway involves the nonphosphorylated form of the

CDC2/CCNB2 complex. HIV-1 induces BRCA1 and subsequently GADD45 mRNA levels,

which results in the inactivation of CDC2 and G2/M arrest (Jin et al., 2000;Vairapandi et al.,

2002). BRCA1 is a downstream target of Rad3-related protein (ATR) phosphorylation, and HIV-

1 Vpr activates ATR (Arlt et al., 2003;Roshal et al., 2003;Yarden et al., 2002). In addition, higher expression levels of a CDK inhibitor, p21Cip1/Waf1 protein, which blocks the CDK-

activating kinase (CAK) phosphorylation of the cyclin D/CDC2 complex (Bottazzi et al.,

1999;Taylor and Stark, 2001), promoting G2 arrest, was detected in virus-treated relative to

mock. Activation of ERKs by phosphorylation can induce p21Cip1/Waf1 (Auer et al.,

1998;Pumiglia and Decker, 1997), and activation of MEK/ERK is reported to occur in T-cell

lines following infection with HIV-1 (Popik and Pitha, 1998).

2.4 Discussion

The overall impact of HIV-1 on gene expression patterns in MDM is global and complex.

Perturbations by virus clearly distinguished between HIV-1 and mock-treated cultures even though ~0.2% of MDM treated with virus were infected by day 2 and only 10% were infected by day 7. The limited frequency of infected macrophages ex vivo resembles restricted HIV-1 infection of lymphoid tissue macrophages or alveolar macrophages in vivo (Brodie, 2000;Lewin

et al., 1998;Schacker et al., 2001). The number of infected MDM was estimated based on the

premise of one viral DNA copy per cell, although cells in vivo can be infected by more than one

virus (Jung et al., 2002). Even if estimates of infected MDM in our study exceed the actual numbers of cells that harbor virus, interpretation of the data would remain the same. Even though low levels of supernatant p24 antigen or cell-associated viral DNA were detected 2 days following HIV-1 treatment, expression of >400 genes at the mRNA or protein level changed relative to mock treatment. In addition, mutually exclusive expression at day 2 of ~250 genes distinguished virus- from mock-treated MDM. The number of genes in macrophages altered by treatment with a CCR5 strain of HIV-1 in our analyses was similar to the number of genes in primary peripheral blood mononuclear cells or MDM that were altered by CCR5 gp120 treatment (Cicala et al., 2002) but greater than the number of genes in lymphocytic or monocytic

cell lines identified by treatment with CXCR4 strains of HIV-1 (Geiss et al., 2000;Ryo et al.,

1999a;Scheuring et al., 1998). Differences between primary cells and cell lines could reflect methodologies for measuring changes in mRNA or the types of viruses, as well as the possibility that transformed cell lines could have elevated basal levels of expression by genes that are altered in primary cells by HIV-1.

The number of genes expressed exclusively in mock-treated MDM increased over time, suggesting that macrophages in culture are dynamic rather than static. Increases in the number of genes expressed in the absence of virus could reflect actual changes induced by culture conditions or apparent changes reflecting down regulation of genes over time in virus-treated macrophages. Loss of cell viability is an unlikely explanation, because macrophage viability is

>90% for 14 to 21 days following differentiation and infection (Tuttle et al., 2002) in contrast to rapid depletion of CD4 T lymphocytes (Tuttle et al., 2004). Either way, the net effect would be

an increase in the number of genes expressed exclusively in mock-treated MDM over time. Clear

differences between HIV-treated and mock-treated cells occur on day 2, which corresponds to

the completion of first-round replication. The results agree with our earlier data showing that signal cascades are initiated by early virus-cell interactions (Kohler et al., 2003). Expression of mutually exclusive genes over the course of the study provided sentinel biomarkers that characterized the effects of virus treatment on macrophage populations and distinguished unequivocally between mock- and virus-treated macrophages.

Using a systems biological approach, we identified substantial changes in mRNA and protein levels within the HIV-1-treated cultures that might occur exclusively in the small subset of macrophages that were infected directly, in the uninfected bystander cells, or in both types of cells. The possibility of residual CD4+ T lymphocytes in the MDM cultures was ruled out by

flow cytometry and an inability of MDM cultures to support entry or replication by non-

macrophage-tropic viruses (Tuttle et al., 1998). A difference between direct and bystander

effects of virus in macrophage cultures at early time points would be difficult to evaluate,

because so few macrophages were infected and strategies to separate infected from uninfected

macrophages could alter mRNA or protein profiles. Nonetheless, the fact that a distinct subset of

genes was detected in mock-treated MDM cultures suggested that uninfected cells not exposed to virus differed from uninfected cells in virus-treated MDM. Bystander effects could be mediated by cytokine expression from infected cells that would influence neighboring uninfected cells in an exocrine fashion. Alternatively, soluble viral components, such as gp120, could mediate

changes in signal transduction cascades that impact downstream gene expression in the absence

of infection (Cefai et al., 1990;Cicala et al., 2000;Gupta et al., 1994;Kohler et al., 2003;Selliah

and Finkel, 2001).

A number of genes that were reported in other studies as induced or repressed at the mRNA or protein level in monocytic or lymphocytic cell lines infected by CXCR4 strains of

HIV-1 were also detected in our biological systems approach involving primary macrophages treated by a CCR5 strain of HIV-1 (Bartz and Emerman, 1999;Brooks and Zack, 2002;Geiss et

al., 2000;Geleziunas et al., 1994;Kuhn et al., 2001;Ryo et al., 1999a;Wahl et al., 2003;Wainberg

et al., 1997;Wang et al., 1999;Zhang et al., 1999). Similarities among genes that were induced or

repressed during treatment of primary human macrophages or cell lines by CCR5 or CXCR4

strains of virus, respectively, suggest that elements of virus-host cell interactions are highly

conserved regardless of the viral envelope, the coreceptor preference, or even the cell type

infected, which could have implications for developing novel therapeutics.

Normal macrophage differentiation involves G1 arrest (Xaus et al., 2001), which would

explain preferential expression of genes mediating the maintenance of G1 phase in mock-treated

MDM in our studies. Even though differentiated cells are typically defined as nondividing or

nonproliferating, differentiated cells can maintain a capacity to shift in their cell-cycling state

following adequate stimulation (Latella et al., 2001). Our data are consistent with studies that

indicate alteration of the cell cycle stage in macrophages by HIV-1 infection and suggest that the

intracellular environment of cells no longer in G1, rather than cell division itself, plays a role in

virus replication in nondividing cells, such as macrophages (Goh et al., 2004;Schuitemaker et al.,

1994a;Wang and Lewis, 2001). G2/M arrest in lymphocytes is critical for optimal gene

expression by long terminal repeats (Argyropoulos et al., 2004;Zack, 1995), while transition

from G1 to G2 in both lymphocytes and MDM correlates with enhanced HIV-1 replication

(Gummuluru and Emerman, 1999;Subbramanian et al., 1998;Felzien et al., 1998). An ability by

HIV-1 to mediate transition from G1 to G2 could contribute to the fitness of viruses in MDM

(Goodenow et al., 2003), although G2-dependent enhancement of long-terminal-repeat-mediated gene expression in macrophages is unclear. The theme of virus-induced cell cycle arrest, specifically in G2/M, is not unique to HIV-1. For example, reovirus and herpes simplex virus also mediate G2/M arrest via the CDC2-cyclin B pathway (Elder et al., 2001;Hobbs and DeLuca,

1999;Poggioli et al., 2002). A virus-dependent transition from G1/S to G2/M in macrophages could impact MDM physiology and function and contribute to immune dysfunction. The potential for more extensive involvement with the cell cycle by HIV-1, beyond the known role of

Vpr, warrants further examination.

Patterns of induced or repressed genes identified within virus-treated MDM cultures have dynamic implications for a cascade of downstream effects that can alter cellular physiology. Our studies focused on global differential gene expression induced in association with the viral replication cycle, similar to the global effects associated with gp120-macrophage interactions

(Cicala et al., 2002;Wahl et al., 2003). In contrast to approaches that analyze single genes or pathways, global analysis provides an overall view of networks and interactions between known and novel genes and can provide insight into macrophage physiology and immune deficiency.

A. B.

Figure 2-1. Kinetics of viral replication and spread in macrophages. A) Supernatant p24 antigen. B) Number of gag DNA copies per 103 cells. The data are means, with error bars representing standard errors of the mean for triplicate donors.

Day A. 247 B. A Early (E) Intermediate (I) 4 4 B 2 2 0 C 0 B -2 -2 -4 -4

C 4 4 2 2 0 I 0 E -2 -2 -4 -4 D Late (L) 4 4 2 2 E 0 H 0 D F -2 -2 G -4 -4 24 7 24 7 H Day Day I

-4 -2 0 2 4

Figure 2-2. Clustering of genes perturbed by HIV infection of macrophage. A) Hierarchical agglomerative clustering of ~900 genes based on expression patterns over time. Median induction (red) or repression (green) of expression ranged between +4 and -4 for each gene. Genes were distributed into nine clusters patterns designated A to I (color coded). B) Median induction or repression (n-fold) over time for ~800 genes in six clusters ranged between +2- and -2-fold. Three patterns of induction of gene expression were observed: early (day 2; clusters C, H, and I), intermediate (day 4; clusters B and E), and late (day 7; cluster D).

Figure 2-3. Functional categories for genes expressed exclusively in virus-treated or in mock- treated macrophage cultures. A) Genes that were expressed only in virus-treated or mock-treated MDM cultures were identified by Venn diagram analysis. B) Black bars, genes expressed uniquely in virus-treated cultures; gray bars, genes expressed uniquely in mock-treated cultures; white bars, co-expressed genes.

Table 2-1. Functional categories of genes with altered gene expression in macrophage following viral treatment. Number of genesb Gene Functiona E I L Total Adhesion and extracellular matrix 31 15 6 52 Apoptosis 14 2 5 21 Cell proliferation 20 14 4 38 Cell stress 8 8 1 17 Cell-Cell signaling 21 8 5 34 Chromatin structure 7 3 0 10 Cytoskeleton and cell motility 33 24 12 69 DNA binding protein 7 4 0 11 DNA synthesis and repair 14 8 3 25 Energy metabolism 42 25 14 81 Hematopoetic 3 5 8 16 Immune response 27 17 13 57 Inflammatory and coagulation 10 3 3 16 Ion and solute transport 28 12 7 47 Protein metabolism 31 20 10 61 RNA binding protein 16 3 0 19 Signal transduction 37 19 3 59 Transcription 52 14 5 71 Tumor related 21 7 3 31 Vesicle related 20 10 6 36 Total 465 231 112 808 a Gene function was assigned based on Gene Ontology Consortium categories. b The numbers of genes within each category across all clusters are tabulated. The total number of genes for each category across all clusters is also tabulated in the final column. Only gene categories with ≥10 genes per category are included for six of nine clusters, resulting in omission of some genes. E genes changed during the early (day 2) timepoint; I, intermediate (day 4) timepoint; L, late (day 7) time point.

Table 2-2. Genes increased or decreased in expression by viral treatment. Status Genbank No. Description mRNA Protein Increased M75099 FK506 binding proteind (Ryo et al., 1999b) NM005347 HSP70d (Vairapandi et al., 2002) (Vairapandi et al., 2002) U15655 Ets repressor factor (ERF)d (Ryo et al., 1999a) M13995 BCL2d (Wahl et al., 2003) (Balestra et al., 2001) AA427491 TCR alpha, c region (Gendelman et al., 1989) D87116 MAP kinase kinase 3 (Ryo et al., 1999a) J03909 Interferon-inducible protein (IP-30) (Ryo et al., 1999b) L27584 Ca2+ channel B3 subunit (Ryo et al., 1999b) M13755 Interferon-induced 17/15 kDa (Ryo et al., 1999b) M20681 GLUT3 (Fischer-Smith et al., 2001) M60485 FGF receptor (Ryo et al., 1999b) (Geiss et al., 2000) M61827 Leukosialin (CD43) (Ryo et al., 1999b) (Lewin et al., 1998)

53 M62831 Transcription factor ETR101 (Ryo et al., 1999b) M77476 Helix-loop-helix zipper protein (Ryo et al., 1999b) S63368 TNF receptor 75 kDa (Ryo et al., 1999b) (Brodie, 2000) U09584 IFRD2 (Ryo et al., 1999b) U09848 Zinc finger protein (ZNF139) (Ryo et al., 1999b) U024576 Breast tumor autoantigen (Ryo et al., 1999b) XM055937 HSP27 (Vairapandi et al., 2002) (Vairapandi et al., 2002) NM001228 Caspase 8 (Bartz and Emerman, 1999) (Norbury et al., 1991) Decreased D13748 EF 4A1d (Ryo et al., 1999b) J02683 ADP/ATP carrier proteind (Ryo et al., 1999b) J03191 Profilind (Ryo et al., 1999b) L15189 HSP 75d (Schuitemaker et al., 1994b) L25080 rhoCd (Ryo et al., 1999b) M14630c Prothymosin alphad (Ryo et al., 1999b;Schuitemaker et al., 1990;Gendelman et al., 1989)

Table 2-2. continued Status Genbank No. Description mRNA Protein Decreased M14630c Prothymosin alphad (Ryo et al., Continued 1999b;Schuitemaker et al., 1990;Gendelman et al., 1989) NM000616 CD4d (Goh et al., 2004) (Cicala et al., 2000;Vahey et al., 2002) U90313 GST homologd (Ryo et al., 1999b) X01060 Transferrin receptord (Ryo et al., 1999b) AR201243 MHC-11d (Tuttle et al., 2004) (Kinoshita et al., 1993) AA401111 Glucose phosphate isomerase (Gendelman et al., 1989) AA455931 Adenylosuccinate lyase (Gendelman et al., 1989) AF006082 ARP2 (Ryo et al., 1999b) 54 D11086 IL-2-R gamma (Ryo et al., 1999b) (Jung et al., 2002) J03592 ADP/ATP translocase (Ryo et al., 1999b) L00160 Phosphoglycarate kinase (Gendelman et al., 1989) M27132 ATP synthetase beta subunit (Ryo et al., 1999b) M84326 ADP ribosylation factor 1 (Ryo et al., 1999b) U36764 TGF-beta R-interacting protein 1 (Ryo et al., 1999b) U94855 Translation initiation factor 3 (Ryo et al., 1999b) X54473 COX Vib (Ryo et al., 1999b) X69549 Rho GDP-dissociation inhibitor 2 (Ryo et al., 1999b) X79538 Translation initiation codon nuk34 (Ryo et al., 1999b) Y08890 RanGTP binding protein 5 (Ryo et al., 1999b) Z37166 Nuclear RNA Helicase (Ryo et al., 1999b) a Regulators of cell cycle (boldface underlined). TCR, T-cell receptor; TNR, tumor necrosis factor; GST, glutathione S-transferase; MHC, major histocompatibility complex, IL-2, interleukin-2; TGF, transforming growth factor. b Numbers correspond to citation numbers of publications that have documented induction or repression of these genes at either the mRNA or protein level during HIV-1 treatment. c Addition M26708. d Exact matches based on GenBank accession number

Table 2-3. Differentially expressed genes involved in cell signaling. Unique genesa Cluster analysisb Mock treated HIV-1 treated Early Intermediate Late GeneID Symbol GeneID Symbol GeneID Symbol GeneID Symbol GeneID Symbol 699 BUB1 891 CCNB1 861 RUNX1 25 ABL1 4303 MLLT7 9133 CCNB2 901 CCNG2 430 ASCL2 460426 BAP1 3205 HOXA9 983 CDC2 4085 MAD2L1 1030 CDKN2B 5532 PPP3CB 3688 ITGB1 392 ARHGAP1 701 BUB1B 2242 FES 1020 CDK5 4004 LMO1 1196 CLK2 10200 MPHOSH6 3996 LLGL1 2001 ELF5 1027 CDKN1B 5523 PPP2R3A 5727 PTCH1 4084 MXD1 905 CCNT2 50486 G0S2 6934 TCF7L2 863 CBFA2T3 899 CCNF 51 ACOX1 9322 TRIP10 6795 AURKC 2619 GAS1 694 BTG1 8646 CHRD 1762 DMWD 1029 CDKN2A 5532 PPP3CB 4665 NAB2 7369 UMOD 5127 PCTK1 1033 CDKN3 4504 MT3 10140 TOB1 2242 FES 8379 MAD1L1 55 4839 NOL1 6929 TCF3 5127 PCTK1 6932 TCF7 9810 RNF40 5129 PCTK3 7741 ZNF187 25803 SPDEF 4175 MCM6

Figure 2-4. Impact of viral infection on cell cycle genes in macrophages. Schematic of the cell cycle, with G1, S, G2, and M indicated. Genes expressed differentially by cluster analysis or mutually exclusive analysis in mock- or virus-treated MDM cultures are listed below the G1/S and G2/M checkpoints. Genes marked + promote progression through cell cycle checkpoints. Genes marked – inhibit progression through the cell cycle checkpoints. Time points at which genes were detected are indicated in parentheses: early (E), intermediate (I), and late (L).

Figure 2-5. Altered protein expression in macrophages. Expression levels of representative proteins determined by PowerBlot analysis from mock (−)- or HIVJRFL (+)-treated monocyte-derived macrophages. Digitally captured images of all blots from duplicate runs were semiquantitated for changes compared to relative controls (indicated in parentheses). Proteins with changes >1.5 were confirmed on duplicate verification blots.

Figure 2-6. Summary of viral impact on cell cycle regulators in macrophages. Progression through G2 is regulated by phosphorylation states of the CDC2-cyclin B2 complex. Reversible phosphorylation reactions of the CDC2-cyclin B2 complex determine active (phosphorylated) or subsequent inactive (hyperphosphorylated) states. Hyperphosphorylated CDC2-cyclin B2 complex can be reactivated through dephosphorylation catalyzed by CDC25. HIV-1 exposure induces the expression of cell cycle regulators (PP2A, BRCA1/GADD45, p21Cip1, and YWHAE) involved in arresting MDM in G2. Inactive CDC2-cyclin B2 complex is promoted in HIV-1- treated cells (boldface arrows). Red indicates factors increased in expression and green indicates factors decreased in expression relative to mock. Ovals, diamonds, and hexagons indicate whether differentially expression was detected at the level of mRNA, protein, or both, respectively.

CHAPTER 3 NETWORK ANALYSIS REVEALS HIV-1 ACTIVATES MACROPHAGES INDEPENDENT OF TOLL-LIKE RECEPTORS

3.1 Introduction

Macrophages play a central role in the immune response and are major targets for chronic

infection with viruses such as HIV-1. Infected macrophages constitute a stable viral reservoir

that can facilitate spread of virus to other compartments (Khati et al., 2001;Fischer-Smith et al.,

2001;Ho et al., 1994;Schuitemaker et al., 1994b;Adams and Hamilton, 1992). In addition, activation of infected and uninfected macrophages can contribute to viral pathogenesis (Del et al., 2001). Macrophage activation is determined primarily by modulation of gene expression in response to a stimulus (Burke B and Lewis CE, 2002;Adams and Hamilton, 1984). HIV-1 induced activation of macrophages involves multiple signaling cascades responsible for reprogramming the transcriptome and the proteome of host cells. HIV activates macrophages via parallel signaling pathways, including GPCR, calcium, PYK2, STATs, and MAPK among others

(Lee et al., 2003;Lee et al., 2005;Arthos et al., 2000;Kohler et al., 2003;Del et al., 2001;Melar et al., 2007;Del et al., 2001). Identification of signaling pathways activated by HIV typically use isolated viral factors to reduce the complexity of events occurring within the host cell. For example, treatment of plasmacytoid dendritic cells with purified HIV-1 genomic RNA activates innate Toll-like receptors (TLR), located within endosomal compartments, resulting in the activation of signal transduction cascades and the release of anti-viral cytokines, such as IFN-α and TNF-α (Beignon et al., 2005).

Signaling pathways interface with one another through “hubs”, which are typically enzymes that participate in multiple signal transduction pathways . Hubs provide crosstalk between pathways by amplifying signals resulting from external stimuli and increasing the

complexity of transcriptional response machinery translocated to the nucleus. Hubs also serve an important role in leukocytes, by transmitting signals through several functional signaling pathways to the nucleus. For instance, if a signal is blocked by chemical or biological inhibition, allelic variation, or absence of signaling partner from using a particular pathway, hub proteins provide redundancy to signaling networks ensuring a signal is transmitted to the nucleus (Citri and Yarden, 2006). In some cases, alternative signaling pathways have resulted in similar transcriptional results (Montmayeur et al., 1997).

Recent advances in technology and annotation databases contribute significantly to pathway analysis of large scale genomic and proteomic studies of viral-host cell interaction

(Coberley et al., 2004;Vazquez et al., 2005). The novelty is that this approach assimilates functional genomic, intracellular proteomic, and secreted cytokine profiles upon whole viral stimulation of primary macrophages. Our analysis strategy included previously identified signaling pathways activated by virus, or viral components, including gp120 and Nef, and assimilates these pathways into a single systematic network interfacing at molecular hubs. The systems biology approach, combined with functional studies, was extended to evaluate a role for

TLR signaling pathways, a family of cellular receptors that recognize general molecular patterns of microbes and induce an inflammatory response in virus/macrophage interactions. Activation of macrophages by HIV-1 occurs independently of TLR signaling. The work presented in this chapter is a manuscript that is prepared to be submitted for publication (Brown et al.).

Furthermore, the data in this chapter have recently been presented at the Cell Signaling and

Proteomics Keystone Conference and received with positive feedback.

3.2 Experimental Design

HIVJR-FL stocks were prepared as described in Appendix A.1, and used to infect monocyte- derived macrophages (MDM) from 4 donors (Appendix A.2). A mock-treatment was also

applied to MDMs to serve as background control (Appendix A.1). Cells were lysed 2, 4, and 7

days post-treatment, and RNA was isolated, prepared for hybridization to Affymetrix

THP-1 cells were prepared (Appendix A.5) and treated with LPS, HIVAD (Appendix A-1),

or left untreated (Appendix A.6). Whole cell lysates were probed for IRAK-1 via western blot

(Appendix A.10). PHA-stimulated or unstimulated PBMC were used as a positive control in the

cell proliferation assays using CFDA-SE (Appendix A.12). MDM were labeled with CFDA-SE

in the same fashion, allowed to adhere overnight, and then either treated with HIVAD or left

untreated for 10 days. Cells were fixed and analyzed through flow cytometry (Appendix A.12).

3.3 Results

3.3.1 Temporal Expression of Genes in HIV-treated Macrophages.

To determine the global impact of HIV-1 on the temporal expression of genes, mRNAs

from macrophages treated with a CCR5-using virus, HIVJR-FL, were analyzed using Affymetrix

GeneChip HG-U95A arrays. Fold-change ratios in mRNA levels were calculated by comparison

of individual probe set hybridization signal intensity values from HIV-1-treated versus mock- treated macrophages. Through database queries, a subset of probe sets that varied by more than

5-fold relative to mock cultures in any given donor was selected and utilized in hierarchical agglomerative clustering (Fig. 3-1A). Based on temporal expression patterns, probe sets fell into nine major clusters defined by letters A through I.

Patterns of expression over time for six of the nine clusters containing 70% of probe sets were represented graphically as waveforms, which displayed median change for the population of genes within each cluster (Fig. 3-1B). Relatively higher expression levels were detected for probe sets on day 2 (Early) in clusters B, C, D, and G in the HIV-treated samples compared to mock, and subsequently decreased on day 7. A second pattern of gene expression where median values remained near baseline relative to mock cultures, but increased by day 7 (Late) was observed in Clusters E and I. A majority of probe sets incorporated in the cluster analysis were categorized as Early in the waveform expression analysis. Different expression profiles were observed by HIV treatment over time, demonstrating the temporal and dynamic nature of macrophage gene expression in the presence of virus.

3.3.2 HIV Activates Genes Involved in Calcium Signaling.

Calcium signaling is a recognized hallmark for activation of host cells and an immediate response to viral recognition (Freedman, 2006). Collective analyses of temporal expression or mutually exclusive expression of probe sets represent cellular factors that fit into a calcium- dependent signaling pathway cascade (Fig. 3-2A). The Gene Ontogeny Consortium (GO) assigned a biological process that involves calcium signaling to 266 probe sets from the HG-

U95Av2 GeneChip. Our analysis detected 33 of 266 probe sets involved in calcium signaling altered by virus. Increased expression of Protein Kinase C (PKC), which plays an important role in calcium signaling, was observed at both the gene and the protein level.

Genes altered in expression and involved in calcium signaling were not representative of a single temporal/waveform cluster. Instead, probe sets from multiple clusters involved in the calcium pathway were altered. Overall, a majority of these probe sets were expressed at a relatively high level early on day 2 and decreased over time (Fig. 3-2B). The release of calcium

from both intracellular and extracellular reservoirs leads to the activation of multiple signaling pathways, including apoptosis and MAPK.

3.3.3 Temporal Activation of Apoptotic Signaling Pathways by HIV in Macrophages.

Macrophages treated with HIV-1 are relatively resistant to apoptosis compared to other cellular targets of the virus, particularly lymphocytes (Aquaro et al., 2002;Goodenow et al.,

2003). Overall, factors involved in apoptosis tended to have enhanced expression upon HIV-1 treatment within 2 days (Fig. 3-3A). The HG-U95Av2 GeneChip contained 368 probe sets

involved in apoptosis as annotated by the GO, and 38 of these probe sets were altered in our

studies. Similar to the calcium pathway, expression levels of probe sets changed over the course

of 7 days of viral spread (Fig. 3-3B). Genes that promote apoptotic events had high levels of

expression within 48-hrs of virus treatment [the early time point], and subsequently declined by

day 7 (Fig. 3-3C). In contrast, probe sets that promote survival by suppressing apoptosis

displayed relatively low expression levels on day 2 [early] that increased by days 4 and 7.

Consistent with transcriptome observations, analysis of the intracellular proteome also identified

increased levels of pro-apoptotic proteins, such as Bad, Apaf-1, and Caspase-7, within 2 days of

viral spread (Fig. 3-3D). Multiple factors in the MAPK pathway, including as JNK, MAPK8IP1,

and NF-κB, mediate apoptotic responses. Modulation of MAPK factors by both calcium and apoptotic signal transduction cascades led us to investigate the MAPK signaling pathway.

3.3.4 HIV Activates the Mitogen-activated Protein Kinase (MAPK) Pathway.

MAPK activation is required for efficient production of infectious viral particles and to

support HIV-1 spread in culture (Muthumani et al., 2004;Popik and Pitha, 1998;Shapiro et al.,

1998). Viral treatment had a global effect on MAPK signaling affecting three major MAPK

groups, ERK, JNK, and p38 (Fig. 3-4A). Each level of the MAPK pathway, from surface receptors to transcription factors, was altered by HIV-1 treatment. From a global perspective,

HIV-1 has an overall inductive effect on the steady-state expression levels of factors involved in

MAPK signaling in MDM within the first 4 days of virus treatment (Fig. 3-4B). Figure 3-4C is a

representative panel of induced proteins involved in MAPK signaling cascade. By 7 days post-

treatment, the relative increased levels in expression observed in the early time point decreased,

again demonstrating the temporal response of host cell transcriptome and proteome to viral

treatment.

3.3.5 HIV Induces Expression and Secretion of Type-2 Cytokines/Chemokines in Macrophages.

Activation of either the calcium pathway or the MAPK pathway results in the induction

and secretion of cytokines (Lee et al., 2005). Affymetrix studies determined greater than 2-fold

changes in mRNA levels for four cytokines/chemokines (IL-1a/b, TNF-alpha, RANTES, GM-

CSF), and six cytokine receptors (IL-6, IL-12, IL-3, IL-10, IL-4, and IL-5). Notably, these

specific cytokines/chemokines collectively define a predominant type-2 cytokine response

(Table 3-1). Subsequent studies were performed on supernatants of cultured macrophages from

two independent donors using Luminex detection system to provide confirmation of the

Affymetrix results and offer assessment of an additional 10 cytokines/chemokines, half of which

potentially have altered expression/secretion levels induced by interaction with HIV-1 (Cotter et

al., 2001;Fantuzzi et al., 2001;Fantuzzi et al., 2000). Results are summarized as average fold-

changes compared to mock-treated cultures (Fig. 3-5). A 6-fold increase in levels of secreted IL-

6, a type-2 cytokine, by 14 hrs post treatment was detected in macrophages treated with HIVJR-FL compared to mock-treatment. In addition, an immediate increase within 2 hrs of treatment in

MIP-1α secretion and a delayed reduction in secreted levels of MCP-1 by 26 and 38 hrs was detected.

3.3.6 Activation of Macrophages is Independent of Cell Proliferation.

Cell proliferation is a marker of cellular activation, and a requirement for most retroviruses to establish infection. Although HIV-1 is capable of crossing the nuclear envelope of terminally differentiated cells, T lymphocytes must be activated to support viral spread. As we have described earlier, terminally differentiated macrophages become activated upon treatment with

HIV-1. Several groups have reported macrophages transition through the cell cycle in the presence of HIV-1 spread in vitro (Schuitemaker et al., 1994a;Wang and Lewis, 2001;Coberley et al., 2004).

MDMs cultured in the absence of HIV-1 for 7 days fail to proliferate, indicated by a single peak of fluorescence (Fig. 3-6A). Similarly, MDMs supporting an HIV-1 spreading infection possess the same parent peak of fluorescence observed in untreated MDMs (Fig. 3-6B). As a positive control, PBMCs were stained with CFSE and subsequently stimulated with PHA or left untreated for 4 days. A single peak of fluorescence was observed from untreated PBMCs (Fig. 3-

6C). In contrast, only 4% of the PHA-stimulated PBMCs possessed the same fluorescence intensity observed in the untreated sample, indicating a small minority of the cell population failed to proliferate in response to PHA stimulation (Fig. 3-6D). A majority of PHA-stimulated

PBMCs formed six discrete peaks of less fluorescent intensity than the parent peak, resulting from proliferation and dilution of signal intensity. PHA-stimulated PBMCs double approximately every 16 hours. These results demonstrate that MDM fail to divide in either the presence or absence of virus and that activation of MDM by HIV-1 treatment is independent of cell proliferation.

3.3.7 HIV Activates Macrophages Independent of Toll-like Receptors (TLR).

TLRs signal through two major pathways: MyD88-dependent pathway, used by all TLRs, and MyD88-independent pathway. MyD88-independent pathway is only used by TLR3 and

TLR4, which recognize dsRNA motifs and LPS, respectively. Both pathways incorporate adapter

molecules that bring kinases in close proximity to each other to transfer activation. The HG-

U95Av2 GeneChip contained 27 probe sets involved in the TLR signal pathway. The genomics

and proteomic analyses identified only 3 factors within this pathway, including NF-κB that is not

restricted to the TLR pathway, as altered in expression (Fig. 3-7).

To determine if HIV activates TLR signaling in cells of the macrophage lineage,

hyperphosphorylation and degradation of IRAK-1, a kinase that is immediately phosphorylated

upon MAMP recognition, was assayed. We used a monocytic cell line, THP-1, differentiated

into a macrophage-like morphology. CCR5-using HIV-1 infects and replicates in THP-1 cells

with similar kinetics and magnitude to primary macrophages (data not shown). LPS stimulation

of THP-1 cells activated IRAK-1 within 30 minutes, followed by rapid degradation of the

hyperphosphorylated form of IRAK-1 (Fig. 3-8A). In contrast to LPS stimulation, CCR5-using

HIV-1AD failed to induce phosphorylation or degradation of IRAK-1 in THP-1 cells (Fig. 3-8B).

Primary monocyte-derived macrophages were sensitive to LPS stimulation of IRAK-1

hyperphosphorylation (Fig. 3-8C), although the kinetics of phosphorylation and degradation appeared slower than in THP-1 cells. Nonetheless, primary macrophages treated by HIV-1AD

displayed no change in phosphorylation or stability of IRAK-1 (Fig. 3-8D).

TLR-signaling in macrophages can induce release of type-1 cytokines and type I

interferons. Primary macrophages were capable of secreting IFN-β in response to LPS or

Poly(I:C) treatment, HIVAD treatment failed to produce detectable levels of secreted IFN-β (Fig.

3-8E).

3.4 Discussion

The impact of HIV-1 on macrophage immunologic function is both broad and complex.

Through our global strategy, we have identified many interrelated events, including several networks that both antagonize and synergize the impact of HIV-1 on macrophages. HIV-1 induces activation of macrophages resulting in an altered immune response, beginning with initial interactions with CD4 and coreceptor CCR5 to internal signaling pathways that result in regulated expression of cytokines, chemokines, and their respective receptors (Fig. 3-9).

The activation of intracellular calcium pathways in macrophages demonstrated in our

Affymetrix study, confirms previous reports in which increased calcium levels were elicited by

Tat or gp120 (Lee et al., 2003;Liu et al., 2000;Mayne et al., 2000). Calcium signals are important regulators of many functions including innate host defense and secretory responses such as cytokine production, implicating their importance in HIV pathogenesis (Stafford et al.,

2002;Qiu et al., 2002). In contrast to other studies that assess single pathways or molecules, our study provides a global view in “time and space” of multiple altered immune functions in primary macrophages induced by HIV-1 identified through changes in mRNA expression, intracellular protein levels, and secreted cytokine profiles.

Macrophages represent an important long-lived reservoir for HIV-1 infection (Aquaro et al., 1997;Aquaro et al., 2002;Balestra et al., 2001;Goodenow et al., 2003). Our studies identified temporal expression profiles of apoptotic factors. An increase in expression of pro-apoptotic genes and a decrease in anti-apoptotic genes early in infection may represent a host response to viral infection. Infected cells may induce pro-apoptotic factors to prevent viral spread to neighboring cells. Within four days, the pattern of expression for apoptotic genes changes relative to the early time point. Viral factors appear to dominate over macrophage defenses ensuring host survival. Anti-apoptotic genes are expressed at a higher level in virus treated than

mock by the intermediate time point, and the pro-apoptotic genes appear to be shutting down.

The ability to extend the host’s life is advantageous to viral pathogens as it perpetuates their own existence.

Interaction through a TLR characteristically leads to the classical activation of macrophages and altered expression of the IFN responsive genes. Signaling through the toll-like receptors (TLR), however, was unchanged. Viral activation of macrophages through TLR- dependent and independent pathways appears cell type-specific (Malmgaard et al., 2004). In mice, for example, ssRNA from HIV and influenza is recognized by muring TLR7 and human

TLR8 (Heil et al., 2004). Viruses, such as influenza, have evolved strategies to sequester dsRNA to avoid the activation of antiviral pathways (Diebold et al., 2003). Other viruses, such as human

Rhinovirus, are recognized by TLR but prevent the IRF-3 transcription factor from effectively dimerizing and interacting with promoter elements (Peng et al., 2006). In our assays, no detectable changes in activation of any TLR were observed within MDM upon HIVJRFL- stimulation, despite observing altered expression in multiple signal transduction pathways previously identified to be activated by HIV-1 (Fig. 3-9). TLRs that detect viral infection sense nucleic acids present in endosomal compartments and are expressed by MDM (Akira, 2006).

HIV-1 particles densely packed in endosomal compartments have been observed by electron microscopy in MDM (Gendelman et al., 1988). Although the main route of entry for HIV-1 is receptor-mediated envelope fusion, viral particles are believed to both enter and exit MDM via endosomal vesicles (Verani et al., 2005). An explanation for the evasion of TLR recognition may be that viral particles within endosomal compartments are resistant to lysosome-mediated degradation. If the viral particle is uncoated through lysosome fusion, the viral genome remains tightly bound to viral nucleocapsid, which may protect the nucleic acid from being recognized by

TLR. Finally, it is possible that viral dsRNA is accessible to and detected by TLR3 subsequent to

entering the endosome. However, as with Rhinovirus, an HIV viral factor may be responsible for

shutting down IRF-3 transcription factor activities, following receptor recognition, by preventing

IRF-3 dimerization and/or nuclear translocation.

Alterations in NF-κB signaling were observed and appear to be mediated by multiple

events converging on NF-κB. NF-κB plays a key role in the production of cytokines and the

induction of immune response genes (Janeway et al., 2001), including TNF-alpha, which can

enhance HIV-1 replication (Swingler et al., 1992). HIV-1 LTR has binding sites for NF-κB

within the viral promoter which can also lead to enhanced viral replication (Swingler et al.,

1994). The observed disturbances in NF-κB signaling emphasize the complex events that are

induced by HIV-1, such as STAT activation (Kohler et al., 2003), that are responsible for

regulating NF-κB signaling during HIV-1 pathogenesis. Receptor tyrosine kinase RON, a critical

negative regulator of macrophage function and inflammation, inhibits HIV-1 proviral

transcription in part by decreasing the binding activity of NF-κB (Lee et al., 2004). While we

noted altered regulation of NF-κB, the role of RON in our studies was not determined as this

protein is only expressed in tissue resident macrophages (Correll et al., 2004). Further studies

will focus on this pathway in depth to elucidate the precise mechanisms of viral interaction with

this genetic network.

A major effect of HIV-1 on MDM is to inhibit chemotactic abilities by perturbing both

chemokine and chemokine receptor expression, in particular the CC chemokines. Several

cytokine transcripts involved in mediating the switch from a type 1- to a type 2- cytokine

response were detected during the course of infection (Table 3-1). These observations fit well

with the theory that one of the major mechanisms of immune system evasion by HIV is to push

the immune response towards a type 2- mediated humoral response, thus circumventing cell

mediated immunity that is critical for eliminating virus infected cells (Levy JA, 1998). Our

studies demonstrate that HIV-1 can rapidly induce, within 2 days, secretion of type 2 cytokines,

such as IL-6, from macrophages independent of T-helper cell interactions. Thus, macrophages

secrete cytokines that can modulate an immune response, contributing to a shift from a type 1- to

a type 2- milieu. While the collective cytokine milieu remains unchanged initially in vivo, due to

higher levels of type 1 cytokine secretions from T-helper cells, the loss of CD4+ T cells

characteristic of progression to AIDS leads to a type-2 shift. Type 2 cytokines such as IL-4 and

IL-10 can also impact viral infection by regulating the expression of co-receptors CXCR4

(upregulation) and CCR5 (downregulation), thus promoting the “phenotypic switch” from

CCR5-monotropic to CXCR4-using HIV (Alfano and Poli, 2005). In addition, the lack of changes in a broader spectrum of cytokines and chemokines which would have been an expected result from the interaction of CD40 (on macrophages) with CD40L (expressed on T-cells), further validates the purity of our macrophage isolation, absent of any T-cell contamination.

While the majority of the macrophages express the coreceptor CCR5, a small subset of macrophages expresses CXCR4 (Tuttle et al 1998). Several type 2 cytokines (IL-4 and IL-10) regulate decreased expression of CCR5 while increasing the alternative HIV-1 coreceptor target,

CXCR4. Transforming growth factor-β1, which is elevated in HIV-1-infected individuals, also up-regulates CXCR4 expression on MDMs, which could increase susceptibility of entry by dual- tropic (D-X4) CXCR4-using HIV-1 (Chen et al., 2005). Therefore, changes in cytokine profile can impact co-receptor-dependent viral entry in addition to altering immune response.

Macrophages play a central role in the immune response and are unequivocally major targets for chronic infection with viruses such as HIV-1. Macrophage activation can occur

through a classical or alternative pathway. The classical pathway involves interferon-γ-dependent activation by type 1 mediated responses, a feature of cellular immunity to infection with intracellular pathogens. The alternative pathway is induced by a type-2 mediated response and leads to the production of angiogenic factors, inhibition of T cell responses, and a chronic infection state (Gordon, 2003;McGrath and Kodelja, 1999). Our finding that HIV-1 induces a predominant type-2 cytokine response at both the mRNA level and in secreted cytokine expression patterns demonstrates the subsequent impact virus can have on MDM, leading to an alternative activation of macrophages. An altered activation of macrophages would provide a mechanism to explain the chronic infection characteristic of HIV-1 associated disease, in addition to reduced T cell responses observed in HIV-1 infected individuals.

Our study design, investigating primary macrophages in a T-cell free culture system, emphasizes the fact that macrophages alone can, in part, influence a type-2 shift in cytokine patterns, independent of T-helper cell interaction. Moreover, the alternative activation pathway induced in MDM occurs independent of the activation of a TLR-signaling pathway. The potential role of macrophages in the establishment of immune deficiency associated with disease progression, warrants further studies to determine the cellular proteins and pathways, independent of TLR, involved as possible targets for therapeutic strategies to promote immune reconstitution.

AB Day 2 4 7 4 0 B Early A -4

4 B 0 C Early -4

C 4 0 D Early -4 D 4 0 E Late E -4

F 4 0 G Early G -4 H 4 I 0 I Late -4 -4 -2 0 2 4 2 4 7 Day

Figure 3-1. Clustering of genes perturbed by viral treatment of macrophages. A) Gene expression values from virus-treated MDM cultures were divided by expression values from mock-treated cultures to derive fold-change ratios. Median values were calculated for all four donors and Hierarchical agglomerative clustering with absolute correlation (un-centered) of approximately 900 genes was based on expression patterns over time. Median Induction [red] or repression [green] of expression ranged between +4 and –4 for each gene. Genes were distributed into nine cluster patterns designated A-I [color coded on right Y axis of the dendrogram]. Major branches in the dendrogram were defined by correlation coefficients of greater than 0.75 (mean 0.85, range 0.75 to 0.96). B) Six cluster patterns were selected for further analysis based on their unique temporal expression patterns. Median fold induction or repression over time ranged between +2 to –2 fold. Two patterns of induction of gene expression were observed: early day 2 [clusters B, C, D, and G], and late day 7 [clusters E and I].

Figure 3-2. Viral directed effects on calcium release pathways. A) Model of calcium signaling pathway altered in MDM by 2 days of HIV-1 treatment. Factors expressed at higher levels in HIV-treated than mock are red and factors expressed at lower levels in HIV- treated than mock are green. Ovals represent factors detected at the RNA level and hexagons are factors detected at both the RNA and protein level. ER stands for endoplasmic reticulum. Signaling hubs are depicted with a yellow border. B) Heat map displaying temporal expression of genes whose protein products are involved in calcium signaling over 7 days of HIV-1 treatment relative to mock. The heat map includes the Entrez Gene identification number and the expression cluster that the gene belongs to. Red indicates expression profiles above the mean, black is equal to the mean, and green represents values below the level of the mean.

Figure 3-3. Viral treatment affects expression patterns of members of the apoptotic pathway in primary macrophages. A) Diagram of the apoptotic signaling pathway depicting factors altered in expression within MDM upon treatment with HIV-1 within 2 days. Factors expressed at higher levels in HIV-treated than mock are red and factors expressed at lower levels in HIV-treated than mock are green. Ovals represent factors detected at the RNA level and diamonds are factors detected at the protein level. Signaling hubs are depicted with a yellow border. The orange pentagon represents the effect of virally-encoded Nef on cellular apoptotic machinery. B) Heat map representing expression of genes whose protein products are involved in apoptosis. The heat map includes the Entrez Gene identification number and the expression cluster that the gene belongs to. Red indicates expression profiles above the mean, black is equal to the mean, and green represents values below the level of the mean. C) PowerBlot of apoptotic proteins altered in MDM by HIV-1 treatment. The signal intensity ratio of HIV-treated to mock-treated is indicated for each protein is indicated above the blot.

Figure 3-4. Factors of MAPK pathway altered in expression by virus. A) Diagram describing MAPK pathway including altered genes and proteins following 2 days HIV-1 treatment. Factors expressed at higher levels in HIV-treated than mock are red and factors expressed at lower levels in HIV-treated than mock are green. Ovals represent factors detected at the RNA level, diamonds are factors detected at the protein level, and hexagons are factors detected at both RNA and protein. Signaling hubs are depicted with a yellow border. B) Expression profiles of genes altered by virus treatment over 7 days and.involved in MAPK signaling displayed in a heat map. The heat map includes the Entrez Gene identification number and the expression cluster that the gene belongs to. Red indicates expression profiles above the mean, black is equal to the mean, and green represents values below the level of the mean. C) PowerBlot of MAPK proteins altered in MDM by HIV-1 treatment. The signal intensity ratio of HIV-treated to mock-treated is indicated for each protein is indicated above the blot.

Table 3-1. Induced cytokine profile. Cytokine mRNA Secreted* Type IL-1 α/β + 20 2 TNF-α + 20 2 RANTES + 50 GM-CSF + <7 1 IL-6 R 1000 2 IL-12 R 20 1 IL-15 ND <7 IL-8 ND 5000 2 IL-2 ND <7 1 MIP-1α ND 300 MCP-1 ND 200 IL-3 R <7 IL-10 R <7 2 IL-4 R(L) <7 2 IL-5 R(L) <7 2 IFN-γ ND <7 1 Cytokines: macrophage-typical cytokines (gray); mRNA: virus-induced (+), receptor levels increased (R), no change from mock-treated (ND), occurred late (L). Secreted: virus-induced (bold) * average peak levels (pg/ml)

)

) 10

0 0

1 1

g g

o o

l l

( (

e e

g g

n n a

a 1

h h

C C

d d

l l

o o

F F 0.1 0 10 20 30 40 50 Time (hrs post infection)

Figure 3-5. Induction and suppression of secreted cytokines. Average fold-change in macrophages by HIVJR-FL treatment relative to mock treatment. Symbols: IL-6, diamond; MCP-1, square; MIP-1α, triangle.

Figure 3-6. Macrophage activation by virus is independent of cell proliferation. Cellular proliferation by staining intracellular proteins with the fluorescent stain, CFSE. MDM divisions were measured over 7 days A) in the absence of virus or B) HIVJRFL. As a positive control, PBMC cellular proliferation was analyzed over 4 days C) in the absence of stimulation or D) the presence of PHA.

Figure 3-7. Altered expression of few TLR-specific factors. TLR signaling pathway. Factors expressed at higher levels in HIV-treated than mock are red Ovals represent factors detected at the RNA level. Signaling hubs are depicted with a yellow border.

LPS A. Hours 0.5.7513.25 - 100 kd IRAK-1 -75 kd

actin -42 kd

HIV-1 B. Hours 0.532448 - 100 kd IRAK-1 - 75 kd

actin - 42 kd

LPS C. Hours 0.25.5.75138 100 kd IRAK-1 75 kd Actin 42 kd

HIV-1 D. Hours 0.51382448

100 kd IRAK-1 75 kd

Actin 42 kd E. 2500

2000

(pg/ml) 1500 1 hour β 3 hours 6 hours IFN- 1000

500

0 Untreated LPS Poly(I:C) AD

Figure 3-8. Virus fails to activate innate immune receptors in macrophages. Differentiated THP-

1 cell lysates from A) LPS treatment over the course of 3 hours or B) HIVJRFL treatment over 48 hours were blotted for IRAK-1 and β-actin. MDM cell lysates of C) LPS over 3 hours or D) HIVJRFL for 48 hours were blotted for IRAK-1 and β-actin. E) Supernatant IFN-β released from MDM over 6 hours in the absence of treatment or stimulated with LPS, Poly(I:C), or HIV-1.

Figure 3-9. Summary of signaling pathways altered or evaded by virus. Factors expressed at higher levels in HIV-treated than mock are red and factors expressed at lower levels in HIV-treated than mock are green. Ovals represent factors detected at the RNA level, diamonds are factors detected at the protein level, and hexagons are factors detected at both RNA and protein. Signaling hubs are depicted with a yellow border.

CHAPTER 4 COMPARATIVE METHODS OF PROTEOMIC PROFILING OF PRIMARY MACROPHAGES: IDENTIFICATION OF THE MACROPHAGE ANTIVIRAL FACTOR

4.1 Introduction

For more than 20 years now, CD8+ T lymphocytes have been known to actively contribute

to host defenses against HIV infection through two independent mechanisms. One method

involves the detection and direct lysis of infected cells in an antigen-specific, HLA-restricted

fashion (Yang and Engel, 1993). The other mechanism involves the suppression of viral spread in the absence of cell killing primarily through the secretion of soluble suppressive factor(s) called “CAF” (CD8 antiviral factor) (Levy et al., 1996). Now after more than 20 years of study

“CAF” appears to be mediated by more than a single protein. In fact, “CAF” represents a

cocktail of soluble factors (Zhang et al., 2002;Baier et al., 1995;Cocchi et al., 1995), some of which are still unknown (Verani et al., 2005).

Macrophages also produce antiviral factors upon activation through a wide variety of stimuli, indicating macrophage-associated antiviral factors. Numerous interactions with or stimulations of macrophages are reported to inhibit HIV-1 infections, including: urokinase- urokinase receptor interactions (Alfano et al., 2003), CD40-CD40L interactions (Cotter et al.,

2001;Marzio et al., 2003), stimulation with lipopolysaccharide (LPS) (Verani et al., 1997), and simulation through FcγR (Perez-Bercoff et al., 2003). Macrophages secrete several antiviral factors in response to LPS stimulation that coincide with factors identified in the CAF, and are referred to as “MAF” (macrophage antiviral factors) (Agace et al., 2000;Agerberth et al.,

2000;Cotter et al., 2001;Perez-Bercoff et al., 2003;Verani et al., 1997;Verani et al., 2005).

MAFs include CCR5 ligands: RANTES, MIP-1α, and MIP-1β, which act as CCR5 entry

inhibitors. In addition , several macrophage-specific cytokines, such as type-I interferons (i.e.,

IFN-α and IFN-β), MDC (macrophage-derived chemokine), TNF-α (tumor necrosis factor-

alpha), IL-10 (interleukin 10), and leukemia inhibitory factor (LIF), which also inhibit HIV, are

released in response to LPS. Immunodepletion of these factors from LPS-primed macrophage

supernatants does not completely rescue HIV-1 infection, suggesting other, unidentified factors

are present that also inhibit both CCR5- and CXCR4-utilizing HIV-1 (Verani et al., 2002).

Previously, our lab discovered that HIV-1 infection of primary macrophages completely

evades TLR signaling through MyD88-dependent arm and the proinflammatory response

commonly initiated upon TLR recognition (See Chapter 3). A feature of TLR recognition is

production of antiviral factors that render the host resistant to HIV infection, however, the

mechanism for this inhibitory state is poorly understood. To define the antiviral factors produced

by macrophages in response to TLR stimulation, I designed a study to examine the extracellular

and intracellular proteomes of macrophages. In this study, we compare three different proteomic

techniques and attempt to identify depth, accuracy, and reproducibility of each method. In

addition to LPS, we also used type II interferon (IFN-γ) stimulation as a reference to another

well-characterized macrophage activator, which uses a separate signaling pathway from TLR.

4.2 Experimental Design

Monocytes were prepared through elutriation from healthy donors and differentiated over 7

days in the presence of M-CSF into macrophages (Appendix A.3). To measure the effect of LPS

on HIV infections of MDM, cells were initially treated with 1 μg/ml LPS for 30 minutes or 1

hour (Appendix A.6). Cells were incubated for 24 hours prior to HIVAD-treatment (Appendix

A.1), and viral spread was quantified over 8 days by measuring supernatant p24 levels by ELISA

(Appendix A.2).

To identify if macrophages secreted factors in response to LPS that directly inhibited R5 and X4 viral spread, macrophages were treated with LPS or left untreated for 24 hours and supernatants were collected (Appendix A.15). LPS was inactivated with polymyxin B (PMB).

Single-cycle envelope-pseudotyped viruses were prepared (Appendix A.1), mixed with collected untreated or LPS-primed supernatants, and applied to healthy macrophages (Appendix A.16).

4.3 Results

4.3.1 Lipopolysaccharide Stimulation of Macrophages Inhibits HIV Replication.

TLRs respond to microbial recognition by activating signal transduction cascades that result in the synthesis of antimicrobial and proinflammatory products. To determine the importance of TLR pathway activation during HIV infection, we asked if LPS pretreatment of

MDM could create an antiviral environment in culture that would inhibit viral replication. As a

positive control, HIVAD (M-R5 virus) was applied to MDM untreated by LPS, and virus spread

through culture as expected from numerous studies in our laboratory (Fig. 4-1). In contrast,

MDM primed with LPS for 30 minutes or 1 hour and then incubated for 24 hours prior to virus

treatment became completely resistant to HIV. If MDM were incubated for 48 hours subsequent

to LPS stimulation and then virus was applied, the suppression of viral replication became

attenuated. These results suggest an important role for TLR signaling in controlling HIV spread

through culture.

4.3.2 Lipopolysaccharide-primed Macrophages Secrete Products Important in Controlling Virus.

TLR recognition and activation alters the expression of proteins in both intracellular and

extracellular compartments. To evaluate the contribution of each compartment to viral

suppression, we separated the two and initially pursued factors of the extracellular compartment

because it was a less complex mixture compared to intracellular, based on Coomassie stains

(data not shown). Serum-free supernatants were removed from MDM following 24 hours of no treatment (mock) or LPS treatment. Serum-free conditions are important to maintain minimum protein complexity in the extracellular compartment. Both supernatants were treated with

Polymyxin B (PMB) to inactivate LPS, ensuring any affects caused by supernatants were specific to factors other than LPS.

+ Single-cycle luc viruses pseudotyped with either an M-R5 envelope (derived from HIVJR-

FL) or a D-X4 envelope (derived from HIVMM) were used to measure the ability of viruses identical except for the envelope to enter host cell, integrate into host genome, and express luciferase. DMEM or PMB treated supernatants were mixed with virus and applied to fresh

MDM for 24 hours, washed, and incubated in fresh media for 3 days. Background luciferase levels were measured on untreated MDM. As expected R5 and X4 viruses infected MDM in the presence of DMEM or mock-sup relatively equally well (Fig. 4-2A). Although, LPS-primed supernatants suppressed R5 infection by more than a log, X4 viruses were not inhibited as severely as the R5s. The red dotted line indicates the threshold, determined by previous MDM infections with single-cycle virus, for efficient viral entry.

The effect of complete media, containing 10% FBS, was also measured to determine if starving the cells in a serum-free environment artificially altered the conditions of the experiment. Both R5 and X4 viruses produced similar levels of luciferase between complete media and the complete mock supernatant. Furthermore, the extent of luciferase production in both viruses was similar between complete and incomplete media, indicating the absence of serum does not affect viral infection. A similar trend of viral inhibition was observed in complete

LPS-primed supernatants compared to incomplete LPS-primed supernatants. As a positive control for viral inhibition, LPS was applied to MDM 24 hours prior to virus (LPS-primed).

LPS-primed MDM inhibited both R5 and X4 virus compared to mock supernatants. However,

X4 virus was inhibited to a greater extent, nearly to the background levels. These results indicate that, in addition to R5 entry competitors, MDM secrete antiviral factors in response to TLR4 recognition that attenuate the ability both R5 and X4 to enter target cells (Fig. 4-2B).

4.3.3 Tandem Mass Spectrometry Identification of a Unique High Molecular Weight Band in Lipopolysaccharide-primed Macrophage Supernatants.

Next, we asked what proteomic differences exist between mock and LPS-primed MDM supernatants that could account for this anti-HIV activity. Supernatants were concentrated, separated through SDS-PAGE, and initially stained with Coomassie R250-based dye, called

Imperial Stain, a stain more sensitive than Coomassie Brillant Blue R-250. Three bands were identified in both mock and LPS-primed supernatants of relatively similar staining intensity within the 70 – 100 kD size range (Fig. 4-3A). Interestingly, a band appeared in the LPS-primed lane at ~150 kD that was completely absent in the mock supernatant. The 150 kD size range is considerably larger than nearly all known cytokines, IL-16 being the exception with a MW of

142 kD. Query of the Human Protein Reference Database (HPRD) for known proteins of MWs between 130 and 200 kD resulted in 937 proteins, 20 of which are assigned a role in immune response (Table 4-1). Within the 20 immune response proteins were several complement factors.

Of interest, a defensin, named Attractin, appeared in the query. Other defensins have been identified through proteomic approaches to possess anti-HIV properties (Zhang et al., 2002).

To obtain a sufficient amount of protein to perform MS-MS peptide identification, samples from mock and LPS-primed supernatants were separated in quadruplicate via SDS-PAGE and stained with “MS-friendly” fluorescent dye, SYPRO ruby (Fig. 4-3B). LPS alone was electrophoresed and appeared as a smear between 50 – 60 kD. Bands within the 130 – 200 kD range were excised, trypsinized, and submitted to MS-MS analysis. 18 unique proteins were

identified with >95% confidence (Table 4-2). Number of peptides detected is a common measure

of protein abundance (Shi et al., 2006). 13 proteins were detected in both mock and LPS-primed

supernatants with high probability, 2 proteins detected exclusively in the mock supernatant, 1

protein detected exclusively in the LPS-primed, and 2 proteins with high probability in the LPS-

primed supernatant but with a single peptide was detected with intermediate probability in the

mock supernatant. 8 of the proteins detected had predicted MW considerably lower than the gel

region sliced for proteomic analysis. Several reasons may account for identification of low MW

proteins within high MW regions: (1) different isoforms of the protein may exist, with one form

of high MW, (2) post-translation modifications retard gel migration of proteins, (3) strong interactions with another factor(s) may persist during SDS-PAGE, thus increasing the size of the complex, or (4) database queries could’ve mismatched identified sequenced peptides with the corresponding protein.

4.3.4 Quantitative Intracellular Proteome Analysis of Macrophages via Isotope-coded Labeling of Peptides.

Preliminary iTRAQ experiments were performed to evaluate sensitivity, proteome depth, and variability in peptide detection derived from whole cell lysate by mass spectrometry. MDM were treated with IFN-γ, Poly(I:C), LPS, or media alone (untreated) for 1, 12 or 24 hours.

Isolated proteins from each sample were fractionated by trypsin. Peptides were chemically modified at the N-terminal by the addition of isotope-labeled tags, separated on an analytical column, and analyzed in an LTQ-OrbiTrap. An advantage of performing technical triplicates is the ability to perform statistics across the replicates to measure technical reproducibility.

Initial analysis detected 128 proteins across all four treatments in the first hour time point

with >95% confidence.

4.3.5 Quantitative Intracellular Proteome Analysis of Unlabeled Macrophage Proteins.

Another method of performing quantitative proteomic analysis on MDM was used to provide perspective and comparison to iTRAQ experiments previously performed. Proteins were

extracted from untreated, IFN-γ-, or LPS-treated MDM at 1, 12 or 24 hours across 3 individual

macrophage donors. In contast to iTRAQ, proteins from each sample were separated by 1D SDS-

PAGE. Each gel was sliced into 15 identical molecular weight regions and subjected to in-gel

trypsin digestion. Peptides from each slice were identified by MS-MS analysis. Approximately

1000 unique proteins, based on Entrez Gene accession IDs, were identified from each sample

(Table 4-3). Custom in-house software was developed to generate scores of relative abundance

for proteins based on number of peptides detected and the level of confidence assigned to the peptides.

In previous western blot data, we had identified β-actin as an endogenous control within

MDM because the level of protein expression relative to total protein remained relatively

constant during treatment with either LPS or IFN-γ (data not shown). Upon initial inspection of

the proteomic dataset, β-actin was present in all samples analyzed and observed to have a low

level of variability expression across all samples (Table 4-4). Therefore, all proteins were

normalized to the level of β-actin within the sample and scaled.

Biological reproducibility was determined as proteins present in at least 2 out of 3 donors.

At this time, we have data from 3 donors for the 24 hour time point, so we focused on this time

period. From the peptides detected, the protein identification software had difficulty

distinguishing between isoforms, and would list multiple isoforms for individual protein entries.

Therefore, we used Entrez Gene identification tags to distinguish between individual proteins

and to determine protein counts. For the 24 hour time point, 914, 901, and 978 proteins were

detected in at least 2 out of 3 donors for untreated, LPS, and IFN-γ, respectively. 702 proteins were detected in 2 out of 3 donors, indicating the considerable depth of the proteomic study and large overlap between biological donors.

4.3.5.1 Proteins altered by lipopolysaccharide within 24 hours.

Within 24 hours of LPS treatment, 211 proteins had 2-fold or greater expression levels, and 280 proteins had 2-fold or less expression levels relative to untreated in at least 2 out of the 3 donors. LPS treatment altered the expression of proteins involved in multiple molecular classes assigned by HPRD. From the proteins altered in expression, the largest number of proteins fell into the metabolism category. An interesting protein detected exclusively in the LPS treated samples within 2 donors is Indoleamine 2,3-dioxygenase (INDO). INDO is involved in the metabolism of L-tryptophan to kynurenine (Kyn), which continues continues down the Kyn pathway to form the neurotoxin, quinolinic acid (QA) (Takikawa, 2005).

4.3.5.2 Proteins altered by interferon-γ within 24 hours.

IFN-γ stimulation over 24 hours increased the expression of 240 proteins by 2 fold and decreased the expression of 101 proteins by 2 fold in at least 2 out of 3 donors relative to untreated.

4.4 Discussion

The ability of TLR signaling to completely eliminate HIV-1 spread in macrophages represents important immune defense mechanisms which may lead to novel therapeutic targets.

In response to LPS, macrophages inhibit HIV-1 spread by secreting a cocktail of antiviral factors, called MAF. The identification of the MAF is incomplete, and the functional mechanisms in which they inhibit HIV-1 are poorly understood. In our studies, we observed macrophage secreted factors in response to LPS stimulation inhibited both R5- and X4-utilizing

HIV-1 viral strains. A proteomic shotgun approach yielded several targets, but more studies need

to be conducted to narrow down on anti-HIV-specific factors. In addition, interferon depletion

from supernatants needs to be performed to determine their contribution, along with TNF-α, to

HIV-1 suppression.

Although the antiviral activities of interferons was first described approximately fifty years

ago (Isaacs and Lindenmann, 1957), the mechanism of interferons in host defense remain poorly

understood (Stetson and Medzhitov, 2006b;Stetson and Medzhitov, 2006a;Honda et al.,

2006;van Boxel-Dezaire et al., 2006). Using a whole proteomic approach on primary macrophages activated with IFN-γ has given us a unique perspective into the altered protein expression profiles within mononuclear phagocytes, which contribute to this antiviral effect and may elucidate the mechanisms behind this resistant state.

Currently, we only have data across three donors for the 24 hour time point. From this data set we identified proteins whose expression altered by at least 2 fold relative to untreated in at least 2 of the 3 donors. These proteins were organized into functional categories according to

HPRD molecular class annotations. In the future, we plan to use pathway analysis database software along with other sources, such as Protein Lounge, KEGG, DAVID, Biocarta, and published literature, to organize these proteins altered in expression into a function context.

Using methods similar to our previous microarray studies, we plan to use these functional pathways and interconnected networks containing our data to make inferences on how LPS and

IFN-γ treatment are affecting primary macrophages in culture.

Recently, peripheral blood mononuclear cells (PBMC) and MDM have been observed to secrete IL-27 in response to stimulation with human papilloma virus-like particles. IL-27 was also shown to possess anti-HIV properties by reducing the infectivity of both R5 and X4 HIV-1

(Fakruddin et al., 2007). In this study, supernatants from VLP-treated MDM contained ~25

ng/ml IL-27, which may be too low to detect using a whole proteome approach and may explain why it wasn’t detected in either treatment or in the untreated samples. However, because of IL-

27’s strong antiviral activity, we plan to investigate IL-27 secretion from LPS- and IFN-γ-

stimulated MDM.

3 No LPS 0.5 h LPS/24 h Incubation 1 h LPS/24 h Incubation 1 h LPS/48 h Incubation 3 Log p24 (pg/ml)

2468 Days Post-virus Treatment

Figure 4-1. Lipopolysaccharide-primed macrophages resist viral replication. As a control, macrophages were treated with HIVAD in the absence of LPS treatment (blue diamonds). Macrophages were primed for 30 minutes (orange squares) or 1 hour (green triangles) with LPS and then incubated for 24 hours prior to viral treatment. Macrophages were also primed with LPS for 1 hour and incubated for 48 hours prior to viral treatment (purple squares). Viral spread through the culture was determined by measuring supernatant p24 levels.

Figure 4-2. Macrophages secrete antiviral factors in response to lipopolysaccharide treatment. + MDM treated with single-cycle luc -HIV pseudotyped with either an R5 (HIVJRFL) or X4 (HIVMN) envelope in the presence of DMEM (Incomplete Media), DMEM + serum (Complete Media), untreated MDM supernatants (mock-sup), or LPS stimulated MDM (LPS-sup), or MDM were pretreated for 24 hours with LPS (LPS- primed). A) Graph displays luciferase activity 3 days post viral treatment. Red dotted line indicates the threshold of non-restricted viral entry. B) Percent viral entry relative to mock-sup is displayed in the histogram.

A. B. 12 LPSkD Untreated-sup LPS-sup 250 250

150 150 100 100 75 75

50 37

37 25 20 25 20 15

Figure 4-3. Lipopolysaccharide-primed macrophages produce and secrete a factor unique to untreated MDM that separate out approximately 150 kilodaltons. A) Imperial stain of supernatant derived from untreated MDM (lane 1) and LPS-treated MDM (lane 2). Red arrow indicates the unique band at ~150 kD. Numbers next to bands in the ladder represent molecular weight in kD. B) Sypro Ruby stain of LPS (first 2 lanes), supernatant derived from untreated MDM (lanes 3-6), and supernatant derived from LPS-treated MDM (lanes 7-10).

Table 4-1. Proteins with molecular weight between 130 and 200 kilodaltons assigned a role in immune response. Entrez Gene MW Protein Name Biological Processa Molecular Function ID (kD) CD205 4065 198 Immune Response Receptor Activity Complement component 4A 720 193 Immune Response Complement Activity Complement component 4B 721 193 Immune Response Complement Activity Complement component 4B, telomeric 432395 193 Immune Response Complement Activity Complement component 5 727 188 Immune Response Complement Activity Complement component 3 718 187 Immune Response Complement Activity SIGLEC1 6614 183 Immune Response Adhesion Molecule SmcY 8284 174 Immune Response MHC Complex Natural killer tumor recognition sequence 4820 166 Immune Response Cell Surface Receptor Humoral Immune T Cell Antigen Coiled-coil domain containing 18 343099 164 Response Receptor CD109 antigen 135228 162 Immune Response Unclassified Scavenger receptor M160 283316 159 Immune Response Cell Surface Receptor 96 Attractin 8455 159 Immune Response Defensin Ubiquitously transcribed tetratricopeptide repeat gene on 7404 150 Immune Response Unclassified Y chromosome B cell CLL/lymphoma 9 607 149 Immune Response Unclassified Immunoglobulin superfamily member 1 3547 149 Immune Response Immunoglobulin Interleukin 16 3603 142 Immune Response Cytokine Regulatory/other Complement factor H 3075 139 Immune Response Subunit NALP5 126206 134 Immune Response Unclassified Hypothetical protein FLJ35961 127294 131 Immune Response Unclassified a according to Human Protein Reference Database (HPRD).

Table 4-2. Proteins identified by mass spectrometry from the 150-200 kilodaltons gel slice of untreated and lipopolysaccharide- treated macrophage supernatants of >95% probability. MW Untreated LPS Protein Name Accession Number (kD) (# of peptides) (# of peptides) Alpha-2-macroglobulin precursor IPI00478003 163 24 15 ALB protein IPI00022434 72 17 15 M130 antigen cytoplasmic variant 2 precursor IPI00104074 125 9 13 Ceruloplasmin precursor IPI00027509 122 8 8 Matrix metalloproteinase-9 precursor IPI00027509 78 8 3 Splice Isoform 1 of Complement factor H precursor IPI00164623 139 5 5 Complement C3 precursor IPI00164623 187 6 6 Inter-alpha-trypsin inhibitor heavy chain H1 precursor IPI00292530 101 3 3 Apolipoprotein A-I precursor IPI00021841 31 3 2 Hypothetical protein DKFZp686N002209 IPI00384938 53 3 2 Hypothetical protein DKFZp686104196 IPI00399007 46 3 2 Monocyte differentiation antigen CD14 precursor IPI00029260 40 1* 5 97 EMILIN 2 precursor IPI00012510 116 1* 2 Macrophage mannose receptor precursor IPI00027848 166 2 1 Complement C4 precursor IPI00032258 193 2 2 Inter-alpha-trypsin inhibitor heavy chain H2 precursor IPI00305461 106 2 0 Actin, cytoplasmic 1 IPI00021439 42 0 2 Apolipoprotein E precursor IPI00021842 36 2 0 * 50-79% confidence

Figure 4-4. Covariance and retention time for peptides detected by isotopic-tag labeling. A) Percent covariance of peptides corresponding to Vimentin in the untreated samples for 1, 12, and 24 hours. The bars in the histogram are colored according to peptide: Peptide I is ILLAELEQLK, Peptide II is DNLAEDIMR, and Peptide III is LQEEMLQR. The red dashed line represents the upper threshold for an acceptable covariance percentage. B) Retention time in minutes for Vimentin peptides detected in the untreated sample in each replicate. Samples were run in triplicate, and the retention time for each replicate is grouped. C) Covariance of peptides corresponding to Peroxiredoxin-1 in the untreated samples for 1, 12, and 24 hours. The bars in the histogram are also colored according to peptide: Peptide I is ATAVMPDGQFK and Peptide II is DISLSDYK. The red dashed line respresents the upper boundary for an acceptable covariance percentage. D) Retention time in minutes for Peroxiredoxin-1 peptides in the untreated samples for each replicate. Bars are colored by peptide and grouped by replicate.

Table 4-3. Magnitude of unique proteins identified through gel separation and subsequent tandem mass-spectrometry analysis. Number of Sample Proteins Donor 1 Untreated 1 hr 920 LPS 1 hr 961 IFN-γ 1 hr 974 Untreated 12 hrs 967 LPS 12 hrs 859 IFN-γ 12 hrs 943 Untreated 24 hrs 980 LPS 24 hrs 1034 IFN-γ 24 hrs 998 Donor 2 Untreated 1 hr NA LPS 1 hr NA IFN-γ 1 hr NA Untreated 12 hrs NA LPS 12 hrs NA IFN-γ 12 hrs NA Untreated 24 hrs 1032 LPS 24 hrs 973 IFN-γ 24 hrs 1137 Donor 3 Untreated 1 hr NA LPS 1 hr NA IFN-γ 1 hr NA Untreated 12 hrs NA LPS 12 hrs NA IFN-γ 12 hrs NA Untreated 24 hrs 1077 LPS 24 hrs 1060 IFN-γ 24 hrs 1122 NA: not available

Table 4-4. Magnitude of β-actin expression detected in unlabeled quantitative proteomic analysis. Sample β-acting Donor 1 Untreated 1 hr 9.29 × 1011 LPS 1 hr 8.39 × 1011 IFN-γ 1 hr 1.40 × 1012 Untreated 12 hrs 6.30 × 1011 LPS 12 hrs 6.95 × 1011 IFN-γ 12 hrs 6.31 × 1011 Untreated 24 hrs 1.06 × 1012 LPS 24 hrs 1.11 × 1012 IFN-γ 24 hrs 1.14 × 1012 Donor 2 Untreated 24 hrs 1.61 × 1012 LPS 24 hrs 1.13 × 1012 IFN-γ 24 hrs 1.57 × 1012 Donor 3 Untreated 24 hrs 1.73 × 1012 LPS 24 hrs 1.38 × 1012 IFN-γ 24 hrs 1.82 × 1012

100

CHAPTER 5 DISTINCT GENE EXPRESSION PROFILES IN MACROPHAGES IN RESPONSE TO PHENOTYPICALLY DIFFERENT VIRAL ENVELOPES

5.1 Introduction

Initial interactions between HIV-1 and target cell involve the recognition of host cell proteins that serve as the primary receptor, CD4, and one of two coreceptors, CCR5 and CXCR4, by the viral envelope glycoprotein, gp120 (Berger et al., 1999). Both CCR5 and CXCR4 are expressed on the surface of the two major cellular targets for HIV infection, T-lymphocytes and macrophages. HIV strains are phenotypically classified by both the coreceptor they use to mediate entry (R5 uses CCR5 only, X4 uses CXCR4 only, and R5X4 uses either), and the target cell type that supports spread (T for viruses that spread in T-cell lines, M for viruses that spread in macrophages, and D for viruses that display dual tropism) (Goodenow and Collman, 2006).

The engagement of gp120 and host receptor complex activates several signal transduction pathways, including G-protein, calcium, PI3K, PYK2, STATs, AKT, and MAPKs (Lee et al.,

2005;Lee et al., 2003;Conti et al., 2004;Kohler et al., 2003). The gp120-induced activation of

signaling cascades results in the production of several cytokines, including MIP-1α, MIP-1β,

RANTES (Fantuzzi et al., 2001), IL-10 (Gessani et al., 1997;Borghi et al., 1995), and TNF-α

(Lee et al., 2005), which potentiate the spread of virus by attracting other cellular targets for

infection. Differences in the magnitude of Ca2+ ion mobilization between macrophages exposed

to R5 envelopes compared to X4 envelopes have been observed (Arthos et al., 2000;Lee et al.,

2003). CCR5 signaling is required for successful establishment of viral infection in both

macrophages and lymphocytes (Lin et al., 2006;Alfano et al., 2001;Guntermann et al., 1999;Lin et al., 2005), despite macrophages and lymphocytes possessing inherent differences in cellular

signaling machinery (Goodenow et al., 2003).

101

The purpose of this study is to investigate the cellular response by macrophages to exposure to HIV envelopes of different coreceptor requirements. In particular, we focused on similarities in the response to envelopes that use different coreceptors for entry. Similarities

between envelopes of different coreceptor specificities represent genes whose enhanced

expression may be required for the establishment of infection. The initial interactions between

viral envelope and host cell receptor complex initiates signaling cascades that set up an

intracellular milieu favorable to the establishment of viral infection. Cellular responsive factors

required for productive viral infection represent therapeutic targets, which are not limited by the

high mutational escape frequency observed within HIV. A subset of X4-utilizing envelops are

incapable of allowing viral entry within macrophages. Differences between envelope responses

may represent targets required to mediate the successful completion of lipid bilayer fusion and

entry of the preintegration complex.

5.2 Experimental Design

Monocytes were isolated from 7 healthy donors and differentiated into macrophages

(Appendix A.2). MDM were treated with gp120 from three phenotypically different HIV-1

strains: M-R5 (HIVBaL), D-X4R5 (HIVSF2), and T-X4 (HIVIIIB) (Appendix A-13). Cells were

lysed following 6, 15, or 24 hours of treatment and RNA was isolated and prepared for

hybridization to HG-U133A (Appendix A.14) [6 donors] or to HG-U95Av2 Affymetrix

GeneChips [1 donor].

5.3 Results

5.3.1 Quality Control of GeneChip Experiments.

Insufficient macrophage yield from one donor (donor 4) permitted analysis of only a

single time point. Preliminary data from an earlier donor (donor 1) measured by an earlier

version GeneChip (HG-U95Av2) indicated the majority of differences in MDM gene expression

102

following gp120-treatment were detected at the 15 hour time point (data not shown). Therefore,

only the 15 hour time point was hybridized for donor 4, for a total of 64 microarrays. GeneChips

for donors 2, 3, and 4 were all performed at the same time, donor 5 was run alone, and donors 6

and 7 were performed together.

Multiple quality control procedures were used to determine the success of GeneChip experiments. Probe set present, marginal, and absent (P/M/A) calls reflect the detection status of particular transcripts on the array. As a first screen of the data, the distribution of probe set

P/M/A calls across arrays was determined. (Fig. 5-1A). Most arrays for donors 2, 3, 4, 5, and 6 had similar distributions of probe set calls. In contrast, approximately 70-80 percent of probe sets

on nearly all of the donor 7 arrays received absent calls. A single array in the donor 6 also

possessed a large percentage of absent calls, ~70%- give exact % since it is one array.

Another indication of the poor quality of these arrays was the overall high level of

fluorescence on the arrays. Despite the large percentage of absent calls, the median signal

fluorescent intensity tended to be considerably greater for the donor 7 (and one array of donor 6)

arrays compared to the other donors (Fig. 5-1B). In addition to a relatively high intensity, the

variability of the signal on these arrays was much narrower overall, indicating poor hybridization

quality. Error bars in figure 5-1B, representing the 25% and 75% quartile ranges, indicate that

donors 2-6 have similar variability in signal intensity. In contrast, donor 7 has a narrow

distribution with values that tend to be greater than the other donors. The standard deviation of

the data supports this interpretation (Fig. 5-2A). The maximum signal intensity values on the

donor 7 arrays were generally much lower than on the other donors which correlates with the

broad distribution of the other donors compared to donor 7 (Fig. 5-2B).

103

As the arrays for donor 7 and the single donor 6 at 24 hours failed to meet the inclusion criteria, they were excluded from further analyses. Complete data for donors 2, 3, and 5 were used to perform an ANOVA while the remaining single time point for donor 4, and profile for donor 6 were reserved for use as validation samples.

5.3.2 Macrophage Gene Expression Profile Altered by Macrophage-tropic Chemokine (C-C motif) Receptor 5-utilizing Virus-treated within 15 Hours.

To identify general similarities in gene expression profiles in response to treatment with 3 different envelopes over 24 hours, an average distance hierarchical clustering on mean treatment/untreated across donors using the top 10% probe set signal intensity values was performed (Figure 5-3). The list of probe sets used in the hierarchical clustering are listed in

Table D-1 in Appendix D. Six hours treatments clustered together suggesting macrophages have similar gene expression profiles at the early time point. By 15 hours of treatment, the T-X4 and

D-X4R5 Envs clustered together, while the M-R5 Env treatment clusters by itself. M-R5 envelope appeared to stimulate a unique genomic response within primary macrophages that was evident by 15 hours. The close clustering of M-R5 24 hours and D-X4R5 with the M-R5 15 hour time point suggests that the effect of M-R5 at 15 hours persists out to 24 hours and that D-X4R5 also has a similar impact on the macrophage transcriptome, but with delayed kinetics. The T-X4

24 hours clustered with the 6 hour treatments suggesting that this envelope, which does not mediate entry into macrophages, may not be affecting the overall transcriptome and thus envelope treatment requires at least 15 hours to affect global gene expression profiles.

5.3.3 Identification of a unique gene altered in expression by viral envelope.

We asked if any probe sets were statistically altered by treatment irrespective of time. In interpreting or targeting the statistical analysis we performed an extensive literature search to identify and include genes that have previously been observed to change in expression in result

104

of envelope treatment in macrophages. An ANOVA was performed across all treatments with weight given to previously identified genes. Using a false discovery rate (FDR) of 0.05, a single probe set was identified as altered by M-R5 treatment only, LILRB5 (leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5). The statistical analysis used failed to detect significant differences between the D-R5X4 and T-X4 envelopes relative to untreated. Relaxing the criteria of the analysis may identify more differences that could be biologically relevant to understanding the importance of downstream signaling events.

5.4 Discussion

In our study we characterized the gene expression profiles within primary macrophages resulting from treatment with HIV-1 gp120 of differing cell tropisms and coreceptor usage, M-

R5, D-X4R5, and T-X4. Initial quality control screening of our Affymetrix GeneChips used in this study identified a single donor, which failed to meet our criteria and was therefore excluded from the analysis. Two other donors were withheld from analysis because of anomalies within a single sample or measurements acquired only from a single time point, and used in confirmational procedures. Quality filters left three donors, three time points, and four treatments, or 36 GeneChips total.

Unsupervised analysis identified the M-R5 treatment may result in unique gene expression signals with 15 hours, which was further supported by a supervised analysis in which only a single gene was detected in the M-R5 group, LILRB5 (leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5). LILRB5 (also known as LIR-8 and

CD85c) belongs to a family of immunoreceptors encoded on the human chromosome 19q13.4 known as the leukocyte immunoglobulin-like receptor (LIR) (or alternatively Immunoglobulin- like transcripts (ILTs), CD85, or LILRs) (Borges et al., 1997). This specific region of the long

105

arm of chromosome 19 is of particular interest as it encodes several immunomodulatory genes,

the majority of which encode receptor proteins that are members of the immunoglobulin

superfamily, such as the killer cell immunoglobulin-like receptors (KIRs), the leukocyte-

associated immunoglobulin-like receptors (LAIRs), the IgA receptor FcαR, the natural killer cell

activator receptor NKp46, and the platelet collagen receptor GpVI (Wende et al., 1999;Martin et

al., 2002). LILRs are expressed in monocytes, macrophages, and dendritic cells, but with various

other members expressed in B cells, natural killer cells, T cells, and granulocytes, suggesting

they have evolved to regulate the function of a broad range of immune cells (Cella et al.,

2000;Borges et al., 1997;Garner et al., 2006). Although the structure of LILRs remains unknown, sequence analysis reveals LILRB5 contains four extracellular immunoglobulin-like

C2-type domains, several possible N-linked glycosylation sites, a single transmembrane spanning region, and a two cytoplasmic ITIM-like domain (Borges et al., 1997). Very little is known about the LILR superfamily, and although LILRB5 has been cloned an exhaustive search failed to find available antibodies to it.

Recently, the two extracellular domains of LILRB4 have been expressed and purified in E.

coli, and refolded in vitro (Garner et al., 2006). By using similar techniques we could express

and purify the extracellular domains of LILRB5 in eukaryotic cells, and use this protein to

develop antibodies against LILRB5. Antibodies specific for LILRB5 would be important for

measuring, via flow cytometry, if M-R5 gp120-treated macrophages express higher levels of

LILRB5 than untreated, T-X4 or D-X4R5 gp120-treated macrophages, and how this compares to

PBMCs. If M-R5 gp120-treated macrophages do express higher levels of LILRB5 on their

surface than untreated, we would next ask if M-R5 HIV-infected macrophages also expressed

greater levels of this immunoregulatory receptor than uninfected, and if LILRB5 serves as a

106

marker for HIV-1 infection in macrophages. A cellular receptor serving as a biomarker for HIV-

1 infection in tissue macrophages could be helpful for delivering therapeutic agents to HIV-

infected cells in peripheral tissues.

Signaling through LILRB5 may provide an important role during HIV infection of

macrophages. Cellular binding partners to the intracellular ITIM-like domains are currently unknown. Protein-protein interaction assays could be used to identify signaling molecules that

bind to and are possibly activated through the LILRB5 intracellular domains. Futhermore,

solving the crystal structure of LILRB5 would provide a framework for molecular docking

programs to virtually dock small molecules on specific targeted domains or regions for inhibition

or enhancement (Huentelman et al., 2004).

107

A. Donor 234567

Figure 5-1. Distribution of GeneChip data. (A) Percent of present, marginal, and absent probe sets on all 64 GeneChips is plotted in the scatter plot. (B) Median log2 signal intensity values for each GeneChip colored and ordered by donor. Error bars represent log 25% and 75% quartile range values donor. Error bars represent log 25% and 75% quartile range values.

108

A. 40

100) 20 × (

15 Standard Deviation Standard 10

234567 Donor B. 14

8 10,000) × (

Maximum Signal Intensity Value Intensity Signal Maximum 2

0 23456 7 Donor

Figure 5-2. Variability across GeneChips. (A) Standard deviation across microarrays with respect to donor. (B) Histogram of maximum signal intensity value obtained on microarray with respect to donor

109

Figure 5-3. Macrophage-tropic virus envelope treatment alters macrophage gene expression profiles within 15 hours. This heatmap represents average linkage hierarchical clustering of 2223 probe sets of envelope treatments relative to untreated. The red circles are BaL (M-R5), blue diamonds represent SF2 (D-X4), and black squares are IIIB (T-X4). Numbers below the tree are hours of treatment. Scale to the right of the tree depicts correlation coefficient. The red-green scale represents fold-difference relative to untreated.

110

CHAPTER 6 SUMMARY AND CONCLUSIONS

6.1 Project Summary

In this project, a discovery approach was undertaken to identify pathways temporally

altered in expression on a global scale in primary macrophages in response to a CCR5-utilizing

HIV-1 over seven days of spread. HIV-1 had the greatest impact on gene expression after only

48 hours of treatment with less that 1% of the culture as infected with virus, indicating early

events in viral infection is important (See Chapters 2 and 3). The organization of altered factors,

at both the genomic and proteomic level, into a functional network proved to be a powerful

method for examining multiple, interconnected pathways simultaneously. Network analysis of

global expression profiles is inherently suited for the discovery approach as the examination

provides a comprehensive view of the data within a functional context, facilitating the

development of questions for further investigation.

Although multiple pathways were altered by HIV-1, we initially directed our attention

towards the cell cycle because the potential of macrophages to transition in the cell cycle plays

an important role during the early steps of the viral life cycle and the establishment of viral

infection (Schuitemaker et al., 1994a;Kootstra and Schuitemaker, 1998;Kootstra et al.,

2000;Wang and Lewis, 2001). Network analysis identified the increased expression of factors

involved in mediating a G2 arrest in macrophages treated with HIV-1 (See Chapter 2). Within 2

days, virus-treated MDM possessed a greater level of the CDK inhibitor, p21Cip1, than mock-

treated macrophages. Subsequent experiments from another lab discovered increased expression

of p21Cip1 in primary macrophages upon virus treatment is required for the establishment of

infection (Vazquez et al., 2005). The mechanism behind the requirement of increased p21Cip1 protein expression for established HIV-1 infection in MDM remains elusive. HIV may require

111

macrophages to transition out of G1 and arrest in a later stage of the cell cycle to effectively

optimize the intracellular milieu. In addition, p21Cip1 activates anti-apoptotic signal transduction

cascades promoting cellular survival, which also benefits viral persistence and replication.

Although p21Cip1 has been described as an inhibitor of both cell cycle progression and apoptosis

(Gartel and Radhakrishnan, 2005;Liu et al., 2003), other as yet unidentified functions for p21Cip1 may exist and may be responsible for the observed viral requirement.

As expected, HIV altered the expression levels of several factors within calcium, apoptosis, and MAPK signaling pathways within 48 hours of treatment (See Chapter 3). Calcium fluxes are secondary messengers initiated immediately upon receptor recognition. Multiple parameters, such as magnitude, frequency, and length of Ca2+ elevation, regulate the activation

of specific transcription factors. Calcium fluxes are responsible for activating several other

signaling cascades, included apoptosis, MAPK, and the focal adhesion kinases (FAK). During

the early time point (48 hours of virus treatment) macrophages increased the expression of pro-

apoptotic signaling molecules in response to the viral infection. Macrophages appear to sense

viral infection and initiate a general apoptotic innate immune response to kill itself and prevent

viral spread. However, this apoptotic response is merely temporal and incomplete. Within 4 to 7

days of viral spread in macrophage culture a switch in gene expression profiles occurs for both

pro- and anti-apoptotic genes. HIV-1 overcomes the cellular defense strategy and executes a

surge of survival signals within the host, effectively ensuring its own survival and optimizing

intracellular conditions for production of progeny virions simultaneously. This result supports

the concept of macrophages providing a long-lived reservoir for virus (Goodenow et al., 2003).

Although HIV-1 appeared to have triggered an innate immune defense causing the

increased expression levels of pro-apoptotic genes, we unexpectedly saw very few factors

112

involved in the TLR signaling pathway (see Chapter 3). Since TLR represent a family of

receptors that are important in the recognition of general molecular patterns associated with

microbes, such as viruses, and HIV-1 RNA activates TLR7 in plasmacytoid dendritic cells

(Beignon et al., 2005), we decided to further investigate this signaling pathway. Functional

analysis revealed HIV-1 treated macrophages failed to secrete Type-1 interferons, IFN-β, and

failed to activate IRAK-1, an S/T/Y kinase downstream from all TLRs. HIV-1 completely

evades TLR immune response in macrophages, representing another illusive tactic utilized by the

virus to subvert immune defense mechanisms and promote its own growth and survival.

In addition to TLR, macrophages also express two cytosolic anti-viral innate immune

receptors, RIG-1 (retinoic acid inducible gene-1) and MDA5 (melanoma differentiation-

associated gene 5). RIG-1 and MDA5 are DEAD-box RNA helicases that have been identified as

suppressors of viral replication by binding to virus associated dsRNA and activating type I

interferon-dependent antiviral immunity (Jeang and Yedavalli, 2006;Stetson and Medzhitov,

2006b). Since HIV-treated macrophages fail to secrete type I interferons, such as IFN-β, the virus appears to evade both RIG-1 and MDA5 recognition in parallel with TLR. We propose two models to explain HIV evasion of innate immunity in macrophages.

The first model is that HIV escapes innate immune receptor recognition (Fig. 6-1A). HIV enters a host macrophage cell by either macropinocytosis, which leads to encapsulation of the virus within an endosome, or the predominate method of receptor-mediated membrane fusion, which leads to entry of the pre-integration complex (PIC). In the case of macropinocytosis, virus may either fuse with the endosome via receptor complex mediated membrane fusion, leading to

PIC entry into the cytosol, or the endosome may fuse with a lysosome resulting in degradation of virus. Nucleic acid-specific TLR may not be present within these endosomes containing viral

113

fragments, which are shuttled to the plasma membrane of the cell and displayed in the context of

MHC-II. If the virus enters the cell through receptor-mediated membrane fusion, the viral RNA genome may reverse transcribe without RIG-1 or MDA5 recognition through tight interaction with viral nucleocapsid, which serves a protective role in masking the RNA from cellular innate immune receptors. Once reverse transcribed into dsDNA, the PIC can freely migrate to the cellular nucleus and complete integration.

The second model is HIV suppression of innate immune signaling (Fig. 6-1B). In this model, I propose innate immune receptors recognize viral component(s) during infection and send a signal to the nucleus. However, the signal is interrupted downstream by a viral protein, as is the case for Human Rhinovirus infection (Peng et al., 2006). Since recognition and signal suppression would likely occur during viral entry, the viral protein that suppresses the signal should be present within the virion particle.

6.2 Functional Genomic and Proteomic Characterization of Macrophage Reservoirs for HIV-1

Macrophages are found ubiquitously throughout the body and are susceptible to infection by multiple strains of HIV-1, including M-R5, D-X4, and D-X4R5 viruses (Schuitemaker et al.,

1994a;Yi et al., 1998;Collman et al., 1992;Collman and Yi, 1999;Doranz et al., 1996;Kim et al.,

1995;Burke B and Lewis CE, 2002). Macrophages represents an important viral reservoir, as infected macrophages have long half-lives and serve as viral vectors (Balestra et al.,

2001;Aquaro et al., 1997;Fischer-Smith et al., 2001). A common feature of long-lived cells is terminal differentiation, with relatively few cells actively cycling within the population, and a relatively low percentage of the cells in the population undergoing apoptosis (Latella et al.,

2001).

114

In addition to serving as an HIV reservoir, macrophages also play an important role in

tumorigenesis. Nearly all malignant tumors are composed of numerous macrophages which represent a major component of leukocyte infiltration (van Ravenswaay Claasen et al., 1992).

These tumor-associated macrophages (TAMs) have been referred to as ‘Janus-faced’ because of their ability to destroy neoplastic cells and present tumor-associated antigens inducing specific anti-tumor immune responses on one hand, and to co-exist with the malignant cells in a symbiotic relationship in which they contribute to the tumor metastasis and proliferation on the other hand (Zuk and Walker, 1987;Burke B and Lewis CE, 2002;Mantovani et al., 1992). How

TAMs affect tumors is driven in large part by their activation status, protein expression, and cytokine secretion profiles. In our studies, we used HIV-1 as a molecular probe to identify changes in macrophage activation status as a result of retroviral infection resulting in alterations in cellular protein expression and protein secretion. We observed an increase in IL-6 in HIV- treated MDM, which has previous been shown to act as a paracrine and autocrine growth factor in vitro for prostatic carcinomas (Okamoto et al., 1997). IL-6 concentration levels within the tumor microenvironment are regulated by tumor cell interactions with TAMs (Burke B and

Lewis CE, 2002). Although TAMs secrete high levels of IL-6, they produce low levels of IL-1β

and TNF-α in ovarian carcinomas (Erroi et al., 1989;Bernasconi et al., 1995), which may be

related to the increase in cytokine secretion we detected in IL-6, but only increased mRNA levels

for IL-1 and TNF-α following HIV-1 treatment. Perhaps low levels of IL-1β and TNF-α are also

secreted by MDM upon HIV-1 treatment, but the sensitivity of our assay could not detect it. The

presence of all three of these proinflammatory cytokines are required for driving viral production

in PBMCs (Kinter et al., 1996), and our results suggest the same may be true for MDM. Our

115

observations provide insight into MDM activation via retroviral infection with implications into macrophage-tumor cell interactions.

Retroviruses were first identified using a discovery-based approach on isolated chicken tumor cells around the turn of the 20th century. The avian erythroblastosis virus (AEV) was isolated from a spontaneous erythroleukemia in a chicken (Ellerman and Bang, 1908) and soon after, Peyton Rous isolated Rous sarcoma virus (RSV) from a chicken fibrosarcoma (Rous,

1911). AEV and RSV are oncoretroviruses that induce tumors in the infected host because they carry viral oncogenes (v-onc) in their genome, which are derived from cellular proto-oncogenes

(c-onc) (Rosenberg and Jolicoeur, 1997). Although HIV-1 is not defined as an oncoretrovirus, such as AEV and RSV, HIV-1 infection is closely associated with development of malignancies because of chronic immune suppression, coinfection with oncogenic viruses, and/or persistence of HIV-1 infection (Goodenow and Kohler, 2007;Ng and McGrath, 1998). However, HIV-1 can directly influence tumorigenesis, albeit with low frequency, through integration just upstream of the c-fes proto-oncogene (Shiramizu et al., 1994). Primarily, herpesviruses are the major etiological agents for HIV-related malignancies. Epstein-Barr virus (EBV) and human herpesvirus-8 (HHV-8) contribute to increased risk for Non-Hodkin’s Lymphoma (NHL) and

Kaposi’s Sarcoma (KS), respectively, in HIV seropositive patients (Goodenow and Kohler,

2007). Furthermore, TAMs serve as targets for HIV-1 infection and produce significant amounts of p24 (Shiramizu et al., 1994), therefore viral influence on its cellular host can have a dramatic affect on regulating tumor growth and metastasis.

A prominent difference in cancer cells relative to healthy cells are alterations in metabolic pathways resulting in increased aerobic glycolysis and the dependency on glycolytic pathway for ATP production, known as the Warburg effect (Pelicano et al., 2006). Four major

116

mechanisms are proposed to account for the Warburg effect: (1) mitochondrial defects [typically mutations of mtDNA resulting in respiration and oxidative phosphorylation malfunction] (Carew and Huang, 2002;Singh, 2004;Taylor and Turnbull, 2005), (2) adaptation to hypoxic environment in cancer tissues (Gatenby and Gillies, 2004;Brahimi-Horn and Pouyssegur, 2005),

(3) oncogenic signals (Flier et al., 1987;Ramanathan et al., 2005;Elstrom et al., 2004;Gottlob et al., 2001;Boren et al., 2001;Serkova and Boros, 2005), and (4) abnormal expression of certain metabolic enzymes (Bustamante and Pedersen, 1977;Rempel et al., 1996;Coy et al., 2005;Astuti et al., 2001;Neumann et al., 2004;Pawlu et al., 2005;Selak et al., 2005). Genomic profiling of primary macrophages treated with HIV-1 revealed the largest number of altered genes fell in the energy metabolism functional pathway (81/808) (Chapter 2). Altering metabolic pathways to favor lactic acid production and away from oxidative phosphorylation may be beneficial to viral pathogens within the host cells because of reduced levels of reactive oxygen species (ROS), which serve as an important immune defense against virally infected cells (Hasnain et al., 2003).

HIV-infected therapy-naïve patients have increased levels of lactate metabolism relative to healthy controls, suggesting increased glycolysis due to HIV infection (Bauer et al., 2004). In the future, we plan to explore metabolic pathways altered by HIV in primary macrophages, as viral infection may establish a scenario within the host that is conducive to maintenance of tumor environments or microenvironments.

6.3 Insights and Future Directions

6.3.1 Cell Cycle Proliferation and Culture Microenvironments in Primary Macrophages and HIV-1 Infection

Studies in our lab have demonstrated that within 2 days HIV-1 treatment alters multiple factors and pathways in macrophages to promote transition in the cell cycle from G1 and towards

G2, despite the small percentage of cells infected (<2%) (Coberley et al., 2004). Propidium

117

iodide (PI) staining of HIV-1-treated MDM cultures indicates these cells retain a 2n

chromosomal status, and CFSE staining indicates MDMs do not divide in the presence or

absence of virus. Other studies have suggested that ~10-20% of macrophages transition out of G1 and these macrophages have the potential to support viral infection (Schuitemaker et al.,

1994a;Wang and Lewis, 2001). A more sensitive analysis method than PI may be required to determine cell cycle transition. For example, dual labeling of cells with 7AAD and pyronin Y

(PY) allows for simultaneous quantification of DNA and RNA, respectively. As opposed to PI, this dual label method allows researchers to divide G1 phase into subphases, G1a and G1b. We

would expect a majority of macrophages in culture would be arrested in G1a, but a small

percentage of cells may transition to G1b, which is characterized by 2n DNA content and high

levels of RNA relative to G1a. Cells that have transitioned to G1b may also possess an

intracellular milieu optimal to viral infectivity, such as high intracellular nucleotide levels and

activated transcription factors. In addition to 7AAD and PY, MDMs would also be labeled with a

fluorescent monoclonal antibody specific to HIV-1 p24. We would use the flow cytometry data

to ask the percentage of cells in G1b prior to and following HIV-1 treatment, the percentage of

+ + p24 cells, and the percentage of cells that were both in G1b and p24 . Using this approach, we

will answer if MDM in culture are naturally transitioning out of G1a and these cells are targets of

HIV-1 infection or if HIV-1 infection itself drives cells out of G1a into G1b or possibly early S.

If there is a small percentage of MDM in culture that do transition out of G1a, and progress through the cell cycle, we could use immunofluorscent techniques to determine how these cells are positioned in tissue culture. If cells that transition through the cell cycle tends to cluster

together in culture we might speculate that these macrophages may have developed a microenvironment that supports growth, and perhaps promotes HIV-1 infection. PCNA is a

118

subunit of the DNA polymerase and its subcelluar localization is commonly used to infer a cell’s position in the cell cycle in immunofluorescence, and could also be used if problems using

7AAD and PY arise. Furthermore, immunofluorescent techniques would accommodate questions regarding viral spread through culture. For instance, do infected macrophages produce HIV-1 virions that are directly delivered to neighboring cells through a “virion synapse”, or do shed

virions diffuse out into the periphery to infect distant cells? Recently, the ability to detect HIV-

infected MDM using GFP+ viruses has demonstrated distinct subpopulations of HIV+ cells that

coexist within the same culture (Brown et al., 2006). Although this report studied viral latency in

the macrophage viral reservoir, their experimental system is important in answering the

questions previously addressed.

Vazquez et al. have demonstrated the importance of cell cycle regulators, specifically

p21Cip1, in MDMs during HIV-1 infection (Vazquez et al., 2005). In our studies we have

identified YWHAE, a 14-3-3 protein, induced in MDM following HIV-1 treatment at both the

RNA and the protein level (Coberley et al., 2004). 14-3-3 proteins play an important role in directing the subcellular localization of cyclin-dependent kinases (CDK) and cyclin-dependent kinase inhibitors (CDKi), and thus contribute considerably to cell cycle progression. YWHAE’s role in HIV-1 infection will be assessed by translational modulation using morpholinos, offered by Gene Tools LLC (http://www.gene-tools.com/), to knock-down expression. Morpholinos are ideally suited for knock-down experiments in cells such as macrophages as they use a patented reagent, called Endo-Porter, which uses the cell’s phagocytic machinery to import the morpholino into the cell. Morpholinos are synthetic molecules that resemble the structure of nucleic acid, and can be used to target specific transcripts for interaction and prevent translation.

The morpholino molecule can be supplied with a GFP label to easily quantify transfection

119

efficiency and sort transfected cells. Initially, the efficiency of message knock-down will be

compared between morpholinos and siRNA. Morpholinos and siRNA molecules will be used to

knock-down the expression of YWHAE to assess its role during HIV-1 treatment in

macrophages. As a 14-3-3 protein, which functions by interacting with and sequestering other

cellular proteins, we could determine if YWHAE also interacts with any viral proteins from

HIV-1, and how that might affect infectivity.

6.3.2 HIV-1 Evasion or Suppression of MyD-88 Independent Toll-like Receptor Signaling

Our studies demonstrated that HIV-1 evades MyD88-dependent signaling by lack of

IRAK-1 hyperphosphorylation upon HIV-1 treatment. The MyD88-independent pathway signals

through the transcription factor IRF-3, resulting in production and secretion of proinflammatory

cytokines, such as IFN-α, IFN-β, TNF-α, and several others. We established that no productive

TLR signaling was occurring in MDM upon HIV-1 treatment. However, we still need to

determine if this is because HIV-1 completely evades TLR recognition, or if HIV-1 suppresses

MyD88-independent signals sent to the nucleus upon TLR recognition. Human Rhinovirus has

recently been discovered to produce an as yet unidentified viral factor that prevents IRF-3 from

dimerizing and activating transcription of proinflammatory cytokines upon recognition by TLR3

despite becoming phosphorylated and migrating to the nucleus (Peng et al., 2006). HIV RNA

activates TLR7 in plasmacytoid dendritic cells (Beignon et al., 2005).

To determine if HIV-1 produces factors that suppress a TLR response we will treat

macrophages for 24 hours with M-R5 HIVAD, and an untreated positive control. On days 2, 7, and 14 post-treatment, we will stimulate cells with R-848 (TLR7 ligand), Poly(I:C) (TLR3 ligand), or LPS (TLR4 ligand), stimulating both MyD88-dependent and –independent arms of the TLR signaling pathway. After 24 hours of TLR stimulation we will measure the

120

concentration of IFN-β secreted into the supernatant. If HIV-1 suppresses TLR signaling, we expect IFN-β secretion considerably attenuated from all TLR stimulations in HIV-1-treated

MDM compared to untreated. In contrast, if IFN-β secretion is not significantly altered between

HIV-1-treated and untreated, this could mean one of two things. First, it could suggest that HIV-

1 completely evades TLR recognition. However, it could also mean that HIV-1 factors suppress only MyD88-independent signaling. Since all TLR still signal through MyD88, normal functioning of this pathway would stimulate production of IFN-β. Therefore, further analysis would be required if untreated and HIV-1-treated cells produce similar IFN-β levels.

We plan to further investigate the activation status of IRF-3 following HIV-1 treatment of macrophages cultures. Human Rhinovirus is recognized by TLR7 in HeLa cells and subsequently activates IRF-3. Infected cells fail to respond with IFN-β secretion because

Rhinovirus inactivates IRF-3 downstream after nuclear translocation, and prevents the transcription factor from dimerizing and inducing transcription of proinflammatory cytokines, such as IFN-β (Peng et al., 2006). HIV-1 is an ssRNA virus with multiple viral factors housed within the virion. IRF-3 inhibition is a plausible strategy for HIV-1 immune evasion, accounting for failure of macrophages to secrete IFN-β.

121

A. B.

Figure 6-1. Proposed models of HIV evasion of innate immune response. (A) HIV evades innate immune recognition receptors. The virus enters macrophages through either macropinocytosis or receptor-mediated membrane fusion. Viral factor elude TLR or the cytosolic RNA helicases, RIG-1 and MDA5, through either protective proteins tightly bound to the genome or inherently never present in the context of these innate immune receptors. (B) HIV suppresses activated innate immune signaling. During the early stages of HIV infection in macrophages, TLR, or RIG-1/MDA5, may detect viral nucleic acid and activate a signaling cascade progressing towards the nucleus. This signaling cascades is interrupted by viral factors before a proinflammatory response can be mounted by the infected cell, promoting viral survival and replication.

122

APPENDIX A METHODS AND MATERIALS

A.1 Preparation of Viral Stocks.

A stock of HIV-1JR-FL (National Institutes of Health, AIDS Reference and Reagent

Program, Rockville, Md.) was prepared in PBMC from a seronegative donor and calculated to

4.5 have a titer of 10 50% tissue culture infective doses (TCID50) per ml (Tuttle et al., 2002).

Supernatants for mock treatment of MDM cultures were prepared simultaneously from

uninfected PBMC from the same seronegative donor.

A stock of HIV-1AD was prepared by using the Superfect transfection reagent (QIAGEN,

Valencia, Calif.) to transfect 293 cells with 15 μg of the pAD plasmid. Supernatants were harvested 2 days post-transfection, cleared of cell debris by passing through a 0.45-μm filter, and stored in aliquots at -80°C. Titers for virus stocks were assayed by determining endpoint values for HIV-1 core antigen (p24 ELISA, Coulter, Hialeah, FL) in PBMC culture supernatants and expressed as TCID50/ml (Tuttle et al., 2004).

Single-cycle, luciferase-positive viruses pseudotyped with M-R5 (HIVJR-FL) envelope, D-

X4 (HIVMM) envelope, or T-X4 (HIVLAI) envelope were prepared as previously described (Tuttle

et al., 2002;Ghaffari et al., 2005). Virus stocks were quantified using p24 antigen enzyme-linked

immunosorbent assay (Coulter, Miami, FL) and gp120 antigen enzyme-linked immunosorbent

assay (Advanced Biotechnologies, Inc., Columbia, MD). Standard virus inoculum contained 120

ng p24 antigen, as determined by previous experiments in the lab.

A.2 Preparation of RosetteSep-isolated Monocytes.

Monocytes from HIV-1- and hepatitis C virus-seronegative donors were isolated using

RosetteSep (a positive-depletion monocyte enrichment method; Stem Cell Technologies,

Vancouver, Canada) according to the manufacturer’s protocol, which produces cell populations

123

that are >99% CD14+ monocytes with <1% B or T cells (CD3+). MDM from four donors provided a 90% chance of detecting a twofold difference between virus- and mock-treated cultures, based on analysis of variance using a randomized complete block design, a two-sided t test, and a standard deviation of 0.5. Cells were induced to adhere to plastic at a concentration of

2 × 106 per ml and were incubated in differentiation medium comprised of Dulbecco’s modified

Eagle’s medium (Life Technologies, Gaithersburg, Md.) with 15% human AB serum (Sigma-

Aldrich Corp., Saint Louis, Mo.) and a single treatment of 10 U of granulocyte-macrophage

colony stimulating factor (Invitrogen, Carlsbad, Calif.) per ml. After 7 days, >70% of cells

expressed CD4 and >80% were positive for CCR5 as measured by flow cytometry (data not

shown). After differentiation, CD14+, Fcγ receptor+ macrophages were the only cell type

detected; no CD3+ or CD19+ T or B lymphocytes, respectively, were detected (Lathey et al.,

2000;Tuttle et al., 2002). MDM cultures were transferred to GM-CSF-free media and treated on

day 0 with 2 ml of either HIV-1JR-FL (multiplicity of infection, ~0.02) or mock supernatants for

24 h, washed, and cultured in GM-CSF-free media. Levels of supernatant p24 antigen on days 2,

4, and 7 were assessed using a specific enzyme-linked immunosorbent assay kit (Coulter,

Hialeah, Fla.). Aliquots of cells were washed twice with phosphate-buffered saline and lysed in a nonionic detergent buffer (50 mM KCl, 10 mM Tris-Cl, pH 8.3, 2.5 mM MgCl2, 0.1 mg of gelatin/ml, 0.45% NP-40, and 0.45% Tween 20) containing proteinase K (100 _g per ml) (K buffer) for quantitation of infected cells by TaqMan real-time PCR assay using HIV-1 gag as the analytical parameter and human apoB as a genomic template control. The primers and probe used for quantitation of apoB were as follows: forward primer, 5’-

TGAAGGTGGAGGACATTCCTCTA; reverse primer, 5’-CTGGAATTGCGATTTCTGGTAA; probe, VIC (Applied Biosystems)–CGAGAATCACCCTGCCAGACTTCCGT–6-carboxy-

124

tetramethylrhodamine (TAMRA). Viral gag gene copies by TaqMan were quantified using forward primer (5’-ACATCAAGCAGCCATGCAAAT-3’), reverse primer (5’-

ATCTGGCCTGGTGCAATAGG-3’), and probe (5’–6-carboxy-fluorescein (FAM)–

CATCAATGAGGAAGCTGCAG AATGGGATAGA–TAMRA–3’) (19). Amplification reactions consisted of TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City,

Calif.),450 nM (each) forward and reverse primers, and 125 nM probe in a total volume of 50 μl.

The PCR conditions were 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Thermal cycling and data acquisition were performed using a Prism

7700 Thermal Cycler (Applied Biosystems).

A.3 Preparation of Elutriated Monocytes

Elutriated monocytes were obtained from Howard Gendelman (University of Nebraska).

Monocytes were resuspended in DMEM media supplemented with 1000 U/ml rhM-CSF, 10% heat-inactivated human serum, 200 mM L-glutamine, 50 mg/ml Gentiamicin, and 25 mg/ml

Ciprofloxacin. Cells were differentiated for 7 days at 37°C, with 50% media changes every 2-3 days. Following differentiation, cells were cultured in media lacking rhM-CSF.

A.5 Preparation of THP-1 cells.

THP-1 monocytic cells were obtained from the American Type Culture Collection

(Manassas, VA), and grown in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, and 50 μg/ml Penn/Strep. Cells were differentiated in the presence of 160 nM PMA for 24 hours and allowed to mature for 6 days.

125

A.6 Treatment of Cells.

Prior to treatment cells were serum-starved for 24 hours. Cells were either left untreated or treated with HIV-1AD [MOI or TCID50], 1 μg/ml E. coli 0111:B4 LPS (Sigma), 1 μg/ml rhIFN-γ

(Sigma), or 100 μg/ml poly(I:C) (Sigma).

A.7 RNA Isolation and Hybridization.

Total RNA for each sample was extracted and prepared for hybridization according to protocols in the GeneChip Expression Analysis Technical Manual (Affymetrix). Briefly, cells from virus-treated or mock-treated cultures at days 0, 2, 4, and 7 were washed two times in

MDM rinse medium and resuspended in RLT RNA lysis buffer (QIAGEN, Valencia, Calif.) for total RNA isolation (RNEasy RNA isolation kit; QIAGEN). RNA aliquots (8 μg) were reverse transcribed from a (dT)24 primer into double-stranded cDNA, which served as a template for in vitro transcription to produce biotin-labeled cRNA that was fragmented under conditions of high magnesium concentration (1 mM) and heat. The quality of the cRNA was first assessed using

Test 3 Genechip arrays (Affymetrix) before hybridization to HG-U95A (version 2) arrays. The arrays were stained by a streptavidin-phycoerythrin conjugate (Molecular Probes, Eugene, Oreg.) using the Affymetrix GeneChip Fluidic Station and scanned by an Agilent argon-ion laser with

488-nm emission and 570-nm detection (GeneArray Scanner). High-resolution chip images were analyzed using Microarray Suite version 4 (Affymetrix). Intensity values from each probe cell were adjusted for background and multiplied by a scaling factor to facilitate comparisons across the arrays. Images were converted into both average difference values and numerical (n-fold) change data based on comparison of virus-treated and mock-treated samples.

126

A.8 RNA Data Analysis.

A custom relational database was designed using Microsoft (Redmond, Wash.) Access

2000 on the Windows 2000 platform. The database contained all raw data, as well as links between unique gene identifiers for mRNA and protein, functional categories, and summary of function. Functional categories of genes were based on the Gene Ontology Consortium public domain database (http://www.geneontology.org/). Cluster analysis was performed to gain an overview of temporal gene expression patterns within the data set. Prior to clustering, filters were applied so that a robust set of genes could be analyzed. Genes were first filtered to remove any transcripts that were considered absent under all conditions. A subsequent filter identified genes in infected cultures that displayed >4-fold change (induced or repressed) in hybridization intensities relative to levels in uninfected cultures. Average linkage hierarchical agglomerative clustering with uncentered correlation was performed on the median values obtained for each probe set for all donors at each time point using the software package Cluster (M. Eisen,

Berkeley, Calif.). Major branches in the dendrogram were defined by correlation coefficients of

>0.75 (mean, 0.85; range, 0.75 to 0.96)

To identify subsets of genes that were expressed exclusively in HIV-1 or mock-treated cultures of MDM, queries were performed within GeneSpring version 4.1 (Silicon Genetics,

Redwood City, Calif.). Genes from each treated population were subjected to three high- stringency statistical filters, which required that a gene be present in all donors, vary by no more than 0.5 standard deviations from the mean expression in all donors, and be induced at least twofold relative to the globally normalized background intensity for the entire data set. The combined effect of the filters identified a set of genes that was robust to outlier, interassay, and donor variability. All genes expressed in virus-treated cultures were compared to all genes

127

expressed in mock-treated cultures by using Venn diagrams. Unique genes that were expressed

by each population were used to create lists and import them into the custom relational database.

A.9 Protein Extraction and PowerBlot Screening.

Monocytes (3 × 107 to 4 × 107) from each of four donors were isolated by RosetteSep and

plated in six-well plates (4 × 106 cells/well), differentiated for 7 days, and treated as previously

described. Two of the four donors were assayed for both proteins and mRNA. After 48 h of virus

treatment, the cells were lysed with boiling lysis buffer (10 mM Tris, pH 7.4, 1 mM sodium

orthovanadate, 1% sodium dodecyl sulfate). Lysates were heated at 95°C for 30 s and passed 10

times through a 25-gauge needle to shear the DNA. Total protein yields were quantitated using

the bicinchoninic acid protein assay (Pierce, Rockford, Ill.).

Immunoblot analysis of proteins was performed by BD Biosciences. Briefly, 5 mg of total

protein per sample was loaded on a total of five gradient (4 to 15%) SDS-polyacrylamide gels

and subsequently transferred to Immobilon-P membranes (Millipore). A total of 1,005 proteins

were screened using different complex antibody cocktails. Digitally captured images of all blots

from duplicate or triplicate runs of the two samples (HIVJR-FL and mock treated) were compared, and confidence values based on change and reproducibility were designated (semiquantitative).

Only proteins with a confidence value of ≥3 were considered in the final analysis. Each protein was entered into our custom relational database and identified by locus link identification (ID) and Swiss Protein ID numbers, predicted and observed molecular weights, and functional categories. A query was designed in the database to link mRNA and protein data according to

common locus link ID numbers.

128

A.10 Western Blots

Cells were washed and immediately lysed in ice-cold lysis buffer (1% Triton X-100, 2 mM

Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1 mM DTT, 1 mM NaF, 1mM Sodium Orthovanadate,

Protease Inhibitor Cocktail Tablet (Roche), Phosphatase Inhibitor Cocktail I (Sigma), and

Phosphatase Inhibitor Cocktail II (Sigma)). Whole cell lysate was diluted with Laemlli Sample

Buffer, loaded onto a 4-20% Tris-HCl polyacrylamide gel, and separated through electrophoresis. Proteins were transferred to a PVDF membrane, and blocked with 5% milk.

Membrane was probed with anti-IRAK-1 antibody (Santa Cruz) or p56Lck (Santa Cruz), followed

by goat anti-mouse IgG1-AP (Santa Cruz). Colorimetric detection was performed using BCIP

(Santa Cruz).

A.11 Secreted Cytokine Determination

Secreted cytokine/ chemokine levels were assessed from supernatants collected over the course of the first 2 days 0, 24, 36, and 48 hours following virus-, LPS, or mock-treatment of macrophages. Levels of secreted cytokines were quantified using a high throughput laser-capture system (Luminex) with Beadlyte human multi-cytokine detection system kit (Upstate USA, Inc.,

Charlottesville, VA) and reported as fold-changes from un-treated macrophage cultures. Results are presented as average fold-changes resulting from macrophages isolated from two independent donors.

Levels of secreted IFN-β were measured using the R&D Systems Quantikine ELISA kit

(R&D Systems, Minneapolis, MN). MDM were serum-starved for 24 hours. Cells were stimulated with 1 μg/ml LPS (Sigma), 100 μg/ml Poly(I:C) (Sigma), 15,000 TCID50 HIV-1AD or media alone (untreated). Supernatants were collected 1, 3, and 6 hours after stimulation.

129

A.12 Cell Proliferation Assays.

PBMC were isolated within 6 hr of blood collection by standard Lymphoprep (Sigma)

Ficoll gradient centrifugation procedures (Tuttle et al., 1998;Sleasman et al., 1997). PBMC were pelleted and labeled with 15 μl CFDA-SE (100 μg/ml) for 15 minutes at room temperature and then washed twice with 1× PBS to remove excess dye. MDM were scrapped, pelleted, and labeled in the same manner. PBMCs were cultured for 4 days in RPMI 1640, 10% FBS, 1%

Penicillin/Streptomycin, 30 U/ml IL-2 in the presence or absence of 9 μg/ml PHA (Sigma).

Following labeling with CFDA-SE, MDM were allowed to adhere overnight then treated with

15,000 TCID50 HIVAD or left untreated for 10 days. Stained cells were fixed in 1% paraformaldehyde for 30 minutes, washed twice and resuspended in cold FACS wash for analysis (Tuttle et al., 2004).

Flow cytometry was performed using a Becton Dickinson FACSCalibur flow cytometer that was routinely standardized by use of Autocomp beads according to the manufacturer’s protocols. Lymphocyte and macrophage gates were set according to forward and side scatter.

Individual generations were determined by CFSE fluorescence intensity using ModFit LT software (Verity Software House, Topsham, ME).

A.13 Envelope Treatment of Monocyte-derived Macrophages.

The gp120 proteins selected for this study include soluble monomeric envelopes from

HIV-1 isolates based on their coreceptor tropism, including macrophage-tropic CCR5-utilizing

(M-R5) (HIV-1BaL), dual-tropic CCR5- and CXCR4-utilizing (D-X4R5) (HIV-1SF2), or T-cell line-tropic CXCR4-utilizing (T-X4) (HIV-1IIIB), obtained from NIH Aids Reference and Reagent

Program, Rockville, MD.

130

Monocytes from seven individual, healthy (HIV-, CMV-) donor were isolated from whole

blood, differentiated into macrophages, and used for these experiments. MDM gene expression

profiles upon no treatment, M-R5, D-R5X4, or T-X4 soluble gp120 treatment at 6, 15, and 24

hours were measured using Affymetrix HG-U133A GeneChip. MDM cultures were washed and

treated with one of the three purified envelope gp120 proteins (250 ng/ well) or untreated in

serum-free media. Cells were pooled from 3 wells for each treatment to yield cellular extracts for

RNA isolation. Insufficient macrophage yield from one donor (donor 4) permitted analysis of only a single time point. Preliminary data from an earlier donor (donor 1) measured by an earlier version GeneChip (HG-U95Av2) indicated the majority of differences in MDM gene expression following gp120-treatment were detected at the 15 hour time point (data not shown). Therefore, only the 15 hour time point was hybridized for donor 4, for a total of 64 microarrays. GeneChips for donors 2, 3, and 4 were all performed at the same time, donor 5 was run alone, and donors 6 and 7 were performed together.

A.14 RNA Isolation and Hybridization from gp120-treated Monocyte-derived Macrophages.

Total RNA for each sample was extracted and prepared for hybridization according to protocols in the GeneChip® Expression Analysis Technical Manual (Affymetrix, Santa Clara,

CA). Briefly, cells from gp120-treated or untreated cultures at 6, 15, and 24 hrs were washed two

times in MDM rinse media and resuspended in RNA lysis buffer RLT (Qiagen, Valencia, CA)

for total RNA isolation (RNEasy RNA isolation kit, Qiagen). RNA aliquots (10 ug) were reverse

transcribed from a (dT)24 primer into double stranded cDNA, which served as a template for in

vitro transcription to produce biotin-labeled cRNA that was fragmented under conditions of high

magnesium concentration (1 mM) and heat. Quality of cRNA was hybridized to HG-U133A

arrays. Arrays were stained by a streptavidin-phycoerythrin conjugate (Molecular Probes,

131

Eugene, OR) using the Affymetrix GeneChip Fluidic Station and scanned by an Agilent argon-

ion laser with 488 nm emission and 570 nm detection (GeneArrayTM Scanner). High-resolution

chip images were analyzed using Microarray Suite Version 5 (Affymetrix). Intensity values from

each probe cell were adjusted for background and multiplied by a scaling factor to facilitate

comparisons across the arrays using dChip (Wang & Li). Clustering algorigthms were performed

by Eisen’s Cluster (citation). Expression values were imported into BRB ArrayTools 3.2.3 (US

National Cancer Institute).

A.15 Harvesting of Lipopolysaccharide-primed Monocyte-derived Macrophage Supernatant Proteins

Macrophages prepared from elutriated monocytes were primed with 1 μg/ml E. coli

0111:B4 LPS (Sigma) for 24 hours in DMEM, 200 mM L-glutamine, 50 mg/ml Gentiamicin,

and 25 mg/ml Ciprofloxacin in the presence and absence of10% heat-inactivated human serum.

Supernatants were removed from cells, centrifuged to remove cellular debris, and stored at -

80°C.

A.16 Single-cycle Viral Infections in Lipopolysaccharide-primed Monocyte-derived Macrophage Supernatants.

Supernatants from untreated and LPS-primed MDM were thawed (A-15), and Polymyxin

B (PMB) (Calbiochem, San Diego, CA) was added to supernatants to a final concentration of 15

μg/ml to inactivate LPS. Single-cycle luciferase+ Env-pseudotyped virus (A-1) was diluted in

supernatants and 120 ng of p24 virus was applied to 2.5 × 105 healthy MDM in triplicate for 24 hours. MDM were washed twice with 1× PBS to remove residual virus and fresh media was applied. Cell lysates were prepared in cell culture lysis reagent (Promega, Madison, WI) 4 days after infection. The amount of luciferase activity in each lysate was determined by a standard luminometer assay (Monolight 2010; Analytical Luminescence Laboratories, San Diego, CA),

132

which reported results in relative light units (RLU). Untreated cells served as background and

values were subtracted from each sample.

A.17 Precipitation and Separation of Lipopolysaccharide-primed Supernatant Proteins.

Supernatants from untreated and LPS-primed MDM were thawed and precipitated using 2-

D Gel Cleanup Kit (BioRad, Hercules, CA). Proteins were resuspended in Laemmli Sample

Buffer (LSB), and 60 μg of total protein was separated via electrophoresis in a 4-20% linear

gradient Tris-HCl gel (BioRad). For visualization, the gel was stained with Imperial Stain

(Pierce, Rockford, IL). To determine protein identities using mass spectrometry, a second gel

was run with samples run in quadruplicate to ensure ample protein for MS-MS analysis. This gel

was stained with SyproRuby (BioRad). Slices of identical molecular weight regions were cut

from untreated and LPS-treated supernatant protein lanes and stored at 4°C until analyzed by

MS.

A.18 Coomassie Staining of Protein Gel.

Proteins were electrophoresed through precast 4-20% linear gradient gel, and fixed in gel with fixative buffer (40% methanol, 10% acetic acid) for 30 minutes at room temperature. Gel was stained with Coomassie Brillant Blue R-250 staining solution (40% methanol, 10% acetic

acid, 0.1% Coomassie blue R-250) for 4 hours at room temperature. Excess stain was washed

away with destain buffer (40% methanol, 10% acetic acid) at room temperature until bands were sharp. The gel was then dried to whatman paper and imaged.

A.19 Preparation of Proteins for iTRAQ Labeling

Elutriated monocytes (3 × 106 cells/well) were plated in 6-well plates and differentiated as

previously described. Cells were either left untreated or treated with 1 μg/ml E. coli 0111:B4

LPS (Sigma),1 μg/ml rhIFN-γ (Sigma), or Poly(I:C) (Sigma) as previously described for 1, 12, or

133

24 hours. Following treatment cells were washed four times with 1× PBS and lysed in lysis buffer (1% Triton X-100, 2 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1 mM DTT, 1 mM

NaF, 1mM Sodium Orthovanadate, Protease Inhibitor Cocktail Tablet (Roche), Phosphatase

Inhibitor Cocktail I (Sigma), and Phosphatase Inhibitor Cocktail II (Sigma)). Lysates were sonicated to breakup genomic DNA. Cell lysate protein concentrations (Table A-2) were obtained with a NanoDrop ND-1000 Spectrometer (NanoDrop Technologies, Wilmington, DE) at 280 nm. Proteins were extracted from the cell lysate using a modified Trizol method (Kirkland et al., 2006). To start the protein extraction, 1 mL of TRI Reagent (Molecular research Center,

Inc., Cincinnati, OH) was added to each sample and held at room temperature for 5 minutes.

Next, 200 μL of chloroform was added to each sample, mixed for 15 seconds, and held at room temperature for 10 minutes. Following incubation, the samples were centrifuged at 12,000 g for

10 minutes. The top aqueous layer was removed without disturbing the bottom layer and discarded. To the bottom layer, 300 μL of ethanol was added, vortexed, and held at room temperature for 3 minutes. The solution was then centrifuged at 2000 g for 5 minutes at 4oC.

Each sample was split in half and transferred to new 1.5 mL tubes. The samples were split based on the volumes of buffers needed for the next steps. To each tube, 1.5 mL of cold isopropanol was added, mixed for 5 minutes, and centrifuged at 12,000 g for 10 minutes at 4oC. The supernatant was removed and the protein pellets were washed 3 times with 2 mL of 0.3 M gauanidine HCl (95% ethanol) for 10 minutes at 4oC. Between washes, the samples were centrifuged at 7500 g for 10 minutes at 4oC. Lastly, the samples were washed with 1.5 mL of

100% ethanol, held at room temperature for 10 minutes, and centrifuged at 7500 g for 5 minutes at 4o C. At this point, half of the protein pellets were stored at -35o C and the other half were worked up following the iTRAQ labeling procedure (Applied Biosystems, Foster City, CA).

134

To the protein pellets, 40 μL of iTRAQ dissolution buffer and 2 μL of iTRAQ denaturing

buffer was added. The solution was vortexed, centrifuged at high speed for 30 seconds, and

incubated at 60oC for 1 hour. Next, 2 uL of iTRAQ cysteine-blocking reagent was added and

allowed to incubated at room temperature for 15 minutes. Trypsin was then added (2 μL of

0.4μg/μL) and incubated at 37oC for 12 hours. Since the pellet was not completely solubilized,

another 2 μL of trypsin was added and incubated for 24 hours at 37oC. After this addition of

trypsin, the pellet had solubilized. To ensure that all of the proteins were digested, one more 2

μL aliquot of trypsin was added and incubated for 12 hours at 37oC.

Tables A-3 and A-4 present the designated isotope tag for a particular sample. iTRAQ

reagents from the iTRAQ Reagent Multiplexing Kit (Lot Number 0607045) were dissolved in 70

μL of 100% ethanol. To the assigned samples described in Tables A-3 and A-4, the entire

content of the particular labeling reagents was transferred. Each tube was then briefly vortexed,

centrifuged at high speed for 30 seconds, and allowed to incubate at room temperature for 1

hour. Following the reaction, samples were speed vacuumed to remove ethanol. At this point,

peptide concentrations were determined with the NanoDrop ND-1000 Spectrometer. Table A-5

presents the sample name, the peptide concentration in mg/mL and the volume taken for a final

target protein amount of 35 μg per a sample. The biological duplicates were then combined and

diluted to 40 μL with iTRAQ dissolution buffer. Also, to ensure that the reactions had proceeded

to completion, MS analysis of 2 μL of the 1 hour untreated sample provided positive results with

several 291 amu peaks in the MS/MS spectra. The combined samples were then subsequently

desalted with strong cation exchange resin. Following the desalt, samples were speed vacuumed

to dryness and resuspended in 25 μL of 0.1 mM acetic acid / 3% acetonitrile for future analysis.

135

Prior to MS analysis, 12 μL of each sample were diluted to 27 μL with 0.1 mM acetic

acid/3% acetonitrile in a 96 well plate for automated injection of 5 μL with an Agilent 1100

micro well plate autosampler (Santa Clara, CA, CA # G1377A). Samples were injected (5 μL)

onto a trapping column (pressure bomb packed to 4.0 cm x 100 μm i.d. with YMC ODS-A 5 to

15 μm particle size, 120 Å) for a 10 minute desalt wash. Following the wash, a 10 port valve was

switched for peptide elution onto an analytical column (8.0 cm x 100 μm i.d. with YMC-ODS

AQ 5 μm particle size, 120 Å) with a 4 hour gradient. Electrospray was generated with Advion

Biosystems Triversa NanoMate (Ithaca, NY) source operated in LC coupling mode. Mass

spectrometry was performed with an LTQ OrbiTrap (ThermoScientific, San Jose, TX) operated

in top 3 data dependent mode with precursor ions measured at 30,000 resolution.

MS/MS spectra for peptide and protein identification were searched against the human

international protein index database (version v3.24, http://www.ebi.ac.uk/IPI/IPIhuman.html) with MASCOT by defining the N-terminus fixed with the iTRAQ mass addition of 145.1115 amu, lysine with the variable iTRAQ mass addition of 272.1940 (includes the mass of lysine), and cysteine with the variable iTRAQ Cysteine-blocking reagent (MMTS) mass addition of

148.9985 amu (includes mass of cysteine). Identified proteins were visualized with Scaffold

(Proteome Software, Portland, OR). A minimum of 2 peptides were required for high confidence protein identification. Furthermore, using Scaffolds PeptideProphet (Keller et al.,

2002;Nesvizhskii and Aebersold, 2004;Carr et al., 2004) scoring algorithm, only proteins that had protein confidence score above 95.0% and a peptide confidence score above 90 % were accepted. Lastly, all identified peptides were within the + 5 ppm mass accuracy afforded by the

instrument.

136

To generate protein quantification profiles, MS precursor ions were aligned with

Proteomarker (Infochromics, Toronto, Ontario) (Le et al., 2006). Briefly, the program first

extracts the total ion chromatogram (TIC) of a specific mass-to-charge and deconvolutes it to the

exact mass of the peptide (also including the different charge states). Second, the software aligns

the deconvoluted exact masses (aka chrompeaks) across the entire 4 hour gradient. Third, the

program normalizes the chrompeak intensities and areas across all of the aligned peaks. Finally,

an output is reported which contains chrompeak IDs and associated retention times, exact mass,

peptide sequence, normalized peak areas, etc.

Several different files were aligned for differential comparison. First, MS triplicates

(technical triplicates) were aligned to generate the coefficient of variance (CV). The CV was

used for quality control of the samples analyzed and errors for the following described

alignments. Second, data sets corresponding to time points were aligned for interrogation of

changes in protein profiles over a 24 hour time period. Lastly, data files corresponding to

different treatments, but the same time point, were aligned for comparison between differently

treated samples at the same time point. To provide a final piece of quality control on the data set,

identified peptides were assigned to proteins with the aid of Scaffold (Proteome Software,

Portland, OR) and re-checked against the raw files for agreement with exact mass and retention

times.

A.20 Preparation of Proteins for 1-Dimensional Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis Tandem Mass Spectrometry Analysis.

Elutriated monocytes (3 × 106 cells/well) were plated in 6-well plates and differentiated as

previously described. Cells were either left untreated or treated with 1 μg/ml E. coli 0111:B4

LPS (Sigma) or 1 μg/ml rhIFN-γ (Sigma) as previously described for 1, 12, or 24 hours.

Following treatment cells were washed four times with 1× PBS and lysed in lysis buffer (8 M

137

GuHCl, 5% 1-propanol, 100 mM ammonium bicarbonate, 10 mM DTT, pH 8.6) and stored at -

80°C.

A.20.1 Reduction and alkylation

Cell lysate samples were thawed on ice bath for 30 minutes. For each sample, 3 x 1mL

aliquots of cells in lysis buffer were pooled together in a 15mL Falcon Tube. Samples were vortexed and briefly probe sonicated. Reduction was performed by boiling samples at 90°C for

20 minutes followed by incubating the samples at 37°C for 60 minutes. Add 240uL of alkylation

solution (500mM iodoacetic acid) to each sample and incubate at room temperature in the dark

for 60 minutes. The alkylation reaction was quenched with 50uL 2M DTT, then placed into 3mL

3500MWCO dialysis cassettes (Pierce) and dialyzed against Milli-Q water for 16 hours. Samples

were removed from cassettes and placed into preweighed 2.0mL Axygen tubes and lyophilized

to dryness. Tubes were reweighed to obtain dry protein pellet weights. For each sample, 2mg of

protein was rehydrated in 400uL of 2X LDS/10mM DTT buffer. Samples were incubated at 37C

for 10 minutes and centrifuged at 14,000rpm for 10 minutes. Samples were loaded into a 2D

10% Bis/Tris MOPS gel (Invitrogen Life Technologies) and run for 2 hours at 250V, 50mA, and

16W. Add 500uL of destain solution (50% ethanol, 7.5% acetic acid) and allow gels to shrink for

14 hours on a rotary shaker. Add 500uL of Milli-Q water and allow gels to swell for 40 minutes

on a rotary shaker. Add 250uL of SimplyBlue SafeStain (Invitrogen Life Technologies) to each

gel and allow gels to stain for one hour on a rotary shaker. Gels were imaged and sliced

according to molecular weight standards (Table A-1) (BenchMark Protein Ladder).

A.20.2 In-gel digestion and peptide extraction

Gel pieces were placed into 2.0mL Axygen tubes. All further processing of the samples was performed in a dual isolation BioSafety Cabinet. The gel pieces are destained with 2 washes

138

of 50% ethanol, 7.5% acetic acid. The destain solution was removed and the gel pieces rinsed

with three alternating washes of 50mM ammonium bicarbonate and acetonitrile. The final

acetonitrile wash was removed just prior to digestion and the gel slices were dried for 30 minutes

in a speedvac. The tubes containing the dried gel pieces were placed on ice and 250μL of

Promega Sequencing grade trypsin in a concentration of 6.6μg/mL in 50mM ammonium bicarbonate/10% acetonitrile was added to each sample. The gel pieces were allowed to swell for

30 minutes on ice. The tubes are then capped and incubated for 48 hours at 37°C. Peptides were extracted with two washes of 350μL of 50mM ammonium bicarbonate/10% acetonitrile and two washes of 350μL of 50% acetonitrile 0.1% formic acid. All extracts are frozen to -80°C and lyophilized to dryness. The lyophilate is redissolved into 200μL of 5% acetonitrile 0.25% formic acid.

A.20.3 Mass spectrometry

Samples are run on a LCQ DECA XP plus Proteome X workstation from Thermo Fisher.

For each run 40μL of each reconstituted sample (20%) was injected with a Famos Autosampler while the separation was done on a 75μm i.d. x 20cm column packed with C18 media running at a 2μL/minute flow rate provided from a Surveyor MS pump with a flow splitter with a gradient of 5-72% water 0.1% formic acid, acetonitrile 0.1% formic acid over the course of 240min.(4.0 hour run). In between each sample a standard of a 5 Angio mix peptides(Michrom

BioResources) to ascertain column performance, and observe any potential carryover that might have occurred. The LCQ is run in a top five configuration, with one MS scans and five MS/MS scans. Dynamic exclusion is set to 1 with a limit of 30 seconds. Peptide ID’s are made using

SEQUEST through the Bioworks Browser 3.2. Sequential database searches was made using the

NCBI RefSeqHuman FASTA database using differential carboxymethylated modified cysteines

139

and oxidized methionines. Peptide score cutoff values were chosen at Xcorr of 1.5 for singly

charged ions, 2.5 for doubly charged ions, and 3.0 for triply charged ions, along with ΔCN

values of 0.1, and RSP values of 10. A Peptide Probability value of 1e-3 was also instituted. The

cross correlation values chosen for each peptide assure a high confidence match for the different

charge states, while the ΔCN cutoff insures the uniqueness of the peptide hit. The RSP value of 1 insures that the peptide matched the top hit in the preliminary scoring.

For each gene, for each slice a minimal (duplicates removed) set of peptides was determined. This list was sorted by the total number of peptides, in descending order. The first peptide array in this list was defined as a cluster and compared pair wise to every other array in the list by determining whether the N-1 comparison was an equal or a proper subset. If the peptide array was determined to be an equal or proper subset, it was added to the cluster and removed from list. The process was repeated until all comparisons were exhausted. For each cluster, the gene with the greatest number peptides elements was assigned to designate the cluster. If multiple genes within the cluster had the same number of peptides, an arbitrary member was assigned as representative of the cluster. Peptides shared between clusters were identified and removed from further analysis.

Peptide area was calculated using the area function in BioWorks 3.2 (Thermo Fisher) with scan window of 60. Gene area was calculated as the sum of the areas for each independent analyte for all unique peptides within a cluster. If multiple areas were identified for a given analyte, the largest area was selected and used in the in the area calculation. An independent analyte is defined as unique mass to charge identified in the SEQUEST search passing the filtering criterion.

140

Table A-1. Molecular weight regions of 1-dimensional gel slices analyzed by mass spectrometry. Molecular Weight Region Slice (kDa) 1 > 350 2 220 – 350 3 160 – 220 4 120 – 160 5 100 – 120 6 80 – 100 7 60 – 80 8 50 – 60 9 40 – 50 10 35 – 40 11 25 – 35 12 20 – 25 13 15 – 20 14 10 – 15 15 < 10

141

Table A-2. Protein concentrations in mg/mL of cell lysate as determined at 280 nm with a NanoDrop ND-100 spectrometer. Treatment Sample 1 hour 12 hours 24 hours Untreated 1 25.18 22.25 26.78 Untreated 2 25.93 26.48 26.47 Poly(I:C) 1 23.92 24.84 25.33 Poly(I:C) 2 26.07 27.93 26.18 IFN-γ 1 27.64 27.59 21.85 IFN-γ 2 27.64 27.59 21.85 LPS 1 24.25 25.30 21.75 LPS 2 26.84 22.48 24.42

142

Table A-3. Sample names associated with isotopic labels: biological sample 1. Treatment 1 hour 12 hours 24 hours Untreated 114 117 116 IFN-γ 115 114 117 LPS 116 115 114 Poly(I:C) 117 116 115

143

Table A-4. Sample names associated with isotopic labels: biological sample 2. Treatment 1 hour 12 hours 24 hours Untreated 115 116 117 IFN-γ 116 117 114 LPS 117 114 115 Poly(I:C) 114 115 116

144

Table A-5. Normalization of protein concentration. Each volume was brought up to 20 μl. Treatment Sample [p] in mg/ml Vol. taken (ml) Treatment Sample [p] in mg/ml Vol. taken (ml) Untreated 1 hour 1 2.78 12.6 IFN-γ 1 hour 1 2.30 15.2 Untreated 1 hour 2 3.83 9.2 IFN-γ 1 hour 2 3.02 11.6 Untreated 12 hours 1 1.80 19.5 IFN-γ 12 hours 1 4.53 7.7 Untreated 12 hours 2 2.66 13.2 IFN-γ 12 hours 2 6.32 5.5 Untreated 24 hours 1 1.90 18.4 IFN-γ 24 hours 1 4.95 7.1 Untreated 24 hours 2 4.77 7.3 IFN-γ 24 hours 2 4.02 8.7 Poly(I:C) 1 hour 1 2.52 13.9 LPS 1 hour 1 2.50 14.0 Poly(I:C) 1 hour 2 2.73 12.8 LPS 1 hour 2 2.23 15.7 Poly(I:C) 12 hours 1 2.69 13.0 LPS 12 hours 1 2.45 10.7 Poly(I:C) 12 hours 2 7.00 5.0 LPS 12 hours 2 2.27 14.0 Poly(I:C) 24 hours 1 2.56 13.7 LPS 24 hours 1 3.29 13.7

145 Poly(I:C) 24 hours 2 6.59 5.3 LPS 24 hours 2 2.50 5.3

Table A-6. Sample names associated with isotopic labels: mixed biological samples. Mixed Samples 1 hour 12 hours 24 hours Untreated 114/115 116/117 116/117 IFN-γ 115/116 114/117 114/117 LPS 116/117 115/117 114/115 Poly(I:C) 117/114 115/116 115/116

146

APPENDIX B CHARACTERIZATION OF THE THP-1 CELL LINE WITH RESPECT TO HIV-1

B.1 Introduction

Macrophages originate from the bone marrow from the following precursor cells: monocytes, promonocytes and monoblasts. The monoblast is the least mature cell in the mononuclear phagocyte system (Burke B and Lewis CE, 2002). Differentiation progresses from monoblast through promonocyte to monocyte, which remains in the bone marrow for less than

24 hours before entering the blood stream (Meuret and Hoffman, 1973;van and Sluiter, 1986).

Monocytes that leave the bone marrow and enter the peripheral blood do not return. Monocytes migrate throughout the entire body and enter extravascular tissues by the expression of adherence molecules, diapedesis between endothelial cells and subsequent migration through subendothelial structures to become macrophages (Table A-1) (Burke B and Lewis CE, 2002).

The culture of macrophages is typically performed by isolating monocytes either from bone marrow or peripheral blood (Gessani et al., 2000). Several methods exist for purifying monocytes from other cell types, the most commonly used being adhesion followed by a wash step to remove non-adherent cells. An extension of this method that is commonly used in our lab is RosetteSep, which is an antibody cocktail added to the cells that cross-links non-monocyte antigens to erythrocytes. The cross-linked cell suspension is layered over ficoll and centrifuged.

The dense erythrocytes pull non-monocytes through the ficoll leaving the monocytes at the interface. The adhesion step is then performed, and monocytes are differentiated for 7 days into macrophages. Although this method results in >99% pure macrophages (Coberley et al., 2004), cellular yields are poor. Elutriation of monocytes from peripheral blood also produces relatively pure macrophages and higher yields, however, experimenters are still constrained to the cells that can be obtained from a single individual. Since individuals possess different genotypes, pooling

147

of macrophage cultures becomes an issue in experimental variability and is therefore not

performed in our lab. Therefore, a cell line that could properly model primary macrophages

would significantly contribute to design of large experiments and reduce variability between experiments.

THP-1 is a monocytic suspension cell line derived from the peripheral blood of a 1-year- old male with acute monocytic leukemia. THP-1 cells can be manipulated, through exposure to phorbol esters, into expressing adhesion molecules and differentiating in a state that morphologically resembles a macrophage (Tsuchiya et al., 1980). Differentiated THP-1 cells are unique because they are one of a few cell lines that express both CD4 and CCR5, without transfection, and support growth of a CCR5-strain HIV-1 (Konopka and Duzgunes, 2002).

In this study, we characterized THP-1 cell line in comparison to primary macrophages and

another promonocytic cell line, U937, which supports growth of CXCR4-utilizing but not CCR5-

utilizing HIV-1. Several features of viral infectivity and spread were analyzed in THP-1 cells and

compared to primary macrophages.

B.2 Experimental Design

THP-1 cells were prepared as described in Appendix A.5. Western blot on whole cell

lysates were performed on differentiated THP-1 cells (Appendix A.10). Coomassie stains of

electrophoresed proteins were performed as described in Appendix A.18.

B.3 Results

B.3.1 THP-1 lacks T-Lymphocyte-specific Signaling Molecule, p56Lck

CD4 molecules on the surface of T-lymphocytes and macrophages signal through different

secondary molecules. HIV-1 and SIV Nef proteins interact with p56Lck, which is important in

priming CD4+ T-lymphocytes for HIV-1 infection (Djordjevic et al., 2004;Yang and Henderson,

2005;Fackler et al., 2001). HIV-1 Tat activates p56Lck, which leads to activation of NF-κB, AP-

148

1, JNK, MAPKK, caspases, and apoptosis (Manna and Aggarwal, 2000). Engagement of CD4 on

T-lymphocytes activates a SRC family protein tyrosine kinase, p56Lck, which macrophages lack.

To determine if THP-1 cells also lack p56Lck, western blot analysis was performed on whole cell

lysates. As a positive control, cell lysate from the T-lymphocytic cell line, Jurkat, was also

prepared. A promonocytic cell line, U937, lysate was also prepared as a negative control.

Coomassie brilliant blue staining indicates presence of protein in cell lysates (Fig. B-1A).

Western blot detected p56Lck in Jurkat cell lysate (Fig. B-1B). In contrast, p56Lck was not

detected in either the U937 or THP-1 lanes. Further analysis on primary cells detected several

different isoforms in peripheral blood mononuclear cells (PBMC) (Fig. B-2). The predominant p56Lck isoform in PBMC has a lower molecular weight compared to the predominant isoform

expressed in Jurkat cells. As expected, no p56Lck expression was detected in MDM cell lysate.

B.3.2 THP-1 and Monocyte-derived Macrophages Both Progress through the Cell Cycle with Similar Kinetics but Blocked before Mitosis.

HIV-1 infection is greatly influenced by the particular position the host cell exists with

respect to the cell cycle upon viral entry (Coberley et al., 2004;Goh et al., 1998;Goh et al.,

2004;Kootstra et al., 2000;Schuitemaker et al., 1994a;Wahl et al., 2003;Wang and Lewis, 2001).

Cell cycle position was compared between THP-1 and MDM by propidium iodide staining to measure DNA content. Flow cytometry analysis revealed relatively similar percentages of cells in all phases of the cell cycle between the two populations (Fig. B-3). THP-1 cells were arrested in G1 in a dose-dependent manner by increasing amounts of aphidicolin (Fig. B-4), a specific inhibitor of DNA polymerase A/D (Dhillon et al., 2003). Aphidicolin treatment blocks HIV-1 infection in MDM, indicating the importance of progression out of G1 for efficient HIV infection

(Schuitemaker et al., 1994a).

149

Relatively high percentages of cells detected in G2 in both MDM and THP-1 cultures raised the question of whether these cells were actually transitioning through mitosis and dividing. THP-1 cell generations were measured by staining intracellular proteins with the fluorescent marker, CFSE. Following 10 days of culture, the cells were analyzed by flow cytometry. A single fluorescence intensity was detected for THP-1 (Fig. B-5), similar to results previously obtained for MDM, suggesting the cells are not proliferating and remain in the parent generation.

B.3.3 Differentiated THP-1 Cells are Susceptible to D-X4 and M-R5 Viral Infection and Resistant to T-X4 Viruses.

MDM are susceptible to infection by viruses expressing either the M-R5 and D-X4 envelope, but are resistant to viruses with a T-X4 envelope (Ghaffari et al., 2005;Goodenow and

Collman, 2006). Differentiated THP-1 cells express CD4, CXCR4, and CCR5 receptors on the surface (Konopka and Duzgunes, 2002). To determine which envelopes confer entry to differentiated (Adherent) and undifferentiated (Suspension) THP-1, cells were treated with viruses pseudotyped with one of the 3 envelopes for 24 hours. Following 3 days of post- treatment culture, cell lysates were measured for luciferase activity, a measure of viral entry.

Undifferentiated THP-1 cells confer relatively similar levels of susceptibility to virus regardless

of envelope (Fig B-6.). In contrast, differentiated THP-1 displayed similar susceptibility and

resistance patterns to MDM. Although higher levels of luciferase activity was detected with D-

X4 viral treatment in the undifferentiated THP-1 cells, M-R5 entered with the greatest efficiency

in differentiated THP-1 cells.

B.3.4 Replication-competent M-R5 Virus use CCR5 for Entry and Spreads in Differentiated THP-1 Culture with Similar Kinetics to Monocyte-derived Macrophages.

Since single-cycle M-R5 virus can enter differentiated THP-1 cells, we next asked if

replication-competent virus can spread through culture and how the kinetics compare to MDMs.

150

THP-1 and MDMs were treated with the M-R5-tropic, HIVAD. Supernatants were collected over seven days and analyzed for p24 concentration by ELISA. HIVAD spread through both THP-1 and MDM cultures with similar replication kinetics (Fig. B-7).

To evaluate the use of CCR5 in the spread of HIVAD in the differentiated THP-1 cell culture, cells were pretreated with monoclonal antibody against CCR5, 2D7, for 1 hour. 2D7 pretreatment completely inhibited viral spread in culture (Fig. B-8). Viral replication was also attenuated by 1 hour pretreatment with at least 100 nM of the small molecule inhibitor of CCR5,

TAK-779 (Fig. B-9). These results suggest that HIVAD replication in differentiated THP-1 cells requires the use of CCR5 on the surface of the host cell.

B.3.5 JAK-STAT Signaling in THP-1 cells

Macrophages signal through STAT1 in response to M-R5 and T-X4 envelopes. T-X4 envelopes are incapable of using CD4 and CXCR4 on the surface of MDM to enter cells. Our lab has previously shown that MDM activate STAT1 through interaction with CD4, using a monoclonal antibody directed against CD4, Q4120 (Kohler et al., 2003). To determine if differentiated THP-1 cells also activate STAT1 through CD4 we performed western blots on

THP-1 cell lysates for phosphorylated STAT1 following stimulation. IFN-γ stimulation served as a positive control, and the level of phosphorylated STAT1 increased following stimulation compared to untreated control (Figure B-10). In contrast to published results in MDM, Q4120 stimulation failed to significantly increase the level of phosphorylated STAT1. A431 is a fibroblast cell line used as a positive control for STAT1. These results suggest a difference in

CD4 signaling through the JAK-STAT pathway.

B.3.6 Supernatant Cytokine Expression Profiles Following gp120 Treatment.

To determine how signaling events within differentiated THP-1 cells in response to HIV-1 envelope treatment altered secreted cytokine expression patterns we used Luminex to probe

151

supernatants at various time points within 24 hours following stimulation with a CCR5-utilizing envelope, gp120BaL. IFN-γ stimulation of THP-1 cells was performed as a positive control. A panel of 9 cytokines was selected for measurement: MIP-1α, MIP-1β, MCP-1, IL-8, Eotaxin,

FGF-2, IFN-γ, RANTES, and TNF-α. Poor correlation in the RANTES standard dilutions made data points for this cytokine unreliable. Altered expression profiles for MIP-1α, MIP-1β, MCP-

1, IL-8, and IFN-γ was observed (Figure B-11).

B.3.7 THP-1 Cells Possess the T-X4 Viral Post-entry Restriction Observed in Monocyte- derived Macrophages.

T-X4 viruses are unable to replicate in macrophage culture with the block occurring at entry, the viral envelope is unable to use CD4 and CXCR4 to infect macrophages. Interestingly, some T-X4 viruses, such as HIVLAI, pseudotyped with CCR5-utilizing envelopes of high infectivity potential, such as the envelope from HIVAD, still fail to spread in macrophages, suggesting a second restriction following entry. Two possibilities may account for this post-entry restriction: (1) macrophages may fail to express a factor required by certain T-X4 viruses for infection or (2) macrophages express a restriction factor that either targets domains of certain T-

X4 viruses or is neutralized by permissive HIV viruses. The viral domains important for this post-entry restriction are currently being elucidated in our lab, and therefore we asked if differentiated THP-1 cells also possess this post-entry restriction observed in primary macrophages. High variability in viral infections of primary macrophages would make differentiated THP-1 cells an ideal model to switch to for elucidating the post-entry restriction domains within T-X4 virus if the restriction is conserved in THP-1 cells.

Five viruses were used to infect differentiated THP-1 cells. HIVAD is the CCR5-utilizing virus that served as the positive control, and spread through culture with kinetics similar to previous observations. HIVLAI, the T-X4 virus, failed to spread through culture as expected. LAI

152

pseudotyped with AD’s envelope (LAI AD(V1-V5)) failed to restore LAI back to AD levels

(Figure B-12), suggesting the post-entry restriction is present in THP-1 cells. Nearly the entire

gag-pol region of LAI was interchanged with AD in the LAI AD(V1-V5) virus and fully rescued

LAI to levels above AD (LAI (AD5’)), as previously observed for MDM. To further narrow

down a particular protein in the 5’ region of the virus, p17MA of LAI was switched with matrix of

AD (LAI (AD MA)). As previously observed in primary macrophages, LAI (AD MA) rescued

LAI to 65 – 70% of AD.

B.4 Discussion

In these studies, we characterized the THP-1 cell line and compared their ability to support

CCR5-utilizing HIV-1 infection and spread through culture to primary macrophages.

Macrophage signaling machinery differs considerably from lymphocytes. For example,

lymphocytes use CD4 in concert with the T-cell receptor complex (TCR) to recognize peptides

presented in the context of MHC class II molecules. THP-1 cells lack the Src-related signaling

kinase, p56Lck, specific to lymphocytes, which correlates with primary macrophage expression.

In addition, differentiated THP-1 cells are terminally differentiated cells, which fail to divide and

possess a small fraction of cells in G2, similar to macrophages. Overall, differentiated THP-1

cells display similar growth kinetics as primary macrophages.

Differentiated THP-1 cells also support entry of M-R5 and D-X4 enveloped viruses, which

correlates with MDM. Using the replication-competent, CCR5-utilizing HIVAD, we showed

THP-1 cells are capable of supporting viral spread through culture with kinetics comparable to

primary macrophages, and that HIVAD replication is dependent on functional CCR5 expression

on the host cells. The presence of the CCR5 inhibitior, TAK-779, restricted HIVAD spread in a

dose-dependent manner.

153

THP-1 cells respond to envelope treatment with similar cytokine profiles as MDM, however, in contrast to macrophages, THP-1 cells constitutively express IFN- γ. IFN- γ, a type II interferon, is typically secreted by T-lymphocytes in response to antigenic recognition.

Expression of this type II interferon represents an important difference between differentiated

THP-1 cells and MDM that is likely fundamentally linked by distinct genomic regulation between these two cell types. Therefore, inherent differences in genomic responses may result in considerable challenges if comparing genomic responses between MDM and differentiated THP-

1, as cancer cells express altered signaling molecules that tend to be constitutively active resulting in considerably different gene expression profiles (Ramanathan et al., 2005;Elstrom et

al., 2004;Serkova and Boros, 2005). Due to differences in IFN-γ expression between MDM and

THP-1 cells we decided not to pursue the use of THP-1 cells to further investigate and confirm

the envelope studies (Chapter 5).

MDM support growth of HIV viruses that possess either an M-R5, D-X4, or D-X4R5

envelope. However, if the envelope of the T-X4 virus, HIVLAI, is replaced with an M-R5

envelope from HIVAD, the virus still fails to spread through culture despite the ability to enter

macrophages. Therefore, a post-entry restriction exists which is specific to a region or regions of

HIVLAI other than gp120 that block viral replication. To determine if THP-1 cells also possess

this post-entry restriction, we used a panel of recombinant viruses commonly used in our post-

entry restriction studies in MDM, and applied them to differentiated THP-1 cells. A very similar

pattern of restriction was observed in THP-1 cells as is typically encountered in representative

MDM donors. Although this pattern of restriction was observed in 2 replicate experiments,

HIVLAI, grew in a third (data not shown). These results are only preliminary, and further studies

need to be conducted to ensure that differentiated THP-1 cells are resistant to HIVLAI entry and

154

they possess the post-entry restriction similar to MDM. THP-1 cells would be a valuable model for the study of post-entry restriction of T-X4 viruses as a considerable amount of variability is commonly associated with primary macrophage studies, and could be significantly reduced by a cell line such as THP-1.

155

Table B-1. Distribution of mononuclear phagocytes. Site Cell Bone Marrow Monoblasts Promonocytes Monocytes Macrophages Peripheral blood tissues Monocyte Liver (Kupffer cells) Lung (Alveolar macrophages) Connective tissue (histiocytes) Spleen (red pulp macrophages) Lymph node Thymus Bone (osteoclasts) Synovium (type A cells) Mucosa-associated lymphoid tissue Gastrourinary tract Endocrine organs Central nervous system (microglia) Skin (histiocytes/Langerhans cells) Serous cavities Pleural macrophages Peritoneal macrophages Inflammatory tissues Epitheloid cells Exudate macrophages Multinucleate giant cells (Burke B and Lewis CE, 2002)

156

Figure B-1. Macrophage-like cell line fails to express p56Lck. A) Coomassie Brilliant Blue stain of cell line proteins subjected to SDS-PAGE. The cell lysate of the T-lymphocytic cell line, Jurkat, was purchased from BD Biosciences and included as a positive control. Lysates prepared from Jurkat cells, PMA-differentiated THP-1 cells, and the promonocytic cell line, U937, were added to the 4-20% linear gradient gel and electrophoresed. B) Western blot of cell line whole cell lysates for p56Lck. 25 and 50 μg of whole cell lysate was added to wells.

157

Figure B-2. Western blot of whole cell lysate derived from both primary and cell line lysate for p56Lck.

158

Figure B-3. Porbol 12-myristate 13-acetate (PMA)-differentiated THP-1 cells and MDM were fixed with ethanol and stained with propidium iodide (PI). PI intercalation into genomic DNA was measured by flow cytometry. Cells were categorized into cell cycle phases by DNA content.

159

Figure B-4. Aphidicolin-mediated G1 arrest of suspension THP-1 cells. Undifferentiated THP-1 cells were treated with up to 7 μg/ml of aphidicolin for 48 hours. Propidium iodide uptake following ethanol fixation was measured by flow cytometry. DNA content in terms of percentage of cells is represented.

160

Figure B-5. Cell proliferation of PMA-differentiated THP-1. THP-1 cells were stained with CFDA-SE and incubated for 10 days. Cellular CFSE fluorescence was detected by flow cytometry, as shown in histogram. Inlay panel indicates the gated population selected for analysis by forward scatter versus side scatter.

161

Figure B-6. Entry of pseudotyped single-cycle viruses in undifferentiated (Suspension) and PMA-differentiated (Adherent) THP-1 cells. Single-cycle viruses encoding the gene for luciferase were pseudotyped with a T-X4 gp120 (derived from HIVLAI), D-X4 gp120 (derived from HIVMM), or M-R5 gp120 (derived from HIVAD). Cells were treated with virus for 24 hours, washed, and incubated for 3 days. Luciferase activity was detected in cell lysates and reported as Relative Light Units (RLU) per 1 million cells.

162

Figure B-7. Viral spread in a differentiated THP-1 cell culture compared to macrophages. HIVAD spread was monitored by p24 ELISA on supernatant samples collected over a week of viral treatment. Samples from cultures left untreated were also collected for background measurement.

163

Figure B-8. Viral spread in differentiated THP-1 cells requires recognition of chemokine (C-C) motif receptor 5 (CCR5) on surface of target cell. Differentiated THP-1 cells were pretreated with the anti-CCR5 monoclonal antibody (2D7) for 1 hour prior to treatment with HIVAD.

164

Figure B-9. Suppressed HIV replication in differentiated THP-1 cell culture by TAK-779, a small molecule inhibitor specific for CCR5. THP-1 cells were pretreated with varying concentrations of TAK-779, up to 1 μM, for 1 hour prior to viral treatment. Supernatants were collected over 12 days and p24 concentration measured by ELISA.

165

Figure B-10. Western blot for STAT1 and pSTAT1 from THP-1 whole cell lysate. PMA- differentiated THP-1 cells were either left untreated or stimulated with IFN-γ or Q4120 for 30 minutes. Membrane was blotted for phosphorylated STAT1 (pSTAT1), STAT1, and β-actin as a loading control.

166

A.3.5 B. 3

3 2.5

2.5 2 2 1.5 1.5 Fold-Change Fold-Change 1 1

0.5 0.5

0 0 0 5 10 15 20 25 30 0 5 10 15 20 25 30 Hours Hours

C. 16 D. 100

8 10 6 Fold-Change Fold-Change 4

0 0 5 10 15 20 25 30 1 0 5 10 15 20 25 30 Hours Hours

E. 1.2

0.8

0.6

Fold-Change 0.4

0.2

0 0 5 10 15 20 25 30 Hours Figure B-11. Cytokine profiles of monocyte-derived macrophages and THP-1 cell supernatants following treatment. A) IL-8, B) MIP-1α, C) MIP-1β, D) MCP-1, and E) IFN-γ. Data is presented as fold-change of envelope-treated cells relative to the matched untreated control over 24 hours of treatment. Blue line with diamonds represents MDM supernatants following 2.5 μg/ml gp120BaL treatment, the green line with squares represents THP-1 supernatants following 2.5 μg/ml gp120BaL treatment, and the maroon line with triangles is supernatant from THP-1 cells treated with 1 μg/ml IFN- γ.

167

Figure B-12. Spread of chimeric viruses in differentiated THP-1 model. LAI post-entry restriction similar in THP-1 cells to previously observed experiments in primary macrophages.

168

APPENDIX C PROTEINS ALTERED BY LPS TREATMENT

Table C-1. Proteins increased ≥ 2-fold difference in expression by 24 hours of LPS treatment in 2 out of 3 donors. Functional Title Symbol Entrez Category GeneID Apoptosis BH3 interacting domain death agonist BID 637 Pre B cell colony enhancing factor 1 PBEF1 10135

Cell Growth Actinin alpha 4 ACTN4 81 Actinin alpha 1 ACTN1 87 Clathrin, heavy polypeptide CLTC 1213 Calponin 2 CNN2 1265 Gelsolin GSN 2934 Interferon induced protein with tetratricopeptide repeats 2 IFIT2 3433 Kinesin family member 5B KIF5B 3799 Keratin 1 KRT1 3848 Keratin 2A KRT2A 3849 Keratin 9 KRT9 3857 Keratin 10 KRT10 3858 Keratin 14 KRT14 3861 Nebulin NEB 4703 SOD2 SOD2 6648 Vimentin VIM 7431 Vitronectin VTN 7448 Major vault protein MVP 9961 Actin related protein 2/3 complex subunit 4 ARPC4 10093 Actin related protein 3 ACTR3 10096 Tumor necrosis factor alpha induced protein 8 TNFAIP8 25816 Myosin IG MYO1G 64005 AMAP 1 MYCBPAP 84073 Tubulin, beta 6 TUBB6 84617 Hepatoma-derived growth factor-related protein 2 84717 Myosin regulatory light chain MRLC2 103910 Tubulin, beta TUBB 203068

Immune Interferon induced protein with tetratricopeptide repeats 3 IFIT3 3437 Response Interferon-gamma-inducible protein 10 CXCL10 3627 RAB27A RAB27A 5873 SIGLEC1 SIGLEC1 6614 Interferon induced protein 15 G1P2 9636 DKFZP564J0863 protein 25923

Metabolism Acyl-Coenzyme A dehydrogenase, medium chain ACADM 34 Acyl CoA dehydrogenase, very long chain ACADVL 37

169

Table C-1. Continued. Functional Title Symbol Entrez Category GeneID Metabolism Acid phosphatase 1 ACP1 52 Continued Aldolase 1 ALDOA 226 Aminopeptidase N ANPEP 290 Serum amyloid P APCS 325 ATP5A1 ATP5A1 498 ATP5O ATP5O 539 Carboxylesterase 1 CES1 1066 Cytochrome c oxidase, subunit 4, isoform 1 COX4I1 1327 Citrate synthase CS 1431 Cathepsin B CTSB 1508 Cytochrome-b5 reductase CYB5R3 1727 Enoyl CoA hydratase 1 ECHS1 1892 Elongation factor 1 alpha 1 EEF1A1 1915 Eukaryotic translation initiation factor 2, subunit 3 EIF2S3 1968 Serpin B1 SERPINB1 1992 Enolase 1 ENO1 2023 Enolase 3 ENO3 2027 Acyl CoA synthetase long chain family member 4 ACSL4 2182 Fructose-1,6-bisphosphatase FBP1 2203 Glyceraldehyde 3 phosphate dehydrogenase GAPDH 2597 Glycerol kinase GK 2710 17 beta hydroxysteroid dehydrogenase 4 HSD17B4 3295 Heat shock 70 KD protein 1A HSPA1A 3303 Heat shock 70 kDa protein 1B HSPA1B 3304 Heat shock 70kDa protein 4 HSPA4 3308 Isocitrate dehydrogenase 1 IDH1 3417 Indoleamine 2,3-dioxygenase INDO 3620 Lactate dehydrogenase A LDHA 3939 Lactate dehydrogenase B LDHB 3945 Malate dehydrogenase mitochondrial MDH2 4191 Asparaginyl tRNA synthetase NARS 4677 Urokinase inhibitor SERPINB2 5055 Pyruvate dehydrogenase, beta polypeptide PDHB 5162 Protease inhibitor 1 SERPINA1 5265 Proteasome 26S subunit, ATPase 3 PSMC3 5702 Proteasome 26S subunit ATPase 4 PSMC4 5704 Ribosomal protein L21 RPL21 6144 Ribosomal protein L30 RPL30 6156 Ribosomal protein L34 RPL34 6164 Ribosomal protein S21 RPS21 6227 Ribosomal protein S27a RPS27A 6233 Seryl-tRNA synthetase SARS 6301 T Complex 1 TCP1 6950 Transketolase TKT 7086 Thioredoxin TXN 7295 Ubiquitin conjugating enzyme E2N UBE2N 7334

170

Table C-1. Continued. Functional Title Symbol Entrez Category GeneID Metabolism UDP glucose pyrophosphorylase 2 UGP2 7360 Continued Valosin containing protein VCP 7415 Tryptophanyl tRNA synthetase WARS 7453 Pyrroline 5 carboxylate dehydrogenase,delta 1 ALDH4A1 8659 Kynureninase KYNU 8942 Ubiquitin specific protease 14 USP14 9097 Suppressor of Lec15 MPDU1 9526 Peptidylprolyl isomerase F PPIF 10105 ORP150 HYOU1 10525 Peroxiredoxin 4 PRDX4 10549 Unactive progesterone receptor 23KD PTGES3 10728 GCN1 general control of amino acid synthesis 1 like 1 GCN1L1 10985 Serine dehydratase SDS 10993 ERO1-like ERO1L 30001 Leucine aminopeptidase 3 LAP3 51056 Leucyl tRNA synthetase LARS 51520 Adipocyte derived leucine aminopeptidase 51752 FLJ10808 Protein UBE1L2 55236 Nitrilase family, member 2 NIT2 56954 Retinoid-inducible serine carboxypeptidase SCPEP1 59342 Hypothetical protein FLJ22021 CORO7 79585 Lactate dehydrogenase A like 6B LDHAL6B 92483 Galactose mutarotase (aldose 1-epimerase) GALM 130589

Signal Annexin AV ANXA5 308 Transduction CD44 CD44 960 CD68 antigen CD68 968 CC chemokine receptor type 7 CCR7 1236 Collapsin response mediator protein 2 DPYSL2 1808 Endothelial cell growth factor 1 platelet derived ECGF1 1890 Eps15 EPS15 2060 Hck HCK 3055 Histidine triad nucleotide binding protein HINT1 3094 Intercellular adhesion molecule 1 ICAM1 3383 Integrin alpha 5 ITGA5 3678 Integrin alpha V ITGAV 3685 Integrin alpha X ITGAX 3687 Prosaposin PSAP 5660 Protein tyrosine phosphatase, non-receptor type 1 PTPN1 5770 Protein tyrosine phosphatase receptor type C PTPRC 5788 Ras-associated protein RAB6A RAB6A 5870 RAB27B RAB27B 5874 Reticulon 1 RTN1 6252 Calcyclin S100A6 6277 Syntaxin binding protein 2 STXBP2 6813 14-3-3 Beta YWHAB 7529

171

Table C-1. Continued. Functional Title Symbol Entrez Category GeneID Signal 14-3-3 zeta YWHAZ 7534 Transduction IQ motif containing GTPase activating protein 1 IQGAP1 8826 Continued Rho guanine nucleotide exchange factor 1 ARHGEF1 9138 Myosin regulatory light chain MRCL3 10627 IQGAP2 IQGAP2 10788 EH domain containing 1 EHD1 10938 Ras related protein Rab35 RAB35 11021 Nicastrin NCSTN 23385 EH domain containing 4 EHD4 30844 RAB6B RAB6B 51560 RAB39A RAB39 54734 Chemokine-like factor super family member 6 CMTM6 54918 RAB34 RAB34 83871 Centaurin delta 2 CENTD2 116985 RAB45 member RAS oncogene family RASEF 158158 RAB41 member RAS homolog family RAB41 347517

Transcription/ Apex nuclease APEX1 328 Translation ATP-dependent RNA helicase A DHX9 1660 GART GART 2618 Heterogenous nuclear ribonucleoprotein A1 HNRPA1 3178 Heterogeneous nuclear ribonucleoprotein C HNRPC 3183 Apex nuclease APEX1 328 Heterogenous nuclear ribonucleoprotein F HNRPF 3185 ISG20 ISG20 3669 Nuclear factor kappa B, subunit 2 NFKB2 4791 Non pou domain containing octamer binding protein NONO 4841 Poly(rC) binding protein 1 PCBP1 5093 Poly(rC) binding protein 2 PCBP2 5094 Placental ribonuclease inhibitor RNH1 6050 SRP20 SFRS3 6428 Transcription elongation factor B, 2 TCEB2 6923 KH type splicing regulatory protein KHSRP 8570 NS1 associated protein 1 SYNCRIP 10492 Prohibitin 2 PHB2 11331 Splicing factor 3B, subunit 3 SF3B3 23450 DDX58 DDX58 23586 UMP-CMP kinase CMPK 51727 Minichromosome maintenance protein 10 MCM10 55388 Heterogeneous nuclear ribonucleoprotein A3 HNRPA3 220988

Transport Albumin ALB 213 Adenine nucleotide translocator 3, Y-chromosomal SLC25A6 293 Apolipoprotein A I APOA1 335 Apolipoprotein E APOE 348 Coatomer protein complex, subunit delta ARCN1 372

172

Table C-1. Continued. Functional Title Symbol Entrez Category GeneID Transport Vacuolar ATP synthase subunit C ATP6V1C1 528 ATP6V1E ATP6V1E1 529 Chloride intracellular channel 1 CLIC1 1192 Fatty acid binding protein 5 FABP5 2171 Ferritin heavy chain 1 FTH1 2495 Transporter 1 ATP binding cassette, subfamily B TAP1 6890 Transferrin receptor TFRC 7037 Voltage dependent anion selective channel protein 2 VDAC2 7417 Adaptor-related protein complex 1, sigma 2 subunit AP1S2 8905 Adaptin, delta AP3D1 8943 Nuclear transport factor 2 NUTF2 10204 Solute carrier family, member 6 SLC2A6 11182 Coatomer protein complex, subunit gamma 1 COPG 22820 SNX5 SNX5 27131 Solute carrier family 15 member 3 protein SLC15A3 51296 Solute carrier family 29 member 3 SLC29A3 55315 Trafficking protein particle complex 1 TRAPPC1 58485 Der1 like domain family, member 1 DERL1 79139

Miscellaneous Ceroid lipofuscinosis, neuronal 8 CLN8 2055 Hematopoietic protein HEM-1 NCKAP1L 3071 Interferon induced protein with tetratricopeptide repeats 1 IFIT1 3434 Transgelin 2 TAGLN2 8407 Transmembrane 9 superfamily protein member 4 TM9SF4 9777 WD repeat protein 1 WDR1 9948 Hypothetical protein KIAA0767 23151 Cytoplasmic FMR1 interacting protein 1 CYFIP1 23191 GTP-binding protein PTD004 29789 SCIRP10-related protein NENF 29937 Calcium binding protein 39 CAB39 51719 Hypothetical protein FLJ10849 55752 Angiotensin II receptor associated protein AGTRAP 57085 DC2 protein 58505 Hypothetical protein LOC64423 C14orf173 64423 PH domain containing protein PLEKHQ1 80301 Normal mucosa of esophagus specific 1 C15orf48 84419 FCH domain only 2 FCHO2 115548 Family with sequence similarity 36, member A FAM36A 116228 Hypothetical protein LOC162427 162427 Hypothetical protein LOC339745 339745 BolA-like protein 2 BOLA2 552900

173

Table C-2. Proteins with ≤ 2-fold difference in expression by 24 hours of LPS treatment in 2 out of 3 donors Functional Title Symbol Entrez Category GeneID Apoptosis BAX BAX 581 BH3 interacting domain death agonist BID 637

Cell Growth Clathrin, heavy polypeptide CLTC 1213 EVI2B EVI2B 2124 Flightless 1 FLII 2314 Filamin A FLNA 2316 Keratin 9 KRT9 3857 Myosin IE MYO1E 4643 Talin TLN1 7094 Vasodilator stimulated phosphoprotein VASP 7408 Vimentin VIM 7431 Vitronectin VTN 7448 ARP2 actin-related protein 2 homolog (yeast) ACTR2 10097 Tubulin, alpha, ubiquitous 10376 Adenylyl cyclase-associated protein CAP1 10487 Charged multivesicular body protein 4a CHMP4A 29082 Reticulon 4 RTN4 57142 Tubulin, beta 6 TUBB6 84617 Tubulin, beta TUBB 203068 Keratin 1B KRT1B 374454

Immune Activated leukocyte cell adhesion molecule ALCAM 214 Response Beta 2 microglobulin B2M 567 Complement component C1q, C chain C1QC 714 CD9 CD9 928 CD14 CD14 929 CD74 antigen CD74 972 Fc IgE receptor,gamma chain FCER1G 2207 HLA-B HLA-B 3106 HLA-DRA HLA-DRA 3122 HLA-DRA HLA-DRA 3122 HLADRB1 HLA-DRB1 3123 Integrin alpha L ITGAL 3683 Galectin 1 LGALS1 3956 DKFZP564J0863 protein 25923 SAM domain and HD domain containing protein 1 SAMHD1 25939 SAM domain and HD domain containing protein 1 SAMHD1 25939 SIGLEC7 SIGLEC7 27036

Metabolism Macroglobulin, alpha 2 A2M 2 Acetyl-CoA acetyltransferase 2 ACAT2 39 Aconitase, mitochondrial ACO2 50 Tartrate resistant acid phosphatase ACP5 54 S adenosylhomocysteine hydrolase AHCY 191 ABCD1 ABCD1 215

174

Table C-2. Continued. Functional Title Symbol Entrez Category GeneID Metabolism Aldolase 1 ALDOA 226 Continued Aldose reductase AKR1B1 231 Serum amyloid P APCS 325 Apolipoprotein C II APOC2 344 Adenine phosphoribosyltransferase APRT 353 Acid ceramidase ASAH1 427 ATP5A1 ATP5A1 498 ATP synthase, beta ATP5B 506 ATP5O ATP5O 539 Carbonic anhydrase II CA2 760 Calreticulin CALR 811 Carbonyl reductase 3 CBR3 874 CD36 CD36 948 Catechol-O-methyltransferase COMT 1312 Cytochrome c oxidase subunit VI b COX6B1 1340 Cathepsin B CTSB 1508 Cathepsin D CTSD 1509 Cathepsin Z CTSZ 1522 Cytochrome b-5 CYB5 1528 Cytochrome b-245 beta polypeptide CYBB 1536 Cytochrome P450, subfamily 27A, polypeptide 1 CYP27A1 1593 7-dehydrocholesterol reductase DHCR7 1717 Elongation factor 1 alpha 1 EEF1A1 1915 eIF2 alpha EIF2S1 1965 Serpin B1 SERPINB1 1992 Enolase 1 ENO1 2023 Enolase 3 ENO3 2027 Fructose-1,6-bisphosphatase FBP1 2203 Fucosidase FUCA1 2517 Glyceraldehyde 3 phosphate dehydrogenase GAPDH 2597 Phosphohexose isomerase GPI 2821 Glutathione S transferase 3 GSTP1 2950 Hexosaminidase B HEXB 3074 Ubiquitin conjugating enzyme E2-25K HIP2 3093 Hexokinase 1 HK1 3098 Heme oxygenase 1 HMOX1 3162 Histamine N methyltransferase HNMT 3176 17 beta hydroxysteroid dehydrogenase 4 HSD17B4 3295 BIP HSPA5 3309 Mortalin 2 HSPA9B 3313 Heat shock protein 27 HSPB1 3315 Isocitrate dehydrogenase 1 IDH1 3417 Lysozyme LYZ 4069 Alpha mannosidase B MAN2B1 4125 Matrix metalloproteinase 9 MMP9 4318 Neutrophil cytosolic factor 4, 40kDa NCF4 4689

175

Table C-2. Continued. Functional Title Symbol Entrez Category GeneID Metabolism NADH ubiquinone oxidoreductase 1,alpha subcomplex 4 NDUFA4 4697 Continued N-myristoyl transferase 1 NMT1 4836 Protein carboxyl methyl transferase 1 PCMT1 5110 Phosphogluconate dehydrogenase PGD 5226 Protease inhibitor 6 SERPINB6 5269 Pyruvate kinase 3 PKM2 5315 Cyclophilin A PPIA 5478 Proteasome subunit,alpha type,4 PSMA4 5685 Proteasome subunit, beta type, 4 PSMB4 5692 Proteasome 26S subunit, ATPase 1 PSMC1 5700 Proteasome 26S subunit, ATPase,6 PSMC6 5706 Proteasome 26S subunit, non ATPase, 12 PSMD12 5718 Ribulose 5 phosphate 3 epimerase RPE 6120 Ribosomal protein L4 RPL4 6124 Ribosomal protein L4 RPL4 6124 Ribosomal protein L15 RPL15 6138 Ribosomal protein L17 RPL17 6139 Ribosomal protein L18 RPL18 6141 Ribosomal protein L19 RPL19 6143 Ribosomal protein L21 RPL21 6144 Ribosomal protein L27 RPL27 6155 Ribosomal protein S8 RPS8 6202 Ribosomal protein S17 RPS17 6218 Ribosomal protein S23 RPS23 6228 Ribosomal protein S24 RPS24 6229 Ribosomal protein S25 RPS25 6230 Ribosomal protein S27a RPS27A 6233 Ribosomal protein S29 RPS29 6235 Serine hydroxymethyl transferase, mitochondrial SHMT2 6472 SUMO3 SUMO3 6612 Transketolase TKT 7086 Ubiquinol cytochrome C reductase rieske iron sulfur UQCRFS1 7386 VHL binding protein 1 VBP1 7411 Degenerative spermatocyte homolog 1 lipid desaturase DEGS1 8560 Pyridoxal kinase PDXK 8566 Aldo-keto reductase 7 AKR7A2 8574 Serine protease 15 PRSS15 9361 Glutathione S transferase omega 1 GSTO1 9446 Phosphatidylserine synthase 1 PTDSS1 9791 Heat shock protein, 75 kDa TRAP1 10131 THO Complex subunit 4 THOC4 10189 Unactive progesterone receptor 23KD PTGES3 10728 Alpha glucosidase II alpha subunit GANAB 23193 Ribosomal protein L13a RPL13A 23521 ATPase H+ transporting lysosomal V0 subunit a isoform ATP6V0A2 23545 Dimethylarginine dimethylaminohydrolase 2 DDAH2 23564

176

Table C-2. Continued. Functional Title Symbol Entrez Category GeneID Metabolism Phospholipase D family member 3 PLD3 23646 Continued Siah1 interacting protein CACYBP 27101 Acyl-CoA dehydrogenase 9 ACAD9 28976 Neurolysin NLN 57486 Vitamin K epoxide reductase complex subunit 1 VKORC1 79001 Mitochondrial ribosomal protein L56 LACTB 114294 Galactose mutarotase (aldose 1-epimerase) GALM 130589 SUMO4 SUMO4 387082 Heat shock protein HSP 90 beta HSP90AB2P 391634

Signal Allograft inflammatory factor 1 AIF1 199 Transduction Annexin A11 ANXA11 311 ADP ribosylation factor 1 ARF1 375 ADP ribosylation factor 3 ARF3 377 RhoA RHOA 387 GTPase activating protein RHO 4 ARHGAP4 393 Complement component 5 receptor 1 C5AR1 728 Calmodulin 1 CALM1 801 Calmodulin 2 CALM2 805 Calmodulin 3 CALM3 808 SCARB2 SCARB2 950 Cell division cycle 10 989 Eps15 EPS15 2060 HSP90B HSPCB 3326 CD11b ITGAM 3684 Integrin alpha X ITGAX 3687 Integrin alpha X ITGAX 3687 Integrin beta 2 ITGB2 3689 Lymphocyte cytosolic protein 1 LCP1 3936 Low density lipoprotein receptor-related protein 1 LRP1 4035 Macrophage mannose receptor MRC1 4360 CD31 PECAM1 5175 Prohibitin PHB 5245 DNA dependent protein kinase catalytic subunit PRKDC 5591 Prosaposin PSAP 5660 Protein tyrosine phosphatase receptor type C PTPRC 5788 Ras associated protein Rab5C RAB5C 5878 Ras related C3 botulinum toxin substrate 1 RAC1 5879 RAN, member RAS oncogene family RAN 5901 Ras related protein 2B RAP2B 5912 14-3-3 Eta YWHAH 7533 CD163 CD163 9332 Guanine nucleotide binding protein, alpha 13 GNA13 10672 Progesterone receptor membrane component 1 PGRMC1 10857 A6RP PTK9L 11344 Plexin D1 PLXND1 23129

177

Table C-2. Continued. Functional Title Symbol Entrez Category GeneID Signal Stabilin 1 STAB1 23166 Transduction Plexin B2 PLXNB2 23654 Continued Sialic acid binding Ig- like lectin 9 SIGLEC9 27180 TAO kinase 3 TAOK3 51347 Vanilloid receptor like protein 1 TRPV2 51393 Butyrate induced transcript 1 PTPLAD1 51495 RAB14 RAB14 51552 ADP ribosylation factor like 10C ARL8B 55207

Transcription/ Annexin II ANXA2 302 Translation Basic transcription factor 3 BTF3 689 Grb2 GRB2 2885 Interleukin enhancer binding factor 3 ILF3 3609 Eukaryotic translation initiation factor 6 ITGB4BP 3692 Nucleolin NCL 4691 YB-1 YBX1 4904 Polypyrimidine tract binding protein 1 PTBP1 5725 Ribosomal protein L18a RPL18A 6142 MPS1 RPS27 6232 Small nuclear ribonucleoprotein polypeptide D1 SNRPD1 6632 Translin TSN 7247 HLA-B-associated transcript 1 BAT1 7919 Histone 4 family member M HIST1H4I 8294 H4 Histone family, member A HIST1H4A 8359 Histone 1 H4d HIST1H4D 8360 Histone 1 H4f HIST1H4F 8361 Histone 1 H4k HIST1H4K 8362 Histone 1 H4j HIST1H4J 8363 Histone 1 H4c HIST1H4C 8364 Histone 1 H4h HIST1H4H 8365 Histone 1 H4b HIST1H4B 8366 Histone 1 H4e HIST1H4E 8367 Histone 1 H4l HIST1H4L 8368 Histone 2 H4 HIST2H4 8370 H2A histone family member Y H2AFY 9555 Oncogene DJ1 PARK7 11315 SERPINE1 mRNA binding protein 1 SERBP1 26135 EBNA2 coactivator p100 27044 Histone 4 H4 HIST4H4 121504 Histone 2 H3c HIST2H3C 126961 Histone 1 H2aa HIST1H2AA 221613

Transport Adaptin, beta 1 AP1B1 162 Albumin ALB 213 Apolipoprotein A I APOA1 335 Apolipoprotein E APOE 348 ADP ribosylation factor 4 ARF4 378

178

Table C-2. Continued. Functional Title Symbol Entrez Category GeneID Transport ATP1B3 ATP1B3 483 Continued Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 ATP2A2 488 Chloride intracellular channel 1 CLIC1 1192 Chromosome segregation 1like protein CSE1L 1434 Ferritin light chain FTL 2512 Hemoglobin beta chain HBB 3043 Vigilin HDLBP 3069 Karyopherin beta 3 RANBP5 3843 Solute carrier family 25,member 3 SLC25A3 5250 Sodium dependent neutral amino acid transporter type 2 SLC1A5 6510 Solute carrier family,member 5 SLC2A5 6518 Solute carrier family 3 (activator of dibasic and neutral SLC3A2 6520 amino acid transport), member 2 Solute carrier family 3 (activator of dibasic and neutral SLC3A2 6520 amino acid transport), member 2 VDAC3 VDAC3 7419 Vesicle associated membrane protein 8 VAMP8 8673 Adaptin, delta AP3D1 8943 Synaptogyrin 2 SYNGR2 9144 TM9SF2 TM9SF2 9375 Syntaxin 8 STX8 9482 Vacuolar protein sorting 26 VPS26A 9559 Secretory carrier membrane protein 3 SCAMP3 10067 BAP31 BCAP31 10134 Transmembrane trafficking protein TMED10 10972 SEC31 like 1 SEC31L1 22872 Importin 9 IPO9 55705 Tweety homolog 3 TTYH3 80727 Solute carrier family 39 (metal ion transporter), member SLC39A11 201266 11 Solute carrier family 37 (glycerol-3-phosphate SLC37A2 219855 transporter), member 2 Solute carrier family 26, member 11 SLC26A11 284129

Miscellaneous H2AX histone H2AFX 3014 Integral membrane protein 1 STT3A 3703 SMT3 suppressor of mif two 3 homolog 2 SUMO2 6613 Chromosome 5 open reading frame 18 REEP5 7905 Chromosome 21 open reading frame 33 C21orf33 8209 KIAA0152 KIAA0152 9761 Reticulon 3 RTN3 10313 Chaperonin containing T complex polypeptide 1, subunit CCT7 10574 7 Endoplasmic reticulum protein 29 ERP29 10961 Stromal cell derived factor 2 like 1 SDF2L1 23753 C20orf22 protein C20orf22 26090

179

Table C-2. Continued. Functional Title Symbol Entrez Category GeneID Miscellaneous CGI-49 protein SCCPDH 51097 Continued Ubiquitin fold modifier 1 UFM1 51569 Hypothetical protein FLJ20481 AYTL1 54947 TPARL protein 55858 KIAA1363 AADACL1 57552 DC2 protein 58505 HS1 binding protein 3 64342 Elongation of very long chain fatty acids protein 1 ELOVL1 64834 C9orf88 protein C9orf88 64855 AHNAK nucleoprotein (desmoyokin) AHNAK 79026 Hypothetical protein MGC5508 TMEM109 79073 Transmembrane protein 43 TMEM43 79188 Actin related protein 2/3 complex subunit 5 like ARPC5L 81873 SH3 domain binding glutamic acid rich protein like 3 SH3BGRL3 83442 Upregulated during skeletal muscle growth 5 USMG5 84833 Hypothetical protein LOC162427 162427 Source of immunodominant MHC associated peptides STT3B 201595 Similar to RIKEN cDNA 4732495G21 gene 345651 Mannose receptor C type1 like 1 MRC1L1 414308 Histone H4/o 554313

180

Table C-3. Proteins increased ≥ 2-fold difference in expression by 24 hours of interferon-gamma treatment in 2 out of 3 donors Functional Title Symbol Entrez Category GeneID Apoptosis BH3 interacting domain death agonist BID 637 ALG2 interacting protein 1 PDCD6IP 10015 Pre B cell colony enhancing factor 1 PBEF1 10135 PYCARD PYCARD 29108

Cell Growth Actin beta ACTB 60 Actin gamma 1 ACTG1 71 Rho GDP dissociation inhibitor alpha ARHGDIA 396 Clathrin, heavy polypeptide CLTC 1213 Grb2 GRB2 2885 Kinesin family member 5B KIF5B 3799 Keratin 1 KRT1 3848 Keratin 10 KRT10 3858 Lysosome associated membrane protein 2 LAMP2 3920 Profilin 1 PFN1 5216 Protein kinase, cAMP dependent, catalytic, alpha PRKACA 5566 SOD2 SOD2 6648 Talin TLN1 7094 Vimentin VIM 7431 Vitronectin VTN 7448 14-3-3 zeta YWHAZ 7534 Major vault protein MVP 9961 ARP2/3 protein complex subunit p21 ARPC3 10094 Actin related protein 3 ACTR3 10096 Actin related protein 2/3 complex subunit 2, 34kDa ARPC2 10109 Tubulin, alpha, ubiquitous 10376 Adenylyl cyclase-associated protein CAP1 10487 Mitofilin IMMT 10989 Coactosin like 1 COTL1 23406 Tumor necrosis factor alpha induced protein 8 TNFAIP8 25816 Tubulin, beta TUBB 203068

Immune Beta 2 microglobulin B2M 567 Response Complement component C1q, C chain C1QC 714 CD14 CD14 929

Metabolism Macroglobulin, alpha 2 A2M 2 Acetyl-CoA acetyltransferase ACAT1 38 Aldolase 1 ALDOA 226 Solute carrier family 25 (mitochondrial carrier; adenine SLC25A5 292 nucleotide translocator), member 5 Adenine phosphoribosyltransferase APRT 353 Acid ceramidase ASAH1 427 ATP synthase, H+ transporting, mitochondrial F1 ATP5D 513 complex, delta subunit

181

Table C-3. Continued. Functional Title Symbol Entrez Category GeneID Metabolism Biliverdin reductase A BLVRA 644 Continued Flavin reductase BLVRB 645 Calreticulin CALR 811 Calpain, small subunit 1 CAPNS1 826 Calpastatin CAST 831 Cathepsin C CTSC 1075 Catechol-O-methyltransferase COMT 1312 Cystatin B CSTB 1476 Cathepsin B CTSB 1508 Cathepsin D CTSD 1509 Cathepsin S CTSS 1520 Cathepsin Z CTSZ 1522 Cytochrome b-245 beta polypeptide CYBB 1536 Diazepam binding inhibitor DBI 1622 Dihydrolipoamide s-succinyl transferase DLST 1743 Dynein, cytoplasmic, heavy polypeptide 1 DYNC1H1 1778 Elongation factor 1 alpha 1 EEF1A1 1915 EIF4A1 EIF4A1 1973 Serpin B1 SERPINB1 1992 Enolase 1 ENO1 2023 Enolase 3 ENO3 2027 Fucosidase FUCA1 2517 Lysosomal alpha glucosidase GAA 2548 Glyceraldehyde 3 phosphate dehydrogenase GAPDH 2597 Glutaredoxin GLRX 2745 GM2 activator GM2A 2760 Glutathione S transferase 3 GSTP1 2950 Hydroxyacyl CoA dehydrogenase, type II HADH2 3028 Hydroxyacyl dehydrogenase, subunit B HADHB 3032 Heat shock 70kDa protein 4 HSPA4 3308 Heat shock 10 KD protein HSPE1 3336 Lactate dehydrogenase A LDHA 3939 Lysozyme LYZ 4069 Alpha mannosidase B MAN2B1 4125 Malate dehydrogenase soluble MDH1 4190 Malate dehydrogenase mitochondrial MDH2 4191 Microsomal glutathione S transferase 3 MGST3 4259 Methylenetetrahydrofolate dehydrogenase 1 MTHFD1 4522 NADH ubiquinone oxidoreductase 1,alpha subcomplex 4 NDUFA4 4697 Ribosomal protein L10a RPL10A 4736 Peroxiredoxin 1 PRDX1 5052 Phosphoglycerate kinase 1 PGK1 5230 Protease inhibitor 1 SERPINA1 5265 Cathepsin A PPGB 5476 Cyclophilin A PPIA 5478 Legumain LGMN 5641

182

Table C-3. Continued. Functional Title Symbol Entrez Category GeneID Metabolism Proteasome subunit,alpha type,4 PSMA4 5685 Continued Proteasome subunit beta, type 1 PSMB1 5689 Proteasome (prosome, macropain) activator subunit 1 (PA28 PSME1 5720 alpha) Proteasome activator complex subunit 2 PSME2 5721 Ribosomal protein L5 RPL5 6125 Ribosomal protein L11 RPL11 6135 Ribosomal protein L13 RPL13 6137 Ribosomal protein L24 RPL24 6152 Ribosomal protein L30 RPL30 6156 Ribosomal protein L27a RPL27A 6157 Ribosomal protein L35A RPL35A 6165 Ribosomal protein, large, P0 RPLP0 6175 Ribosomal protein, large, P1 RPLP1 6176 Ribosomal protein S12 RPS12 6206 Ribosomal protein S14 RPS14 6208 Ribosomal protein S16 RPS16 6217 Ribosomal protein S21 RPS21 6227 Ribosomal protein S23 RPS23 6228 Ribosomal protein S26 RPS26 6231 Ribosomal protein S27a RPS27A 6233 Tumor rejection antigen 1 HSP90B1 7184 Thioredoxin TXN 7295 Valyl tRNA synthetase 2 VARS 7407 Tryptophanyl tRNA synthetase WARS 7453 Pyridoxal kinase PDXK 8566 Glutathione S transferase omega 1 GSTO1 9446 ATP synthase, H+ transporting, mitochondrial F0 complex, ATP5J2 9551 subunit f, isoform 2 Peptidylprolyl isomerase F PPIF 10105 Aldehyde reductase AKR1A1 10327 HE1 NPC2 10577 Unactive progesterone receptor 23KD PTGES3 10728 Peroxiredoxin 3 PRDX3 10935 Ribosomal protein L13a RPL13A 23521 6-phosphogluconolactonase PGLS 25796 Leucine aminopeptidase 3 LAP3 51056 Leucyl tRNA synthetase LARS 51520 Adipocyte derived leucine aminopeptidase 51752 UDP glucose ceramide glucosyltransferase like 1 UGCGL1 56886 Hypothetical protein FLJ22021 CORO7 79585 Histidine triad nucleotide binding protein 2 HINT2 84681 Thioredoxin like 5 TXNL5 84817 Galactose mutarotase (aldose 1-epimerase) GALM 130589 Myotrophin MTPN 136319 Glutathione S transferase kappa 1 GSTK1 373156

183

Table C-3. Continued. Functional Title Symbol Entrez Category GeneID Signal Allograft inflammatory factor 1 AIF1 199 Transduction Annexin AV ANXA5 308 Ras homolog gene family, member G RHOG 391 GTPase activating protein RHO 4 ARHGAP4 393 CD44 CD44 960 Cell division cycle 10 SEPT7 989 CDC42 CDC42 998 Dual specificity phosphatase 3 DUSP3 1845 Endothelial cell growth factor 1 platelet derived ECGF1 1890 Eukaryotic translation elongation factor 1,delta EEF1D 1936 Ras homolog gene family, member G RHOG 391 Fatty acid binding protein 4 FABP4 2167 FK506 binding protein 1A FKBP1A 2280 Histidine triad nucleotide binding protein HINT1 3094 HSP90B HSPCB 3326 Intercellular adhesion molecule 1 ICAM1 3383 Lymphocyte cytosolic protein 1 LCP1 3936 Macrophage mannose receptor MRC1 4360 Protein kinase, cAMP dependent, regulatory, type I, alpha PRKAR1A 5573 Prosaposin PSAP 5660 Protein tyrosine phosphatase receptor type C PTPRC 5788 Ras associated protein Rab2 RAB2 5862 Ras associated protein Rab5C RAB5C 5878 Reticulon 1 RTN1 6252 Calcyclin S100A6 6277 S100 Calcium binding protein A8 S100A8 6279 S100 Calcium binding protein A9 S100A9 6280 Calgizzarin S100A11 6282 SH3BGRL SH3BGRL 6451 Serine/Threonine protein kinase 10 STK10 6793 14-3-3 gamma YWHAG 7532 RAB7 RAB7 7879 RACK1 GNB2L1 10399 Progesterone receptor membrane component 2 PGRMC2 10424 Progesterone receptor membrane component 1 PGRMC1 10857 Ras related protein Rab35 RAB35 11021 A6RP PTK9L 11344 Suppressor of actin mutations 1 like SACM1L 22908 Ras associated protein RAB18 RAB18 22931 RAB8B protein RAB8B 51762 SARA1 SAR1A 56681

Transcription/ ATP-dependent RNA helicase A DHX9 1660 Translation Histone H2A.z H2AFZ 3015 Heterogenous nuclear ribonucleoprotein A1 HNRPA1 3178 Heterogeneous nuclear ribonucleoprotein C HNRPC 3183

184

Table C-3. Continued. Functional Title Symbol Entrez Category GeneID Transcription/ Interleukin enhancer binding factor 3 ILF3 3609 Translation Galectin 3 LGALS3 3958 Continued Poly(rC) binding protein 1 PCBP1 5093 Placental ribonuclease inhibitor RNH1 6050 Small nuclear ribonucleoprotein polypeptide D1 SNRPD1 6632 Single stranded DNA binding protein 1 SSBP1 6742 STAT1 STAT1 6772 Transcription elongation factor B, 1 TCEB1 6921 Histone 4 family member M HIST1H4I 8294 H4 Histone family, member A HIST1H4A 8359 Histone 1 H4d HIST1H4D 8360 Histone 1 H4f HIST1H4F 8361 Histone 1 H4k HIST1H4K 8362 Histone 1 H4j HIST1H4J 8363 Histone 1 H4c HIST1H4C 8364 Histone 1 H4h HIST1H4H 8365 Histone 1 H4b HIST1H4B 8366 Histone 1 H4e HIST1H4E 8367 Histone 1 H4l HIST1H4L 8368 Histone 2 H4 HIST2H4 8370 Leucine rich repeat in FLII interacting protein 1 LRRFIP1 9208 H2A histone family member Y H2AFY 9555 Matrin 3 MATR3 9782 Oncogene DJ1 PARK7 11315 EBNA2 coactivator p100 27044 UMP-CMP kinase CMPK 51727 TBP-Interacting protein CAND1 55832 LSM2 LSM2 57819 H2A histone family member V H2AFV 94239 Histone 4 H4 HIST4H4 121504 Histone 2 H3c HIST2H3C 126961 Matrin 3 MATR3 9782 Oncogene DJ1 PARK7 11315

Transport Adaptor related protein complex 2, alpha2 subunit AP2A2 161 Aldehyde dehydrogenase 1 ALDH1A1 216 Apolipoprotein E APOE 348 ADP ribosylation factor 4 ARF4 378 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 ATP2A2 488 Chloride intracellular channel 1 CLIC1 1192 Chromosome segregation 1like protein CSE1L 1434 Fatty acid binding protein 5 FABP5 2171 Hemoglobin beta chain HBB 3043 Karyopherin beta 1 KPNB1 3837 Sodium dependent neutral amino acid transporter type 2 SLC1A5 6510 Transporter 1 ATP binding cassette, subfamily B TAP1 6890

185

Table C-3. Continued. Functional Title Symbol Entrez Category GeneID Transport Syntaxin 7 STX7 8417 Continued Adaptin, delta AP3D1 8943 Vesicle amine transport protein 1 VAT1 10493 SEC31 like 1 SEC31L1 22872 Solute carrier family 25 member 24 SLC25A24 29957 Solute carrier family 12 (potassium/chloride transporters), SLC12A9 56996 member 9 Solute carrier family 37 (glycerol-3-phosphate transporter), SLC37A2 219855 member 2

Miscellaneous Arginine rich protein ARMET 7873 Transgelin 2 TAGLN2 8407 Transmembrane protein 63A TMEM63A 9725 Transmembrane 9 superfamily protein member 4 TM9SF4 9777 WD repeat protein 1 WDR1 9948 Glycoprotein NMB GPNMB 10457 Chromosome 6 open reading frame 108 C6orf108 10591 RER1 protein RER1 11079 Transmembrane protein 14C TMEM14C 51522 Angiotensin II receptor associated protein AGTRAP 57085 Hypothetical protein MGC5508 TMEM109 79073 LENG4 LENG4 79143 C9orf19 protein C9orf19 152007 Mannose receptor C type1 like 1 MRC1L1 414308 BolA-like protein 2 BOLA2 552900 Histone H4/o 554313

186

Table C-4. Proteins increased ≤ 2-fold difference in expression by 24 hours of interferon-gamma treatment in 2 out of 3 donors. Functional Title Symbol Entrez Category GeneID Cell Growth Clathrin, heavy polypeptide CLTC 1213 Keratin 1 KRT1 3848 Keratin 2A KRT2A 3849 Keratin 9 KRT9 3857 Keratin 10 KRT10 3858 Microtubule associated protein 4 MAP4 4134 Myosin IE MYO1E 4643 Tumor protein D52 like 2 TPD52L2 7165 Vitronectin VTN 7448 C21orf5 protein DOPEY2 9980 Tubulin, alpha, ubiquitous 10376 Coronin 1C CORO1C 23603 Tubulin, beta 6 TUBB6 84617 Tubulin, beta TUBB 203068

Immune CD14 CD14 929 Response DKFZP564J0863 protein 25923 SAM domain and HD domain containing protein 1 SAMHD1 25939

Metabolism Tartrate resistant acid phosphatase ACP5 54 S adenosylhomocysteine hydrolase AHCY 191 ABCD1 ABCD1 215 Aldehyde dehydrogenase 2 ALDH2 217 Aldolase 1 ALDOA 226 Serum amyloid P APCS 325 CD36 CD36 948 Catechol-O-methyltransferase COMT 1312 Cathepsin D CTSD 1509 Cytochrome b-245 beta polypeptide CYBB 1536 Dihydrolipoamide s-succinyl transferase DLST 1743 Elongation factor 1 alpha 1 EEF1A1 1915 Fructose-1,6-bisphosphatase FBP1 2203 Glyceraldehyde 3 phosphate dehydrogenase GAPDH 2597 Glutathione S transferase 3 GSTP1 2950 17 beta hydroxysteroid dehydrogenase 4 HSD17B4 3295 BIP HSPA5 3309 Mortalin 2 HSPA9B 3313 Isocitrate dehydrogenase 1 IDH1 3417 CD-MPR M6PR 4074 Alpha mannosidase B MAN2B1 4125 Pyruvate carboxylase PC 5091 Phosphogluconate dehydrogenase PGD 5226 Pyruvate kinase 3 PKM2 5315 Proteasome 26S subunit, ATPase 1 PSMC1 5700 Ribosomal protein L3 RPL3 6122

187

Table C-4. Continued. Functional Title Symbol Entrez Category GeneID Metabolism Ribosomal protein L11 RPL11 6135 Continued Ribosomal protein L18 RPL18 6141 Ribosomal protein L26 RPL26 6154 Ribophorin II RPN2 6185 Ribosomal protein S2 RPS2 6187 Ribosomal protein S14 RPS14 6208 Ribosomal protein S23 RPS23 6228 Ribosomal protein S24 RPS24 6229 Ribosomal protein S25 RPS25 6230 Ribosomal protein S27a RPS27A 6233 SUMO3 SUMO3 6612 Transketolase TKT 7086 Pyridoxal kinase PDXK 8566 Eukaryotic translation initiation factor 3, subunit 10 EIF3S10 8661 EIF3S8 EIF3S8 8663 Protein disulfide isomerase P5 PDIA6 10130 Peroxiredoxin 3 PRDX3 10935 Monoglyceride lipase MGLL 11343 Phosphoglycerate dehydrogenase PHGDH 26227 Glutamate carboxypeptidase-like protein 1 CNDP2 55748 ATPase type 13A ATP13A1 57130 SUMO4 SUMO4 387082

Signal Allograft inflammatory factor 1 AIF1 199 Transduction Annexin II ANXA2 302 CD68 antigen CD68 968 GDP dissociation inhibitor 1 GDI1 2664 Integrin alpha X ITGAX 3687 Integrin beta 2 ITGB2 3689 Laminin receptor 1 RPSA 3921 CD31 PECAM1 5175 Ras related protein 2B RAP2B 5912 14-3-3 gamma YWHAG 7532 CD163 CD163 9332 CD163 CD163 9332 14-3-3 theta YWHAQ 10971 Vanilloid receptor like protein 1 TRPV2 51393

Transcription/ Basic transcription factor 3 BTF3 689 Translation Heterogenous nuclear ribonucleoprotein A1 HNRPA1 3178 Heterogeneous nuclear ribonucleoprotein H3 HNRPH3 3189 Histone 2 H3c HIST2H3C 126961

Transport ATP1B3 ATP1B3 483 Chloride channel 7 CLCN7 1186

188

Table C-4. Continued. Functional Title Symbol Entrez Category GeneID Transport Solute carrier family 3 (activator of dibasic and neutral SLC3A2 6520 Continued amino acid transport), member 2 Signal sequence receptor gamma SSR3 6747 Transferrin receptor TFRC 7037 Syntaxin 7 STX7 8417 Adaptin, delta AP3D1 8943 Secretory carrier membrane protein 3 SCAMP3 10067 Tweety homolog 3 TTYH3 80727 Solute carrier family 39 (metal ion transporter), member 11 SLC39A11 201266

Miscellaneous CLPTM1 CLPTM1 1209 Integral membrane protein 1 STT3A 3703 Plectin 1 PLEC1 5339 SMT3 suppressor of mif two 3 homolog 2 SUMO2 6613 Ribosomal protein L26 like 1 RPL26L1 51121 Ubiquitin fold modifier 1 UFM1 51569 KIAA1363 AADACL1 57552 AHNAK nucleoprotein (desmoyokin) AHNAK 79026 Similar to RIKEN cDNA 4732495G21 gene 345651

189

APPENDIX D PROBE SETS DISTINGUISHING ENVELOPE TREATMENTS

Table D-1. Probe sets incorporated in Fig. 5-3 cluster analysis. The table includes the ratio of average treated signal intensity value across donors to average untreated signal intensity value over 6, 15, and 24 hours of treatment. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200000_s_at PRPF8 10594 -1.15 0.26 -1.17 0.23 -0.51 0.14 2.16 0.32 -0.28 200001_at CAPNS1 826 -0.05 -0.87 0.47 0.69 0.88 -0.11 -1.07 -1.48 1.54 200002_at RPL35 11224 -0.11 -0.45 -1.43 0.44 -0.62 0.41 1.88 0.78 -0.9 200003_s_at RPL28 6158 0.85 -0.62 -0.08 0.82 -0.92 -0.7 1.57 0.52 -1.44 200004_at EIF4G2 1982 -0.82 0.72 -1.3 -0.23 0.65 -0.08 1.75 0.46 -1.15 200005_at EIF3S7 8664 -1.07 -0.09 -0.61 -0.1 -0.76 -0.73 1.78 0.15 1.45 200006_at DJ-1 11315 -0.54 -0.21 -0.08 -1.72 -0.67 -0.07 1.56 1.21 0.53 200007_at SRP14 6727 -0.79 -0.73 1.07 0.03 -1.75 -0.04 1.16 1.1 -0.05 200008_s_at GDI2 2665 -0.72 -0.4 -0.17 -0.41 -0.79 0.86 -1.17 0.95 1.85 190 200009_at GDI2 2665 0.17 -0.25 -0.79 0.92 -1.67 -0.61 1.57 -0.18 0.84 200010_at RPL11 6135 -0.01 -1.69 1.56 0.45 -0.06 -0.29 0.92 0.31 -1.19 200011_s_at ARF3 377 -1.26 0.75 -1.1 -0.61 0.25 1.26 0.49 -0.95 1.18 200012_x_at RPL21 6144 0.72 -1.69 0.03 0.29 -1.16 0.39 0.44 1.55 -0.59 200013_at RPL24 6152 1.57 -1.26 0.18 1.13 -0.97 0.02 0.5 -0.02 -1.16 200014_s_at HNRPC 3183 2.08 0.32 0.33 0.37 -0.6 -0.94 0.36 -1.13 -0.79 200015_s_at NEDD5 4735 -1.19 0.11 0.12 -0.94 -0.27 -0.2 0.07 -0.03 2.35 200016_x_at HNRPA1 3178 -0.69 -1.55 0.66 -0.16 0.1 -0.23 2.11 0.03 -0.27 200017_at RPS27A 6233 0.11 0.46 -1.14 -0.17 -1.08 0.65 1.1 1.38 -1.31 200018_at RPS13 6207 0.32 -0.48 -0.47 -0.2 -0.98 -0.72 1.05 2.1 -0.6 200019_s_at FAU 2197 0.29 -1.17 -0.55 -0.74 -0.24 0.42 1.44 1.53 -0.98 200020_at TARDBP 23435 1.02 0.46 0.36 0.42 1.23 -1.64 -0.93 0.18 -1.11 200021_at CFL1 1072 -0.81 -0.86 -0.4 -0.59 -0.77 2.01 -0.13 1.04 0.53 200022_at RPL18 6141 -0.62 -0.13 0.94 1 -0.37 -1.06 1.78 -0.86 -0.67 200023_s_at EIF3S5 8665 0.96 -0.79 0.68 1.36 -0.52 -1.13 1.02 -0.48 -1.11

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200027_at NARS 4677 -1.72 1.61 -0.77 -0.58 0.31 -0.48 0.95 0.37 0.31 200028_s_at STARD7 56910 0.7 1.34 1.32 0.56 -0.47 -0.47 -0.8 -0.81 -1.36 200029_at RPL19 6143 -0.96 -1.32 0.87 1.09 -0.88 0.6 0.84 0.73 -0.98 200030_s_at SLC25A3 5250 -0.89 -1.54 0.32 -0.22 -0.8 1.09 -0.1 1.56 0.59 200031_s_at RPS11 6205 -0.77 -1.02 -0.39 -0.8 -0.65 1.78 0.006 1.24 0.61 200032_s_at RPL9 6133 1.5 -0.24 0.17 0.35 -1.51 0.04 0.7 0.53 -1.56 200033_at DDX5 1655 0.87 -0.64 0.15 1.42 -0.8 -1.08 1.37 -0.33 -0.96 200034_s_at RPL6 6128 0.46 1.35 0.32 0.45 0.11 -1.2 0.56 -0.13 -1.95 200035_at HSA011916 23399 -1.16 0.46 0.66 1.08 0.44 0.85 -0.41 -1.92 0.001 200036_s_at RPL10A 4736 0.93 -0.45 0.35 0.54 -0.53 -0.88 1.73 -0.14 -1.55 200037_s_at CBX3 11335 0.03 1 1.48 -1.1 -0.64 -0.14 -1.41 -0.24 1.03

191 200038_s_at RPL17 6139 0.88 -1.32 0.73 0.83 -1.26 0.1 1.03 0.22 -1.22 200039_s_at PSMB2 5690 -0.52 0.28 -0.21 1.47 -0.42 -1.57 0.25 1.46 -0.73 200040_at KHDRBS1 10657 0.3 -0.28 1.51 -0.12 -1.67 0.19 1.07 -1.21 0.2 200041_s_at BAT1 7919 -0.03 0.09 1.3 0.84 -0.79 0.57 0.29 -2.12 -0.15 200042_at HSPC117 51493 -1.02 -0.41 0.09 -1.72 0.91 0.01 -0.05 1.6 0.58 200043_at ERH 2079 -0.34 0.47 0.2 0.86 1.03 -1.18 1.25 -1.43 -0.87 200044_at SFRS9 8683 -1 1.84 -0.2 -1.6 0.48 -0.02 0.81 -0.08 -0.22 200045_at ABCF1 23 0.76 0.27 -1 0.32 0.64 -0.69 0.66 -1.96 0.99 200046_at DAD1 1603 -0.25 -0.2 1.01 -0.05 -1.11 -0.31 0.22 1.97 -1.26 200047_s_at YY1 7528 1.01 0.34 0.45 0.98 0.82 -1.56 -0.12 -0.39 -1.54 200048_s_at JTB 10899 1.34 0.74 0.44 0.38 0.27 -0.9 -0.04 -0.15 -2.08 200049_at HBOA 11143 0.98 -0.05 -0.54 -0.61 1.87 -0.32 -1.47 -0.44 0.6 200050_at ZNF146 7705 0.86 -0.51 1.36 1.24 -0.43 -0.72 0.47 -1.32 -0.94 200051_at SART1 9092 -1.5 -0.2 -0.86 -0.64 -0.21 0.06 0.43 1.5 1.42 200052_s_at ILF2 3608 -0.29 2.34 0.001 0.1 0.27 -0.67 0.08 -0.59 -1.23 200053_at SPAG7 9552 -0.22 -1.88 0.84 -0.64 -0.31 -0.51 0.4 1.12 1.21

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200054_at ZNF259 8882 1.89 0.91 -0.001 0.02 0.4 -1.5 -0.34 -0.5 -0.87 200055_at TAF10 6881 -0.84 -1.18 -0.17 0.39 0.48 0.09 2.22 -0.4 -0.6 200056_s_at C1D 10438 0.63 0.95 -0.27 0.92 0.4 0.96 -0.73 -1.3 -1.55 200057_s_at NONO 4841 -0.78 -0.39 0.5 -1.77 -0.55 0.02 1.22 0.37 1.37 200058_s_at U5-200KD 23020 -0.44 1.64 -1.21 0.15 0.62 0.52 -1.19 -0.92 0.8 200059_s_at ARHA 387 0.23 -1.74 0.04 -0.36 -1.15 0.87 -0.02 1.51 0.61 200060_s_at RNPS1 10921 1.33 0.19 -0.9 0.01 1.38 -1.85 -0.07 -0.03 -0.06 200061_s_at RPS24 6229 -0.21 -1.33 -0.13 -0.31 -1.18 1.21 0.34 1.74 -0.12 200062_s_at RPL30 6156 -0.3 -0.58 0.14 -0.38 -0.84 0.5 1.8 1.07 -1.41 200063_s_at NPM1 4869 -0.1 -0.78 0.22 -0.34 -0.59 0.08 0.28 2.34 -1.11 200064_at HSPCB 3326 -0.12 -1.29 0.46 -0.89 -0.87 1.19 -0.71 0.98 1.27

192 200065_s_at ARF1 375 -1.4 1.53 -0.63 0.07 -0.71 -0.94 0.35 1.16 0.57 200067_x_at 0.15 -1.86 0.9 0.71 -0.64 -0.31 -0.06 1.56 -0.43 200068_s_at CANX 821 -0.78 -1.68 0.1 -0.8 -0.37 1.26 0.25 0.91 1.11 200069_at SART3 9733 1.14 1.94 -0.11 -1.05 0.34 -0.75 -0.15 -0.39 -0.95 200069_at SART3 9733 1.14 1.94 -0.11 -1.05 0.34 -0.75 -0.15 -0.39 -0.95 200070_at CGI-57 27013 0.62 -0.17 0.37 -1.02 1.59 -1.57 -0.87 0.64 0.42 200071_at SPF30 10285 0.62 0.1 1.05 1.5 -0.01 -0.16 -0.42 -1.8 -0.86 200072_s_at HNRPM 4670 0.39 -0.4 -2.23 0.19 0.56 -0.36 1.25 -0.19 0.78 200073_s_at HNRPD 3184 -1.27 0.99 -0.57 -1.09 1.07 -1 0.79 0.06 1.02 200074_s_at RPL14 9045 0.8 -0.52 0.46 0.56 -0.47 -1.09 1.49 0.4 -1.64 200075_s_at GUK1 2987 0.4 -0.63 -1.06 1.24 0.7 1.01 -1.15 0.68 -1.19 200076_s_at MGC2749 79036 -0.55 -1.09 -0.31 -0.77 0.04 -0.3 1.06 -0.19 2.13 200077_s_at OAZ1 4946 -0.93 -1.28 -0.4 -0.07 -0.96 1.39 0.08 1.18 1 200078_s_at ATP6V0B 533 -0.46 -0.93 -0.74 -0.47 -1.01 1.17 1.68 0.93 -0.13 200079_s_at KARS 3735 -1.52 1.6 -0.18 -0.66 0.71 -0.91 -0.27 1.06 0.18 200080_s_at -1.28 0.04 0.22 0.3 0.53 1.5 0.007 0.49 -1.83

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200081_s_at RPS6 6194 1.08 -0.97 0.84 0.92 -0.01 -0.39 0.11 0.41 -1.99 200082_s_at RPS7 6201 1.65 -0.2 0.77 0.7 -0.8 -0.36 -0.17 0.22 -1.81 200083_at USP22 23326 0.45 0.78 -0.31 1.07 0.2 -1.49 1.27 -1.14 -0.83 200084_at SMAP 10944 -0.13 1.07 0.62 -0.41 0.13 -0.15 -0.1 1.17 -2.19 200085_s_at TCEB2 6923 1.04 -0.006 -0.28 1.22 -0.2 -0.7 1.12 -0.35 -1.84 200086_s_at COX4I1 1327 -0.45 -1.21 -0.63 -0.04 -0.74 0.76 1.23 1.69 -0.6 200087_s_at RNP24 10959 -0.07 1.19 -0.75 -1.65 0.69 -0.84 1.29 0.48 -0.34 200088_x_at RPL12 6136 1.07 -0.9 0.37 1.28 -0.46 -0.36 0.88 -0.1 -1.76 200089_s_at RPL4 6124 0.94 -0.69 0.53 1 -0.41 -1.31 1.45 -0.5 -1.01 200090_at FNTA 2339 -0.09 -0.37 1.26 -0.001 0.38 -1.99 1.32 0.08 -0.59 200091_s_at RPS25 6230 0.04 1.44 -1.35 0.61 0.71 -0.54 0.94 -0.55 -1.3

193 200092_s_at RPL34 6164 -0.08 -1.09 -0.24 1.78 0.79 -0.05 0.71 -0.29 -1.52 200093_s_at HINT1 3094 -1.27 0.44 -0.28 0.57 -0.97 0.76 1.87 -0.32 -0.8 200094_s_at EEF2 1938 1.13 -0.51 -0.69 0.55 -0.56 -0.23 1.96 -1.03 -0.61 200095_x_at -0.12 -1.36 -0.43 0.18 -1.19 0.71 1.4 1.31 -0.5 200096_s_at ATP6V0E 8992 0.96 -0.68 0.97 0.83 0.37 -1.21 0.03 0.48 -1.76 200097_s_at HNRPK 3190 0.26 0.45 0.17 -0.19 1.65 -1.2 -0.01 0.61 -1.75 200098_s_at ANAPC5 51433 -2.04 0.58 0.43 0.48 -0.41 1.03 -1.07 0.75 0.24 200099_s_at 1.69 0.33 0.4 0.2 -0.3 -1.58 0.39 0.25 -1.4 1007_s_at DDR1 780 -0.28 -1.19 -0.87 -0.65 -0.25 1 -0.3 0.62 1.93 1053_at RFC2 5982 -1.31 0.1 -0.66 -0.46 0.34 -0.3 -0.25 0.25 2.29 117_at HSPA6 3310 -1.15 1.08 -0.84 -0.49 0.73 0.61 -1.51 1 0.57 121_at PAX8 7849 0.82 -1.58 0.42 -1.16 -0.56 0.11 -0.4 1.25 1.1 1255_g_at -0.48 -0.43 -0.68 -0.06 -0.28 2.19 -1.21 0.85 0.12 1294_at UBE1L 7318 0.62 -1.51 -0.55 -0.84 -0.58 0.71 -0.34 1.54 0.96 1316_at THRA 7067 -1.37 0.45 0.14 0.17 0.4 -0.11 -1.81 0.83 1.28 1320_at PTPN21 11099 -0.92 -0.48 1.01 -0.21 0.31 -0.16 -0.87 -0.75 2.08

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 1405_i_at CCL5 6352 -0.15 2.33 0.58 -0.68 -0.66 -0.59 0.38 -0.76 -0.44 1431_at CYP2E1 1571 0.64 -0.37 -1.68 -0.44 -0.37 1.18 -0.62 0.1 1.56 1438_at EPHB3 2049 -0.82 0.49 -1.79 -0.66 -0.39 1.36 0.26 1.01 0.53 1487_at ESRRA 2101 -1.2 1.15 -1.68 0.83 0.6 -0.82 -0.01 0.6 0.51 1494_f_at CYP2A6 1548 -0.29 -0.97 -0.42 -1.18 -0.39 0.89 -0.4 0.94 1.83 1598_g_at SC65 10609 -0.95 -0.44 0.25 -0.71 -0.74 -0.3 -0.12 0.8 2.23 160020_at MMP14 4323 -0.20 0.01 -0.38 -1.33 -1.44 0.26 0.58 1.68 0.83 1729_at TRADD 8717 -0.85 0.25 0.46 -2.15 -0.04 0.61 0.35 1.36 -0.01 1773_at FNTB 2342 -0.50 -0.37 0.32 -1.69 1.04 -0.05 -0.98 0.97 1.26 177_at PLD1 5337 -1.20 0.50 -0.28 -0.32 -0.51 2.23 -0.85 0.30 0.13 179_at PMS2L9 5387 -0.59 -0.82 -0.75 -1.21 -0.18 1.33 0.16 0.38 1.70

194 1861_at BAD 572 -1.91 0.83 -0.86 -0.97 0.53 0.95 0.64 0.36 0.41 2028_s_at E2F1 1869 0.11 1.08 -2.06 -0.97 -0.16 0.88 -0.05 0.83 0.33 243_g_at MAP4 4134 -0.96 1.51 -0.65 -0.23 1.45 -0.25 0.15 -1.39 0.37 266_s_at CD24 934 0.37 0.58 -0.82 -0.93 -0.80 -0.58 1.36 -0.75 1.59 31637_s_at NR1D1 9572 -0.87 0.54 0.37 -0.44 0.95 0.04 -1.66 1.61 -0.55 31799_at -0.61 -0.59 -0.05 0.43 0.91 -0.60 -1.24 2.06 -0.31 31807_at FLJ10432 54555 0.33 1.97 -0.59 -1.13 -0.67 0.74 -1.10 0.15 0.30 31826_at KIAA0674 23307 0.53 -1.35 0.28 1.20 -1.05 -0.27 1.59 -0.77 -0.16 31835_at HRG 3273 -1.17 0.77 1.10 -0.04 -0.79 -1.66 0.70 0.93 0.15 31837_at BC002942 91289 -0.17 -0.37 -0.92 -0.01 -0.29 1.69 0.06 -1.40 1.42 31845_at ELF4 2000 1.41 0.24 0.23 1.21 0.01 -1.17 0.38 -0.89 -1.43 31846_at ARHD 29984 -0.19 -0.41 -1.02 -1.10 0.54 1.28 -1.16 0.85 1.22 31861_at IGHMBP2 3508 -0.16 0.33 0.36 -2.31 0.27 -0.48 0.11 0.59 1.29 31874_at GAS2L1 10634 -1.87 1.48 -0.79 -0.70 0.40 0.13 0.28 0.13 0.93 32029_at PDPK1 5170 -0.85 -0.22 -0.17 -0.43 0.22 -0.08 -0.37 2.53 -0.61 32032_at DGCR14 8220 -1.78 -0.09 0.16 -0.66 0.27 1.74 -0.13 0.98 -0.49

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 32042_at COVA1 10495 -0.52 0.50 0.31 0.94 0.77 -1.29 0.55 0.60 -1.88 32062_at KIAA0014 9684 0.49 0.06 -0.80 -0.87 0.43 0.06 1.52 0.86 -1.75 32069_at N4BP1 9683 1.00 1.35 -1.73 0.65 0.25 -0.75 -0.25 -0.93 0.39 32088_at BLZF1 8548 0.51 1.01 -0.41 -0.71 -1.18 -1.21 -0.29 0.69 1.60 32091_at KIAA0446 9673 0.99 0.63 -0.70 0.26 0.79 -1.13 0.99 -0.06 -1.77 32094_at CHST3 9469 -1.13 -0.48 0.20 -0.79 -0.67 1.31 0.02 -0.32 1.87 32099_at KIAA0138 9667 1.42 -0.50 0.27 1.70 -0.57 -0.86 0.22 -0.54 -1.13 320_at PEX6 5190 0.04 0.74 -0.53 -0.17 0.85 -0.08 -2.30 0.88 0.56 32128_at CCL18 6362 0.67 0.52 0.67 0.78 0.46 -1.62 0.61 -0.46 -1.65 32137_at JAG2 3714 -0.08 -1.73 0.12 -0.94 -0.42 0.84 -0.27 1.20 1.28 32209_at MTVR1 23625 0.51 0.01 -0.43 2.03 -0.12 -0.90 0.81 -0.77 -1.14

195 32259_at EZH1 2145 -0.48 0.55 -1.97 -0.13 -0.50 -0.30 0.91 0.48 1.45 32402_s_at SPK 8189 0.13 2.01 -0.67 -1.08 -0.51 -0.06 1.08 0.01 -0.91 32502_at PP1665 81544 -0.44 1.46 -1.31 -1.13 0.23 -0.64 -0.14 1.30 0.67 32540_at PPP3CC 5533 0.44 -1.34 -0.45 -0.29 -0.79 1.63 -0.81 0.35 1.26 32541_at PPP3CC 5533 1.10 1.23 -1.25 -1.49 -0.03 0.36 -0.90 0.59 0.37 32625_at NPR1 4881 1.11 0.59 -0.28 0.67 -0.51 1.22 -0.25 -1.89 -0.66 32699_s_at PVR 5817 -0.36 -0.92 0.09 -1.77 0.49 0.41 -0.46 1.26 1.27 32723_at CSTF1 1477 -0.38 1.12 1.26 -0.69 0.66 -1.00 -0.16 0.75 -1.56 32811_at MYO1C 4641 0.38 1.10 -1.07 -0.63 0.37 -0.95 -1.31 1.21 0.89 32836_at AGPAT1 10554 -0.67 0.91 -0.13 0.82 1.13 0.98 -1.01 -1.58 -0.45 32837_at AGPAT2 10555 -0.93 -1.88 -0.38 -0.26 0.55 0.17 1.48 0.71 0.54 33132_at CPSF1 29894 -0.95 -1.68 -0.12 0.61 0.42 0.26 0.22 -0.56 1.79 33148_at ZFR 51663 -0.30 1.32 0.43 0.97 -0.01 -0.23 -2.22 -0.06 0.10 33197_at MYO7A 4647 -0.56 0.04 -0.46 -1.31 -0.39 1.76 -0.86 0.65 1.14 33304_at ISG20 3669 1.39 0.83 -0.76 1.04 -0.81 -0.99 -1.34 0.41 0.22 33307_at CGI-96 27341 -0.26 -0.36 -0.79 -1.80 -0.08 1.46 0.69 0.01 1.13

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 33307_at CGI-96 27341 -0.26 -0.36 -0.79 -1.80 -0.08 1.46 0.69 0.01 1.13 33322_i_at SFN 2810 -0.48 1.32 -0.53 -0.36 2.05 -0.71 0.03 -0.68 -0.62 33323_r_at SFN 2810 -0.75 1.59 0.14 -1.58 0.32 -0.05 -0.88 1.22 -0.01 33494_at ETFDH 2110 0.50 -1.60 0.93 0.04 -0.16 0.51 -0.33 -1.33 1.44 33579_i_at GALR3 8484 0.30 0.36 -0.94 -0.08 0.81 -0.81 -1.46 1.84 -0.01 33646_g_at GM2A 2760 -0.83 -0.30 0.10 -0.52 -0.60 1.29 -1.39 0.70 1.56 336_at TBXA2R 6915 -0.91 0.56 -0.26 -1.02 -0.73 2.10 -0.36 -0.12 0.76 33736_at STOML1 9399 -1.22 1.19 -0.22 -0.52 1.73 -0.70 -0.98 0.37 0.34 33760_at PEX14 5195 -1.20 0.04 0.72 -0.14 -0.01 0.18 -0.09 -1.46 1.95 33767_at -0.37 2.38 -0.31 -0.73 0.07 -0.03 -1.22 0.06 0.16 33768_at DMWD 1762 -0.15 -0.31 0.62 -2.19 1.04 1.17 -0.35 -0.06 0.24

196 33778_at C22orf4 25771 -0.82 -0.47 -1.01 0.65 -0.84 1.38 0.49 -0.81 1.44 33814_at PAK4 10298 -0.54 -0.89 -1.59 -0.66 0.16 1.54 0.35 0.93 0.70 33850_at MAP4 4134 -0.20 0.09 -1.07 0.15 0.57 1.39 -0.84 1.32 -1.42 34031_i_at CCM1 889 0.16 0.33 0.43 1.24 1.00 -1.91 -0.21 -1.16 0.11 34063_at RECQL5 9400 -0.82 1.06 0.98 -0.03 -0.04 1.25 -0.41 -1.85 -0.13 34187_at RBMS2 5939 1.57 -1.29 -0.11 1.60 0.17 -0.48 -0.27 -0.90 -0.29 34206_at CENTD2 116985 -1.50 -0.59 -0.89 -0.75 1.26 1.06 0.82 -0.16 0.76 34210_at CDW52 1043 -0.20 -1.19 -0.19 0.52 -1.33 -0.21 1.88 0.89 -0.16 34221_at KIAA0194 22993 0.05 1.32 -0.36 -1.22 -0.23 0.74 -1.72 0.67 0.75 34225_at WHSC2 7469 0.05 1.49 -0.38 -0.44 1.21 0.23 -1.81 0.32 -0.68 34260_at KIAA0683 9894 -0.75 0.62 -0.26 -1.99 1.21 -0.28 0.17 1.18 0.10 34406_at KIAA0602 23241 -0.39 0.08 -1.20 0.93 0.12 1.12 -0.93 -1.15 1.42 34408_at RTN2 6253 1.40 1.14 0.53 -0.12 0.53 -0.39 -0.36 -1.11 -1.61 34449_at CASP2 835 0.24 0.30 -0.43 -1.75 1.39 0.25 -1.25 0.95 0.29 34471_at MYH8 4626 -0.37 0.02 -0.46 -0.85 1.77 0.97 -0.70 0.87 -1.24 34478_at RAB11B 9230 0.92 0.79 0.40 0.04 -0.35 -0.60 -2.08 -0.29 1.18

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 34689_at TREX1 11277 -0.38 -0.48 0.50 0.92 -2.01 0.33 0.40 -0.61 1.33 34697_at LRP6 4040 0.07 -0.25 -0.58 -1.28 -0.49 1.64 -0.99 0.65 1.25 34726_at CACNB3 784 -0.33 -0.15 -0.93 1.07 -0.82 -0.72 -0.73 0.77 1.86 34764_at LARS2 23395 -1.81 0.68 -0.73 -1.11 0.34 0.23 0.77 0.39 1.23 34846_at CAMK2B 816 -0.49 0.62 -0.87 -1.43 0.71 -0.64 -0.06 0.29 1.87 34858_at KIAA0176 23510 -0.03 0.61 -0.39 0.60 0.13 -0.70 0.57 -2.12 1.31 34868_at KIAA1089 23381 0.81 0.00 -0.23 1.76 -0.34 -0.73 0.75 -0.34 -1.67 35147_at MCF2L 23263 -0.46 -0.53 0.32 -0.82 -0.15 -0.51 -0.48 0.17 2.47 35148_at TJP3 27134 1.51 -0.03 0.96 0.50 -0.06 -0.82 -1.90 -0.39 0.24 35150_at TNFRSF5 958 0.01 2.29 -0.48 -0.87 0.17 -1.17 -0.26 -0.17 0.48 35156_at -0.97 0.27 -1.89 -0.48 0.43 1.16 -0.18 1.14 0.51

197 35160_at LDB1 8861 0.77 2.01 0.50 -0.41 -0.17 -1.41 -0.25 -0.89 -0.15 34868_at KIAA1089 23381 0.81 0.00 -0.23 1.76 -0.34 -0.73 0.75 -0.34 -1.67 35179_at B3GAT3 26229 -0.16 0.26 0.33 0.62 1.54 -1.25 -1.44 0.87 -0.77 35201_at HNRPL 3191 -0.34 -0.08 -1.16 -1.57 1.05 1.14 0.01 1.23 -0.28 35254_at FLN29 10906 -0.06 0.03 0.72 -0.70 0.54 -0.78 -1.62 0.03 1.84 35265_at FXR2 9513 0.27 0.10 -0.48 -0.27 0.76 -1.27 1.74 0.57 -1.42 35436_at GOLGA2 2801 -1.88 1.35 -0.44 -0.28 -0.08 0.38 -0.76 0.57 1.13 35617_at MAPK7 5598 -0.79 -0.20 -0.86 -0.26 -0.03 1.10 -0.79 -0.28 2.14 35626_at SGSH 6448 -1.17 -0.43 2.29 -0.28 -0.86 0.47 0.21 0.05 -0.28 35666_at SEMA3F 6405 -0.47 0.40 -0.54 -1.73 -0.85 0.95 -0.07 1.18 1.13 35671_at GTF3C1 2975 -0.54 2.00 -0.77 -0.94 0.91 -0.49 -0.88 0.52 0.19 35685_at RING1 6015 -0.01 -0.21 -1.42 1.78 0.82 -0.82 -0.50 0.90 -0.54 35776_at ITSN1 6453 0.18 1.04 -1.02 -1.76 0.48 0.35 -0.72 1.35 0.09 35820_at GM2A 2760 -0.41 -1.05 -0.71 -0.67 -1.06 1.31 0.37 0.76 1.47 35846_at THRA 7067 0.83 -0.03 -0.35 0.09 0.85 1.03 -1.58 -1.54 0.68 35974_at LRMP 4033 -1.10 -0.18 -0.50 -1.00 -0.34 1.51 -0.52 0.59 1.55

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 36004_at IKBKG 8517 0.62 0.35 0.55 -1.00 -0.34 -0.64 -1.11 -0.47 2.04 36019_at STK19 8859 0.59 0.31 -1.54 -1.04 0.85 -0.45 -0.13 -0.32 1.73 36030_at DKFZP586I2223 25900 1.02 1.29 -0.72 -1.70 -0.04 -0.72 1.11 -0.06 -0.17 36084_at KIAA0076 9820 -1.07 0.00 1.56 -1.55 0.30 0.75 -0.82 0.01 0.81 36129_at KIAA0397 9905 -0.29 0.11 0.03 -0.96 0.00 1.25 -1.75 0.09 1.51 36475_at GCAT 23464 -0.32 -1.22 0.31 -0.34 -0.90 0.58 0.37 -0.60 2.12 36499_at CELSR2 1952 -0.38 -0.40 -0.79 0.82 0.82 -1.33 -0.94 0.56 1.64 36545_s_at KIAA0542 9814 -0.15 0.44 -1.68 0.05 0.49 1.88 -0.66 -0.74 0.38 36552_at DKFZP586P0123 26005 0.43 1.84 -1.04 -0.14 0.38 -1.23 -1.09 0.26 0.59 36553_at ASMTL 8623 0.99 -0.89 0.80 0.98 -1.33 0.44 0.88 -0.78 -1.09 36554_at ASMTL 8623 1.44 -0.37 1.44 0.42 -0.30 -0.17 0.12 -1.15 -1.42

198 36564_at FLJ90005 127544 0.37 1.07 0.57 -1.09 1.25 -0.08 0.40 -0.85 -1.64 36566_at CTNS 1497 -1.40 0.32 -1.17 -0.34 -0.29 0.14 0.50 0.24 1.99 36612_at KIAA0280 23201 0.80 1.68 1.14 -0.37 -0.63 -1.37 -0.08 -0.80 -0.35 36711_at MAFF 23764 1.99 0.37 -0.98 0.33 -1.02 -0.62 0.63 -0.95 0.23 36742_at TRIM15 89870 -0.20 -0.32 1.52 -1.28 -0.33 -0.92 -0.64 1.19 1.01 36829_at PER1 5187 -1.11 0.40 -0.54 -0.91 0.19 0.16 -0.94 0.78 1.97 36830_at MIPEP 4285 -1.12 0.76 -0.21 -0.68 -0.60 0.34 -0.51 -0.18 2.20 36865_at KIAA0759 23357 -0.70 -0.16 -1.41 0.68 1.14 0.67 -0.58 1.36 -1.01 36888_at KIAA0841 23354 0.02 0.68 -0.13 -1.86 1.27 -0.95 1.15 0.19 -0.38 36907_at MVK 4598 -0.30 -0.52 -0.10 -0.47 -0.13 1.12 -1.59 1.88 0.12 36920_at MTM1 4534 -0.43 0.75 -0.08 -1.40 0.36 0.45 -1.56 0.40 1.51 36936_at TSTA3 7264 -0.86 0.05 0.86 -0.17 -0.21 0.92 -0.22 1.45 -1.83 36994_at ATP6V0C 527 -1.12 -0.84 -0.77 -0.61 -0.37 1.90 0.27 0.73 0.81 37004_at SFTPB 6439 0.74 -0.84 -1.24 -0.10 -0.02 1.97 -0.92 0.60 -0.17 37005_at NBL1 4681 0.62 -0.81 -1.38 -0.47 -0.84 1.64 -0.08 1.15 0.18 37012_at CAPZB 832 -1.00 0.99 -0.78 -0.64 1.45 0.92 -0.82 -0.86 0.75

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 37020_at CRP 1401 0.18 -0.94 1.58 1.30 -0.99 -0.61 -0.78 -0.52 0.78 37022_at PRELP 5549 -0.32 -0.43 -0.73 -0.67 0.10 0.00 -1.04 0.92 2.18 37028_at PPP1R15A 23645 1.10 -0.25 -0.55 1.80 -0.10 -0.95 0.56 -0.26 -1.35 37079_at LOC116150 116150 1.40 0.03 0.88 -0.10 1.30 -0.85 -0.99 -1.28 -0.38 37117_at ARHGAP8 23779 0.19 -1.26 0.75 0.27 0.41 -1.67 1.18 -0.75 0.86 37145_at GNLY 10578 0.48 -0.68 -0.79 -0.90 -0.65 -0.54 0.08 2.01 1.00 37152_at PPARD 5467 -1.16 0.96 -0.81 0.72 -0.47 0.17 0.21 -1.24 1.63 37170_at BIKE 55589 -1.20 2.02 -0.66 -0.32 0.77 -0.96 0.37 -0.36 0.35 37201_at -0.30 -0.35 -0.65 -0.78 0.64 -1.31 -0.22 1.56 1.43 37226_at BNIP1 662 -0.96 -1.19 1.21 -0.28 1.32 -1.05 -0.45 0.74 0.65 37232_at KIAA0586 9786 -0.64 0.73 -1.67 -1.13 0.03 0.52 0.13 0.46 1.56

199 37254_at ZNF133 7692 0.62 -0.67 -0.91 -0.44 -1.24 1.12 0.01 1.79 -0.29 37278_at TAZ 6901 -1.13 1.03 0.63 0.37 -1.28 -1.48 0.43 0.56 0.86 37384_at PPM1F 9647 1.17 0.05 -1.45 -0.01 -0.66 1.79 0.20 -0.25 -0.85 37408_at MRC2 9902 0.79 -1.71 -0.74 -0.45 0.39 0.11 1.84 -0.28 0.05 37424_at C6orf18 54535 -0.18 0.55 -0.88 -1.32 1.46 0.64 -1.04 -0.37 1.15 37425_g_at C6orf18 54535 -1.51 -0.13 1.29 0.99 0.48 -1.02 0.29 0.68 -1.08 37433_at PIASX-BETA 9063 -1.33 -0.89 0.31 0.25 0.67 1.06 -0.71 1.52 -0.90 37462_i_at SF3A2 8175 -0.36 0.43 -0.24 1.98 -0.42 0.60 0.34 -1.53 -0.80 37512_at RODH 8630 -1.85 0.32 -0.05 -0.99 0.39 -0.39 0.27 0.71 1.59 37547_at B1 27241 1.38 -0.26 -0.28 -0.85 0.75 -0.90 -1.08 1.58 -0.33 37549_g_at B1 27241 0.11 -0.80 0.07 -1.65 1.87 0.11 -0.74 0.42 0.58 37566_at KIAA1045 23349 -0.94 0.47 -0.16 -1.08 -1.11 1.00 1.02 1.41 -0.60 37577_at MGC14258 84986 -1.35 -0.79 0.45 1.25 0.59 0.54 0.51 -1.63 0.42 37586_at ZNF142 7701 0.05 -0.34 0.11 1.35 0.76 -0.14 -1.49 1.10 -1.40 37590_g_at -0.37 0.03 0.05 -0.31 -0.58 0.64 -0.47 -1.26 2.27 37652_at CABIN1 23523 -1.32 1.11 -0.68 -0.57 0.52 1.40 -0.25 -1.07 0.85

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 37793_r_at RAD51L3 5892 -0.98 1.98 0.96 -0.76 0.20 -0.57 -1.06 0.25 -0.02 37796_at LRRN1 4034 0.24 -0.57 -0.24 -1.54 0.60 -0.05 -1.06 0.98 1.64 37802_r_at KIAA1164 54629 0.45 -0.37 0.35 1.08 1.81 -1.20 -0.67 -0.53 -0.92 37831_at KIAA0545 23094 -1.23 1.20 1.61 -1.12 0.05 -0.97 -0.14 0.44 0.15 37860_at ZNF337 26152 0.54 -1.45 1.27 -0.97 0.45 -0.88 0.58 -0.66 1.12 37872_at JRK 8629 -0.26 -0.47 -1.65 -0.62 0.61 1.39 -0.33 -0.11 1.45 37892_at COL11A1 1301 -0.57 -0.23 0.75 -0.57 -0.76 -0.86 2.31 0.03 -0.08 37943_at KIAA0321 23503 -1.69 1.02 -0.07 -1.39 0.05 0.40 -0.27 0.97 0.97 37950_at PREP 5550 -1.92 1.19 0.27 -0.54 0.03 -0.09 -0.69 0.39 1.36 37953_s_at ACCN2 41 0.26 -0.62 -0.47 -1.16 1.96 -1.08 0.04 0.94 0.12 37965_at PARVB 29780 -1.10 1.70 -0.47 0.33 0.14 1.19 -0.84 -1.15 0.18

200 37966_at PARVB 29780 -0.40 0.32 -1.06 0.61 -0.78 2.23 -0.54 -0.54 0.17 37986_at EPOR 2057 -1.44 0.54 0.01 -1.45 -0.04 1.76 0.16 -0.14 0.59 37996_s_at DMPK 1760 1.16 -0.32 1.57 -0.18 -0.51 -0.36 0.74 -1.70 -0.41 38037_at DTR 1839 2.06 -0.55 0.19 0.31 -0.68 -0.80 0.97 -0.93 -0.57 38043_at FAM3A 60343 1.01 0.27 -1.44 1.56 -0.59 0.70 -0.87 0.18 -0.82 38069_at CLCN7 1186 1.24 -0.48 -1.19 0.78 -1.58 -0.13 1.03 -0.33 0.67 38149_at KIAA0053 9938 -1.39 -0.51 -0.73 -0.64 0.40 0.93 -0.32 0.38 1.88 38157_at DOM3Z 1797 0.11 0.26 -0.83 1.36 1.37 -1.83 -0.31 -0.11 -0.03 38158_at ESPL1 9700 -1.35 -0.93 -0.23 -1.35 1.08 0.30 0.93 0.61 0.93 38241_at BTN3A3 10384 -0.52 -0.16 -0.07 -0.20 -0.91 2.26 -0.89 -0.37 0.87 38269_at PKD2 25865 -1.11 -0.67 -0.44 -0.93 -0.12 1.23 -0.47 0.87 1.64 38290_at RGS14 10636 -0.40 0.18 -0.80 -0.66 -0.70 1.35 -1.16 0.56 1.64 38340_at HIP1R 9026 -0.34 -0.28 -1.00 0.56 0.88 1.89 0.19 -0.58 -1.30 38398_at MADD 8567 -0.32 0.91 -1.39 -1.31 1.46 0.62 0.14 -0.68 0.58 38447_at ADRBK1 156 -0.95 0.94 -0.26 -0.55 -0.23 0.81 -1.53 0.13 1.65 38487_at STAB1 23166 -0.44 -0.66 0.23 -0.59 -0.53 1.92 -0.54 -0.78 1.41

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 38521_at CD22 933 0.21 -0.82 -0.60 0.08 -0.49 1.92 -1.49 0.65 0.54 38671_at KIAA0620 23129 -1.34 0.20 0.09 -0.52 -1.17 1.60 -0.24 0.01 1.36 38691_s_at SFTPC 6440 -1.09 -0.67 -0.93 1.41 0.70 0.33 -0.99 -0.12 1.35 38703_at DNPEP 23549 0.71 -0.94 -0.05 -1.33 0.06 -0.46 1.17 1.61 -0.77 38707_r_at E2F4 1874 0.31 -1.24 -0.83 -1.08 0.05 0.55 -0.41 0.83 1.81 38710_at FLJ20113 55611 0.99 -0.51 -1.03 0.22 -1.48 0.35 -0.27 1.78 -0.06 38766_at SRCAP 10847 1.76 -0.66 -0.15 0.09 0.25 -0.12 -1.70 1.07 -0.53 38892_at KIAA0240 23506 -1.15 1.91 0.25 0.15 0.11 0.48 0.41 -0.85 -1.32 38918_at SOX13 9580 -0.29 -0.50 -1.09 1.58 1.57 0.42 -0.11 -0.80 -0.77 38964_r_at WAS 7454 -0.62 0.96 1.36 -0.74 1.18 -0.61 -1.13 -0.95 0.55 39248_at AQP3 360 -0.39 -1.14 1.13 0.06 0.40 -0.73 1.82 -1.09 -0.05

201 39249_at AQP3 360 -1.14 -0.17 -0.17 0.44 -0.59 -0.44 1.59 1.51 -1.01 39313_at PRKWNK1 65125 1.08 0.08 1.17 -0.63 0.94 -1.59 -1.17 -0.26 0.38 39318_at TCL1A 8115 -0.15 0.91 -0.28 1.19 0.88 -0.48 -1.58 0.75 -1.22 39402_at IL1B 3553 2.12 -0.02 -0.41 -0.08 -0.56 -0.71 1.17 -0.75 -0.72 39548_at NPAS2 4862 -0.78 -1.15 0.21 0.43 0.20 1.65 -0.63 -1.11 1.17 39549_at NPAS2 4862 0.50 -1.35 -1.32 1.60 0.85 0.36 -0.14 0.29 -0.79 39582_at 0.12 1.87 1.27 -1.15 -0.62 -0.30 -0.47 -0.87 0.16 39650_s_at KIAA0435 9845 -0.80 -0.74 0.92 -0.50 -1.11 1.14 -0.84 0.43 1.49 396_f_at EPOR 2057 -0.64 -0.64 -0.04 -0.98 -0.75 0.79 -0.70 1.44 1.55 39705_at SIN3B 23309 1.08 -2.02 0.72 0.05 0.90 -0.64 0.74 -0.58 -0.25 39729_at PRDX2 7001 -0.69 -0.74 -0.29 1.10 -0.06 -0.99 1.94 0.52 -0.76 39763_at -0.01 1.18 -1.21 0.14 -0.05 -1.37 0.21 1.68 -0.57 39817_s_at RCL 10591 -0.96 -0.57 -0.65 0.11 -1.63 1.20 0.89 0.64 0.96 39835_at SBF1 6305 0.61 1.73 -1.33 1.09 -0.05 -0.14 -0.79 -0.98 -0.12 39854_r_at TTS-2.2 57104 0.33 -0.41 -1.24 1.81 0.67 -1.00 -0.12 0.82 -0.85 39891_at -1.22 0.57 0.48 -0.70 1.00 1.35 -1.59 -0.04 0.14

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 39966_at CSPG5 10675 -0.44 -0.13 0.11 0.17 1.65 -1.32 -0.49 1.43 -0.98 40016_g_at KIAA0303 23227 0.42 1.30 -0.06 0.24 -1.12 0.50 -1.38 1.18 -1.09 40020_at CELSR3 1951 -0.27 -0.50 0.69 -0.91 -0.90 1.41 -1.04 1.56 -0.03 40093_at LU 4059 0.24 0.85 0.10 0.26 0.75 -1.51 -0.32 1.23 -1.62 40148_at APBB2 323 0.43 -1.01 -0.29 1.42 -0.79 0.28 -0.53 -1.07 1.58 40149_at SH2B 25970 1.74 0.36 -0.65 -0.47 -1.18 -0.64 -0.40 -0.19 1.46 40189_at SET 6418 -1.53 1.01 -0.61 -0.92 1.56 -0.17 -0.47 0.68 0.44 40225_at GAK 2580 -0.70 1.28 -0.53 0.25 -1.04 0.32 -0.76 -0.62 1.82 40255_at DDX28 55794 -0.56 -0.22 1.55 -0.40 0.32 1.44 -1.47 -0.80 0.14 40273_at DBP 1628 -1.40 1.36 0.21 -0.14 -0.04 0.67 -0.62 -1.29 1.25 40284_at FOXA2 3170 -0.77 1.21 0.39 -0.17 1.36 -0.95 0.95 -0.98 -1.03

202 40359_at C11orf13 8045 -0.83 -0.48 0.37 -1.27 -0.70 0.78 -0.61 1.22 1.52 40420_at STK10 6793 1.23 1.73 -1.27 0.31 -0.31 -0.67 -0.85 -0.54 0.37 40446_at PHF1 5252 1.99 -0.61 0.33 0.82 -0.84 -0.18 0.22 -1.39 -0.34 40465_at U5-100K 9416 -0.67 -0.13 -0.69 -1.57 -0.52 0.37 0.52 0.98 1.70 40472_at LOC254531 254531 -0.33 -0.53 -0.81 0.29 -0.05 1.38 -0.77 -1.00 1.82 40489_at DRPLA 1822 -0.04 0.25 -0.96 -0.13 -0.74 -0.09 -0.93 2.32 0.33 40524_at PTPN21 11099 -0.86 -0.60 -0.96 -0.97 1.52 1.62 0.20 0.07 -0.03 40560_at TBX2 6909 0.26 -0.97 -0.75 0.58 -0.82 2.27 0.03 -0.38 -0.23 40562_at GNA11 2767 -0.32 -0.65 -0.60 -1.55 0.70 -0.19 -0.20 1.21 1.61 40569_at ZNF42 7593 0.87 -0.15 0.06 1.58 -1.63 -0.24 0.17 -1.26 0.60 40612_at KIAA1117 23033 -0.29 0.42 -0.56 -1.54 1.06 0.19 1.73 -0.91 -0.10 40640_at -0.80 -0.15 -0.96 -0.87 0.41 0.51 -1.00 1.21 1.65 40665_at FMO3 2328 0.37 -0.04 -0.10 -1.82 0.58 -1.09 0.97 1.39 -0.27 40687_at GJA4 2701 0.13 -1.72 0.81 -0.09 -1.28 0.59 1.53 0.00 0.02 40829_at KIAA1037 23038 -0.49 0.05 0.72 1.80 0.49 0.24 -0.88 -0.27 -1.67 40837_at TLE2 7089 -0.04 -0.10 -1.20 -1.16 0.29 -0.40 -0.39 1.20 1.82

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 40850_at FKBP8 23770 0.83 0.30 -0.60 1.63 0.29 0.57 -0.48 -1.64 -0.90 41037_at TEAD4 7004 0.88 0.58 -0.83 1.97 -0.36 -0.87 -0.27 0.03 -1.13 41047_at C9orf16 79095 -0.30 -1.08 0.62 1.31 0.91 -0.75 1.14 -1.20 -0.65 41113_at KIAA0557 26048 1.46 -0.82 -0.62 -0.02 -0.76 0.87 1.44 -0.47 -1.07 41160_at MBD3 53615 0.05 0.10 -0.73 -1.87 0.61 0.84 1.62 -0.35 -0.29 41220_at MSF 10801 -0.85 -0.85 -0.39 -0.45 -1.26 0.56 1.38 0.39 1.47 41329_at PACE-1 57147 1.53 -0.32 -0.10 -0.05 1.42 -1.13 0.58 -0.95 -0.96 41386_i_at KIAA0346 23135 -1.33 0.53 -0.18 -1.23 0.65 1.77 -0.57 0.63 -0.26 41387_r_at KIAA0346 23135 2.20 -0.39 -0.63 -1.01 0.54 -0.15 0.68 -0.72 -0.48 41397_at LOC55565 55565 -0.63 -0.81 -0.29 -0.11 -0.45 -0.66 -0.24 0.93 2.28 41469_at -1.19 -0.98 -0.01 0.56 1.84 0.43 -0.74 -0.70 0.80

203 41512_at BRAP 8315 1.36 0.67 -0.56 0.98 -0.12 -1.79 0.41 -0.99 0.04 41553_at C8orf1 734 -0.12 -0.49 -0.01 -0.87 -1.10 1.09 -0.87 1.87 0.50 41577_at PPP1R16B 26051 1.93 0.59 -1.55 0.81 -0.50 -0.40 -0.39 -0.49 0.02 41644_at KIAA0790 23328 -0.12 -0.14 0.14 -1.96 0.61 0.54 -0.92 0.29 1.56 41657_at STK11 6794 -0.75 -0.19 1.25 -0.69 -0.28 -1.77 0.76 0.63 1.05 41660_at CELSR1 9620 1.98 0.37 -1.47 -0.23 0.13 0.70 -0.49 -0.96 -0.02 41856_at 0.16 -0.03 0.74 -1.67 -0.28 -0.73 -0.74 0.95 1.59 41553_at C8orf1 734 -0.12 -0.49 -0.01 -0.87 -1.10 1.09 -0.87 1.87 0.50 41858_at FRAG1 27315 -1.24 -0.32 -0.21 0.18 -0.52 1.43 -0.81 -0.27 1.78 564_at GNA11 2767 0.18 0.89 -0.36 -2.00 1.14 -0.81 -0.36 0.49 0.82 632_at GSK3A 2931 -0.38 0.51 -0.74 -1.08 0.98 0.76 -1.61 0.30 1.25 635_s_at PPP2R5B 5526 0.21 0.58 0.83 -1.51 1.02 0.58 -0.39 0.37 -1.70 823_at CX3CL1 6376 -1.01 1.14 0.55 -0.40 -0.09 -1.77 -0.09 0.29 1.39 42361_g_at C6orf18 54535 -1.65 0.15 0.93 -0.32 1.07 0.56 -1.08 1.05 -0.71 43427_at -0.08 0.33 0.16 -2.21 -0.93 0.66 0.90 0.31 0.84 43511_s_at 0.55 0.75 0.19 -0.69 -0.39 -1.03 -0.18 -1.18 1.98

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 43544_at TRAP95 10025 -0.91 -1.10 1.00 -0.82 -1.00 0.36 0.87 0.05 1.53 43934_at C11ORF4 56834 -0.01 0.02 -0.23 1.06 1.98 -0.86 -1.40 -0.30 -0.26 43977_at FLJ20422 54929 -0.45 1.06 0.76 -2.07 0.13 0.75 -0.93 0.32 0.41 44040_at KIAA1940 150726 0.79 1.33 -0.18 -1.52 -0.49 -0.79 -0.43 -0.15 1.46 44065_at FLJ14827 84934 -1.52 0.02 -0.46 -0.91 0.10 1.12 -0.53 1.66 0.52 44111_at VPS33B 26276 -0.95 1.27 -0.38 -1.48 0.31 -0.44 -0.04 0.05 1.66 44120_at MGC20727 90956 -1.13 0.33 1.00 -1.51 -0.01 0.59 -0.56 -0.30 1.59 44146_at GMEB2 26205 -0.60 0.25 -0.35 -1.07 -1.25 -0.34 0.56 1.01 1.80 44563_at FLJ10385 55135 -0.26 -0.56 -0.29 -1.45 0.25 2.31 0.03 0.03 -0.08 44617_at ARL6IP4 51329 -0.43 -0.08 -0.20 -1.32 -0.25 -0.30 -0.55 1.07 2.09 44654_at LOC92579 92579 -0.64 -1.16 -0.49 0.16 -0.67 -0.27 1.76 1.50 -0.17

204 44669_at 1.81 0.51 -1.24 -0.27 -0.98 0.74 -0.79 -0.42 0.66 44673_at SN 6614 -0.13 1.26 -0.89 -1.08 -0.07 1.72 0.04 -1.14 0.30 44696_at FLJ10743 54662 -0.09 1.52 -0.84 0.19 0.39 1.48 -1.16 -0.92 -0.56 44702_at 7h3 85360 -0.95 -0.03 0.41 -0.73 -1.28 -0.26 -0.17 1.47 1.55 44783_s_at HEY1 23462 1.01 -0.42 -0.02 -1.15 1.06 -1.77 -0.06 1.02 0.33 44790_s_at FLJ21562 80183 1.03 -0.25 0.26 1.86 -0.95 -1.09 0.39 -0.30 -0.96 44822_s_at KIAA1193 54531 0.64 0.71 1.46 -1.07 -0.55 -1.69 -0.04 -0.19 0.74 45288_at LOC57406 57406 -0.16 -0.26 -0.79 -0.27 0.82 1.00 0.58 1.09 -1.99 45297_at MGC45806 115273 -1.52 -0.68 -0.38 0.86 -0.25 1.32 -1.00 0.59 1.06 45526_g_at FLJ14154 79903 -0.07 0.59 0.10 -0.19 -1.23 -1.23 -0.59 0.71 1.92 45572_s_at GGA1 26088 0.91 -0.45 -1.01 -0.34 -0.58 0.11 1.44 -1.33 1.25 45633_at FLJ13912 64785 0.17 -0.76 0.30 -1.05 1.10 0.33 1.43 0.14 -1.66 45653_at 1.51 0.55 -0.60 1.03 0.00 0.15 -0.14 -0.64 -1.86 45687_at MGC3121 78994 -0.91 -0.63 0.02 -1.39 -0.47 1.24 0.61 1.63 -0.09 45714_at HPIP 54985 0.26 0.62 1.34 0.73 0.71 -0.33 -0.38 -1.63 -1.32 45749_at FLJ13725 79567 -1.18 0.55 -0.61 -0.89 0.12 0.69 -0.89 0.28 1.93

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 45828_at FLJ10241 55101 -1.41 1.40 -0.12 -0.29 1.19 -1.02 0.54 -0.88 0.59 46142_at FLJ12681 64788 0.98 -0.72 0.20 -0.33 -0.39 0.72 -0.51 -1.61 1.66 46167_at TTC4 7268 1.80 0.58 -0.41 0.42 0.01 -1.58 0.44 -0.13 -1.13 46256_at SSB3 90864 -0.81 0.65 0.43 -1.55 0.31 -1.02 -0.41 0.95 1.43 46270_at UBAP1 51271 0.74 0.09 -0.03 1.67 -0.70 -0.94 1.00 -1.44 -0.37 46323_at SHAPY 124583 0.62 1.57 0.40 0.04 0.93 -1.29 -0.61 -1.40 -0.26 46665_at SEMA4C 54910 -1.72 0.13 -0.87 -0.09 1.11 1.67 0.18 -0.07 -0.33 46947_at FLJ10613 54552 -1.36 -0.27 0.41 -0.11 -0.46 1.57 -1.29 0.35 1.17 47069_at ARHGAP8 23779 -0.22 -0.43 -0.58 0.31 -0.34 1.79 -1.03 -0.91 1.43 47083_at MGC2718 79034 1.75 0.95 -0.01 0.12 -0.96 -1.64 0.36 -0.14 -0.42 47105_at FLJ20399 54920 -1.48 0.07 0.60 -1.20 0.01 -0.27 1.60 -0.42 1.08

205 47530_at HSPC219 51531 -1.60 0.59 0.71 1.44 0.41 -0.99 0.70 -0.73 -0.52 47550_at LZTS1 11178 1.50 -0.64 0.70 -0.07 -0.90 -0.16 0.99 0.29 -1.70 47553_at DKFZP434N014 25861 -1.15 0.74 -1.31 0.27 -0.84 0.40 0.04 1.85 0.01 47560_at FLJ11939 79732 0.06 -0.32 1.01 -0.07 -0.13 0.60 0.59 -2.38 0.64 47571_at ZNF236 7776 0.36 0.25 -0.48 -1.33 -0.87 0.44 -0.51 0.01 2.13 47608_at TJP4 93643 1.20 0.77 0.52 0.28 -1.46 0.58 0.39 -0.77 -1.52 47773_at KIAA1332 54455 0.86 -0.52 1.10 -1.62 0.50 -1.34 0.30 -0.22 0.94 48030_i_at C5orf4 10826 0.65 0.74 -0.26 -0.85 -0.38 0.85 -1.72 -0.48 1.45 48031_r_at C5orf4 10826 -1.04 -0.67 -0.38 0.29 0.40 -1.23 -0.23 1.04 1.83 48106_at FLJ20489 55652 0.35 -1.23 0.75 0.13 -0.54 0.24 -1.76 1.32 0.73 48117_at LOC112869 112869 -1.07 -0.16 1.32 -1.26 -0.53 0.54 -0.23 1.65 -0.24 48531_at TNIP2 79155 1.02 1.47 -0.88 0.62 -0.59 -0.71 0.96 -0.93 -0.95 48580_at CGBP 30827 -0.29 0.22 -0.90 -0.99 -0.68 -0.10 -0.03 2.31 0.47 49111_at -0.43 1.76 -1.18 -0.49 -0.36 -0.58 0.59 -0.63 1.33 49306_at AD037 83937 -1.61 0.44 -0.67 -0.35 -0.06 1.16 -0.52 -0.11 1.72 49327_at SIRT3 23410 -0.46 0.26 -0.33 -0.94 0.56 0.28 -1.82 1.17 1.27

Table D-1. Continued. Probe Set Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL ID Gene ID 6 15 24 6 15 24 6 15 24 49452_at 0.97 -0.76 -0.84 -1.62 -0.05 0.03 0.00 0.61 1.65 49485_at PRDM4 11108 -0.80 -0.21 -0.40 -0.78 -0.42 -0.12 -0.30 0.62 2.41 49878_at PEX16 9409 -0.62 1.66 -0.44 0.92 -1.24 0.80 0.47 -0.56 -1.01 50221_at TFEB 7942 -0.59 1.87 -0.30 -0.98 -0.17 1.50 -0.71 -0.50 -0.10 50277_at GGA1 26088 0.52 0.03 -1.94 -0.37 -0.59 0.47 0.38 -0.24 1.73 50314_i_at C20orf27 54976 -0.10 0.06 -0.59 0.53 0.43 1.88 -0.53 -1.81 0.11 50374_at -0.79 0.37 -0.80 -1.60 -0.28 1.68 0.12 0.33 0.96 50376_at EZF-2 55311 -1.06 0.02 -0.31 -0.35 -0.81 0.23 0.82 -0.71 2.17 50400_at DKFZp434J245 196743 -0.19 -0.03 -0.52 -1.50 0.37 1.77 -0.94 -0.07 1.12 50965_at RAB26 25837 -1.15 0.07 -1.88 -0.42 0.67 1.25 0.33 0.84 0.27 51146_at FLJ20477 55650 1.55 0.58 0.36 0.13 -1.35 -1.70 0.13 -0.20 0.49

206 51158_at 0.13 0.93 -0.59 -1.88 0.70 0.61 -0.84 1.23 -0.28 51176_at CRSP8 9442 0.75 -0.28 0.36 -1.20 -1.59 0.47 1.39 -0.67 0.77 51192_at SSH-3 54961 1.23 2.02 -0.11 -0.23 -0.68 -0.48 -0.89 -0.89 0.04 51200_at FLJ20850 55049 -0.02 0.25 -1.66 0.91 -0.36 0.43 0.63 -1.43 1.24 51226_at -0.37 -0.18 -0.50 0.05 -0.85 0.04 0.03 -0.72 2.51 51228_at 0.09 1.45 -0.36 1.46 0.38 -1.24 0.15 -0.92 -1.01 52005_at WIZ 58525 -2.33 0.68 -0.53 0.64 0.27 0.23 1.07 0.16 -0.21 52078_at DKFZP564D0478 84065 0.91 1.52 -0.45 -0.65 -0.72 0.00 1.29 -0.64 -1.25 52159_at HEMK 51409 -0.73 0.16 -0.24 -0.26 -0.91 1.58 -0.48 -0.83 1.73 52164_at C11orf24 53838 -0.18 0.54 0.37 0.00 1.55 -0.59 0.86 -0.68 -1.87 52169_at FLJ90524 92335 -0.70 0.84 -0.27 -1.62 0.41 0.59 -1.08 0.33 1.49 52255_s_at COL5A3 50509 -0.36 0.10 -1.18 -0.97 1.48 -0.06 -0.53 1.72 -0.20 52285_f_at FLJ12542 79959 0.59 0.91 1.30 1.24 -0.40 -0.84 -1.10 -0.83 -0.87 52651_at COL8A2 1296 0.62 0.82 -0.93 1.70 0.05 -0.38 0.22 -1.65 -0.46 52731_at FLJ20294 55626 1.24 0.16 -0.94 0.44 0.45 -1.45 1.25 -1.19 0.02 52741_at FLJ40452 115708 0.23 -1.26 0.01 -0.04 -1.42 1.14 0.80 -0.78 1.33

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 52837_at KIAA1644 85352 -1.21 1.58 0.37 -0.66 -0.94 -0.60 -0.47 1.14 0.79 52940_at SIGIRR 59307 -1.03 -0.91 -0.15 -0.09 -0.20 1.00 0.53 -1.05 1.90 52975_at FLJ00001 89853 -1.92 0.84 -1.01 -0.46 0.90 0.72 -0.32 0.86 0.38 53071_s_at FLJ22222 79701 0.70 0.47 1.49 0.80 0.36 -1.17 -0.48 -0.71 -1.45 53076_at B4GALT7 11285 -0.14 0.15 -1.19 -0.78 -0.70 -0.18 0.04 2.24 0.57 53202_at MGC2821 79020 -0.68 -0.31 0.00 -1.67 1.33 0.22 -0.10 -0.40 1.61 52837_at KIAA1644 85352 -1.21 1.58 0.37 -0.66 -0.94 -0.60 -0.47 1.14 0.79 53720_at FLJ11286 55337 -0.11 1.03 -0.25 -1.22 0.44 -0.45 -1.55 0.70 1.42 53912_at SNX11 29916 -0.19 1.42 0.70 -0.59 -0.18 -0.45 -1.41 -0.77 1.49 53968_at KIAA1698 80789 0.94 1.04 -0.83 1.45 -1.15 -0.86 0.52 -0.24 -0.88 53987_at KIAA1464 57610 -1.55 2.04 -0.70 -0.67 0.35 0.09 -0.22 0.44 0.21

207 53991_at KIAA1277 27147 -0.18 0.91 -0.65 -0.25 -1.26 -0.83 1.61 -0.54 1.19 54037_at HPS4 89781 1.09 0.51 0.21 -0.92 0.01 -1.39 -1.33 0.58 1.23 54051_at MCCC2 64087 0.63 0.76 -0.70 1.50 0.03 -1.80 -0.58 -0.48 0.63 54632_at FLJ21877 63892 -0.36 -0.80 -0.18 -0.99 0.06 0.71 -1.22 1.07 1.73 54970_at DKFZP761I2123 83637 -0.60 1.87 -1.36 -1.15 0.59 0.04 0.72 0.06 -0.18 55065_at MARK4 57787 0.43 -1.07 0.01 -0.24 0.01 0.80 0.04 -1.72 1.72 55081_at KIAA1668 85377 0.05 -0.24 -1.09 1.81 1.51 -0.61 -0.64 -0.23 -0.54 55093_at CSGlcA-T 54480 -1.57 -0.25 0.20 -0.68 -1.18 0.30 0.85 1.04 1.28 55583_at KIAA1395 57572 -0.88 -0.53 -1.20 -0.44 -0.29 -0.26 0.49 1.51 1.60 55616_at MGC9753 93210 -0.87 -0.46 -0.31 -1.40 -0.50 -0.13 1.05 1.40 1.24 55662_at FLJ13114 79591 -1.45 1.22 0.27 -0.31 1.76 -0.45 -0.72 -0.52 0.20 55692_at ELMO2 63916 -0.64 1.26 -1.61 0.40 0.70 1.25 -0.98 -0.40 0.01 55705_at LOC91300 91300 -0.11 1.55 -1.19 0.02 1.65 -0.59 0.07 -0.48 -0.90 56197_at PLSCR3 57048 -0.52 -0.13 0.53 -1.90 -0.22 0.37 0.33 -0.30 1.84 56256_at CGI-40 51092 -0.34 0.04 0.17 1.57 -1.45 -1.09 0.96 -0.67 0.81 56821_at FLJ10815 55238 -0.90 0.26 -0.83 -1.68 0.88 0.77 0.64 -0.41 1.26

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 56829_at MGC4737 83696 0.49 -0.80 -0.67 -1.10 -0.08 -0.14 -0.77 1.59 1.50 56919_at KIAA1449 57599 -1.17 0.08 0.25 -0.90 -0.40 1.93 -0.86 0.04 1.03 57082_at ARH 26119 -1.02 0.17 -0.45 0.66 0.24 1.03 -1.54 -0.63 1.53 57163_at ELOVL1 64834 -1.89 1.48 -0.16 -0.45 0.83 0.38 0.17 0.53 -0.89 57516_at MGC13138 92595 -0.34 -1.23 -0.21 0.78 -0.53 -1.30 0.68 1.75 0.39 57532_at DVL2 1856 -0.48 0.14 -0.97 -0.97 -0.43 2.21 0.71 0.25 -0.45 57539_at KIAA1847 84619 -0.81 -1.31 0.51 -0.60 0.17 2.19 0.00 0.16 -0.31 57540_at RBSK 64080 -1.01 0.12 0.02 0.80 -0.84 0.87 0.20 -1.63 1.45 57588_at SLC24A3 57419 0.04 1.75 -0.49 -0.45 -0.01 -1.48 -0.57 1.37 -0.14 57703_at MGC27076 205564 1.19 -1.83 -0.03 0.55 -1.15 0.61 0.46 0.77 -0.58 57715_at LOC51063 51063 -0.68 -1.08 -0.90 0.22 -0.48 0.51 1.19 -0.57 1.79

208 57739_at 0.44 0.95 0.43 -2.07 0.54 1.07 -0.52 -0.02 -0.81 58308_at FLJ10759 55223 -0.77 0.03 -0.35 -0.83 0.10 1.94 -0.97 -0.43 1.28 58696_at FLJ20591 54512 0.94 0.96 0.00 0.40 -0.41 -0.47 1.11 -0.52 -2.02 58916_at MGC2376 65987 -0.27 1.15 -0.59 -0.99 0.33 -1.39 0.68 -0.50 1.57 58994_at FLJ20241 54862 -1.04 1.71 -0.94 0.51 0.68 -0.71 0.45 -1.17 0.52 59625_at NOL3 8996 -0.95 1.38 -0.82 -0.68 -1.20 1.08 -0.01 0.03 1.18 59631_at TR2 114112 -0.39 -1.36 -1.28 0.38 0.22 -0.34 1.39 1.43 -0.06 59644_at BIKE 55589 -0.24 2.04 -0.33 0.36 0.35 -1.60 0.38 -0.80 -0.15 59697_at -0.37 0.46 0.27 -1.51 0.37 0.27 -0.44 1.96 -1.00 59705_at SCLY 51540 1.07 0.69 -0.42 -0.83 -0.20 1.33 -1.36 -1.06 0.80 48612_at FLJ31821 146268 -0.03 -0.15 0.50 -1.16 1.09 -1.30 -1.04 0.80 1.30 48659_at -1.20 0.27 -0.82 -0.95 0.79 1.40 -1.03 0.83 0.72 48808_at DHFR 1719 -0.21 -1.14 0.12 -1.27 0.26 -0.70 1.26 -0.01 1.69 48825_at ING4 51147 0.14 -1.11 0.47 0.20 -1.34 1.42 -0.97 1.28 -0.09 49049_at 1.27 -0.19 -0.71 -1.78 0.62 -0.97 0.99 0.27 0.49 49051_g_at -0.40 -0.57 -0.72 0.69 2.27 0.07 -0.30 -1.09 0.05

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 49077_at PME-1 51400 -0.97 0.35 -0.49 -1.32 -0.66 0.62 -0.03 0.58 1.93 49329_at FLJ14360 84861 -0.80 1.22 -0.08 -1.42 1.46 0.29 -1.14 -0.08 0.54 49679_s_at MMP24 10893 -1.32 1.04 1.16 -0.62 -0.24 0.33 1.34 -0.84 -0.83 51774_s_at -0.46 0.77 0.98 -1.63 0.86 0.14 -1.52 0.19 0.66 55872_at KIAA1196 57473 -0.64 1.15 0.15 0.14 -1.46 1.63 0.02 -1.15 0.15 56748_at TRIM10 10107 -0.71 -1.81 -0.09 -0.38 1.53 0.33 -0.39 0.43 1.09 58367_s_at FLJ23233 79744 -0.67 -0.08 -0.01 -0.57 0.37 -1.32 -0.62 0.91 2.02 58780_s_at FLJ10357 55701 -0.98 1.89 0.13 -1.03 0.41 0.28 -1.35 0.19 0.43 58900_at -0.10 0.72 0.43 -2.12 0.33 -0.01 -1.03 0.91 0.85 59375_at MYO15B 80022 0.03 -0.51 -0.72 -0.84 -0.86 1.94 0.53 1.11 -0.67 59433_at -0.27 -0.31 -1.19 -1.29 0.45 0.44 -0.55 0.99 1.73

209 59437_at MGC29761 138162 -0.69 0.26 0.44 -1.41 0.39 -1.64 1.00 0.75 0.89 59999_at HIF1AN 55662 -0.65 0.57 -0.54 -0.67 1.97 -1.43 0.43 0.53 -0.19 60084_at CYLD 1540 0.30 0.05 1.03 -0.44 -0.01 -1.49 -1.19 0.03 1.72 60471_at RIN3 79890 -1.88 0.54 0.41 -0.84 0.90 0.48 -0.54 -0.40 1.32 60474_at C20orf42 55612 1.09 0.60 -0.04 -1.13 -0.69 -0.40 -1.41 1.50 0.48 60528_at PLA2G4B 8681 -0.02 -0.53 -0.90 -1.20 1.03 0.45 -1.16 0.92 1.40 60794_f_at 0.04 -0.06 -0.92 0.68 1.82 -1.60 -0.18 -0.46 0.69 60815_at POLR2J 5439 1.30 -0.13 0.08 1.13 -1.31 0.54 -0.70 0.54 -1.47 61297_at CASKIN2 57513 1.33 0.55 -0.92 0.20 0.99 -0.62 -1.37 0.85 -1.00 61732_r_at CMG1 80173 -1.49 -0.29 -0.66 -0.40 0.16 1.36 -0.65 0.35 1.62 61734_at LOC57333 57333 -1.05 -0.09 -1.22 0.30 -0.23 2.18 0.35 0.25 -0.48 61874_at C9orf7 11094 0.02 0.90 -0.46 -1.98 0.00 1.21 -0.89 0.66 0.54 62212_at MGC955 79078 0.56 0.33 -1.30 -1.18 -0.39 0.57 1.36 1.05 -1.00 62987_r_at CACNG4 27092 0.03 -0.58 -0.44 -1.35 -0.85 0.06 0.05 1.32 1.76 63009_at FLJ10539 55164 -1.74 1.59 0.68 -0.63 -0.94 0.01 -0.08 0.65 0.45 63305_at PKNOX2 63876 0.38 -0.31 -0.94 -1.58 -0.42 1.25 -0.50 1.19 0.94

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 63825_at 0.17 0.11 0.06 2.05 0.78 -1.02 -0.19 -1.19 -0.77 64064_at IAN4L1 55340 -1.25 2.00 -1.11 -0.61 0.31 -0.35 0.15 0.17 0.70 64371_at KIAA0365 10147 -0.48 -0.24 0.96 -1.94 1.47 -0.45 -0.32 0.52 0.49 64408_s_at MGC4809 91860 -1.83 -0.17 0.58 -0.11 -0.65 1.30 -0.59 0.17 1.31 64418_at -0.41 0.77 1.09 -0.73 1.03 -1.76 0.90 -0.21 -0.68 64432_at LOC51275 51275 -2.11 -0.53 0.71 0.37 -0.27 0.31 1.47 0.36 -0.32 64438_at FLJ22222 79701 -0.14 -0.35 1.01 0.83 1.80 -1.17 -0.34 -0.84 -0.78 64440_at IL-17RC 84818 0.58 0.27 -2.29 -0.57 0.71 0.63 -0.23 -0.10 1.00 64474_g_at FLJ22127 64790 0.63 1.52 -0.49 -0.03 1.30 -1.64 -0.49 -0.29 -0.50 64486_at CORO1B 57175 -0.30 0.13 -1.09 -0.38 -0.35 1.40 -0.05 -1.13 1.77 64488_at 0.88 0.69 -1.18 1.36 -0.29 0.26 -0.54 -1.66 0.47

210 64883_at MGC26706 158747 -1.06 0.70 0.22 -1.24 0.65 0.97 -1.41 -0.03 1.18 64899_at FLJ13055 64748 -0.61 1.11 -0.16 1.75 0.76 -0.78 -0.31 -0.43 -1.32 64900_at FLJ22167 79583 -1.73 0.13 1.45 0.63 -0.24 1.02 -0.86 0.29 -0.70 64942_at 0.46 0.72 1.40 0.44 0.77 -0.28 -0.93 -1.61 -0.96 65086_at MGC3262 78992 -0.01 -1.39 -1.15 0.08 -0.23 0.11 0.22 0.23 2.13 65133_i_at PAPA-1 83444 -1.33 1.55 0.88 -0.41 0.26 -0.25 -0.72 1.05 -1.04 65438_at KIAA1609 57707 -1.48 -0.14 0.20 -0.51 0.21 2.17 -0.74 0.35 -0.05 65472_at 1.23 0.69 0.92 -0.78 -1.13 -0.71 -1.07 -0.34 1.20 65493_at FLJ22087 63897 -1.06 -0.03 0.05 -1.32 -0.32 1.31 -0.73 0.58 1.54 65517_at AP1M2 10053 1.25 1.05 -0.43 -1.04 0.88 -1.53 0.50 -0.78 0.10 65521_at LOC51619 51619 -0.81 0.54 -0.70 -1.46 1.04 0.94 -0.55 1.38 -0.38 65585_at -0.81 1.76 -1.24 -0.82 1.12 -0.13 -0.63 0.29 0.48 65588_at 0.93 0.44 -0.53 1.44 0.62 -1.54 0.19 -0.27 -1.28 65591_at KIAA1449 57599 -1.46 1.59 -0.25 -0.99 -0.02 -0.86 0.78 0.32 0.89 65630_at -0.65 0.47 1.50 0.41 -1.46 0.02 0.58 -1.44 0.56 65635_at FLJ21865 64772 -0.94 -0.63 -0.23 -1.08 0.67 0.19 -0.54 0.47 2.10

Table D-1. Continued. Probe Set Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID ID 6 15 24 6 15 24 6 15 24 65718_at TEM5 25960 -0.07 -0.29 0.89 -1.27 -1.09 0.20 -0.89 0.95 1.58 65770_at MIRO-2 89941 0.14 -0.73 -0.69 -1.05 -0.50 1.62 0.05 -0.48 1.64 65884_at MAN1B1 11253 -1.41 -0.06 -0.63 -0.04 -0.17 2.01 -0.23 -0.51 1.06 66053_at DKFZp762N1910 221092 -1.27 0.15 0.01 -0.36 -1.08 0.29 -0.64 1.09 1.82 71933_at 0.01 0.06 0.98 -1.64 -0.62 0.27 -1.17 1.40 0.69 74694_s_at FRA 79874 -0.98 0.15 0.24 -1.71 0.03 -0.55 1.67 0.93 0.21 76897_s_at -0.99 0.38 0.27 -0.96 0.82 0.49 -1.82 0.94 0.85 79005_at FLJ14251 79939 -0.49 0.19 -0.97 -0.99 1.46 0.79 -1.21 -0.01 1.23 81737_at -0.55 0.01 -0.61 -0.50 -0.57 1.25 -0.53 -0.61 2.12 77508_r_at FRA 79874 -0.60 0.60 -0.62 -1.59 0.06 1.46 -0.72 1.28 0.13 78047_s_at MMP24 10893 0.91 0.47 -0.99 0.10 -2.02 -0.18 -0.15 0.84 1.02

211 78330_at ZNF335 63925 0.74 0.08 -1.53 -1.13 -0.87 1.56 0.28 0.18 0.67 78383_at 1.86 -0.30 0.02 0.66 0.27 -1.15 -0.20 0.39 -1.54 78495_at DKFZp762P2111 55537 0.91 -1.27 0.32 1.07 -1.15 1.13 -0.27 -1.18 0.43 81811_at -1.87 -0.45 -0.32 0.29 0.09 1.09 0.94 -0.86 1.10 87100_at 0.14 0.74 0.52 1.87 0.36 -0.79 -0.70 -0.86 -1.27 89476_r_at NPEPL1 79716 0.05 -1.39 -0.84 0.31 -1.16 1.04 -0.31 1.19 1.11 89948_at C20orf67 63935 0.11 -0.34 0.66 -1.28 -0.44 -0.76 -0.84 1.25 1.64 89977_at FLJ20581 54988 -0.43 -0.33 -0.90 -0.70 0.27 2.25 -0.86 0.02 0.68 90265_at CENTA1 11033 1.05 2.00 -0.18 -0.71 0.17 -0.13 -0.89 -0.09 -1.20 90610_at LRRN1 4034 -0.59 1.32 -1.52 -0.54 -0.12 0.60 -0.98 0.62 1.23 91580_at HT017 57408 1.69 -0.20 -0.55 0.07 -0.06 -0.07 0.88 -1.98 0.23 91617_at FLJ22127 64790 0.13 0.80 -1.46 -0.09 0.56 -1.72 0.36 1.30 0.10 91682_at FLJ20591 54512 -1.66 1.87 -0.02 -1.07 -0.10 0.66 0.03 -0.05 0.33 91684_g_at FLJ20591 54512 0.77 0.82 -1.80 0.33 -0.19 -0.41 1.31 0.31 -1.15 91703_at DKFZp762C186 254102 -0.55 1.18 -0.67 -1.30 0.09 1.77 0.20 -0.94 0.21 91816_f_at 0.30 1.89 -1.38 -0.40 0.22 -1.06 -0.38 -0.12 0.93

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 91826_at EPS8R1 54869 -0.85 -0.40 -1.23 1.33 0.92 -0.54 -0.76 1.43 0.10 91920_at BCAN 63827 -0.95 -0.79 -0.58 -0.93 -0.03 1.75 1.01 -0.43 0.97 91952_at LOC90379 90379 -0.58 2.17 -0.35 0.58 0.76 -0.56 -0.99 -0.62 -0.40 200593_s_at HNRPU 3192 0.08 -1.86 -0.20 1.44 -0.23 0.39 1.05 0.30 -0.98 200594_x_at HNRPU 3192 -0.39 1.76 -0.36 -0.15 1.62 -1.03 -0.39 -0.81 -0.21 200595_s_at EIF3S10 8661 0.33 0.44 0.73 1.69 0.17 -0.63 -0.02 -1.61 -1.11 200596_s_at EIF3S10 8661 -0.07 0.03 0.89 1.19 -0.02 -2.00 0.87 -0.97 0.08 200597_at -1.01 -0.31 1.03 -1.66 1.33 0.96 -0.20 0.28 -0.43 200598_s_at TRA1 7184 -1.14 -0.05 1.32 -0.84 0.84 0.62 -1.64 0.51 0.37 200599_s_at TRA1 7184 -1.37 0.54 -0.07 0.09 1.34 1.49 -1.05 -0.22 -0.75 200600_at MSN 4478 0.76 1.54 -1.21 0.78 0.49 -0.18 -0.02 -1.47 -0.69

212 200601_at ACTN4 81 -2.15 0.26 -0.98 -0.22 0.73 0.11 0.88 0.60 0.75 200602_at APP 351 0.54 0.65 -0.71 1.64 0.87 -0.99 0.13 -0.99 -1.14 200603_at PRKAR1A 5573 -0.75 -1.19 1.17 1.52 -0.16 0.93 -1.13 -0.08 -0.30 200604_s_at PRKAR1A 5573 -0.76 -1.21 0.19 0.26 -0.25 1.61 -1.17 -0.01 1.33 200605_s_at PRKAR1A 5573 -1.04 0.02 1.83 -0.57 -0.45 1.16 -1.13 -0.30 0.49 200606_at DSP 1832 1.22 -0.23 0.46 1.65 -0.48 -0.37 -1.12 -1.34 0.22 200607_s_at RAD21 5885 0.03 -1.55 0.41 0.08 2.04 0.17 -0.80 -0.69 0.30 200608_s_at RAD21 5885 0.84 1.39 1.24 -0.11 -0.93 0.13 -1.44 -0.85 -0.27 200609_s_at WDR1 9948 -0.28 -0.75 -0.75 -1.26 -0.48 0.09 0.52 1.89 1.03 200610_s_at NCL 4691 0.61 -1.33 0.72 -0.13 0.06 -0.80 1.35 0.92 -1.40 200611_s_at WDR1 9948 -1.62 -0.03 -0.13 -0.92 0.16 1.56 -0.21 -0.18 1.39 200612_s_at AP2B1 163 0.18 0.37 -0.42 -1.12 0.56 0.03 -1.79 0.63 1.55 200613_at AP2M1 1173 0.94 0.37 0.75 -1.53 1.10 0.41 -1.20 -1.07 0.20 200614_at CLTC 1213 -0.53 0.13 -0.54 -1.15 -0.83 0.88 -0.48 2.02 0.50 200615_s_at AP2B1 163 -0.66 -1.48 -0.66 0.58 -0.78 1.32 -0.28 0.70 1.26 200616_s_at KIAA0152 9761 -0.60 1.43 0.59 1.16 0.65 -0.20 -0.63 -0.99 -1.40

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200617_at KIAA0152 9761 -0.78 0.74 -1.28 -0.61 0.13 0.83 -0.16 -0.73 1.87 200618_at LASP1 3927 -0.58 0.96 -1.33 -1.67 0.54 0.40 0.16 0.25 1.26 200619_at 0.58 -0.31 -0.51 -0.25 -2.19 0.77 0.69 1.14 0.09 200620_at C1orf8 9528 0.41 -1.57 -0.02 0.44 -1.49 0.07 1.49 0.81 -0.16 200621_at CSRP1 1465 -1.25 -0.09 -1.11 -1.12 0.37 0.85 0.01 1.56 0.79 200622_x_at CALM3 808 1.24 -0.29 -0.25 1.39 -1.91 0.29 -0.46 -0.44 0.44 200623_s_at CALM3 808 -0.75 0.63 -1.11 0.87 0.86 1.41 -0.56 -1.39 0.04 200624_s_at MATR3 9782 0.85 -1.19 1.38 1.29 -0.67 0.30 -0.53 -0.26 -1.16 200625_s_at CAP 10487 -1.39 -0.70 -0.45 -0.87 -0.10 1.70 0.01 0.83 0.98 200626_s_at MATR3 9782 0.66 1.17 -0.26 1.46 0.41 -0.97 -0.22 -1.48 -0.76 200627_at TEBP 10728 1.60 -0.22 1.01 0.81 -0.11 -1.13 -0.06 -0.41 -1.48

213 200628_s_at WARS 7453 -1.13 -0.26 -0.19 -0.88 -1.28 1.28 0.43 0.67 1.37 200629_at WARS 7453 -0.07 0.75 -0.45 0.16 -1.10 -0.25 2.20 -0.22 -1.00 200630_x_at SET 6418 -0.28 -1.23 -0.24 -1.65 0.01 0.34 0.73 1.50 0.81 200631_s_at SET 6418 0.02 0.62 -1.52 -1.42 1.45 -0.49 0.87 0.31 0.15 200632_s_at NDRG1 10397 0.89 -0.79 -0.02 1.85 -1.26 0.06 0.34 -1.17 0.11 200633_at UBB 7314 -0.72 -1.11 0.68 -0.73 -1.42 0.32 1.28 0.77 0.92 200634_at PFN1 5216 -1.38 -0.76 -0.61 -0.23 -0.38 1.60 1.50 0.20 0.08 200635_s_at PTPRF 5792 1.31 1.55 -0.47 -1.01 0.31 -1.14 -0.76 -0.41 0.63 200636_s_at PTPRF 5792 1.84 0.04 -0.51 -0.99 -0.10 -0.97 1.44 -0.31 -0.42 200637_s_at PTPRF 5792 0.92 0.08 -0.79 1.81 0.07 -1.64 0.30 -0.61 -0.14 200638_s_at YWHAZ 7534 -1.48 0.03 -0.53 -0.22 1.52 0.21 -0.22 1.52 -0.83 200639_s_at YWHAZ 7534 -0.48 -1.32 -0.30 -0.32 0.02 -0.18 0.12 2.39 0.07 200640_at YWHAZ 7534 -0.51 -0.28 -0.27 -1.22 -0.24 1.39 -0.98 1.71 0.41 200641_s_at YWHAZ 7534 -0.69 -1.12 0.24 -1.13 0.45 0.76 -0.94 1.55 0.89 200642_at SOD1 6647 -0.46 0.35 0.04 -0.52 -0.59 -1.03 0.83 2.15 -0.76 200643_at HDLBP 3069 -0.73 0.01 -1.82 0.08 -0.61 0.67 0.74 0.00 1.65

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200644_at MLP 65108 -0.61 1.76 1.12 -1.33 -0.14 -0.65 0.54 -0.83 0.16 200645_at GABARAP 11337 0.22 -1.23 0.17 1.47 -0.12 -0.48 1.33 0.11 -1.48 200646_s_at NUCB1 4924 0.37 0.42 -0.42 1.84 0.97 -0.66 -0.29 -1.36 -0.87 200647_x_at EIF3S8 8663 -0.93 -0.51 0.22 0.42 -1.32 -0.32 1.31 -0.52 1.66 200648_s_at GLUL 2752 -1.67 0.20 1.82 -0.08 0.67 0.22 -1.09 0.22 -0.30 200649_at NUCB1 4924 0.71 1.08 -1.02 1.09 0.53 -0.35 0.22 -1.84 -0.42 200650_s_at LDHA 3939 -1.17 -0.48 -0.27 -1.26 -0.39 1.74 0.32 0.41 1.10 200651_at GNB2L1 10399 0.60 -0.65 -0.25 1.28 0.10 -1.05 1.57 -0.23 -1.35 200652_at SSR2 6746 0.54 -0.51 1.27 0.00 -0.35 -1.52 1.32 0.44 -1.19 200653_s_at CALM1 801 -1.69 0.33 -0.44 -0.49 0.73 1.56 0.48 -1.02 0.53 200654_at P4HB 5034 -0.91 -0.64 -0.39 -0.26 -1.00 0.36 1.33 -0.33 1.86

214 200655_s_at CALM1 801 -2.16 -0.16 0.61 -0.02 -0.35 0.90 1.01 -0.59 0.75 200656_s_at P4HB 5034 0.73 0.83 -0.50 1.09 -0.18 -0.24 -1.47 -1.35 1.10 200657_at SLC25A5 292 -0.59 -0.81 0.49 -0.16 -1.94 0.94 0.24 1.28 0.56 200658_s_at PHB 5245 -1.42 -0.59 -0.59 -1.33 0.62 0.87 1.24 0.72 0.48 200659_s_at PHB 5245 -0.22 -0.56 -0.08 -1.07 1.25 1.46 -1.55 0.52 0.25 200660_at S100A11 6282 -0.97 -0.92 -0.19 -1.02 -0.90 1.08 0.98 1.30 0.64 200661_at PPGB 5476 0.20 0.01 1.08 0.60 -0.49 -0.73 1.19 -2.04 0.17 200662_s_at TOMM20 9804 1.04 1.05 0.30 0.85 0.51 -1.04 -0.07 -1.12 -1.52 200663_at CD63 967 -0.25 -0.72 -0.80 -1.61 -0.39 0.82 0.80 1.48 0.68 200664_s_at DNAJB1 3337 0.03 0.06 0.76 -1.07 1.07 -0.95 -1.60 0.54 1.14 200665_s_at SPARC 6678 1.16 -0.54 -1.04 1.19 -0.40 -0.21 1.44 -1.13 -0.46 200666_s_at DNAJB1 3337 -0.18 1.13 1.28 -0.53 1.24 -0.75 -0.97 0.07 -1.29 200667_at UBE2D3 7323 1.65 0.07 0.85 0.82 -0.69 -1.03 0.36 -1.18 -0.86 200668_s_at UBE2D3 7323 1.42 -0.64 0.92 -0.57 -0.97 -1.42 1.16 0.04 0.05 200669_s_at UBE2D3 7323 1.37 -1.36 1.13 0.78 -0.77 -0.52 0.53 -1.07 -0.08 200670_at XBP1 7494 0.49 0.40 -0.94 -0.50 1.76 -1.50 0.62 0.39 -0.72

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200671_s_at -0.51 -0.62 -1.11 1.00 -0.73 -0.71 1.72 1.03 -0.05 200672_x_at SPTBN1 6711 -0.06 0.01 -1.17 1.46 0.80 -1.67 0.72 -0.52 0.43 200673_at LAPTM4A 9741 0.69 0.23 -0.33 2.23 -0.62 -0.44 -0.09 -0.39 -1.25 200674_s_at RPL32 6161 -0.46 -1.08 -0.42 -0.18 -0.43 0.92 1.74 1.04 -1.11 200675_at CD81 975 -0.14 1.05 0.67 0.09 -0.99 0.62 1.15 -0.67 -1.79 200676_s_at UBE2L3 7332 -0.99 2.10 0.09 -0.09 0.83 -1.31 -0.18 -0.19 -0.23 200677_at PTTG1IP 754 -0.97 -1.33 -0.60 -0.52 -0.27 0.32 1.56 0.48 1.33 200678_x_at GRN 2896 -0.40 -1.21 -0.59 -0.68 -1.10 1.14 0.48 1.14 1.22 200679_x_at HMGB1 3146 -1.86 -0.09 1.43 -0.63 0.52 0.69 0.18 -0.89 0.66 200680_x_at HMGB1 3146 -1.82 0.08 0.42 0.69 0.85 1.40 -0.77 -0.82 -0.02 200681_at GLO1 2739 -0.46 -0.38 -0.67 0.00 -0.81 1.09 0.58 -1.21 1.86

215 200682_s_at 0.06 -0.01 -0.16 -0.02 -0.85 -0.75 1.32 1.76 -1.34 200683_s_at UBE2L3 7332 1.05 -0.41 0.83 0.79 -1.76 -1.25 -0.17 0.12 0.80 200684_s_at UBE2L3 7332 -0.95 1.72 -0.38 -1.17 0.73 -1.02 -0.14 0.28 0.94 200685_at SFRS11 9295 -0.70 0.83 0.97 -0.21 -0.72 1.23 -0.19 -1.82 0.61 200686_s_at SFRS11 9295 -1.29 1.85 0.06 -1.11 0.10 0.20 -0.93 0.38 0.73 200687_s_at SF3B3 23450 -0.48 2.34 -0.52 -0.81 0.22 -0.53 -0.73 -0.12 0.66 200688_at SF3B3 23450 0.55 -0.12 0.01 0.06 -0.22 0.73 -0.64 -2.00 1.63 200689_x_at EEF1G 1937 0.92 -1.49 1.06 0.17 -1.69 -0.06 0.76 0.49 -0.18 200690_at HSPA9B 3313 1.02 -0.46 -1.62 -0.08 -0.24 -1.24 1.17 0.65 0.80 200691_s_at HSPA9B 3313 1.13 0.59 -0.15 1.47 -0.30 -1.07 0.34 -1.63 -0.37 200692_s_at HSPA9B 3313 0.64 -0.16 -0.03 0.57 -0.83 -0.70 -0.28 -1.27 2.08 200693_at YWHAQ 10971 -0.67 -1.05 -0.40 -1.03 -0.48 1.34 -0.14 0.97 1.48 200694_s_at DDX24 57062 0.34 -0.02 1.31 0.15 -0.56 -0.99 0.45 -1.82 1.13 200695_at PPP2R1A 5518 -0.40 -0.35 -2.08 0.01 -0.01 1.31 -0.21 0.65 1.08 200696_s_at GSN 2934 -0.87 -1.20 -1.13 0.31 0.05 1.51 0.77 -0.53 1.09 200697_at HK1 3098 -1.13 0.59 -0.85 -1.41 -0.07 1.12 1.37 -0.26 0.64

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200698_at KDELR2 11014 1.57 -0.02 -0.50 1.63 0.04 -0.93 0.03 -1.02 -0.80 200699_at MGC16723 255042 1.33 -0.34 0.00 1.21 -0.04 -1.92 0.58 -0.05 -0.75 200700_s_at KDELR2 11014 0.24 -0.98 1.26 1.78 -0.61 -0.02 0.13 -0.64 -1.16 200701_at NPC2 10577 -0.85 -0.96 -0.13 -0.46 -1.20 1.87 0.38 0.84 0.51 200702_s_at DDX24 57062 0.46 -0.86 0.41 0.46 1.03 -1.80 1.13 0.15 -1.00 200703_at DNCL1 8655 0.56 -0.96 -0.60 0.10 0.51 -1.08 -0.27 2.16 -0.41 200704_at PIG7 9516 0.72 -0.66 1.84 0.61 -1.29 -0.68 0.45 -0.04 -0.94 200705_s_at EEF1B2 1933 1.16 -1.87 0.19 -0.26 -0.09 0.03 1.14 0.75 -1.05 200706_s_at PIG7 9516 0.58 -1.30 0.13 1.94 -0.43 0.16 0.12 -1.37 0.16 200707_at PRKCSH 5589 0.51 0.95 0.26 1.29 0.68 -0.37 -0.63 -0.89 -1.80 200708_at GOT2 2806 -1.74 0.58 0.38 -0.52 -0.29 1.49 -1.03 0.31 0.83

216 200709_at FKBP1A 2280 -1.46 0.30 -0.31 1.62 0.82 0.91 -1.07 -0.50 -0.31 200710_at ACADVL 37 0.82 -0.82 1.03 1.18 0.05 -0.68 0.84 -1.14 -1.29 200711_s_at SKP1A 6500 0.42 0.52 0.01 -0.98 1.90 -0.59 0.47 -0.24 -1.52 200712_s_at MAPRE1 22919 -0.26 -1.28 1.54 0.17 -0.32 0.89 -1.48 0.85 -0.12 200713_s_at MAPRE1 22919 0.36 -0.59 -0.06 0.69 -1.75 -0.43 1.93 -0.01 -0.13 200714_x_at OS-9 10956 -0.67 0.76 0.10 0.42 0.11 0.07 -0.68 -1.83 1.70 200715_x_at RPL13A 23521 1.46 -0.66 0.12 -0.03 -1.14 -0.89 1.67 0.13 -0.67 200716_x_at RPL13A 23521 0.65 -1.58 0.17 -0.01 -1.00 -0.45 1.79 0.70 -0.27 200717_x_at RPL7 6129 0.09 -1.79 -0.65 0.67 -0.32 0.09 1.58 0.93 -0.60 200718_s_at SKP1A 6500 1.07 -0.34 0.15 -1.45 1.85 -0.25 -0.08 0.08 -1.02 200719_at SKP1A 6500 0.29 0.67 1.28 -0.20 1.02 -1.77 -0.36 0.22 -1.17 200720_s_at ACTR1A 10121 -0.93 -0.42 -0.22 -1.01 0.40 1.47 -0.48 -0.53 1.73 200721_s_at ACTR1A 10121 -0.66 0.36 -1.48 -1.01 0.76 0.79 -0.57 0.20 1.60 200722_s_at M11S1 4076 -0.27 -0.18 0.90 -1.60 0.36 0.37 -1.45 0.51 1.36 200723_s_at M11S1 4076 -0.74 1.03 -0.92 -0.96 0.53 -1.17 -0.14 1.10 1.28 200724_at RPL10 6134 0.10 0.60 -0.01 -0.42 -0.05 0.66 -1.20 -1.49 1.81

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200725_x_at RPL10 6134 0.57 -1.73 0.03 -0.42 -1.27 0.28 1.01 1.31 0.21 200726_at PPP1CC 5501 -1.01 0.19 1.67 -0.63 -0.43 -0.34 0.03 1.53 -1.01 200727_s_at ACTR2 10097 -0.93 -0.73 -0.43 -1.17 0.46 1.72 -0.49 1.19 0.39 200728_at 0.18 -1.31 -0.68 -0.39 -0.43 0.51 -0.48 0.44 2.17 200729_s_at ACTR2 10097 -0.25 -1.39 0.01 -0.56 1.01 0.02 -0.80 1.99 -0.02 200730_s_at PTP4A1 7803 -0.16 -0.36 -0.79 0.13 0.23 1.74 -1.86 0.62 0.45 200731_s_at PTP4A1 7803 -0.59 0.83 -0.24 0.01 2.31 -0.65 -0.89 -0.44 -0.33 200732_s_at PTP4A1 7803 0.10 1.95 -0.78 -0.23 1.09 -1.15 -0.73 0.29 -0.55 200733_s_at PTP4A1 7803 0.75 -0.08 -0.55 0.50 1.60 0.36 -0.85 0.09 -1.84 200734_s_at ARF3 377 -0.82 1.46 -0.45 -1.61 0.12 -0.28 1.25 -0.40 0.72 200735_x_at NACA 4666 0.68 -0.43 0.18 0.78 -0.47 -0.87 1.75 -0.02 -1.61

217 200736_s_at GPX1 2876 -0.54 -0.48 0.20 -0.81 -1.85 0.71 1.30 0.66 0.81 200737_at PGK1 5230 -1.11 0.04 0.12 -1.56 -0.18 1.55 -0.08 -0.12 1.34 200738_s_at PGK1 5230 -1.38 -0.37 0.15 -1.09 -0.59 1.71 0.11 0.33 1.14 200739_s_at SMT3H1 6612 -1.29 0.60 2.06 -0.61 0.27 0.58 -0.69 -0.42 -0.50 200740_s_at SMT3H1 6612 -0.41 1.64 0.58 -0.67 1.48 -0.60 -0.69 -1.09 -0.22 200741_s_at RPS27 6232 0.62 -0.75 -0.06 0.08 -0.32 -0.97 0.69 1.97 -1.26 200742_s_at CLN2 1200 -0.70 0.48 -0.09 -0.16 1.35 0.56 -1.53 -1.11 1.21 200743_s_at CLN2 1200 -0.61 -1.72 0.13 0.65 -1.02 0.63 1.38 -0.29 0.84 200744_s_at GNB1 2782 -0.34 -1.76 1.38 0.31 -0.86 1.17 0.43 -0.58 0.25 200745_s_at GNB1 2782 -0.58 0.13 1.60 -0.62 1.33 -0.30 -1.58 -0.36 0.39 200746_s_at GNB1 2782 0.41 1.04 1.54 0.28 -0.20 -0.62 0.24 -1.57 -1.13 200747_s_at NUMA1 4926 0.77 -0.04 -0.92 0.41 0.22 -0.60 1.84 -1.58 -0.08 200748_s_at FTH1 2495 -0.75 -0.84 -0.35 -0.67 -0.84 2.02 -0.12 0.93 0.63 200749_at RAN 5901 0.15 1.33 -0.34 0.01 1.43 -1.38 0.09 0.14 -1.43 200750_s_at RAN 5901 -1.57 -0.12 -0.44 -0.99 -0.67 1.01 0.61 1.26 0.92 200751_s_at HNRPC 3183 1.31 -0.11 1.15 1.36 -0.52 -0.48 -0.98 -1.03 -0.70

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200752_s_at CAPN1 823 -0.67 0.08 -0.40 0.31 -0.35 1.64 -0.84 -1.25 1.48 200753_x_at SFRS2 6427 0.79 -0.88 0.10 -0.96 0.79 -0.95 0.38 1.72 -0.99 200754_x_at SFRS2 6427 1.66 -1.04 0.34 0.06 0.48 -1.17 0.93 -0.06 -1.22 200755_s_at CALU 813 -0.41 -0.13 0.72 0.27 -1.43 0.90 -0.74 -0.90 1.72 200756_x_at CALU 813 -0.24 -1.05 1.66 0.46 -1.05 -0.03 -0.89 -0.20 1.36 200757_s_at CALU 813 -0.24 -0.51 -1.07 1.37 -0.30 0.84 -0.46 -1.13 1.52 200758_s_at NFE2L1 4779 -0.88 1.26 -1.17 0.20 -1.05 1.61 0.52 -0.45 -0.04 200759_x_at NFE2L1 4779 -1.76 0.58 0.21 1.17 0.98 -0.74 -0.47 -0.81 0.83 200760_s_at JWA 10550 -0.33 1.11 0.86 -1.39 -0.64 1.47 -1.02 -0.40 0.35 200761_s_at JWA 10550 -0.02 0.73 0.80 0.13 -1.34 -1.39 1.56 0.25 -0.72 200762_at DPYSL2 1808 -0.38 2.19 0.15 -0.53 -1.13 0.47 0.20 -1.07 0.11

218 200763_s_at RPLP1 6176 -0.32 -0.09 0.84 -0.94 -1.47 1.37 0.36 1.14 -0.88 200764_s_at MAGED1 9500 -0.65 -0.58 -0.92 0.23 -1.32 0.83 -0.24 0.99 1.67 200765_x_at MAGED1 9500 0.33 -0.92 0.27 0.72 -1.20 0.71 0.28 -1.57 1.37 200766_at CTSD 1509 0.02 -0.71 -1.27 0.35 -0.66 2.27 -0.17 0.28 -0.09 200767_s_at C9orf10 23196 -0.46 -0.87 -0.67 -0.14 1.42 1.00 -1.60 0.57 0.77 200768_s_at MAT2A 4144 1.33 -0.78 0.16 1.76 -0.66 -0.75 0.48 -0.79 -0.75 200769_s_at MAT2A 4144 1.54 -1.00 1.15 1.10 -0.52 -1.00 -0.06 -0.51 -0.68 200770_s_at LAMC1 3915 0.58 0.93 -0.14 1.50 -0.28 -1.69 0.01 0.29 -1.20 200771_at LAMC1 3915 0.70 1.24 -0.53 0.29 -0.40 -1.16 1.00 0.52 -1.65 200772_x_at PTMA 5757 -2.00 -0.11 -0.06 -0.65 0.36 1.47 -0.14 1.09 0.05 200773_x_at PTMA 5757 -1.39 0.33 -0.69 -1.04 -0.49 1.36 -0.17 1.02 1.08 200774_at C9orf10 23196 -0.75 2.02 -0.70 -0.13 0.57 0.50 0.47 -1.03 -0.95 200775_s_at HNRPK 3190 1.32 1.52 -0.37 0.33 0.49 -0.77 -0.30 -0.77 -1.46 200776_s_at BZW1 9689 0.46 -0.56 -0.47 1.88 0.22 -1.37 0.88 -0.08 -0.97 200777_s_at BZW1 9689 1.83 -1.17 -0.60 1.29 -0.48 -0.91 0.03 0.28 -0.26 200778_s_at NEDD5 4735 -1.00 -0.68 0.69 -1.24 0.55 0.82 -1.08 0.50 1.44

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200779_at ATF4 468 1.73 -1.10 0.63 1.20 -0.77 -0.72 0.17 -0.31 -0.82 200780_x_at GNAS 2778 -0.69 -1.33 0.23 -0.46 -1.27 1.53 0.55 0.48 0.96 200781_s_at RPS15A 6210 0.52 -1.70 0.72 0.89 0.15 -0.59 0.72 0.70 -1.44 200782_at ANXA5 308 -0.37 -1.17 0.27 -1.34 -1.00 0.92 0.64 1.32 0.73 200783_s_at STMN1 3925 1.15 -0.18 1.19 -0.64 -0.52 0.17 1.24 -1.16 -1.25 200784_s_at ZNF258 9204 -0.20 1.01 -1.83 0.83 1.19 0.54 -0.94 -0.14 -0.46 200785_s_at LRP1 4035 1.04 -0.51 -0.23 0.92 1.38 0.01 -0.14 -0.64 -1.83 200786_at PSMB7 5695 1.33 1.15 -0.56 0.72 -0.59 -1.00 -0.92 0.88 -1.00 200787_s_at PEA15 8682 -1.16 0.84 -0.97 -1.17 0.20 1.14 -0.63 0.48 1.27 200788_s_at PEA15 8682 -1.28 1.05 -0.90 -1.13 -0.03 0.59 0.73 1.43 -0.45 200789_at ECH1 1891 0.98 -1.22 0.64 0.75 -0.70 -0.17 1.41 -0.31 -1.38

219 200790_at ODC1 4953 -0.99 1.90 -0.71 -1.09 1.21 -0.09 -0.29 0.22 -0.16 200791_s_at IQGAP1 8826 0.39 -0.79 -1.17 -1.02 -0.89 0.86 1.56 0.20 0.86 200792_at G22P1 2547 -0.57 -0.62 -1.08 -1.21 -0.30 0.87 0.32 0.92 1.67 200793_s_at ACO2 50 -1.32 -0.30 -0.07 -0.67 0.31 -0.97 0.43 0.56 2.03 200794_x_at DAZAP2 9802 1.13 -0.16 0.56 0.75 -1.34 -1.18 0.59 0.86 -1.21 200795_at SPARCL1 8404 -1.16 0.31 1.39 -1.83 -0.06 1.09 0.09 0.02 0.14 200796_s_at MCL1 4170 0.95 -2.16 1.13 -0.62 0.41 -0.22 -0.34 0.47 0.37 200797_s_at MCL1 4170 0.94 -0.29 -0.41 0.87 -1.24 -0.59 1.87 -0.59 -0.55 200798_x_at MCL1 4170 2.05 -0.58 0.01 0.97 -0.52 -0.52 0.43 -0.73 -1.09 200799_at HSPA1A 3303 0.40 1.40 0.85 0.72 0.39 -1.21 -0.78 -0.28 -1.50 200800_s_at HSPA1A 3303 -0.04 -0.88 -0.26 -0.03 0.36 -0.96 -0.28 2.42 -0.30 200801_x_at ACTB 60 -0.63 -0.87 -0.38 -0.76 -0.88 2.00 -0.05 0.78 0.82 200802_at SARS 6301 -0.59 -1.31 -0.64 -0.77 -0.36 1.04 0.13 0.76 1.75 200803_s_at TEGT 7009 0.19 -1.39 1.02 -0.20 -1.61 0.96 0.16 -0.26 1.12 200804_at TEGT 7009 0.16 -0.76 -0.37 -0.30 0.42 2.15 0.55 -1.31 -0.53 200805_at C5orf8 10960 -0.38 -1.43 -1.56 0.52 0.30 1.09 1.33 0.09 0.01

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200806_s_at HSPD1 3329 -1.09 -0.43 1.14 -0.96 -0.55 0.94 -0.67 -0.01 1.65 200807_s_at HSPD1 3329 -1.36 1.46 -0.29 -0.95 -0.68 -0.63 1.06 0.72 0.67 200808_s_at ZYX 7791 -1.22 0.84 -1.23 0.01 1.06 1.56 -0.40 -0.71 0.09 200809_x_at RPL12 6136 0.81 -1.41 -0.42 0.68 -0.66 -0.45 1.35 1.10 -0.99 200810_s_at CIRBP 1153 0.58 -0.64 0.98 0.68 -0.41 -1.35 1.63 -0.87 -0.59 200811_at CIRBP 1153 0.74 -1.07 1.42 0.18 0.00 -0.74 0.87 0.27 -1.68 200812_at CCT7 10574 0.25 -0.45 -0.18 -0.76 -0.07 -1.78 0.95 0.36 1.69 200813_s_at PAFAH1B1 5048 -0.18 1.56 -1.23 -0.22 1.74 -0.69 -0.06 -0.44 -0.45 200814_at PSME1 5720 0.89 -1.30 -0.24 -1.76 -0.40 0.74 0.41 0.70 0.95 200815_s_at PAFAH1B1 5048 0.66 -0.97 -0.09 1.44 -0.29 1.10 0.55 -1.30 -1.09 200816_s_at PAFAH1B1 5048 0.01 0.65 -1.05 -0.58 1.22 -1.04 0.57 1.37 -1.14

220 200817_x_at RPS10 6204 -0.18 -1.42 0.32 0.01 -1.49 1.06 1.25 0.86 -0.40 200818_at ATP5O 539 -0.26 -0.72 0.47 1.14 -0.42 0.49 1.38 -0.21 -1.86 200819_s_at RPS15 6209 -0.23 -1.67 -0.46 -0.42 -0.85 0.59 1.43 1.19 0.42 200820_at PSMD8 5714 -0.35 0.36 -1.31 0.76 -0.53 -1.10 1.66 0.97 -0.46 200821_at LAMP2 3920 1.38 1.56 -0.87 -0.45 0.43 0.34 -1.04 -0.25 -1.08 200822_x_at -1.13 0.24 -0.12 -1.35 -0.30 1.44 0.24 -0.53 1.51 200823_x_at RPL29 6159 0.90 -0.90 1.03 0.28 -1.38 -0.17 1.03 0.55 -1.36 200824_at GSTP1 2950 -0.40 1.72 -0.95 0.25 -0.12 -1.15 1.25 0.32 -0.92 200825_s_at HYOU1 10525 -0.94 1.34 -1.39 -1.08 0.93 0.65 0.87 -0.04 -0.34 200826_at SNRPD2 6633 0.16 0.57 -0.17 -0.03 -0.57 -0.86 2.05 0.32 -1.48 200827_at PLOD 5351 -1.58 -0.59 0.35 -0.72 -0.24 0.89 -0.30 0.34 1.84 200828_s_at ZNF207 7756 0.94 -0.73 0.14 -0.14 -0.48 -0.85 0.81 1.71 -1.39 200829_x_at ZNF207 7756 0.70 0.87 -0.05 0.91 0.17 -1.28 0.56 0.08 -1.97 200830_at PSMD2 5708 -1.21 0.27 -0.33 0.27 -1.35 0.72 -0.26 -0.08 1.95 200831_s_at SCD 6319 -1.33 -0.92 -0.14 0.67 -0.68 0.71 -0.33 0.09 1.93 200832_s_at SCD 6319 -0.16 1.67 -0.72 1.08 0.49 0.08 -0.27 -1.70 -0.46

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200833_s_at RAP1B 5908 -0.13 2.35 0.05 0.22 -0.32 -0.96 -0.03 -0.03 -1.15 200834_s_at RPS21 6227 1.06 -0.87 0.23 0.35 -0.49 0.00 1.37 0.26 -1.92 200835_s_at MAP4 4134 -0.07 1.23 1.71 -0.72 -1.00 -0.86 -0.56 0.80 -0.51 200836_s_at MAP4 4134 0.92 1.49 -1.16 -0.19 0.77 -0.51 -1.52 -0.27 0.47 200837_at BCAP31 10134 0.52 -2.13 -0.02 0.09 -0.95 0.49 0.71 1.22 0.05 200838_at CTSB 1508 -0.76 -0.75 -0.41 -0.70 -0.96 1.86 -0.14 0.94 0.93 200839_s_at CTSB 1508 -0.83 -0.94 -0.07 -0.47 -0.95 2.12 -0.02 0.72 0.46 200840_at KARS 3735 -0.41 0.81 0.02 0.17 1.67 -1.73 0.37 0.16 -1.06 200841_s_at EPRS 2058 -0.66 -0.04 0.86 -0.93 0.74 -0.05 -1.41 1.80 -0.31 200842_s_at EPRS 2058 -1.88 -0.57 -0.95 0.08 0.30 1.06 0.02 0.70 1.22 200843_s_at EPRS 2058 -0.94 -0.35 -0.01 0.73 -0.69 0.68 1.07 -1.70 1.20

221 200844_s_at SETDB1 9869 -0.47 -0.83 -1.08 0.68 -1.15 -0.03 0.24 0.83 1.82 200845_s_at AOP2 9588 -0.89 1.24 -1.60 -0.04 -0.67 1.16 -0.31 0.06 1.06 200846_s_at PPP1CA 5499 -1.42 0.41 -1.38 -0.07 0.53 1.05 -0.05 -0.53 1.47 200847_s_at MGC8721 51669 1.18 -0.48 0.92 0.39 0.75 -1.02 0.74 -1.08 -1.41 200848_at AHCYL1 10768 -0.31 0.82 -0.80 1.50 1.39 -1.16 -0.16 -0.33 -0.93 200849_s_at AHCYL1 10768 -0.56 -0.23 -0.95 2.29 -0.15 -0.92 0.20 -0.32 0.66 200850_s_at AHCYL1 10768 1.28 -0.31 0.09 1.00 0.71 -1.47 0.67 -0.72 -1.25 200851_s_at KIAA0174 9798 -0.37 -0.33 1.16 0.61 -1.74 0.30 0.89 -1.24 0.71 200852_x_at GNB2 2783 -0.27 -1.32 -0.63 -0.42 1.38 1.76 0.38 -0.43 -0.44 200853_at H2AFZ 3015 0.28 -1.49 1.48 0.88 -0.17 -0.56 1.06 -0.50 -0.97 200854_at NCOR1 9611 -0.63 1.07 -2.01 -0.41 0.23 -0.25 -0.01 1.18 0.84 200855_at NCOR1 9611 -1.32 0.62 1.27 -0.34 0.37 0.03 -1.77 0.27 0.85 200856_x_at NCOR1 9611 0.35 1.26 -1.24 -0.97 1.27 0.05 -1.35 0.04 0.57 200857_s_at NCOR1 9611 -2.12 0.54 -0.13 0.90 0.81 0.12 -0.63 -0.50 1.00 200858_s_at RPS8 6202 0.49 -0.02 1.06 1.17 0.27 -0.42 0.15 -0.55 -2.15 200859_x_at FLNA 2316 -0.67 0.88 -1.47 -0.58 0.65 1.49 0.35 -1.12 0.46

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200860_s_at KIAA1007 23019 -0.15 0.03 -2.13 -0.05 0.03 1.31 -0.62 0.79 0.80 200861_at KIAA1007 23019 0.49 -0.07 -0.27 0.70 1.24 -1.26 -1.74 0.99 -0.07 200862_at DHCR24 1718 -1.19 1.23 -1.59 -0.86 0.88 0.18 0.26 0.91 0.17 200863_s_at RAB11A 8766 -0.23 -1.46 1.32 0.63 -1.39 1.14 0.49 -0.32 -0.18 200864_s_at RAB11A 8766 0.39 0.78 -1.27 0.06 0.55 1.44 -1.17 -1.26 0.47 200865_at EIF3S5 8665 -0.31 -0.43 0.96 0.35 -1.64 1.10 -0.28 -1.01 1.26 200866_s_at PSAP 5660 -0.57 -1.34 -0.29 -0.35 -1.05 0.95 0.72 1.74 0.19 200867_at ZNF313 55905 -0.31 0.44 -1.02 1.27 1.09 0.13 0.42 -0.14 -1.89 200868_s_at ZNF313 55905 -1.08 -0.31 0.61 -1.00 -0.27 1.40 -1.21 1.04 0.83 200869_at RPL18A 6142 1.26 -0.13 -0.15 0.76 -0.39 -0.60 1.39 -0.35 -1.78 200870_at UNRIP 11171 0.79 -1.17 0.40 1.12 1.49 -1.26 -0.61 -0.48 -0.26

222 200871_s_at PSAP 5660 -0.69 -1.16 -0.40 -0.53 -1.08 1.55 0.64 1.19 0.49 200872_at S100A10 6281 0.49 -1.57 0.28 -0.19 -1.06 -0.90 1.09 1.27 0.58 200873_s_at CCT8 10694 0.47 -1.88 0.10 0.16 -0.49 0.18 0.18 1.87 -0.61 200874_s_at NOL5A 10528 -0.35 -0.66 -0.47 -0.33 -0.14 0.55 -1.11 2.33 0.20 200875_s_at NOL5A 10528 1.59 0.63 -1.40 -0.77 -0.10 -0.66 1.11 0.40 -0.79 200876_s_at PSMB1 5689 -0.04 0.95 1.22 0.60 0.66 -0.88 0.24 -1.15 -1.60 200877_at CCT4 10575 -0.64 -0.42 1.15 -0.55 -1.84 -0.22 1.08 0.91 0.53 200878_at DPP7 29952 -0.93 -1.75 -0.10 0.26 -0.70 0.84 0.52 1.53 0.32 200879_s_at EPAS1 2034 -0.68 -0.29 -0.58 -1.39 1.26 1.16 -0.98 0.65 0.87 200880_at DNAJA1 3301 0.52 1.43 0.35 0.72 0.58 -1.61 -0.23 -0.42 -1.34 200881_s_at DNAJA1 3301 1.46 -0.82 0.31 1.25 -0.34 -1.66 -0.02 0.45 -0.64 200882_s_at PSMD4 5710 -0.51 -0.94 0.05 -0.60 -0.09 -1.19 2.02 0.88 0.39 200883_at UQCRC2 7385 -2.04 0.08 1.55 -0.08 0.11 0.15 -0.54 -0.22 0.99 200884_at CKB 1152 0.05 0.02 -0.71 -0.07 1.79 -0.04 -1.60 1.15 -0.59 200885_at ARHC 389 -0.73 0.72 -1.76 -0.60 0.14 1.25 0.87 -0.68 0.78 200886_s_at PGAM1 5223 -1.20 -0.35 -0.39 -0.37 -1.10 1.29 0.86 -0.27 1.55

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200887_s_at STAT1 6772 0.92 0.93 1.29 -0.32 0.49 -1.60 -0.76 0.09 -1.04 200888_s_at RPL23 9349 0.98 -1.63 -0.16 0.05 -0.37 0.40 0.36 1.56 -1.20 200889_s_at SSR1 6745 -0.60 -1.02 1.02 -0.28 0.14 1.13 -1.68 0.17 1.11 200890_s_at SSR1 6745 -0.40 0.17 0.14 -0.86 0.59 1.20 -1.62 -0.68 1.46 200891_s_at SSR1 6745 0.06 0.24 -0.99 1.54 0.48 -1.01 1.21 -1.34 -0.19 200892_s_at SFRS10 6434 0.10 1.44 0.03 -1.06 1.79 -0.93 -0.43 -0.30 -0.64 200893_at SFRS10 6434 0.28 0.85 -0.15 0.20 0.43 -1.30 1.45 0.01 -1.76 200894_s_at FKBP4 2288 -0.99 1.67 -1.07 0.08 0.28 0.76 -1.13 -0.50 0.90 200895_s_at FKBP4 2288 1.00 1.72 -1.06 0.55 -0.76 -0.91 -0.99 0.04 0.39 200896_x_at HDGF 3068 -0.89 1.61 -0.03 -0.13 1.30 0.62 -0.30 -1.06 -1.11 200897_s_at KIAA0992 23022 1.64 -0.30 0.19 0.84 0.15 -1.25 0.36 0.01 -1.64

223 200898_s_at MGEA5 10724 -1.69 -0.30 -0.36 0.46 0.44 -0.23 0.50 -0.71 1.91 200899_s_at MGEA5 10724 -0.14 -0.03 0.06 -0.11 0.01 -1.82 0.60 1.98 -0.55 200900_s_at M6PR 4074 -1.21 -1.41 0.21 -0.57 -0.01 0.82 -0.26 1.65 0.79 200901_s_at M6PR 4074 -1.32 -0.14 -0.97 -0.94 -0.36 0.36 1.37 0.70 1.30 200902_at 37879 9403 0.29 -1.33 -0.64 1.17 1.71 -0.52 0.38 -0.10 -0.96 200903_s_at AHCY 191 1.25 -0.41 0.16 -0.19 -0.23 0.89 -1.93 -0.61 1.09 200904_at HLA-E 3133 0.87 -0.25 0.81 1.60 0.24 -0.55 -0.08 -1.10 -1.52 200905_x_at HLA-E 3133 0.27 -1.12 1.21 1.17 -1.67 0.01 0.85 -0.43 -0.29 200906_s_at KIAA0992 23022 1.92 -0.45 0.15 1.07 0.18 -1.01 -0.47 -0.15 -1.24 200907_s_at KIAA0992 23022 1.33 0.28 0.21 1.28 0.33 -1.26 -0.11 -0.49 -1.57 200908_s_at RPLP2 6181 -0.51 -1.02 -0.32 -1.01 -0.55 1.13 -0.38 1.02 1.66 200909_s_at RPLP2 6181 -0.68 -0.55 -0.82 1.84 -0.35 -0.14 1.22 0.56 -1.07 200910_at CCT3 7203 -0.91 1.44 -0.58 0.18 0.58 -0.24 -1.82 0.52 0.83 200911_s_at TACC1 6867 -1.90 0.01 -0.73 -0.26 1.38 0.86 -0.50 0.27 0.86 200912_s_at EIF4A2 1974 -1.15 1.96 0.93 -0.14 0.59 -0.69 -0.02 -0.68 -0.79 200913_at PPM1G 5496 -1.31 1.41 0.06 0.73 -0.63 -0.39 -1.10 -0.15 1.38

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200914_x_at KTN1 3895 -0.42 0.26 -0.80 -0.46 1.95 0.87 0.25 -1.48 -0.17 200915_x_at KTN1 3895 -0.15 -0.38 2.38 -0.02 -0.66 -0.46 -1.09 -0.11 0.50 200916_at TAGLN2 8407 0.66 1.74 -0.68 -1.02 -0.89 0.46 0.63 0.30 -1.21 200917_s_at SRPR 6734 0.22 -0.01 0.48 1.46 0.78 0.33 -1.97 -0.45 -0.85 200918_s_at SRPR 6734 -0.62 0.73 -0.07 0.22 0.44 -1.86 1.69 0.14 -0.67 200919_at PHC2 1912 -1.26 -0.98 0.08 1.89 0.44 -0.94 0.10 0.84 -0.18 200920_s_at BTG1 694 1.71 -0.23 0.66 -0.45 -0.56 -0.29 0.82 -1.80 0.15 200921_s_at BTG1 694 1.60 -0.81 0.34 -0.39 0.69 0.54 0.32 -1.85 -0.43 200922_at KDELR1 10945 0.20 0.14 1.03 1.60 0.50 -0.40 -1.46 -0.36 -1.26 200923_at LGALS3BP 3959 -0.05 -0.89 -0.43 -0.76 -1.35 1.02 1.81 0.20 0.46 200924_s_at SLC3A2 6520 1.67 -0.83 0.55 0.57 -0.52 -1.24 0.64 0.37 -1.22

224 200925_at COX6A1 1337 -0.98 -1.09 -0.15 0.60 -1.15 0.89 1.29 1.15 -0.55 200926_at RPS23 6228 0.14 -0.37 0.41 -0.28 -0.30 -1.14 1.50 1.42 -1.37 200927_s_at RAB14 51552 0.09 0.49 0.82 -0.09 -0.28 0.26 -2.06 1.47 -0.69 200928_s_at RAB14 51552 -0.63 2.10 -0.27 -0.37 0.05 -0.98 -0.19 1.12 -0.80 200929_at TMP21 10972 -1.39 -1.79 0.36 0.66 -0.09 1.40 0.27 0.19 0.38 200930_s_at VCL 7414 -1.10 0.19 -0.63 0.08 -0.94 0.07 -0.52 0.68 2.16 200931_s_at VCL 7414 -0.96 -0.02 -0.90 -0.18 1.54 -0.15 -0.89 1.72 -0.13 200932_s_at DCTN2 10540 -0.46 -0.60 -0.78 -0.17 -1.14 0.86 0.26 -0.11 2.15 200933_x_at RPS4X 6191 0.13 -0.91 -0.54 0.48 -0.49 -0.35 1.82 1.13 -1.26 200934_at DEK 7913 -0.98 0.22 0.68 0.41 2.04 -0.45 -0.35 -1.32 -0.25 200935_at CALR 811 -0.87 1.64 -0.15 -0.02 1.01 0.82 -1.54 -0.56 -0.31 200936_at RPL8 6132 0.52 -1.92 0.11 0.65 -0.84 -0.20 1.00 1.23 -0.55 200937_s_at RPL5 6125 0.68 -2.15 0.40 0.84 -0.46 0.21 0.77 0.59 -0.88 200938_s_at RERE 473 0.08 -0.75 -0.59 -0.10 2.25 -0.20 -1.19 -0.16 0.68 200939_s_at RERE 473 1.26 -0.85 -0.45 -0.90 0.00 0.00 -0.75 -0.30 1.99 200940_s_at RERE 473 -0.91 1.20 -0.79 -0.68 1.63 0.36 0.42 -1.26 0.02

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200941_at HSBP1 3281 0.53 0.50 0.43 0.40 0.44 -2.35 0.52 0.43 -0.93 200942_s_at HSBP1 3281 2.02 -0.66 -1.06 -0.87 -0.28 -0.02 0.21 1.10 -0.43 200943_at HMGN1 3150 -1.06 -0.99 1.74 -0.15 -0.64 -0.08 0.17 1.46 -0.46 200944_s_at HMGN1 3150 0.33 -1.57 0.84 1.16 -0.55 -0.02 1.02 -1.39 0.17 200945_s_at KIAA0905 22872 1.33 -0.79 0.56 1.71 -0.26 0.01 -0.69 -0.80 -1.06 200946_x_at GLUD1 2746 0.21 -1.76 -0.14 0.19 0.10 0.95 -1.32 0.35 1.41 200947_s_at GLUD1 2746 -0.24 0.12 1.25 1.11 0.84 -1.16 -1.11 0.45 -1.26 200948_at MLF2 8079 -0.72 0.89 -1.31 -0.23 1.83 -0.09 -0.82 0.84 -0.38 200949_x_at RPS20 6224 0.05 -0.79 -0.03 -0.12 -1.41 0.95 0.74 1.66 -1.04 200950_at ARPC1A 10552 0.95 -0.62 1.33 0.76 0.01 -1.34 0.76 -0.58 -1.26 200951_s_at CCND2 894 -0.48 -0.73 -0.89 2.24 0.06 0.66 -0.84 0.31 -0.33

225 200952_s_at CCND2 894 0.78 -0.80 -1.80 0.19 1.65 -0.16 -0.54 0.08 0.60 200953_s_at CCND2 894 0.73 -0.44 -1.45 1.51 0.51 -0.78 1.09 -0.42 -0.76 200954_at ATP6V0C 527 -1.43 -1.00 -0.85 -0.08 -0.13 1.77 0.50 0.50 0.72 200955_at IMMT 10989 -1.11 -0.04 -0.05 -0.62 -0.74 1.40 0.24 -0.82 1.75 200956_s_at SSRP1 6749 -0.45 0.45 -1.82 -0.78 1.58 0.63 0.70 -0.45 0.14 200957_s_at SSRP1 6749 -1.71 0.96 0.51 0.10 -0.21 -0.76 1.54 -0.81 0.38 200958_s_at SDCBP 6386 -0.37 0.96 0.33 -0.13 -1.33 -1.02 0.91 1.53 -0.87 200959_at FUS 2521 0.78 1.11 -0.82 0.24 -0.70 -1.77 1.20 -0.42 0.38 200960_x_at CLTA 1211 -1.02 0.30 -0.68 -1.09 0.00 0.26 -0.18 2.24 0.18 200961_at SPS2 22928 1.10 -1.35 -0.19 1.41 -1.12 0.70 -0.29 -0.83 0.58 200962_at 1.16 -0.21 1.80 0.73 -0.25 -0.83 -0.85 -0.57 -0.97 200963_x_at RPL31 6160 0.94 -0.61 -0.29 0.67 -0.15 -0.69 1.32 0.67 -1.86 200964_at UBE1 7317 0.39 1.38 -0.74 1.16 0.18 0.56 -1.03 -1.57 -0.33 200965_s_at ABLIM1 3983 -1.07 0.01 -0.79 -1.23 1.23 -0.33 -0.17 1.52 0.84 200966_x_at ALDOA 226 -0.89 -0.93 -0.33 -0.45 -0.88 2.08 0.22 0.35 0.83 200967_at PPIB 5479 -0.41 0.85 0.61 -0.22 -0.14 -1.41 0.94 1.24 -1.47

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200968_s_at PPIB 5479 -1.39 0.19 0.89 -0.06 -0.99 0.13 1.86 0.17 -0.82 200969_at SERP1 27230 1.01 1.36 0.10 -0.16 0.63 -0.87 -0.12 0.01 -1.97 200970_s_at SERP1 27230 1.52 0.15 -0.69 -0.48 0.60 -1.30 0.27 1.14 -1.21 200971_s_at SERP1 27230 0.88 -2.02 0.40 1.23 0.03 -0.85 0.76 -0.22 -0.21 200972_at TSPAN-3 10099 1.39 -0.50 0.73 0.50 -0.38 -1.13 0.84 0.20 -1.67 200973_s_at TSPAN-3 10099 1.26 -0.07 -0.02 1.61 -0.93 -1.23 0.49 -0.03 -1.06 200974_at ACTA2 59 -0.76 -0.92 1.01 -0.10 -0.39 0.70 -0.02 -1.28 1.78 200975_at PPT1 5538 -1.07 -1.17 0.90 -0.93 -0.65 0.31 0.63 0.34 1.64 200976_s_at TAX1BP1 8887 0.19 -0.79 -1.59 -1.00 0.74 0.59 0.93 -0.42 1.34 200977_s_at TAX1BP1 8887 0.82 -0.13 0.27 -0.17 -1.36 -0.01 0.18 1.81 -1.41 200978_at MDH1 4190 -1.07 -0.83 -0.41 -0.75 -0.71 1.17 0.02 1.06 1.54

226 200979_at -1.22 1.29 0.08 -1.79 0.23 -0.37 0.19 0.99 0.59 200980_s_at PDHA1 5160 -0.85 1.29 -0.18 -0.37 -0.55 0.98 -1.69 0.30 1.09 200981_x_at GNAS 2778 -0.89 -1.25 -0.31 0.01 -1.24 1.35 1.18 0.43 0.73 200982_s_at ANXA6 309 -0.25 -0.86 -0.78 -0.11 -0.65 1.04 -0.26 -0.30 2.20 200983_x_at CD59 966 0.60 -1.43 -0.17 0.55 -0.98 -0.60 -0.21 1.93 0.30 200984_s_at CD59 966 0.27 -0.61 0.76 -1.09 -1.35 0.94 -0.96 0.90 1.13 200985_s_at CD59 966 0.30 -1.82 -0.23 -0.02 -0.96 0.30 -0.09 0.87 1.65 200986_at SERPING1 710 1.79 -0.03 0.18 -0.20 0.86 -0.94 0.47 -1.58 -0.54 200987_x_at PSME3 10197 -0.43 -0.77 -0.52 0.53 1.25 -0.17 -1.77 0.69 1.18 200988_s_at PSME3 10197 -0.63 0.87 -0.83 -0.69 1.69 -0.02 -0.63 1.21 -0.95 200989_at HIF1A 3091 1.26 1.32 0.88 -0.95 0.26 -1.11 -0.36 -1.22 -0.08 200990_at TRIM28 10155 -0.43 2.10 -0.41 0.89 0.59 -0.40 -0.56 -0.86 -0.90 200991_s_at SNX17 9784 -0.83 1.08 -0.70 -0.97 1.56 1.20 -0.75 -0.33 -0.25 200992_at RANBP7 10527 1.99 0.01 0.88 0.01 -1.08 -1.30 0.25 -0.27 -0.48 200993_at RANBP7 10527 0.39 -0.53 -0.54 1.49 1.38 -0.67 -0.89 0.59 -1.22 200994_at RANBP7 10527 0.61 0.67 -0.38 1.05 0.60 -1.31 0.61 0.00 -1.85

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 200995_at RANBP7 10527 0.74 2.24 -0.18 -0.14 0.00 -1.09 -0.19 -0.36 -0.99 200996_at ACTR3 10096 -0.53 1.61 -0.14 -1.13 0.03 0.38 -1.40 1.28 -0.10 200997_at RBM4 5936 1.27 0.79 -0.45 0.60 0.15 -1.98 0.72 -0.73 -0.35 200998_s_at CKAP4 10970 0.15 1.49 0.17 0.84 1.08 -1.32 -0.66 -0.75 -1.01 200999_s_at CKAP4 10970 1.43 -0.11 -0.40 -0.62 -0.09 -0.81 1.51 0.53 -1.44 201000_at AARS 16 0.06 -0.24 -1.37 -0.59 -1.20 0.78 0.19 0.56 1.80 201001_s_at UBE2V1 7335 1.35 0.39 0.57 0.56 0.50 -0.08 -0.12 -1.52 -1.65 201002_s_at UBE2V1 7335 -1.15 2.05 -0.20 0.13 0.92 0.01 -1.15 -0.37 -0.24 201003_x_at UBE2V1 7335 -0.51 -0.32 -1.15 -0.70 -0.77 0.16 1.12 0.22 1.96 201004_at SSR4 6748 0.22 -1.12 0.22 -0.91 -1.47 -0.05 1.02 1.47 0.62 201005_at CD9 928 -0.34 -1.77 -0.87 1.55 -0.08 1.02 0.15 0.61 -0.28

227 201006_at PRDX2 7001 0.12 1.24 0.92 0.07 -1.34 -1.09 -1.24 0.92 0.39 201007_at HADHB 3032 0.79 -0.83 1.23 -1.16 0.26 0.03 1.34 -0.30 -1.35 201008_s_at TXNIP 10628 0.54 -1.58 1.79 1.01 -0.14 -0.50 -0.65 -0.02 -0.43 201009_s_at TXNIP 10628 0.40 -1.38 1.44 1.31 0.31 -1.27 -0.12 -0.11 -0.58 201010_s_at TXNIP 10628 0.63 -1.86 1.08 0.91 -0.77 -0.37 -0.16 1.04 -0.50 201011_at RPN1 6184 -1.05 -0.54 -0.49 -0.42 -0.55 -0.36 2.22 0.49 0.71 201012_at ANXA1 301 1.00 -1.15 0.38 1.00 -1.00 -0.71 1.49 -0.16 -0.84 201013_s_at PAICS 10606 -0.94 1.80 0.19 -1.79 0.17 0.58 0.30 -0.33 0.00 201014_s_at PAICS 10606 -0.85 1.59 -0.11 -0.80 -0.28 0.80 -1.20 -0.43 1.30 201015_s_at JUP 3728 -1.35 0.45 0.94 -1.15 -0.25 1.38 -0.83 -0.19 1.01 201016_at EIF1A 1964 -0.09 1.34 -1.20 -0.45 1.86 -0.56 -0.02 -0.01 -0.84 201017_at -0.72 0.25 -0.49 0.12 1.42 0.15 0.09 1.11 -1.96 201018_at -0.34 0.94 -0.02 -1.11 1.09 0.69 -1.15 1.11 -1.21 201019_s_at EIF1A 1964 -0.70 1.29 -0.72 -0.76 1.54 -0.81 -0.42 1.11 -0.51 201020_at YWHAH 7533 -1.44 -0.69 0.80 -1.16 0.98 1.36 -0.25 0.67 -0.26 201021_s_at DSTN 11034 -1.03 -0.16 0.30 -1.32 -0.13 1.03 -0.99 1.53 0.78

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201022_s_at DSTN 11034 -0.51 0.43 -0.09 -1.42 -0.77 0.57 0.79 -0.80 1.81 201023_at TAF7 6879 0.55 0.33 0.64 1.46 -1.20 -0.65 -0.29 -1.58 0.72 201024_x_at IF2 9669 0.29 -0.24 -1.67 0.11 0.48 0.00 1.18 -1.37 1.22 201025_at IF2 9669 -0.96 1.84 -0.26 -0.16 0.49 -0.11 -0.17 -1.56 0.90 201026_at IF2 9669 1.02 0.44 -0.90 -1.21 0.04 -1.54 0.75 1.20 0.19 201027_s_at IF2 9669 -0.91 2.01 -1.46 0.22 -0.31 0.07 -0.47 0.75 0.10 201028_s_at MIC2 4267 1.72 -1.76 -0.14 -0.89 0.41 -0.01 0.87 0.14 -0.34 201029_s_at MIC2 4267 0.03 -0.40 -1.15 -1.10 -1.07 1.46 0.37 1.11 0.75 201030_x_at LDHB 3945 -0.58 -0.92 1.58 -0.24 -1.16 0.61 1.29 -0.85 0.28 201031_s_at HNRPH1 3187 0.44 -0.63 0.65 -0.45 1.33 -1.61 0.37 1.00 -1.11 201032_at BLCAP 10904 0.55 2.11 0.01 0.05 0.49 -1.15 -0.35 -0.72 -0.99

228 201033_x_at RPLP0 6175 -0.25 -1.52 0.01 -0.46 -1.33 0.48 0.90 1.33 0.86 201034_at ADD3 120 1.00 -1.51 0.73 0.68 -0.47 0.40 0.47 -1.70 0.38 201035_s_at HADHSC 3033 -0.28 -1.58 -0.05 -0.24 -0.26 0.06 0.50 -0.35 2.21 201036_s_at HADHSC 3033 1.02 -0.34 0.60 -1.25 1.27 -0.85 1.12 -0.85 -0.72 201037_at PFKP 5214 -1.08 0.18 -0.63 -0.86 -0.34 1.16 0.61 -0.79 1.77 201038_s_at ANP32A 8125 -1.18 0.55 -0.32 -1.73 0.47 0.67 -0.27 1.52 0.29 201039_s_at RAD23A 5886 -1.38 -0.68 0.58 0.63 0.30 1.34 0.53 0.27 -1.60 201040_at GNAI2 2771 -1.50 1.10 0.09 0.29 0.52 1.26 -1.55 -0.31 0.09 201041_s_at DUSP1 1843 1.25 -0.64 1.04 0.86 0.07 -1.17 0.70 -1.05 -1.07 201042_at TGM2 7052 0.64 -0.10 -0.28 1.43 0.05 -0.21 1.15 -1.79 -0.89 201043_s_at ANP32A 8125 -1.32 1.90 0.08 -0.78 -0.44 -0.03 -0.81 0.95 0.46 201044_x_at DUSP1 1843 1.34 -1.11 -0.48 -0.09 -0.83 -0.55 0.32 -0.41 1.84 201045_s_at RAB6A 5870 -0.39 -0.98 -0.73 0.86 -0.24 -1.46 0.93 0.51 1.49 201046_s_at RAD23A 5886 0.38 0.34 -0.79 1.60 0.31 0.69 0.19 -1.09 -1.64 201047_x_at RAB6A 5870 -0.68 0.88 -1.80 -0.32 0.23 1.33 1.11 -0.29 -0.46 201048_x_at RAB6A 5870 0.57 -0.84 -0.18 -1.03 -0.47 1.78 -1.21 0.67 0.71

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201049_s_at RPS18 6222 -0.91 -0.99 0.13 -0.33 -1.05 1.25 0.54 1.71 -0.34 201050_at PLD3 23646 0.00 -0.90 0.74 0.78 -0.46 1.58 -1.73 -0.38 0.35 201051_at ANP32A 8125 -1.78 0.91 -0.15 -0.86 0.73 0.40 -0.99 0.99 0.73 201052_s_at PSMF1 9491 -1.76 1.22 -0.21 -0.51 1.48 0.22 0.13 0.25 -0.83 201053_s_at PSMF1 9491 0.56 1.69 -0.19 -1.01 0.54 -1.11 0.26 0.59 -1.33 201054_at HNRPA0 10949 0.79 1.23 0.77 0.18 -0.66 -1.16 0.06 0.53 -1.76 201055_s_at HNRPA0 10949 1.35 0.25 -1.19 -0.25 0.82 -1.68 -0.37 0.12 0.95 201056_at -1.21 -0.37 0.35 -0.08 1.37 0.81 1.10 -1.49 -0.48 201057_s_at GOLGB1 2804 -1.04 0.30 -0.25 -0.22 -0.48 -0.88 1.09 -0.55 2.04 201058_s_at MYL9 10398 -1.10 0.80 -0.72 0.54 0.10 1.32 -1.59 -0.30 0.95 201059_at EMS1 2017 -0.43 -0.24 -0.96 -1.19 -0.93 0.32 0.79 1.71 0.93

229 201060_x_at STOM 2040 -0.36 -1.67 0.03 0.28 0.67 0.23 0.55 -1.30 1.56 201061_s_at STOM 2040 0.92 -0.48 0.26 -0.31 -1.11 -0.33 2.18 -0.59 -0.52 201062_at STOM 2040 -0.29 0.23 1.28 -0.74 -0.94 -0.97 -0.79 0.55 1.69 201063_at RCN1 5954 1.28 1.17 -0.59 0.63 0.18 -0.69 0.55 -0.99 -1.54 201064_s_at PABPC4 8761 1.76 -0.27 -0.19 1.20 -0.27 -1.21 0.62 -0.63 -1.00 201065_s_at GTF2I 2969 -0.82 2.01 -0.24 -0.43 0.66 -0.09 -0.92 -0.98 0.84 201066_at CYC1 1537 -0.96 -0.34 -0.38 0.23 -1.74 0.68 1.58 0.07 0.84 201067_at PSMC2 5701 -1.06 1.26 0.60 -1.34 1.38 0.56 -0.77 -0.14 -0.48 201068_s_at PSMC2 5701 -0.70 0.29 0.17 -0.30 -0.76 0.70 -1.75 1.59 0.76 201069_at MMP2 4313 0.70 -0.84 1.06 0.79 -0.87 0.61 0.04 -1.92 0.42 201070_x_at SF3B1 23451 -1.52 -0.43 -0.45 -0.90 0.36 0.89 -0.49 1.33 1.22 201071_x_at SF3B1 23451 -1.39 1.51 -0.20 -1.19 0.45 0.57 -0.99 0.63 0.60 201072_s_at SMARCC1 6599 -0.36 -0.75 0.17 -0.39 0.56 -0.91 -0.99 0.50 2.17 201073_s_at SMARCC1 6599 0.26 1.40 -1.99 -0.25 -0.32 0.07 -0.65 0.40 1.08 201074_at SMARCC1 6599 -1.66 1.26 -0.11 -0.41 0.16 1.43 -0.02 -1.07 0.43 201075_s_at SMARCC1 6599 -1.20 2.07 -0.89 0.59 0.67 -0.21 -0.64 0.04 -0.43

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201076_at NHP2L1 4809 -0.02 0.42 0.99 -0.62 1.32 -1.76 -0.72 -0.48 0.88 201077_s_at NHP2L1 4809 -1.29 1.15 -0.29 0.13 -0.54 0.53 0.08 1.57 -1.35 201078_at TM9SF2 9375 0.10 -1.48 -0.54 1.06 -0.99 -0.37 0.03 0.45 1.74 201079_at SYNGR2 9144 -1.32 -0.64 0.76 -1.44 0.08 1.45 1.01 0.16 -0.07 201080_at MGC45562 125113 -1.77 -0.09 -0.62 -0.48 0.11 0.21 -0.12 1.00 1.76 201081_s_at PIP5K2B 8396 -1.26 -0.17 -0.12 -1.31 0.45 1.85 -0.53 0.76 0.35 201082_s_at DCTN1 1639 0.33 1.90 -1.73 0.49 -0.05 0.10 -0.46 -0.83 0.24 201083_s_at BTF 9774 0.71 1.71 0.60 -0.83 0.43 -0.14 -1.71 -0.22 -0.54 201084_s_at BTF 9774 0.15 1.31 -0.29 0.62 0.69 -0.51 0.66 -2.06 -0.56 201085_s_at SON 6651 -0.09 1.38 0.09 0.85 0.72 -1.10 -1.68 0.50 -0.68 201086_x_at SON 6651 0.80 -0.68 0.51 1.55 0.38 -0.99 -0.10 0.25 -1.72

230 201087_at PXN 5829 -0.55 1.73 -1.87 -0.15 0.87 0.50 -0.30 -0.05 -0.16 201088_at KPNA2 3838 0.02 2.07 0.56 -0.75 0.48 -1.07 -0.53 0.25 -1.03 201089_at ATP6V1B2 526 -1.27 -0.28 0.01 -0.65 -1.42 1.44 0.48 0.70 1.00 201090_x_at K-ALPHA-1 10376 -1.36 -0.60 0.07 -0.75 -0.74 1.73 0.03 0.40 1.20 201091_s_at CBX3 11335 0.99 -0.37 0.34 1.59 -0.41 0.27 -0.13 -0.31 -1.96 201092_at RBBP7 5931 -1.01 -0.57 0.54 -1.24 -0.74 0.17 0.86 0.13 1.85 201093_x_at SDHA 6389 -0.82 -1.50 0.19 1.24 -1.01 0.93 -0.25 0.01 1.21 201094_at RPS29 6235 0.43 -1.02 0.17 0.09 -1.35 0.08 1.46 1.22 -1.10 201095_at DAP 1611 -1.07 -1.48 0.71 0.25 -0.70 1.37 1.23 -0.37 0.06 201096_s_at ARF4 378 0.84 -0.32 1.86 0.77 -0.37 -0.41 -0.07 -0.83 -1.45 201097_s_at ARF4 378 1.25 -0.01 0.55 0.56 -0.09 -1.44 -0.05 0.92 -1.68 201098_at COPB2 9276 -0.12 0.31 -1.39 -0.98 -0.80 0.35 0.75 -0.02 1.90 201099_at -1.46 0.62 0.86 -1.67 -0.01 0.67 -0.50 0.58 0.90 201100_s_at USP9X 8239 -0.54 0.58 -1.35 1.44 -0.17 0.68 -1.57 0.58 0.34 201101_s_at BTF 9774 1.09 0.02 0.81 -0.16 -1.63 1.01 -1.25 0.69 -0.59 201102_s_at PFKL 5211 -0.56 0.33 0.04 -0.70 -0.82 1.18 -0.04 -1.27 1.83

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201103_x_at FLJ20719 55672 1.22 0.97 0.55 -0.54 -0.39 -1.03 1.27 -0.99 -1.05 201104_x_at DJ328E19.C1.1 25832 1.21 0.52 -0.26 -0.93 0.44 -0.84 -1.75 0.91 0.68 201105_at LGALS1 3956 -1.04 -0.52 -0.01 -0.38 -1.42 1.82 0.51 0.17 0.89 201106_at GPX4 2879 0.46 0.17 0.19 0.99 -0.31 -1.12 1.61 -0.39 -1.61 201107_s_at THBS1 7057 -0.96 -0.29 -0.37 2.16 -0.68 0.87 -0.57 0.46 -0.61 201108_s_at THBS1 7057 0.31 -0.60 2.28 -0.82 -0.50 -0.27 0.59 -0.97 -0.01 201109_s_at THBS1 7057 -0.01 -0.84 1.22 -0.36 -0.79 -1.09 1.75 -0.54 0.66 201110_s_at THBS1 7057 1.33 -1.21 -0.71 0.73 -0.78 -0.01 1.50 0.04 -0.89 201111_at CSE1L 1434 -0.85 2.05 -0.28 -1.20 1.00 -0.40 -0.17 -0.46 0.32 201112_s_at CSE1L 1434 -1.37 2.01 -0.48 -0.06 0.43 0.10 -1.14 0.56 -0.05 201113_at TUFM 7284 -1.59 -0.67 -0.77 -0.35 -0.40 0.85 0.75 0.64 1.54

231 201114_x_at PSMA7 5688 1.11 -1.66 0.65 -0.10 -0.76 -0.51 -0.47 1.55 0.19 201115_at POLD2 5425 -1.00 0.42 -1.09 -1.62 0.40 1.37 0.20 0.62 0.68 201116_s_at CPE 1363 1.42 -0.32 0.01 -0.75 -0.84 1.50 -0.86 -0.95 0.80 201117_s_at CPE 1363 -1.71 0.01 1.00 1.07 -1.05 -0.75 0.91 0.61 -0.10 201118_at PGD 5226 0.89 -0.18 1.60 1.09 -0.40 -1.17 -0.11 -0.46 -1.26 201119_s_at COX8 1351 0.52 -1.33 -0.48 0.87 -1.56 -0.04 0.35 1.52 0.15 201120_s_at PGRMC1 10857 -0.61 -0.79 1.52 -0.85 0.11 0.36 -1.19 1.53 -0.08 201121_s_at PGRMC1 10857 -0.23 -1.84 0.31 0.07 -0.26 -0.04 0.13 2.07 -0.21 201122_x_at EIF5A 1984 -0.89 0.92 -0.34 -1.64 -0.11 1.16 -0.80 0.80 0.90 201123_s_at EIF5A 1984 -1.26 1.09 0.78 -1.10 0.83 0.72 -1.40 -0.05 0.39 201124_at ITGB5 3693 0.36 0.50 -0.62 -0.94 0.60 -1.68 -0.58 1.07 1.29 201125_s_at ITGB5 3693 -0.13 -1.20 -1.15 -0.11 -0.66 1.50 -0.26 0.61 1.43 201126_s_at MGAT1 4245 -0.84 -0.45 0.94 1.81 0.73 -0.33 -0.02 -1.44 -0.37 201127_s_at ACLY 47 -1.87 1.08 0.19 -0.60 -0.17 1.21 -0.48 -0.37 1.00 201128_s_at ACLY 47 0.33 1.81 -0.74 -1.35 1.24 -0.53 -0.08 -0.58 -0.07 201129_at SFRS7 6432 -1.45 0.68 0.17 -0.87 1.86 -0.98 0.17 0.39 0.01

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201130_s_at CDH1 999 -0.68 -0.25 -0.99 -0.19 1.22 2.06 -0.75 -0.13 -0.28 201131_s_at CDH1 999 -0.35 -0.55 -0.23 0.51 -0.63 2.48 -0.64 -0.48 -0.08 201132_at HNRPH2 3188 0.35 1.92 0.69 0.44 0.11 -1.18 -0.46 -1.13 -0.74 201133_s_at KIAA0438 9867 0.01 -0.10 -0.71 -0.67 0.90 0.92 -1.79 -0.01 1.45 201134_x_at COX7C 1350 1.24 0.56 0.65 0.72 -0.36 -1.01 0.67 -0.75 -1.72 201135_at ECHS1 1892 -0.61 -1.48 0.94 -0.25 -1.32 0.85 0.40 0.11 1.34 201136_at PLP2 5355 -1.06 -0.16 -0.71 -1.26 -0.52 1.22 1.57 0.51 0.40 201137_s_at HLA-DPB1 3115 0.45 -1.00 1.63 -0.21 -1.07 0.08 1.42 -0.79 -0.50 201138_s_at SSB 6741 -0.24 1.28 0.08 -0.32 1.59 0.24 -0.59 -0.25 -1.78 201139_s_at SSB 6741 -1.63 0.99 1.50 -0.55 0.62 0.00 -1.06 0.39 -0.26 201140_s_at RAB5C 5878 -0.30 1.53 1.14 0.68 -0.06 -1.11 -1.55 -0.36 0.04

232 201141_at GPNMB 10457 -0.81 -0.99 -0.29 -1.01 -0.77 1.58 0.29 1.01 0.99 201142_at EIF2S1 1965 1.91 -0.43 -0.40 -1.29 -0.45 -0.68 0.55 1.11 -0.30 201143_s_at EIF2S1 1965 -0.14 0.79 -0.23 1.41 1.42 -0.73 -0.71 -0.37 -1.44 201144_s_at EIF2S1 1965 -0.26 -0.78 0.06 -0.69 -0.65 -0.52 1.91 1.47 -0.51 201145_at HAX1 10456 -1.16 -0.78 0.28 2.14 -0.28 0.44 0.37 -0.04 -0.96 201146_at NFE2L2 4780 1.77 0.59 -0.36 0.12 -0.24 -0.93 0.92 -0.32 -1.56 201147_s_at TIMP3 7078 -1.58 0.42 -0.82 -0.59 0.65 1.68 -0.54 0.83 -0.05 201148_s_at TIMP3 7078 -0.53 -0.55 -0.96 -0.40 0.70 -0.36 -0.95 1.44 1.63 201149_s_at TIMP3 7078 -1.74 0.24 -0.78 -0.08 0.93 1.31 -0.94 0.85 0.22 201150_s_at TIMP3 7078 -0.23 0.75 -0.98 -0.26 1.33 -1.14 1.16 0.61 -1.23 201151_s_at MBNL 4154 0.26 0.30 -0.30 -0.89 -0.64 1.67 -1.57 1.11 0.06 201152_s_at MBNL 4154 -1.14 -1.15 0.77 -1.12 -0.05 1.27 0.82 -0.40 1.00 201153_s_at MBNL 4154 -0.32 2.36 -0.29 -0.56 0.22 -0.46 -0.29 -1.13 0.48 201154_x_at RPL4 6124 0.90 -0.19 0.54 1.37 -1.00 -0.89 1.15 -1.01 -0.87 201155_s_at MFN2 9927 -0.79 1.52 -1.41 -0.46 0.79 1.27 -0.49 -0.55 0.12 201156_s_at RAB5C 5878 -0.42 -0.19 1.76 0.42 -0.78 -0.90 -1.38 0.71 0.78

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201157_s_at NMT1 4836 -1.64 1.46 -0.14 1.26 -0.20 -0.34 -0.18 -0.91 0.71 201158_at NMT1 4836 -0.22 1.78 -1.14 -0.27 -1.32 0.17 0.05 -0.26 1.23 201159_s_at NMT1 4836 -0.20 1.70 0.09 0.11 1.33 -1.19 -0.70 0.00 -1.14 201160_s_at CSDA 8531 0.18 -0.12 0.05 2.13 -0.18 -0.39 0.66 -1.04 -1.28 201161_s_at CSDA 8531 -0.46 0.63 -0.51 1.24 0.33 0.56 0.91 -1.90 -0.80 201162_at IGFBP7 3490 -0.52 -0.49 0.61 -0.45 -1.33 1.46 -0.06 -0.74 1.55 201163_s_at IGFBP7 3490 1.17 -0.56 1.09 -1.52 0.66 -0.29 -0.01 0.76 -1.29 201164_s_at PUM1 9698 0.48 -0.72 1.35 -0.30 0.47 -0.40 0.78 -2.03 0.36 201165_s_at PUM1 9698 -0.79 0.92 1.00 0.42 0.84 0.67 -1.83 -0.63 -0.60 201166_s_at PUM1 9698 -0.54 0.55 1.57 -0.40 -1.46 -0.08 -1.12 1.06 0.44 201167_x_at ARHGDIA 396 -0.76 1.01 -1.31 0.13 1.58 0.39 -1.05 -0.63 0.65

233 201168_x_at ARHGDIA 396 -0.74 1.14 -0.85 0.27 1.23 1.31 -0.64 -1.14 -0.57 201169_s_at BHLHB2 8553 -0.71 0.10 -0.96 -0.86 1.30 1.59 -1.02 -0.10 0.68 201170_s_at BHLHB2 8553 -0.78 0.18 -1.07 -1.48 -0.06 0.88 -0.11 1.52 0.93 201171_at ATP6V0E 8992 0.40 -1.34 1.08 -1.23 -0.11 -0.10 -0.14 1.78 -0.34 201172_x_at ATP6V0E 8992 -1.41 0.08 -0.42 -0.39 -0.40 -0.38 -0.28 1.78 1.44 201173_x_at NUDC 10726 -0.39 -0.24 -0.84 -0.64 1.47 0.75 -1.62 0.60 0.93 201174_s_at TERF2IP 54386 0.53 1.32 -0.09 0.59 -0.91 -0.72 -0.58 -1.45 1.33 201175_at CGI-31 51075 -0.33 1.86 -0.90 -0.69 1.14 -0.61 -0.50 0.79 -0.74 201176_s_at ARCN1 372 0.66 -0.35 -1.25 0.46 -1.01 1.53 -0.22 -0.94 1.14 201177_s_at UBA2 10054 1.79 0.91 0.18 0.35 0.11 -0.77 -0.19 -1.55 -0.84 201178_at FBXO7 25793 0.17 0.04 0.67 -1.14 1.49 -0.09 0.95 -0.38 -1.70 201179_s_at GNAI3 2773 0.06 -1.41 -0.26 -0.71 0.93 0.76 -1.11 1.64 0.09 201180_s_at GNAI3 2773 0.95 0.72 -1.01 -0.09 1.66 -1.38 0.29 -0.77 -0.37 201181_at GNAI3 2773 1.79 0.79 -1.35 0.24 0.36 -1.13 -0.78 0.35 -0.27 201182_s_at CHD4 1108 -0.39 -0.18 -1.00 -0.72 -0.03 1.21 -1.31 1.44 0.98 201183_s_at CHD4 1108 -1.41 0.28 -0.66 -0.91 -0.07 1.45 -0.63 0.67 1.28

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201184_s_at CHD4 1108 -0.87 -0.01 -0.83 -1.22 -0.92 0.85 0.46 1.27 1.27 201185_at PRSS11 5654 -0.15 -0.40 0.86 -1.58 -0.02 1.66 -1.13 0.08 0.69 201186_at LRPAP1 4043 1.53 -0.96 -0.59 0.36 -0.62 -1.42 1.27 0.40 0.03 201187_s_at ITPR3 3710 0.92 -1.03 0.33 -0.78 -0.08 1.47 0.50 0.33 -1.66 201188_s_at ITPR3 3710 -0.31 -0.75 -0.74 -0.92 1.08 -0.30 -0.14 -0.04 2.14 201189_s_at ITPR3 3710 1.26 -0.13 -0.24 1.06 1.14 -1.48 0.11 -1.14 -0.58 201190_s_at 1.34 0.93 -0.34 0.00 0.01 -1.96 -0.84 0.80 0.06 201191_at 0.77 0.71 -0.51 0.44 0.89 -1.62 1.03 -1.32 -0.39 201192_s_at PITPN 5306 1.00 0.82 -0.62 -0.89 1.45 -1.45 -0.40 0.64 -0.56 201193_at IDH1 3417 -0.14 -2.20 1.29 0.03 -0.48 0.46 0.59 0.74 -0.30 201194_at SEPW1 6415 0.07 0.11 1.66 -0.46 0.07 1.07 -0.19 -1.88 -0.45

234 201195_s_at SLC7A5 8140 1.39 -0.31 -0.16 1.32 -0.27 -0.67 0.98 -0.91 -1.36 201196_s_at AMD1 262 1.46 -2.19 0.65 0.48 -0.37 0.06 0.31 -0.11 -0.30 201197_at AMD1 262 1.12 -0.79 -0.27 1.99 0.28 -0.49 -0.01 -0.81 -1.01 201198_s_at PSMD1 5707 -1.38 -0.10 -0.13 -1.03 0.83 -0.06 -0.80 1.39 1.29 201199_s_at PSMD1 5707 -0.43 0.63 -0.71 -0.56 1.45 0.31 -1.68 -0.21 1.21 201200_at CREG 8804 0.83 0.68 -0.72 0.03 -0.09 -2.27 0.95 0.14 0.44 201201_at CSTB 1476 -0.76 -0.79 -0.28 -0.59 -1.11 1.94 -0.01 0.86 0.75 201202_at PCNA 5111 -1.70 1.18 0.99 -0.99 0.82 -0.19 0.66 -0.03 -0.73 201203_s_at RRBP1 6238 -1.63 -0.43 -1.09 0.79 1.08 1.44 -0.21 -0.03 0.08 201204_s_at -0.55 1.84 -1.04 0.00 1.31 -0.25 0.26 -0.97 -0.60 201205_at RRBP1 6238 -0.27 0.03 -0.69 -0.57 2.13 0.00 -1.20 0.96 -0.39 201206_s_at RRBP1 6238 0.18 -0.24 -0.44 -0.86 -1.42 -0.50 0.63 0.74 1.92 201207_at TNFAIP1 7126 -1.13 -0.12 -0.33 -1.19 1.42 0.45 -1.02 0.91 1.02 201208_s_at TNFAIP1 7126 -0.16 -0.46 -1.62 -0.17 -0.03 0.94 0.34 -0.70 1.88 201209_at HDAC1 3065 -1.25 0.60 0.36 -0.53 -0.87 0.21 1.87 0.59 -0.98 201210_at DDX3 1654 1.27 1.08 -0.27 1.04 -0.17 -1.46 -0.07 -0.06 -1.35

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201211_s_at DDX3 1654 1.75 -1.37 0.09 -0.17 -0.65 0.63 -1.10 0.95 -0.12 201212_at LGMN 5641 -1.26 -0.66 0.01 -1.09 -0.21 1.55 -0.34 0.78 1.24 201213_at PPP1R7 5510 0.39 1.13 -0.90 -1.12 0.43 0.45 -0.88 -1.00 1.50 201214_s_at PPP1R7 5510 -1.47 -0.52 -0.55 -0.41 -0.54 1.11 0.81 -0.10 1.68 201215_at PLS3 5358 -0.86 -0.40 -1.38 -0.91 0.13 1.40 0.29 0.25 1.48 201216_at C12orf8 10961 0.60 -1.69 0.87 -0.32 -1.36 0.02 1.36 0.43 0.08 201217_x_at RPL3 6122 0.90 -1.24 0.99 0.09 -1.31 -0.34 1.59 -0.39 -0.27 201218_at CTBP2 1488 -0.49 1.41 0.33 -1.10 0.58 -0.58 -1.62 0.84 0.61 201219_at CTBP2 1488 -1.64 0.35 -0.89 1.00 0.23 0.14 -0.34 -0.55 1.69 201220_x_at CTBP2 1488 -1.44 1.73 0.52 -0.20 0.55 0.03 -1.16 -0.68 0.65 201221_s_at SNRP70 6625 -1.24 0.24 0.79 -0.41 -0.42 0.98 -0.52 -1.11 1.70

235 201222_s_at RAD23B 5887 0.20 0.11 -1.11 1.02 -1.21 1.02 1.38 -1.02 -0.39 201223_s_at RAD23B 5887 0.25 0.49 -0.64 0.50 0.75 -0.14 1.54 -1.07 -1.70 201224_s_at SRRM1 10250 -0.35 -0.67 0.43 -0.42 -1.39 1.80 -0.76 0.31 1.06 201225_s_at SRRM1 10250 -0.89 1.34 -0.01 0.22 1.42 -0.04 0.27 -1.68 -0.63 201226_at NDUFB8 4714 -0.55 -0.70 1.94 -0.97 -0.89 0.49 1.08 0.07 -0.45 201227_s_at NDUFB8 4714 0.21 -1.28 -0.90 1.19 -0.25 -0.76 0.67 1.64 -0.51 201228_s_at ARIH2 10425 -0.13 -0.24 1.53 -0.27 1.26 -0.11 -1.62 0.55 -0.97 201229_s_at ARIH2 10425 -1.09 0.06 0.63 1.29 1.65 -0.30 -1.08 -0.60 -0.56 201230_s_at ARIH2 10425 0.84 0.54 -1.19 -1.24 -0.87 -0.56 1.48 0.83 0.17 201231_s_at ENO1 2023 -0.97 -0.58 -0.78 -0.88 -0.43 1.80 0.00 0.62 1.22 201232_s_at PSMD13 5719 0.12 -0.61 -0.66 2.16 -0.20 -0.93 -0.83 0.92 0.04 201233_at PSMD13 5719 -0.25 0.06 1.09 -0.70 -0.76 -0.27 -0.96 2.13 -0.32 201234_at ILK 3611 -1.41 0.81 0.71 -0.62 -0.31 1.25 -1.03 -0.56 1.16 201235_s_at BTG2 7832 2.18 -0.46 -0.11 -1.03 0.85 -0.53 0.10 -0.03 -0.95 201236_s_at BTG2 7832 2.12 -0.08 -0.17 0.72 0.05 -0.80 0.11 -0.55 -1.40 201237_at CAPZA2 830 0.13 0.93 -0.99 0.04 2.07 -0.05 -1.07 -0.28 -0.77

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201238_s_at CAPZA2 830 -0.01 2.07 -0.08 0.36 0.64 -1.52 -0.31 -0.43 -0.72 201239_s_at KIAA0102 9789 -0.31 -1.53 0.16 -1.13 -0.13 1.10 1.07 1.26 -0.48 201240_s_at KIAA0102 9789 0.95 1.35 1.14 -0.44 0.11 -1.21 -0.96 0.19 -1.14 201241_at DDX1 1653 0.57 1.70 -0.86 1.38 -0.79 -1.04 -0.27 -0.19 -0.50 201242_s_at ATP1B1 481 -1.03 -1.32 -1.25 0.21 1.09 0.65 0.33 1.35 -0.03 201243_s_at ATP1B1 481 0.50 -0.93 -0.28 -1.53 0.17 -0.13 0.61 1.96 -0.36 201244_s_at RAF1 5894 0.71 0.91 0.20 0.18 0.07 -1.87 0.92 -1.45 0.29 201245_s_at FLJ20113 55611 -2.35 0.67 -0.16 0.29 -0.63 0.32 0.38 1.02 0.43 201246_s_at FLJ20113 55611 -0.79 0.35 -0.27 0.12 -0.11 0.64 -1.00 2.14 -1.06 201247_at SREBF2 6721 -1.12 0.92 -1.68 -0.25 0.39 1.54 -0.45 0.34 0.31 201248_s_at SREBF2 6721 -1.55 0.50 -0.51 -0.73 0.67 1.43 -1.09 0.70 0.56

236 201249_at SLC2A1 6513 -0.66 0.85 0.52 -0.25 -0.11 -0.54 -0.31 -1.46 1.98 201250_s_at SLC2A1 6513 0.43 0.33 -0.74 -1.18 0.21 -1.73 0.62 0.70 1.34 201251_at PKM2 5315 -0.81 1.75 -0.08 0.49 -0.20 1.10 -1.57 -0.15 -0.52 201252_at PSMC4 5704 -0.65 1.24 1.18 0.99 -1.27 0.53 -0.69 -0.24 -1.08 201253_s_at CDIPT 10423 -1.01 1.29 1.52 -0.80 0.64 -0.98 -0.77 -0.33 0.45 201254_x_at RPS6 6194 0.56 -1.53 0.42 0.23 -1.20 0.14 1.03 1.28 -0.95 201255_x_at BAT3 7917 0.11 -1.12 -0.34 1.63 -0.29 0.28 -0.03 -1.48 1.24 201256_at COX7A2L 9167 1.47 -1.47 0.55 0.72 -0.72 -0.76 1.13 -0.47 -0.43 201257_x_at RPS3A 6189 -0.36 -0.86 -0.85 -0.51 -1.10 0.23 1.75 1.25 0.45 201258_at RPS16 6217 1.47 -0.77 -0.32 0.44 0.17 -1.13 1.14 0.45 -1.44 201259_s_at SYPL 6856 0.04 -1.35 0.94 0.17 -0.08 0.53 -1.46 1.62 -0.41 201260_s_at SYPL 6856 -0.15 1.43 -0.49 -0.32 1.81 -0.20 -1.16 0.01 -0.92 201261_x_at BGN 633 0.81 -0.64 0.12 -0.44 -0.36 1.71 -1.54 0.94 -0.60 201262_s_at BGN 633 -1.16 -0.29 -0.25 0.52 -0.98 -0.47 0.31 0.12 2.21 201263_at TARS 6897 1.05 0.02 0.46 1.58 -0.96 0.09 0.15 -1.59 -0.81 201264_at COPE 11316 0.04 -0.46 -0.85 1.72 -0.55 0.32 1.31 -1.36 -0.17

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201265_at FTL 2512 0.30 1.78 -0.38 -1.62 -0.74 -0.30 -0.47 0.83 0.60 201266_at TXNRD1 7296 1.19 -1.04 0.41 1.50 -0.54 -1.05 0.72 -0.13 -1.04 201267_s_at PSMC3 5702 -1.30 -0.62 -0.05 -0.76 -0.55 1.50 -0.36 0.72 1.44 201268_at NME2 4831 -0.49 -1.40 0.50 0.12 -1.44 0.24 1.70 0.68 0.08 201269_s_at KIAA1068 23386 2.04 -0.58 -0.65 -1.04 0.46 0.23 0.80 -0.31 -0.96 201270_x_at KIAA1068 23386 -1.24 1.28 0.24 -1.15 1.14 0.50 -1.31 0.29 0.24 201271_s_at RALY 22913 -0.58 -1.40 1.58 0.32 -0.23 -1.04 0.43 -0.35 1.27 201272_at AKR1B1 231 1.24 0.47 0.19 0.08 -0.59 -1.30 1.38 0.00 -1.48 201273_s_at SRP9 6726 0.37 1.41 1.17 0.71 0.11 -1.03 -0.95 -0.50 -1.31 201274_at PSMA5 5686 1.00 1.84 -0.25 -0.01 0.17 -0.95 0.36 -0.88 -1.28 201275_at FDPS 2224 -0.90 1.13 -1.12 -0.76 -0.70 0.63 0.39 -0.36 1.68

237 201276_at RAB5B 5869 0.08 1.80 0.07 0.40 0.36 -0.72 -0.78 -1.73 0.51 201277_s_at HNRPAB 3182 1.13 0.67 -0.32 0.84 0.25 -1.08 0.94 -0.82 -1.61 201278_at -1.50 -1.19 0.77 0.98 -0.30 0.27 1.20 0.61 -0.85 201279_s_at DAB2 1601 -1.22 -0.57 0.89 0.95 -0.75 0.98 -1.10 -0.41 1.23 201280_s_at DAB2 1601 -2.06 -0.13 0.04 1.45 0.70 -0.73 -0.13 0.73 0.11 201281_at ADRM1 11047 1.09 -1.46 -0.90 -0.58 -0.03 -0.32 0.32 1.80 0.10 201282_at OGDH 4967 -1.39 1.22 -0.49 -0.54 -0.20 0.49 -1.12 0.63 1.42 201283_s_at APEH 327 -0.87 -0.36 -0.14 0.41 0.82 0.09 -1.77 1.74 0.07 201284_s_at APEH 327 -0.56 -1.62 0.34 -0.87 0.22 -0.06 1.42 -0.27 1.41 201285_at MKRN1 23608 -0.24 0.47 0.82 -0.49 -0.64 0.89 0.72 -2.15 0.63 201286_at -0.07 -0.53 -1.27 -0.11 0.21 0.15 -1.06 0.55 2.13 201287_s_at SDC1 6382 -0.99 0.65 0.43 -1.23 1.80 0.47 -0.94 -0.57 0.39 201288_at ARHGDIB 397 -1.54 0.13 -0.28 -0.82 -0.87 1.58 0.13 0.60 1.07 201289_at CYR61 3491 -0.88 -0.60 0.56 -0.43 -0.46 0.09 -0.37 -0.31 2.42 201290_at SPC18 23478 1.05 -0.81 0.48 1.74 -0.70 -1.12 0.45 -0.12 -0.97 201291_s_at TOP2A 7153 -0.41 -1.23 0.80 0.79 1.10 -1.77 0.50 -0.30 0.52

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201292_at TOP2A 7153 -0.64 -1.80 -0.31 0.72 -0.06 -0.82 0.88 0.74 1.29 201293_x_at PPIA 5478 -1.18 -0.59 -0.21 -1.11 -0.89 1.25 0.86 0.89 1.00 201294_s_at WSB1 26118 0.06 0.00 -1.01 -1.04 0.31 2.10 -1.00 -0.01 0.57 201295_s_at WSB1 26118 -0.79 -0.48 2.01 -0.66 1.14 0.09 -1.11 0.06 -0.24 201296_s_at WSB1 26118 0.82 0.50 0.11 1.90 0.02 -1.11 -0.19 -0.99 -1.08 201297_s_at C2orf6 55233 -0.35 1.43 0.47 0.01 1.44 -0.24 -0.18 -1.03 -1.53 201298_s_at C2orf6 55233 0.44 -0.21 1.55 0.51 -0.65 0.30 -2.08 -0.25 0.38 201299_s_at C2orf6 55233 0.17 0.66 -0.41 0.55 1.23 0.08 -1.78 0.78 -1.30 201300_s_at PRNP 5621 0.86 -0.36 0.08 1.83 -0.23 -1.27 0.68 -0.39 -1.20 201301_s_at ANXA4 307 -0.81 -1.29 0.06 -0.60 -0.34 1.12 -0.17 0.07 1.97 201302_at ANXA4 307 -1.57 -0.30 -0.32 -1.16 0.85 1.42 -0.10 0.11 1.08

238 201303_at KIAA0111 9775 -2.20 -0.46 0.83 0.53 0.66 0.31 -0.76 0.86 0.22 201304_at NDUFA5 4698 -0.95 1.62 -0.69 0.09 -0.20 0.70 -0.09 1.05 -1.51 201305_x_at ANP32B 10541 -1.78 1.19 0.79 0.39 -0.39 1.24 -0.33 -0.27 -0.84 201306_s_at ANP32B 10541 -1.06 0.97 -0.11 -0.81 -0.01 -0.53 0.82 1.78 -1.05 201307_at FLJ10849 55752 -0.45 0.66 -0.40 -0.23 -0.64 1.00 0.41 -1.82 1.48 201308_s_at FLJ10849 55752 -0.41 1.35 -0.42 -1.39 -0.79 1.44 -0.70 0.12 0.80 201309_x_at P311 9315 -0.12 -0.35 0.63 -0.61 -0.67 1.76 -1.25 -0.61 1.24 201310_s_at P311 9315 -0.99 -0.03 -0.01 -0.84 0.12 1.42 -0.98 -0.43 1.75 201311_s_at SH3BGRL 6451 0.41 0.05 1.58 -0.12 0.10 0.24 -1.86 0.71 -1.11 201312_s_at SH3BGRL 6451 -1.27 -0.23 0.16 -1.71 1.17 0.02 1.24 -0.01 0.63 201313_at ENO2 2026 -0.16 0.16 -1.87 0.64 1.58 -1.01 0.53 -0.21 0.34 201314_at STK25 10494 0.40 1.08 -0.34 -0.07 -0.66 -1.91 0.73 -0.50 1.28 201315_x_at IFITM2 10581 -1.84 -0.81 0.15 0.28 0.92 1.54 0.41 -0.63 -0.03 201316_at PSMA2 5683 0.26 0.14 -0.04 -1.54 1.35 -0.11 -0.72 1.54 -0.88 201317_s_at PSMA2 5683 -1.24 0.19 0.20 -0.23 -0.01 -0.04 0.99 1.70 -1.56 201318_s_at MLCB 10627 -0.37 0.01 -1.12 -1.58 -0.61 1.35 0.90 0.86 0.56

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201319_at MLCB 10627 -0.47 0.61 0.30 -2.35 0.61 0.32 -0.22 1.11 0.07 201320_at SMARCC2 6601 -0.02 0.77 1.79 -0.72 0.41 -1.02 0.31 -1.53 0.01 201321_s_at SMARCC2 6601 1.56 1.48 -0.64 -0.44 0.30 0.09 -1.05 -1.23 -0.07 201322_at ATP5B 506 -0.92 -0.57 -0.48 -1.08 -0.98 1.45 0.81 0.67 1.10 201323_at EBNA1BP2 10969 -0.47 2.40 -0.84 -1.10 0.10 0.15 0.05 -0.14 -0.14 201324_at EMP1 2012 -0.95 -1.33 -0.24 0.00 1.17 -0.21 0.23 -0.52 1.86 201325_s_at EMP1 2012 1.23 -1.09 -0.65 1.17 -1.25 0.56 -0.13 -0.79 0.96 201326_at CCT6A 908 0.12 0.98 -0.25 0.52 -0.24 -1.16 1.11 0.76 -1.85 201327_s_at CCT6A 908 0.34 0.76 -0.83 0.96 0.79 -0.67 -0.16 0.77 -1.98 201328_at 1.92 -0.12 -0.62 1.02 0.58 -1.21 -0.30 -0.38 -0.88 201329_s_at ETS2 2114 1.89 0.29 -0.47 0.57 -1.07 -1.23 0.81 -0.22 -0.58

239 201330_at RARS 5917 0.40 -1.78 -0.14 0.02 -0.04 0.37 1.27 1.14 -1.24 201331_s_at STAT6 6778 -1.19 1.27 -1.61 0.93 0.61 0.52 0.30 -0.83 0.01 201332_s_at STAT6 6778 -0.22 1.27 -1.17 0.89 0.62 0.84 -1.00 -1.40 0.17 201333_s_at ARHGEF12 23365 -0.65 -0.76 -0.58 -0.67 0.21 1.16 -1.22 1.42 1.10 201334_s_at ARHGEF12 23365 -0.22 1.48 -0.53 -0.47 1.71 -0.48 -1.41 0.10 -0.17 201335_s_at ARHGEF12 23365 0.10 0.25 -0.38 -0.59 -0.51 2.53 -0.46 -0.67 -0.25 201336_at VAMP3 9341 0.22 -1.96 -0.10 0.20 -0.96 1.19 1.11 -0.28 0.57 201337_s_at VAMP3 9341 -0.08 -0.93 1.47 -0.29 -0.58 1.41 -1.40 -0.25 0.67 201338_x_at GTF3A 2971 0.01 0.47 1.75 0.41 -1.88 -0.26 -0.54 0.56 -0.51 201339_s_at SCP2 6342 0.54 -1.12 1.32 0.85 0.15 0.94 -0.72 -0.44 -1.51 201340_s_at ENC1 8507 -1.08 0.33 0.99 0.95 -0.69 1.52 -0.12 -0.62 -1.27 201341_at ENC1 8507 -0.99 -0.01 1.47 -1.06 -0.84 0.80 -0.96 1.05 0.54 201342_at SNRPC 6631 -0.30 -0.50 -0.81 -0.07 -0.64 0.38 1.03 2.02 -1.10 201343_at UBE2D2 7322 0.40 0.68 -0.66 0.12 1.24 -1.02 0.74 0.38 -1.89 201344_at UBE2D2 7322 -1.37 -0.19 -0.68 0.21 -0.88 -0.06 0.01 1.91 1.06 201345_s_at UBE2D2 7322 1.13 -0.99 1.78 -0.70 -0.56 -0.58 0.26 0.62 -0.96

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201346_at FLJ21432 79602 0.04 -0.05 1.04 -0.39 -0.15 -1.80 0.85 -0.92 1.37 201347_x_at GRHPR 9380 -2.05 0.78 -0.16 -0.58 0.18 -0.30 -0.15 1.20 1.08 201348_at GPX3 2878 0.05 1.30 0.90 0.78 -0.19 0.16 -2.06 -0.31 -0.65 201349_at SLC9A3R1 9368 -1.05 -0.08 -1.51 0.34 -0.33 -0.18 -0.10 1.37 1.55 201350_at FLOT2 2319 -0.58 0.15 0.53 0.93 -1.03 0.74 0.64 -2.01 0.61 201351_s_at YME1L1 10730 0.02 -0.01 1.17 0.63 0.69 -1.85 0.22 -1.39 0.51 201352_at YME1L1 10730 0.67 2.02 0.22 -0.60 0.15 -1.43 -0.01 -0.05 -0.96 201353_s_at BAZ2A 11176 -0.56 0.51 -2.03 0.05 0.87 -0.96 0.47 0.90 0.73 201354_s_at BAZ2A 11176 0.88 0.37 -0.64 -2.15 -0.23 0.32 -0.04 1.35 0.13 201355_s_at BAZ2A 11176 0.41 -0.11 -0.71 -1.76 -0.01 -0.28 0.37 1.98 0.10 201356_at 1.56 1.49 -0.10 0.27 0.00 -0.75 -0.23 -0.91 -1.33

240 201357_s_at SF3A1 10291 -0.68 -1.29 0.44 0.90 -0.98 0.76 -0.71 -0.08 1.65 201358_s_at COPB 1315 -0.39 0.51 0.58 -1.88 0.08 -0.02 -1.06 0.80 1.37 201359_at COPB 1315 -1.17 0.27 0.88 -1.61 0.02 1.12 -0.80 0.18 1.10 201360_at CST3 1471 -0.08 0.18 1.51 -0.24 0.23 1.46 -1.04 -1.35 -0.66 201361_at MGC5508 79073 -0.97 -0.28 -0.30 -1.42 -0.24 1.21 -0.10 0.34 1.78 201362_at NS1-BP 10625 -1.68 0.77 -0.04 -1.10 0.64 0.78 -0.20 -0.57 1.38 201363_s_at NS1-BP 10625 -1.33 0.59 -0.21 -1.00 0.38 1.07 -1.04 -0.01 1.55 201364_s_at OAZ2 4947 -0.04 -0.72 0.16 -1.14 -0.80 0.59 -0.94 1.37 1.52 201365_at OAZ2 4947 -0.38 1.86 -1.19 -1.12 -0.43 0.78 -0.36 -0.02 0.87 201366_at ANXA7 310 -0.12 2.32 0.68 -0.98 -0.32 -0.20 -0.21 -0.19 -0.95 201367_s_at ZFP36L2 678 -1.07 1.06 0.12 1.40 0.53 0.44 -0.04 -1.57 -0.88 201368_at ZFP36L2 678 -0.18 -1.15 2.29 -0.21 -1.02 0.45 -0.21 0.12 -0.07 201369_s_at ZFP36L2 678 -1.15 0.34 -0.42 0.64 1.81 0.47 0.42 -1.13 -0.98 201370_s_at CUL3 8452 -1.08 0.13 0.68 -0.80 0.40 -0.27 -1.18 2.00 0.12 201371_s_at CUL3 8452 0.68 -0.24 0.51 1.77 -0.71 -1.02 0.86 -0.92 -0.94 201372_s_at CUL3 8452 0.96 -0.92 -0.50 2.09 -0.70 0.37 0.06 -0.60 -0.74

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201373_at PLEC1 5339 -1.41 -0.89 0.59 0.24 -0.83 0.61 -0.28 0.06 1.90 201374_x_at PPP2CB 5516 0.18 -0.71 -1.05 0.12 0.08 0.41 -1.18 2.17 -0.03 201375_s_at PPP2CB 5516 0.81 -0.41 -0.63 1.95 -1.18 -1.10 0.12 0.55 -0.09 201376_s_at HNRPF 3185 1.71 -1.59 1.11 0.48 -0.60 -0.67 0.13 -0.46 -0.10 201377_at NICE-4 9898 -0.70 2.03 -0.42 -0.10 0.30 -0.35 -1.18 1.06 -0.64 201378_s_at NICE-4 9898 -0.04 1.83 -0.14 0.46 0.91 -0.47 -1.69 -0.66 -0.17 201379_s_at TPD52L2 7165 1.51 1.47 -0.98 0.26 0.45 -0.47 -0.26 -0.92 -1.06 201380_at CRTAP 10491 1.68 0.20 -1.00 0.90 -0.57 -1.58 0.53 0.17 -0.34 201381_x_at SIP 27101 -1.77 0.32 1.08 -0.89 0.19 1.61 -0.19 -0.24 -0.10 201382_at SIP 27101 0.27 1.65 0.94 -0.84 -0.74 -0.78 -0.47 1.02 -1.06 201383_s_at M17S2 4077 -1.18 0.69 -0.25 -1.30 0.08 1.34 -0.44 -0.41 1.46

241 201384_s_at M17S2 4077 -1.23 1.19 0.20 -0.46 -0.75 1.13 0.00 -1.24 1.17 201385_at DDX15 1665 1.06 -0.38 -0.28 1.14 -1.10 -1.18 1.46 0.01 -0.72 201386_s_at DDX15 1665 1.73 -1.38 0.00 0.86 -0.89 -0.79 -0.34 -0.05 0.87 201387_s_at UCHL1 7345 -0.69 0.74 -1.06 -0.42 -0.30 0.15 -1.21 1.13 1.65 201388_at PSMD3 5709 -0.88 1.49 -1.83 -0.15 -0.12 0.59 -0.02 1.08 -0.16 201389_at ITGA5 3678 0.25 0.10 -0.64 0.90 0.12 -0.02 1.83 -1.38 -1.17 201390_s_at CSNK2B 1460 -0.68 0.62 -1.44 -0.41 -1.27 1.26 0.32 1.13 0.48 201391_at TRAP1 10131 -0.63 -0.13 -0.65 -0.12 -1.23 0.45 -0.73 1.27 1.79 201392_s_at IGF2R 3482 -1.63 0.43 -0.79 0.01 0.23 0.60 -1.16 1.21 1.10 201393_s_at IGF2R 3482 -0.59 2.06 -1.22 -0.37 0.25 0.82 -0.69 -0.60 0.35 201394_s_at RBM5 10181 -0.84 0.13 -0.46 1.11 0.35 -1.39 -0.70 0.01 1.79 201395_at RBM5 10181 -0.90 0.79 0.93 0.53 -1.48 -0.27 -0.40 -0.73 1.54 201396_s_at SGT 6449 -1.87 0.82 0.19 0.66 1.54 -0.04 0.01 -0.52 -0.80 201397_at PHGDH 26227 1.57 -0.01 0.10 1.30 0.38 -0.94 -0.11 -1.41 -0.87 201398_s_at TRAM 23471 -0.60 1.14 -0.81 -0.51 0.11 -1.26 1.72 -0.52 0.72 201399_s_at TRAM 23471 -0.44 -1.39 1.59 -0.05 -0.26 1.29 -1.20 0.15 0.31

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201400_at PSMB3 5691 -0.14 1.41 -0.43 0.11 -0.07 -1.01 0.92 0.94 -1.72 201401_s_at ADRBK1 156 -0.92 0.68 -0.31 -0.11 0.76 1.92 -0.86 -1.23 0.06 201402_at ADRBK1 156 -0.77 -0.61 1.59 -0.93 -0.78 1.40 -0.36 -0.37 0.85 201403_s_at MGST3 4259 0.25 -0.90 0.20 0.19 -1.95 -0.15 0.31 1.72 0.31 201404_x_at PSMB2 5690 -0.70 -0.93 -0.10 -1.73 -0.27 0.98 1.05 0.88 0.81 201405_s_at COPS6 10980 -0.37 -1.30 0.16 -0.71 -1.18 0.28 0.29 1.58 1.24 201406_at RPL36A 6173 0.83 -1.01 -0.07 0.43 -0.40 -0.79 1.47 0.99 -1.45 201407_s_at PPP1CB 5500 0.39 -0.56 1.08 -0.27 1.21 -1.31 0.29 0.73 -1.56 201408_at -0.14 1.36 -0.28 -0.17 0.95 -0.39 1.05 -0.49 -1.89 201409_s_at PPP1CB 5500 -0.05 1.53 0.34 -0.22 1.19 0.09 -0.08 -1.21 -1.60 201410_at 0.23 -1.82 0.92 1.41 -0.73 0.46 0.18 0.26 -0.93

242 201411_s_at PLEKHB2 55041 -0.81 -0.42 1.29 0.05 0.81 0.88 -1.92 0.46 -0.35 201412_at LRP10 26020 0.35 1.51 -0.48 1.17 -1.10 -0.05 0.56 -1.48 -0.48 201413_at HSD17B4 3295 -0.58 -1.49 -0.92 0.58 -0.77 0.54 0.85 0.20 1.59 201414_s_at NAP1L4 4676 -0.27 0.19 -1.13 -1.45 0.82 -0.13 0.17 -0.13 1.93 201415_at GSS 2937 -0.52 0.69 -0.94 -0.65 -0.55 0.09 -0.21 -0.22 2.34 201416_at -0.54 0.56 0.00 -0.01 0.14 -1.50 2.04 0.23 -0.92 201417_at 0.61 0.17 1.14 1.26 -0.60 -0.97 0.73 -1.06 -1.30 201418_s_at SOX4 6659 -0.93 2.22 0.62 -0.63 -0.88 -0.48 0.40 0.11 -0.42 201419_at BAP1 8314 0.05 2.14 -0.87 -0.15 0.87 -0.54 -1.08 -0.57 0.17 201420_s_at MEP50 79084 -1.39 0.98 -0.16 -0.45 0.18 0.85 -1.50 0.12 1.34 201421_s_at MEP50 79084 -0.28 -0.47 -0.57 -1.31 1.63 1.40 -0.70 0.63 -0.31 201422_at IFI30 10437 -0.82 -1.43 0.09 -0.50 -1.06 1.25 0.43 1.00 1.04 201423_s_at CUL4A 8451 0.37 -1.56 1.24 -1.30 0.99 -0.86 0.36 0.48 0.25 201424_s_at CUL4A 8451 0.24 1.89 -0.24 0.57 0.85 -0.61 -1.41 -0.63 -0.65 201425_at ALDH2 217 0.66 -0.14 0.31 0.99 0.22 -1.03 1.48 -1.30 -1.19 201426_s_at VIM 7431 -0.93 -0.73 -0.62 -0.75 -0.84 1.77 0.31 0.89 0.90

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201427_s_at SEPP1 6414 -0.90 -0.32 -0.02 -0.62 0.04 0.68 -0.68 -0.50 2.34 201428_at CLDN4 1364 -0.51 -0.09 0.99 0.18 -1.19 -1.18 1.96 -0.15 -0.01 201429_s_at RPL37A 6168 -0.07 -1.21 -0.67 -0.74 -0.98 1.14 0.45 1.68 0.40 201430_s_at DPYSL3 1809 1.41 1.93 -0.35 -0.22 -0.11 -1.02 -0.53 -0.33 -0.76 201431_s_at DPYSL3 1809 1.88 1.31 -0.49 0.07 -0.23 -1.09 -0.23 -0.16 -1.05 201432_at CAT 847 1.15 -1.46 1.12 1.14 -0.48 0.02 -0.07 -0.12 -1.30 201433_s_at PTDSS1 9791 -0.02 0.24 -1.23 -1.09 1.17 -0.74 1.25 1.11 -0.67 201434_at TTC1 7265 -0.38 -0.70 -1.21 -0.48 -0.98 1.26 1.62 0.58 0.27 201435_s_at EIF4E 1977 -1.17 -0.09 -0.45 -0.87 0.71 -0.50 -0.44 1.99 0.83 201436_at EIF4E 1977 0.17 1.22 -1.13 -0.82 1.55 -1.06 -0.57 0.78 -0.14 201437_s_at EIF4E 1977 0.36 1.78 -0.48 -0.36 0.96 -1.15 0.66 -0.80 -0.97

243 201438_at COL6A3 1293 -0.77 0.19 -0.12 -1.19 -0.54 -0.68 1.42 1.77 -0.07 201439_at GBF1 8729 -0.51 0.63 -1.62 -0.14 -0.97 0.96 -0.26 0.31 1.61 201440_at U5-100K 9416 -0.49 1.37 -0.65 -0.17 -1.05 -0.48 1.96 -0.01 -0.45 201441_at COX6B 1340 0.37 -0.11 -0.60 0.25 -0.99 -0.43 1.98 0.82 -1.27 201442_s_at ATP6IP2 10159 -1.06 -0.44 -0.17 -1.08 -0.37 0.93 -0.24 2.04 0.40 201443_s_at ATP6IP2 10159 -1.98 1.03 -0.12 0.23 -1.00 1.05 0.28 0.78 -0.27 201444_s_at ATP6IP2 10159 -0.81 0.43 0.94 -0.95 -0.45 -0.22 -1.19 0.37 1.87 201445_at CNN3 1266 0.60 2.20 0.47 -0.23 -1.15 -0.56 -0.61 -0.03 -0.66 201446_s_at TIA1 7072 -0.97 0.42 -0.11 -1.30 0.93 0.12 -1.13 1.68 0.36 201447_at -0.75 0.40 -1.01 -0.92 -0.27 2.01 -0.25 1.06 -0.25 201448_at -0.54 1.74 -0.35 -0.74 1.34 -0.78 -0.94 0.68 -0.41 201449_at -1.01 0.89 -0.40 -0.77 1.29 1.47 0.03 -0.30 -1.20 201450_s_at TIA1 7072 -0.10 -0.68 -0.02 -0.63 -0.24 1.60 -1.70 0.88 0.88 201451_x_at RHEB2 6009 1.05 -0.66 0.37 0.39 -0.93 -0.70 -1.58 0.75 1.31 201452_at -0.25 -1.10 -0.07 2.18 -0.12 0.33 0.67 -0.95 -0.67 201453_x_at RHEB2 6009 0.49 -1.19 1.46 1.59 -0.41 -1.06 -0.45 -0.33 -0.07

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201454_s_at NPEPPS 9520 0.59 0.58 -0.41 -0.64 1.11 0.12 -1.67 -0.97 1.30 201455_s_at NPEPPS 9520 -0.29 1.74 1.46 -0.77 -0.06 0.08 -0.74 -1.22 -0.20 201456_s_at BUB3 9184 -1.08 -1.28 -0.45 0.71 1.40 1.49 -0.17 -0.36 -0.24 201457_x_at BUB3 9184 -0.58 -0.13 0.68 -2.23 0.38 0.36 -0.33 0.76 1.09 201458_s_at BUB3 9184 0.58 -1.07 0.12 1.13 -0.11 -1.36 1.67 -0.65 -0.32 201459_at RUVBL2 10856 -1.08 1.83 0.11 0.60 -0.11 -0.97 -0.53 1.03 -0.87 201460_at MAPKAPK2 9261 0.90 -0.32 -0.75 0.30 0.61 -0.68 1.86 -1.29 -0.63 201461_s_at MAPKAPK2 9261 0.50 0.72 -0.93 1.79 0.61 0.06 -0.63 -1.24 -0.88 201462_at KIAA0193 9805 -0.32 0.70 0.25 -0.44 0.26 2.16 -1.00 -0.64 -0.98 201463_s_at TALDO1 6888 0.97 0.32 0.97 0.09 -1.16 -1.39 1.07 0.31 -1.19 201464_x_at JUN 3725 0.48 -0.09 0.57 1.83 -0.23 -1.43 0.58 -0.61 -1.10

244 201465_s_at JUN 3725 0.20 -0.20 0.67 1.42 0.29 -1.85 0.91 -0.68 -0.76 201466_s_at JUN 3725 1.15 -0.12 0.33 1.68 -0.19 -1.30 0.21 -0.47 -1.29 201467_s_at NQO1 1728 0.08 1.75 0.59 0.13 0.00 -0.36 -0.69 0.42 -1.93 201468_s_at NQO1 1728 1.29 1.79 -0.01 -0.30 -0.52 -1.06 -0.07 0.14 -1.25 201469_s_at SHC1 6464 0.04 -0.31 -0.66 0.03 0.60 0.19 -2.05 1.58 0.55 201470_at GSTTLp28 9446 0.94 -1.72 0.35 0.45 -1.11 -0.08 1.11 0.82 -0.79 201471_s_at SQSTM1 8878 1.51 0.27 0.61 0.56 0.05 -1.45 0.45 -0.49 -1.53 201472_at VBP1 7411 -0.36 1.54 -0.57 0.47 1.58 -0.54 -0.11 -1.22 -0.77 201473_at JUNB 3726 1.10 1.20 0.32 1.06 0.09 -0.55 -0.68 -1.06 -1.47 201474_s_at ITGA3 3675 -0.57 -0.82 -0.71 0.94 -0.02 1.95 0.29 -1.27 0.22 201475_x_at MARS 4141 -0.20 0.36 0.13 -0.46 1.05 -0.80 1.76 -1.63 -0.21 201476_s_at RRM1 6240 -1.04 -0.88 1.53 -0.37 -0.42 0.62 -0.96 1.46 0.07 201477_s_at RRM1 6240 -0.83 0.02 0.13 -0.48 1.16 -0.42 1.28 -1.75 0.88 201478_s_at DKC1 1736 0.13 -0.18 0.83 1.00 -0.50 0.10 0.27 0.68 -2.33 201479_at DKC1 1736 1.82 0.74 -0.19 -0.97 0.18 -1.33 0.24 0.49 -0.98 201480_s_at SUPT5H 6829 1.57 0.40 -0.71 0.39 0.73 0.77 -1.41 -0.78 -0.96

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201481_s_at PYGB 5834 -0.44 0.08 -0.52 -0.03 -0.65 1.99 1.27 -0.94 -0.76 201482_at QSCN6 5768 1.62 0.35 -1.45 0.73 -0.11 -0.18 0.88 -0.94 -0.91 201483_s_at SUPT4H1 6827 0.16 2.11 -0.83 -0.25 -0.61 0.07 0.09 0.64 -1.38 201484_at SUPT4H1 6827 -0.64 0.41 -0.89 -1.14 -0.57 -0.54 0.70 0.81 1.87 201485_s_at RCN2 5955 -0.09 2.09 -1.08 0.00 -0.72 -0.41 -0.86 0.97 0.11 201486_at RCN2 5955 -0.44 2.42 -0.38 -0.32 0.63 -0.59 -0.42 -0.85 -0.03 201487_at CTSC 1075 1.28 -0.36 1.28 -0.19 -0.06 -0.71 0.94 -0.48 -1.69 201488_x_at KHDRBS1 10657 -1.21 -1.23 1.64 -0.78 0.37 -0.01 -0.02 0.02 1.23 201489_at PPIF 10105 1.84 -0.49 0.23 1.01 -0.80 -0.91 0.66 -0.50 -1.03 201490_s_at PPIF 10105 2.03 -0.45 0.49 0.81 -0.69 -0.89 0.24 -0.48 -1.06 201491_at C14orf3 10598 -0.15 0.31 0.42 -0.85 -0.94 -1.29 -0.28 1.85 0.93

245 201492_s_at RPL41 6171 -0.71 -1.21 -0.29 -0.42 -1.06 1.57 0.59 1.30 0.24 201493_s_at PUM2 23369 -1.40 1.34 -0.19 -1.16 0.65 0.47 -1.05 0.92 0.42 201494_at PRCP 5547 -0.11 0.27 0.75 0.34 -1.95 0.79 -0.87 -0.53 1.31 201495_x_at MYH11 4629 -0.05 -1.00 2.36 -0.31 -0.39 0.25 0.46 -0.73 -0.57 201496_x_at MYH11 4629 -0.35 0.77 -1.21 0.51 0.38 -0.79 -0.72 1.97 -0.55 201497_x_at MYH11 4629 -0.79 -1.49 -0.75 0.43 1.42 0.22 0.93 -0.82 0.85 201498_at USP7 7874 0.11 -0.36 0.08 1.02 1.25 -1.66 -0.67 1.10 -0.87 201499_s_at USP7 7874 1.73 -1.21 0.36 1.14 -0.90 -0.52 -0.92 0.31 0.01 201500_s_at PPP1R11 6992 1.68 -0.66 1.15 0.12 -1.58 -0.58 0.19 0.30 -0.62 201501_s_at GRSF1 2926 -0.74 2.04 -0.36 -1.03 0.77 -0.33 -0.36 0.79 -0.77 201502_s_at NFKBIA 4792 1.87 1.11 -0.14 0.27 -0.51 -0.98 0.25 -0.71 -1.16 201503_at G3BP 10146 1.72 1.29 0.09 -0.24 0.03 -1.41 -0.16 -0.24 -1.07 201504_s_at TSN 7247 -0.05 -1.60 1.37 -0.41 0.14 -0.88 -0.62 0.98 1.09 201505_at LAMB1 3912 -0.77 -0.69 0.88 0.56 -1.11 0.53 1.20 0.84 -1.45 201506_at TGFBI 7045 -1.03 -0.52 0.64 -0.85 -0.59 1.87 -0.47 -0.20 1.16 201507_at PFDN1 5201 0.75 -0.79 0.79 0.52 -1.24 -0.55 1.46 -1.32 0.36

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201508_at IGFBP4 3487 -0.38 -0.28 -0.30 -0.15 -0.43 -0.35 -0.42 -0.30 2.65 201509_at IDH3B 3420 0.10 0.87 0.09 -0.03 -1.21 0.35 -0.26 1.70 -1.61 201510_at ELF3 1999 0.10 1.71 -0.57 -1.60 0.72 0.60 -0.48 0.41 -0.90 201511_at AAMP 14 0.51 -0.55 -0.82 -0.38 2.27 -0.91 -0.31 0.59 -0.39 201512_s_at TOMM70A 9868 0.89 1.35 -0.38 1.23 -0.23 -1.35 -0.98 -0.85 0.32 201513_at TSN 7247 0.45 1.63 -0.17 -0.69 1.24 0.07 -0.52 -1.60 -0.40 201514_s_at G3BP 10146 1.13 0.82 -0.61 0.01 -0.20 0.06 -1.54 -1.09 1.42 201515_s_at TSN 7247 -0.84 0.89 0.87 -0.56 0.11 -0.91 0.52 -1.50 1.41 201516_at SRM 6723 -1.34 0.37 -0.54 -0.65 -0.53 1.63 -0.78 0.85 1.01 201517_at NCBP2 22916 1.64 -0.53 1.27 0.23 -0.36 -0.35 0.47 -0.99 -1.37 201518_at CBX1 10951 -1.74 1.29 0.93 -0.87 0.09 -0.18 1.16 -0.36 -0.32

246 201519_at TOMM70A 9868 0.67 1.85 -0.17 -0.29 0.75 -1.66 -0.15 -0.73 -0.26 201520_s_at GRSF1 2926 -0.82 -0.66 0.72 -0.99 -0.66 0.83 -0.70 0.42 1.87 201521_s_at NCBP2 22916 1.56 -0.47 1.54 0.72 -0.46 -0.70 -0.52 -0.87 -0.79 201522_x_at SNRPN 6638 0.42 -1.13 0.73 1.31 -0.01 -0.08 1.13 -1.47 -0.90 201523_x_at UBE2N 7334 -0.86 -1.03 -0.20 -0.99 -0.89 1.01 0.62 0.95 1.41 201524_x_at UBE2N 7334 -0.19 -0.42 -0.17 -0.36 -0.75 -1.15 2.08 1.16 -0.18 201525_at APOD 347 -1.61 -1.13 -0.10 0.61 -0.10 1.04 0.38 -0.55 1.46 201526_at ARF5 381 -0.07 1.72 -0.50 -1.00 0.03 0.88 0.75 -1.51 -0.29 201527_at ATP6V1F 9296 -0.33 -0.88 -0.06 -1.42 -0.53 -0.22 1.62 1.35 0.48 201528_at RPA1 6117 -1.65 1.45 -0.23 -0.65 0.17 0.73 -0.66 -0.37 1.23 201529_s_at RPA1 6117 -1.31 0.29 -0.32 -1.04 -0.20 1.21 -0.45 0.01 1.80 201530_x_at EIF4A1 1973 -1.17 -0.60 0.53 -0.66 -1.54 0.80 1.12 0.94 0.57 201531_at ZFP36 7538 -1.09 -1.09 0.21 -1.63 0.45 1.13 0.55 0.68 0.77 201532_at PSMA3 5684 1.47 0.80 0.19 -0.47 -0.15 -1.02 0.08 0.85 -1.75 201533_at CTNNB1 1499 0.83 -0.96 -0.51 0.62 1.18 0.26 1.03 -0.97 -1.49 201534_s_at UBL3 5412 1.13 -1.45 -0.38 1.71 0.13 0.63 -0.54 -0.49 -0.73

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201535_at UBL3 5412 -1.16 1.63 0.59 0.78 0.27 0.02 -0.53 -1.61 0.01 201536_at DUSP3 1845 -1.12 0.67 -1.25 0.89 0.63 -0.84 -0.52 1.57 -0.04 201537_s_at DUSP3 1845 -1.22 1.29 -1.08 0.91 1.36 -0.19 -0.62 0.24 -0.68 201538_s_at DUSP3 1845 -1.28 -1.28 0.03 0.07 1.02 0.66 -1.15 1.08 0.84 201539_s_at FHL1 2273 -0.81 -1.70 0.58 0.02 0.46 1.27 -1.15 0.77 0.56 201540_at FHL1 2273 -0.58 -2.25 0.40 0.11 0.84 0.70 -0.03 1.05 -0.25 201541_s_at CG1I 10467 1.26 -1.84 -0.83 0.78 -0.44 1.12 0.33 -0.28 -0.10 201542_at SAR1 56909 0.98 -0.75 0.27 1.49 -0.94 -0.57 1.10 -0.29 -1.28 201543_s_at SAR1 56909 0.07 -0.73 0.20 1.59 -0.75 -0.91 1.67 -0.58 -0.55 201544_x_at PABPN1 8106 1.12 0.32 -0.03 1.46 -0.30 -0.87 0.65 -0.72 -1.63 201545_s_at PABPN1 8106 0.57 0.78 0.56 0.81 0.81 -1.03 0.34 -1.23 -1.63

247 201546_at TRIP12 9320 1.02 1.42 -1.08 1.20 -0.57 -0.99 0.31 -0.71 -0.59 201547_at PLU-1 10765 -0.66 0.02 0.98 -0.45 -0.23 2.20 -0.74 -0.16 -0.95 201548_s_at PLU-1 10765 -0.04 1.13 -0.12 1.38 -0.87 -0.31 0.38 -1.91 0.35 201549_x_at PLU-1 10765 -0.67 1.81 -1.17 -1.28 0.14 0.91 0.22 0.38 -0.35 201550_x_at ACTG1 71 -1.01 -1.11 -0.70 -0.69 -0.49 1.34 0.57 1.32 0.76 201551_s_at LAMP1 3916 0.08 -1.82 -0.50 1.16 -0.13 1.04 -0.08 -0.85 1.09 201552_at LAMP1 3916 0.42 -2.06 0.13 1.09 -0.46 -0.06 0.65 1.05 -0.77 201553_s_at LAMP1 3916 -0.08 -0.53 -0.31 -0.39 -1.28 0.09 0.29 2.38 -0.16 201554_x_at GYG 2992 -0.35 -0.52 0.48 -1.40 -0.34 0.38 -1.06 1.29 1.52 201555_at MCM3 4172 -1.33 0.08 -0.58 -1.47 0.06 0.84 0.55 0.22 1.61 201556_s_at VAMP2 6844 -0.68 1.85 -0.04 0.11 1.22 -1.45 -0.46 -0.47 -0.06 201557_at VAMP2 6844 -0.48 0.60 -0.25 -0.27 0.70 1.52 -2.09 0.25 0.02 201558_at RAE1 8480 1.33 0.12 0.30 1.00 -0.56 -1.06 1.03 -0.76 -1.41 201559_s_at CLIC4 25932 1.14 -1.04 -0.88 -1.39 0.26 0.63 -0.35 1.50 0.14 201560_at CLIC4 25932 1.98 -0.17 -1.52 0.56 -0.51 -0.51 0.78 -0.16 -0.42 201561_s_at CLSTN1 22883 -0.57 0.50 -0.73 -1.62 0.08 1.24 -0.57 0.14 1.52

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201562_s_at SORD 6652 -0.54 -0.08 0.02 -1.55 -0.20 1.13 -1.10 1.18 1.14 201563_at SORD 6652 -0.39 0.48 -1.18 -1.08 0.59 1.23 -0.80 -0.39 1.53 201564_s_at FSCN1 6624 -1.44 1.61 -0.40 -0.06 0.30 1.40 -0.98 -0.12 -0.29 201565_s_at ID2 3398 0.11 -0.15 0.54 -1.20 1.43 -0.95 -0.58 1.53 -0.73 201566_x_at ID2 3398 0.52 -0.29 -0.09 0.71 1.55 -0.48 -0.86 0.73 -1.78 201567_s_at GOLGA4 2803 0.32 -0.53 1.01 -1.50 1.75 0.03 -0.09 -1.09 0.11 201568_at QP-C 27089 -0.78 -0.19 -0.25 -1.28 -0.96 0.80 1.90 0.63 0.15 201569_s_at CGI-51 25813 0.01 1.80 -1.37 0.19 0.60 -0.25 -1.21 -0.54 0.78 201570_at CGI-51 25813 -0.95 0.26 -1.15 0.17 -1.38 0.12 0.68 1.71 0.52 201571_s_at DCTD 1635 0.27 -0.68 1.87 -0.44 -0.62 0.95 -0.68 0.60 -1.26 201572_x_at DCTD 1635 1.44 0.16 -0.43 -1.57 1.38 0.06 -1.04 -0.31 0.31

248 201573_s_at ETF1 2107 1.94 -0.62 -0.08 0.84 -0.52 -1.16 0.57 0.10 -1.06 201574_at ETF1 2107 0.81 -0.07 -0.69 1.74 -0.01 -0.65 0.95 -0.62 -1.44 201575_at SNW1 22938 1.17 0.65 0.47 0.72 -1.08 -0.69 1.02 -1.40 -0.87 201576_s_at GLB1 2720 0.95 -0.83 -0.82 1.13 -1.07 -1.29 0.85 0.17 0.91 201577_at NME1 4830 -0.96 0.48 -0.45 -2.00 -0.18 1.01 0.79 0.78 0.53 201578_at PODXL 5420 -0.35 -0.15 -1.84 -0.02 -0.29 -0.04 0.39 0.28 2.02 201579_at FAT 2195 -0.93 0.12 0.56 0.33 -1.42 1.40 -0.89 -0.45 1.28 201580_s_at DJ971N18.2 56255 -0.82 0.95 0.85 -0.36 -0.56 1.16 -1.90 0.27 0.39 201581_at DJ971N18.2 56255 -1.52 1.88 -0.09 0.61 -0.20 0.55 -0.42 -1.05 0.25 201582_at SEC23B 10483 -0.83 -1.10 1.22 -1.36 0.61 1.25 -0.47 -0.03 0.71 201583_s_at SEC23B 10483 -1.19 0.75 -0.45 -0.19 -0.92 0.76 -0.56 -0.17 1.98 201584_s_at DDX39 10212 1.26 -0.36 -0.45 1.16 0.60 -0.80 0.44 0.01 -1.87 201585_s_at SFPQ 6421 1.05 -0.84 0.49 1.97 -0.19 -0.76 -0.07 -0.63 -1.00 201586_s_at SFPQ 6421 1.37 -0.08 0.46 1.36 -0.25 -1.21 0.38 -0.62 -1.39 201587_s_at IRAK1 3654 0.55 -1.50 -0.88 -0.49 -0.49 0.35 1.98 0.29 0.17 201588_at TXNL 9352 0.81 -0.30 0.52 0.71 0.50 -1.41 0.57 0.50 -1.90

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201589_at SMC1L1 8243 -1.55 1.31 0.64 -0.75 0.66 0.30 -0.21 -1.25 0.84 201590_x_at ANXA2 302 -0.84 -0.75 -0.31 -0.91 -1.03 1.59 0.20 1.06 0.99 201591_s_at NISCH 11188 -1.52 -0.32 2.02 0.64 0.28 -0.16 -0.71 -0.57 0.34 201592_at EIF3S3 8667 0.68 -1.30 0.76 1.16 0.08 -0.91 0.96 0.01 -1.45 201593_s_at HT010 55854 -0.12 0.08 0.57 1.89 0.73 -1.09 0.00 -0.73 -1.33 201594_s_at PPP4R1 9989 -0.68 1.45 -1.04 -1.24 0.65 0.75 0.20 -0.98 0.89 201595_s_at HT010 55854 0.00 1.13 -0.57 1.51 0.98 -1.08 -0.03 -0.79 -1.14 201596_x_at KRT18 3875 -1.00 -1.44 -0.29 0.07 -0.65 1.26 1.59 0.46 0.00 201597_at COX7A2 1347 0.22 0.99 -0.15 1.10 0.30 -1.23 0.17 0.53 -1.94 201598_s_at INPPL1 3636 -0.39 1.18 -1.56 -1.03 0.15 1.54 -0.21 -0.28 0.59 201599_at OAT 4942 0.47 0.47 0.52 -0.18 0.37 -0.58 0.35 -2.39 0.94

249 201600_at REA 11331 -1.41 -0.74 -0.08 -0.49 -0.96 0.74 0.32 1.57 1.06 201601_x_at PTS 5805 0.59 -0.02 0.77 -1.40 -0.19 1.91 -0.30 -0.25 -1.09 201602_s_at PPP1R12A 4659 0.12 1.72 0.51 0.56 0.36 -0.41 -0.01 -1.42 -1.45 201603_at PPP1R12A 4659 -0.74 -1.30 -0.64 -0.05 1.26 1.56 -0.92 0.60 0.22 201604_s_at PPP1R12A 4659 0.02 1.37 0.37 -0.55 1.67 -0.38 -1.45 -0.44 -0.60 201605_x_at CNN2 1265 -1.02 0.01 -0.92 -1.46 0.81 0.78 -0.43 1.09 1.13 201606_s_at PWP1 11137 0.70 1.48 0.01 0.50 1.10 -1.12 -0.62 -0.90 -1.15 201607_at PWP1 11137 0.49 1.04 1.02 -0.86 0.81 -1.95 -0.60 -0.08 0.13 201608_s_at PWP1 11137 0.70 -2.21 0.14 0.24 0.17 0.83 -0.98 0.25 0.86 201609_x_at ICMT 23463 -0.57 0.42 -0.36 -1.99 0.03 -0.03 0.16 1.71 0.63 201610_at ICMT 23463 1.23 -0.58 -0.79 0.69 1.30 -1.38 -1.00 0.61 -0.06 201611_s_at ICMT 23463 -0.56 -0.01 -1.90 -0.75 -0.13 1.23 0.26 0.65 1.20 201612_at ALDH9A1 223 0.57 -0.26 1.24 0.80 0.67 -0.71 0.53 -1.59 -1.26 201613_s_at 0.15 -0.28 -0.56 1.10 -0.97 0.61 -0.28 -1.44 1.68 201614_s_at RUVBL1 8607 -0.77 1.60 -1.37 -0.47 0.09 0.21 0.06 1.42 -0.78 201615_x_at CALD1 800 -0.23 -0.04 -0.11 -0.74 0.03 -0.43 -1.04 0.12 2.46

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201616_s_at CALD1 800 0.61 -0.49 -1.01 -1.18 -0.49 1.65 -0.27 1.36 -0.17 201617_x_at CALD1 800 -0.16 1.75 1.13 -0.20 -0.46 -0.90 -0.91 -1.03 0.79 201618_x_at GPAA1 8733 -1.37 -0.05 -1.42 0.20 -0.74 1.28 0.84 0.23 1.02 201619_at PRDX3 10935 -1.09 -1.12 0.20 0.30 0.92 0.29 -1.11 -0.17 1.78 201620_at MBTPS1 8720 -1.43 1.99 -0.43 -0.50 -0.05 -0.74 0.54 0.80 -0.17 201621_at NBL1 4681 -0.70 -0.45 0.25 -0.16 -0.51 -0.08 -0.79 -0.04 2.50 201622_at p100 27044 -0.89 -0.33 -1.22 -0.82 -0.31 1.14 -0.14 1.53 1.06 201623_s_at DARS 1615 -1.08 0.57 -0.88 -0.84 0.92 1.15 0.13 -1.15 1.19 201624_at DARS 1615 -0.34 1.63 -1.02 -0.18 1.56 0.40 -0.41 -0.87 -0.74 201625_s_at INSIG1 3638 1.61 -1.46 -0.67 1.05 0.57 0.16 -0.19 0.06 -1.12 201626_at INSIG1 3638 1.71 -0.98 0.27 0.71 -0.06 -0.88 0.73 -0.04 -1.47

250 201627_s_at INSIG1 3638 1.39 -1.02 0.26 1.48 -0.10 -1.04 0.31 -0.05 -1.23 201628_s_at RAGA 10670 -0.52 0.37 0.78 -1.51 -1.33 0.52 -0.40 0.67 1.40 201629_s_at ACP1 52 -0.32 -0.19 -0.01 1.33 -2.18 1.02 -0.07 0.49 -0.06 201630_s_at ACP1 52 0.12 -0.88 0.49 2.19 -0.71 -0.02 0.39 -1.14 -0.42 201631_s_at IER3 8870 2.35 -0.20 0.01 0.05 -0.64 -0.74 0.63 -0.68 -0.76 201632_at EIF2B1 1967 -1.36 0.01 -0.02 -0.47 -0.01 -0.05 -1.11 1.47 1.57 201633_s_at CYB5-M 80777 -1.73 0.93 -0.49 -0.73 0.39 1.15 -0.92 0.70 0.71 201634_s_at CYB5-M 80777 -1.02 0.52 -1.38 0.28 -0.30 0.24 -0.90 0.86 1.71 201635_s_at FXR1 8087 -0.03 -1.03 1.16 0.43 0.37 -0.80 -1.76 0.62 1.05 201636_at FXR1 8087 1.73 0.38 0.82 -0.36 0.83 -0.66 -0.95 -1.32 -0.46 201637_s_at FXR1 8087 -0.06 -0.18 0.98 1.39 -0.80 0.14 0.02 -2.02 0.52 201638_s_at CPSF1 29894 1.28 0.36 -0.99 -1.88 -0.43 0.43 0.86 0.68 -0.32 201639_s_at CPSF1 29894 -1.85 1.45 0.03 0.80 0.28 0.58 0.06 -0.25 -1.13 201640_x_at CLPTM1 1209 -0.05 0.15 -0.44 1.52 0.88 0.74 -0.50 -1.93 -0.38 201641_at BST2 684 -1.05 0.80 1.37 0.33 -0.64 -0.58 1.11 -1.49 0.14 201642_at IFNGR2 3460 -0.30 1.43 -0.75 -2.09 0.50 0.32 -0.07 0.34 0.62

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201643_x_at C5orf7 51780 0.41 1.18 -0.63 -1.86 1.37 -0.17 0.45 -0.11 -0.63 201644_at TSTA3 7264 -0.58 0.04 -0.18 -1.06 0.05 0.14 -0.29 2.45 -0.59 201645_at TNC 3371 0.41 1.15 0.15 -1.16 -0.71 0.86 1.32 -1.13 -0.89 201646_at -0.87 -0.86 0.09 -1.13 0.14 0.68 -0.78 1.76 0.97 201647_s_at SCARB2 950 -0.76 -1.00 0.67 -0.84 0.12 1.29 -1.34 0.89 0.96 201648_at -0.09 1.56 -0.62 0.45 -0.24 -0.17 1.41 -1.46 -0.84 201649_at UBE2L6 9246 1.12 -0.07 0.96 0.98 -1.06 -0.75 0.91 -0.89 -1.21 201650_at KRT19 3880 1.06 -0.30 -0.60 -0.62 -0.29 2.26 -0.58 -0.33 -0.58 201651_s_at PACSIN2 11252 0.21 1.48 0.62 -1.81 -0.46 -0.77 -0.09 -0.24 1.07 201652_at COPS5 10987 -1.18 0.02 -1.04 -0.78 -0.01 -0.53 1.68 0.80 1.04 201653_at CNIH 10175 1.55 0.76 0.90 -0.33 0.55 -0.74 -0.44 -0.63 -1.61

251 201654_s_at HSPG2 3339 -0.34 -0.21 -0.09 -2.11 1.31 0.39 0.02 1.20 -0.17 201655_s_at HSPG2 3339 1.15 0.42 0.15 -1.23 -1.00 -0.76 0.84 -0.92 1.33 201656_at ITGA6 3655 -0.38 1.40 0.01 -1.67 0.81 1.26 -0.79 -0.32 -0.32 201657_at ARL1 400 0.75 -0.43 1.36 1.53 -0.15 -1.17 -1.11 -0.53 -0.24 201658_at 0.09 1.19 0.08 -1.48 0.96 -1.64 -0.30 0.49 0.60 201659_s_at ARL1 400 -0.31 -1.29 1.56 -0.70 1.34 -0.62 -0.42 0.85 -0.40 201660_at FACL3 2181 -1.50 1.66 0.49 -0.34 1.23 -0.63 0.13 -0.76 -0.28 201661_s_at FACL3 2181 -1.13 0.83 -0.86 -0.87 1.82 -0.13 0.55 0.53 -0.74 201662_s_at FACL3 2181 0.34 1.61 -1.20 0.59 0.68 -0.05 0.09 -1.67 -0.40 201663_s_at SMC4L1 10051 -0.13 -0.86 0.83 -1.72 0.74 -0.02 -0.45 -0.04 1.67 201664_at SMC4L1 10051 -0.99 0.33 1.16 -1.47 1.19 -1.06 0.72 -0.30 0.43 201665_x_at RPS17 6218 0.47 -1.41 0.61 -0.52 -1.18 0.09 1.50 1.03 -0.61 201666_at TIMP1 7076 1.39 -0.08 0.68 0.13 -0.42 -0.84 1.20 -0.31 -1.75 201667_at GJA1 2697 0.96 -0.23 -0.63 -1.16 -0.42 -1.14 0.07 1.77 0.78 201668_x_at MARCKS 4082 1.52 0.62 -0.11 -1.04 0.59 0.88 -1.50 -0.86 -0.10 201669_s_at MARCKS 4082 1.90 1.14 -0.34 -1.13 -0.40 0.02 0.38 -0.56 -1.00

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201670_s_at MARCKS 4082 2.20 0.07 -0.69 -1.55 0.14 0.02 -0.18 -0.31 0.30 201671_x_at USP14 9097 0.51 1.57 0.65 -0.08 1.04 -0.75 -0.91 -0.71 -1.33 201672_s_at USP14 9097 1.38 0.86 1.26 -0.34 0.33 -1.10 -1.21 -0.33 -0.84 201673_s_at GYS1 2997 -1.05 1.05 -0.81 -1.12 -0.03 1.20 -0.55 -0.10 1.43 201674_s_at AKAP1 8165 -0.34 0.95 0.65 -0.21 1.64 -1.35 -1.23 0.41 -0.51 201675_at AKAP1 8165 -0.09 1.74 -0.77 -0.70 1.36 -0.14 -1.29 0.31 -0.40 201676_x_at PSMA1 5682 -0.58 1.15 0.48 0.00 -1.11 -1.65 -0.29 1.04 0.97 201677_at DC12 56941 -1.13 0.46 -0.21 -0.39 -0.09 -1.26 0.21 0.29 2.13 201678_s_at DC12 56941 -0.38 -0.67 -1.52 -0.59 -0.05 0.81 -0.36 1.27 1.50 201679_at ARS2 51593 0.00 1.45 -0.71 -1.11 1.53 0.23 -0.14 0.05 -1.30 201680_x_at ARS2 51593 0.50 1.67 -1.28 -1.20 1.05 -0.78 0.27 -0.11 -0.10

252 201681_s_at DLG5 9231 0.31 -0.60 -0.62 -0.41 -0.45 -0.62 -0.51 2.42 0.49 201682_at PMPCB 9512 0.13 1.11 -0.37 0.09 -0.97 -1.39 1.87 -0.44 -0.03 201683_x_at C14orf92 9878 -1.23 0.65 0.55 -0.01 0.75 0.74 -1.60 1.08 -0.94 201684_s_at C14orf92 9878 -0.28 -1.14 1.89 -0.52 1.07 0.03 -1.22 0.23 -0.05 201685_s_at C14orf92 9878 -1.50 1.29 -0.44 -0.33 1.39 -1.20 0.01 0.24 0.54 201686_x_at API5 8539 -0.21 0.11 -0.13 -1.27 0.01 0.45 -1.52 0.81 1.75 201687_s_at API5 8539 0.11 1.40 -1.48 0.33 0.22 -0.63 1.40 -1.08 -0.28 201688_s_at TPD52 7163 -1.03 0.47 0.31 -0.40 -1.05 1.52 -1.32 0.99 0.51 201689_s_at TPD52 7163 -2.13 -0.47 0.75 0.19 -0.73 1.29 0.42 0.35 0.30 201690_s_at TPD52 7163 -1.72 -0.46 0.31 1.62 -0.63 0.52 0.82 -0.78 0.31 201691_s_at TPD52 7163 -0.64 -0.53 -0.71 0.54 -0.74 2.36 -0.53 0.23 0.01 201692_at SR-BP1 10280 -1.15 -0.33 -0.51 -1.08 -0.27 0.65 -0.01 2.02 0.70 201693_s_at EGR1 1958 -1.12 -0.84 -0.61 0.16 0.53 0.78 -0.05 -0.84 2.00 201694_s_at EGR1 1958 0.01 -0.35 0.89 -1.75 1.76 0.61 -0.27 -0.57 -0.32 201695_s_at NP 4860 0.50 -0.03 0.06 1.28 0.42 -1.99 0.91 -0.10 -1.04 201696_at SFRS4 6429 0.05 0.68 1.14 -0.72 -0.12 -0.07 0.14 -2.14 1.02

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201697_s_at DNMT1 1786 -1.70 0.87 0.69 -1.63 0.72 0.50 -0.13 0.03 0.63 201698_s_at SFRS9 8683 -1.16 -0.38 -0.86 -1.50 0.33 1.15 0.97 0.83 0.61 201699_at PSMC6 5706 0.71 1.14 0.91 0.49 0.86 -0.86 -1.20 -1.07 -0.98 201700_at CCND3 896 -0.02 0.74 -0.87 0.43 -0.07 1.35 -1.82 -0.67 0.93 201701_s_at PGRMC2 10424 -1.30 0.85 0.54 -1.08 1.09 1.04 -0.67 -1.01 0.54 201702_s_at PPP1R10 5514 -0.04 -0.76 1.37 1.88 -0.50 -0.19 0.00 -0.58 -1.15 201703_s_at PPP1R10 5514 0.84 0.59 -0.42 1.57 0.15 0.14 -1.43 -1.48 0.02 201704_at ENTPD6 955 -0.61 -0.01 2.18 -0.77 0.67 -0.14 -0.04 0.06 -1.33 201705_at PSMD7 5713 -0.51 -1.41 0.95 -0.19 -0.68 -0.42 0.48 1.96 -0.15 201706_s_at PXF 5824 -0.87 0.20 1.05 1.61 -0.55 0.73 -1.03 -1.23 0.09 201707_at PXF 5824 0.81 -1.43 0.27 1.54 -0.98 0.94 -0.09 -0.97 -0.07

253 201708_s_at NIPSNAP1 8508 -0.74 -0.77 1.25 -0.19 0.35 -0.03 -0.97 -0.77 1.88 201709_s_at NIPSNAP1 8508 -0.14 -0.41 1.19 -0.09 -0.79 1.93 -0.92 -1.02 0.28 201710_at MYBL2 4605 -0.85 -1.22 -0.93 -0.34 0.57 -0.56 0.58 1.38 1.36 201711_x_at RANBP2 5903 0.91 -1.04 -0.09 1.48 0.86 0.15 -1.67 -0.52 -0.06 201712_s_at RANBP2 5903 0.77 -0.10 -0.13 -1.34 0.12 -1.12 -0.10 2.05 -0.16 201713_s_at RANBP2 5903 0.78 0.96 0.78 1.24 -0.18 -0.10 -0.81 -1.26 -1.41 201714_at TUBG1 7283 -1.00 1.87 0.19 -0.71 0.44 0.66 -1.38 -0.45 0.39 201715_s_at ACINUS 22985 0.58 0.24 -1.04 1.30 -1.83 0.95 -0.12 -0.54 0.46 201716_at SNX1 6642 -1.64 0.40 -0.97 -0.50 0.33 0.55 -0.59 0.91 1.52 201717_at MRPL49 740 0.11 0.63 0.40 -2.22 0.63 -0.66 0.78 -0.52 0.84 201718_s_at EPB41L2 2037 -0.42 -1.11 0.52 -0.97 -0.56 0.62 -0.79 0.98 1.73 201719_s_at EPB41L2 2037 -0.10 -0.69 1.02 -0.48 -1.11 1.97 -0.98 0.28 0.09 201720_s_at LAPTM5 7805 -0.86 -1.18 -0.01 -0.86 -0.96 1.29 0.47 0.99 1.12 201721_s_at LAPTM5 7805 -0.41 -0.98 -0.39 -0.48 -0.88 2.17 -0.29 0.75 0.52 201722_s_at GALNT1 2589 -0.16 1.39 0.07 -1.85 0.48 0.06 -0.25 -0.93 1.18 201723_s_at GALNT1 2589 -1.42 -0.17 0.41 -0.51 -0.34 1.09 -1.13 0.44 1.64

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201724_s_at GALNT1 2589 -0.79 1.65 -0.34 -1.19 0.35 1.10 0.50 -1.21 -0.06 201725_at D123 8872 0.42 -1.52 -0.28 -0.37 -0.10 -0.26 -0.65 2.06 0.72 201726_at ELAVL1 1994 -1.46 0.35 0.28 -1.02 -0.56 0.79 0.88 -0.77 1.49 201727_s_at ELAVL1 1994 -1.30 0.07 1.04 -0.99 0.42 1.85 -0.63 -0.01 -0.44 201728_s_at KIAA0100 9703 -1.21 -0.84 -0.21 -0.61 0.24 2.08 -0.58 0.47 0.65 201729_s_at KIAA0100 9703 -1.32 0.27 -0.42 0.12 -0.48 1.82 -0.27 -0.93 1.22 201730_s_at TPR 7175 -1.57 -0.66 0.79 -1.09 1.22 -0.19 -0.14 1.21 0.43 201731_s_at TPR 7175 -1.09 1.50 0.22 -1.02 -0.63 0.60 0.87 -1.17 0.72 201732_s_at CLCN3 1182 -1.33 -0.16 -0.19 0.29 1.17 1.45 -1.23 0.71 -0.71 201733_at -0.15 1.48 0.79 0.03 -0.61 0.61 0.64 -1.55 -1.24 201734_at -0.48 1.51 0.27 0.94 0.86 -1.08 -1.33 -0.87 0.18

254 201735_s_at CLCN3 1182 0.64 -0.49 0.86 1.54 -0.33 0.88 -1.23 -1.09 -0.78 201736_s_at TEB4 10299 1.35 -0.32 1.28 0.40 -0.42 0.23 -0.56 -1.91 -0.05 201737_s_at TEB4 10299 1.48 -0.70 0.32 1.32 -0.56 -1.22 0.45 0.09 -1.18 201738_at GC20 10289 1.85 -0.64 0.39 1.18 -0.46 -0.88 0.26 -0.72 -0.98 201739_at SGK 6446 -1.68 -0.76 -0.28 -0.23 0.82 -0.29 1.07 1.57 -0.19 201740_at NDUFS3 4722 -2.16 -0.05 -0.29 0.66 -0.73 0.26 0.26 0.92 1.11 201741_x_at SFRS1 6426 -1.11 0.42 -0.27 -0.83 0.77 -1.03 -0.30 0.39 1.97 201742_x_at SFRS1 6426 -0.27 -0.84 1.12 -1.16 1.90 -0.17 -0.93 0.17 0.19 201743_at CD14 929 1.33 -0.72 0.00 1.26 -0.54 -1.00 1.21 -0.51 -1.03 201744_s_at LUM 4060 -0.17 -0.54 -1.25 -0.04 -0.42 -0.25 -0.54 1.22 2.01 201745_at PTK9 5756 1.05 0.28 -0.73 -0.32 1.75 -1.71 0.14 -0.27 -0.19 201746_at TP53 7157 -0.84 2.05 0.17 -0.03 0.25 0.74 -0.75 -1.33 -0.26 201747_s_at SAFB 6294 1.96 -0.59 -0.16 0.01 0.95 -0.34 -0.65 0.31 -1.48 201748_s_at SAFB 6294 1.48 -1.03 0.01 0.16 -0.45 -1.28 1.63 -0.38 -0.13 201749_at 0.69 -0.75 -0.35 0.57 0.20 -1.67 1.81 -0.57 0.06 201750_s_at ECE1 1889 1.09 -0.37 0.01 1.07 -1.87 1.20 -0.18 -0.64 -0.31

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201751_at KIAA0063 9929 1.32 -0.92 -0.51 1.57 -0.59 -0.99 0.96 -0.49 -0.34 201752_s_at ADD3 120 0.15 -1.77 0.75 0.61 -0.69 1.08 -0.83 -0.45 1.14 201753_s_at ADD3 120 0.73 -0.23 1.05 1.01 -0.96 0.77 0.20 -1.72 -0.85 201754_at COX6C 1345 0.82 -1.06 -0.30 -1.51 0.17 0.87 1.40 0.50 -0.88 201755_at MCM5 4174 -1.50 -0.32 -0.44 -0.71 -0.66 1.37 1.16 0.01 1.11 201756_at RPA2 6118 -0.88 -0.68 0.19 0.00 1.75 0.47 -1.66 0.79 0.03 201757_at NDUFS5 4725 0.95 1.44 -0.47 0.79 -0.28 -0.96 -0.22 0.44 -1.69 201758_at TSG101 7251 -0.50 0.01 0.05 -1.88 1.05 0.35 0.15 1.52 -0.77 201759_at TBCD 6904 -1.49 0.90 -1.38 -0.57 0.85 1.20 0.66 -0.23 0.07 201760_s_at WSB2 55884 0.31 0.72 -0.42 -0.18 0.61 -1.43 1.68 0.08 -1.37 201761_at MTHFD2 10797 1.66 1.70 -0.34 -0.04 -0.68 -0.63 -0.04 -0.71 -0.90

255 201762_s_at PSME2 5721 -0.78 1.74 0.40 -0.89 -0.57 -0.52 1.49 -0.71 -0.14 201763_s_at DAXX 1616 0.69 -1.76 0.89 -0.28 1.58 0.36 -0.70 -0.20 -0.59 201764_at MGC5576 79022 -0.37 -1.25 0.59 -0.72 -0.01 -0.07 2.29 -0.30 -0.14 201765_s_at HEXA 3073 1.33 -1.28 -0.02 0.70 -1.43 -1.00 0.53 0.72 0.44 201766_at ELAC2 60528 -0.87 -0.56 0.25 -1.33 -0.17 2.12 0.55 0.34 -0.33 201767_s_at ELAC2 60528 -0.41 0.85 -0.35 -2.23 1.06 0.28 -0.09 0.04 0.84 201768_s_at ENTH 9685 -1.02 -0.66 -0.25 -0.82 -0.22 2.08 -0.51 0.52 0.90 201769_at ENTH 9685 1.36 1.98 -0.38 -0.79 0.04 -0.91 -0.47 -0.48 -0.33 201770_at SNRPA 6626 -1.25 -0.24 -0.27 -0.35 -0.91 0.60 -0.16 0.41 2.18 201771_at SCAMP3 10067 0.74 -1.74 -0.29 -0.55 0.59 1.28 -0.51 1.14 -0.66 201772_at OAZIN 51582 1.72 1.08 0.28 -0.19 -0.39 -1.24 0.10 -1.41 0.04 201773_at ADNP 23394 -0.12 0.12 0.49 2.04 -0.42 -0.32 0.48 -1.60 -0.66 201774_s_at CNAP1 9918 -0.80 -0.24 0.27 0.41 0.42 -0.37 -0.89 -1.00 2.21 201775_s_at KIAA0494 9813 -1.36 0.68 -1.35 0.38 0.03 0.31 -0.93 1.41 0.83 201776_s_at KIAA0494 9813 -0.81 1.16 0.44 1.46 0.25 0.57 -0.85 -1.02 -1.19 201777_s_at KIAA0494 9813 -0.19 -0.20 -1.08 -0.70 1.29 0.30 -1.47 0.75 1.31

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201778_s_at KIAA0494 9813 -1.32 0.34 -0.73 -1.34 0.73 0.48 -0.38 0.63 1.57 201779_s_at RNF13 11342 0.20 -1.45 0.88 1.09 -0.94 0.81 -0.82 -0.78 1.00 201780_s_at RNF13 11342 0.53 0.00 0.49 1.78 -0.64 0.05 0.23 -1.86 -0.58 201781_s_at AIP 9049 -0.99 -1.60 1.34 -0.52 -0.74 0.71 0.75 0.26 0.78 201782_s_at AIP 9049 0.18 1.04 1.61 0.51 -0.18 -0.96 -1.32 0.20 -1.09 201783_s_at RELA 5970 1.08 0.00 0.94 0.52 0.93 -1.82 -0.27 -1.12 -0.26 201784_s_at SMAP 10944 0.60 0.47 2.16 -0.82 -0.23 -0.44 -0.32 -0.10 -1.29 201785_at RNASE1 6035 -0.21 -1.56 1.54 -0.13 -0.72 1.34 -0.77 0.14 0.38 201786_s_at ADAR 103 -1.16 1.52 0.57 0.66 0.33 -0.89 0.71 -1.42 -0.32 201787_at FBLN1 2192 -0.68 -0.62 -0.88 1.45 -1.11 -0.50 0.04 1.24 1.08 201788_at RNAHP 11325 0.49 -1.33 -0.93 0.95 -0.35 -0.16 1.95 -0.35 -0.25

256 201789_at retSDR4 51635 1.63 0.50 -0.25 -0.60 -0.16 -1.19 1.34 -1.16 -0.09 201790_s_at DHCR7 1717 -0.56 0.44 -0.91 -1.45 0.09 1.29 -0.53 0.04 1.59 201791_s_at DHCR7 1717 -0.23 0.91 -1.65 -0.28 -0.86 1.28 -0.12 -0.35 1.32 201792_at AEBP1 165 0.17 -1.07 2.05 -0.47 -0.72 0.10 -1.10 0.65 0.38 201793_x_at C1orf16 9887 0.30 -0.40 -1.11 0.51 2.24 -0.21 -0.67 0.17 -0.82 201794_s_at C1orf16 9887 1.19 1.10 -0.35 1.00 -0.97 0.02 -0.87 -1.52 0.39 201795_at LBR 3930 -1.20 0.17 2.04 -0.50 0.76 0.16 0.01 -1.18 -0.26 201796_s_at VARS2 7407 0.64 -0.87 0.35 -0.58 -0.34 0.47 -1.41 -0.24 1.98 201797_s_at VARS2 7407 -0.54 -0.41 -0.34 0.09 -0.31 2.15 -0.21 -1.32 0.91 201798_s_at FER1L3 26509 -1.00 -0.13 -0.79 -0.46 -1.19 0.89 0.18 0.67 1.84 201799_s_at OSBP 5007 1.24 1.03 -0.02 -0.28 -1.06 -1.66 1.12 -0.34 -0.01 201800_s_at OSBP 5007 -1.21 -0.19 -0.92 1.29 1.52 -0.95 -0.11 -0.23 0.80 201801_s_at SLC29A1 2030 0.02 -1.27 1.16 0.61 -1.29 1.01 0.24 -1.17 0.67 201802_at SLC29A1 2030 0.37 1.38 0.51 1.19 -0.46 -1.57 -0.56 -1.08 0.22 201803_at POLR2B 5431 1.84 -0.47 0.59 0.83 -1.17 -1.23 0.25 -0.57 -0.06 201804_x_at CKAP1 1155 -1.66 0.30 0.58 0.65 -1.29 0.21 -0.09 -0.30 1.58

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201805_at PRKAG1 5571 0.54 -0.17 -1.52 -1.44 0.69 1.24 -0.04 1.05 -0.34 201806_s_at A2LP 11273 -1.20 0.10 -1.16 0.40 -0.28 1.93 0.26 0.72 -0.77 201807_at VPS26 9559 -1.91 0.99 -0.57 -0.18 -0.31 -0.38 0.03 1.12 1.21 201808_s_at ENG 2022 -0.70 -0.69 -0.20 0.09 1.39 1.27 -1.73 -0.04 0.62 201809_s_at ENG 2022 -0.07 -0.60 1.31 -1.59 -0.76 0.91 1.00 0.57 -0.76 201810_s_at SH3BP5 9467 -0.04 1.08 0.36 1.88 -0.12 -0.88 -0.14 -1.00 -1.13 201811_x_at SH3BP5 9467 0.56 1.14 0.64 0.51 -1.46 -0.69 0.60 0.29 -1.61 201812_s_at TOM7 54543 0.76 -0.68 0.60 1.15 -0.39 -0.75 1.14 -0.03 -1.79 201813_s_at TBC1D5 9779 -0.11 0.24 1.96 -0.21 -1.06 -0.42 -1.07 -0.46 1.15 201814_at TBC1D5 9779 -0.01 -0.20 1.81 0.72 -0.45 0.69 -1.04 -1.54 0.03 201815_s_at TBC1D5 9779 -1.12 0.18 0.55 -0.60 -0.02 1.82 -1.00 -0.81 1.00

257 201816_s_at GBAS 2631 -0.12 1.85 0.98 -0.61 0.05 0.55 -1.00 -0.38 -1.31 201817_at KIAA0010 9690 1.12 1.20 -1.11 0.80 0.46 0.26 -0.47 -1.52 -0.74 201818_at FLJ12443 79888 0.12 -0.12 -1.08 1.63 -0.21 0.53 -1.21 -0.88 1.23 201819_at SCARB1 949 0.39 0.08 -0.37 0.39 -1.81 0.80 -0.25 -0.88 1.65 201820_at KRT5 3852 -0.69 0.29 1.14 -0.66 -0.68 -1.01 0.22 -0.54 1.95 201821_s_at TIMM17A 10440 -1.14 0.36 1.18 -1.42 1.10 0.08 -0.85 1.01 -0.34 201822_at TIMM17A 10440 -0.91 0.73 -1.21 0.69 -1.54 1.03 0.15 -0.04 1.09 201823_s_at RNF14 9604 -0.31 0.38 0.54 -1.69 0.40 1.26 -1.24 -0.40 1.05 201824_at RNF14 9604 -1.46 1.05 0.28 -0.88 0.75 0.24 -1.30 0.07 1.23 201825_s_at CGI-49 51097 0.27 -2.02 0.87 0.59 -1.19 0.87 0.57 -0.27 0.30 201826_s_at CGI-49 51097 0.71 -0.63 0.82 -0.45 -1.03 -0.20 1.18 -1.53 1.14 201827_at SMARCD2 6603 -0.33 0.11 -0.38 -0.36 -0.02 -0.02 -0.99 -0.49 2.51 201828_x_at CXX1 8933 -0.19 -0.81 -0.54 0.22 -1.46 0.82 -0.15 0.09 2.02 201829_at NET1 10276 -0.34 -0.73 -0.70 1.14 -0.14 2.19 -0.59 -0.46 -0.35 201830_s_at NET1 10276 0.59 0.41 -2.09 0.34 -0.20 0.25 1.45 0.09 -0.85 201831_s_at VDP 8615 -1.12 -0.78 0.23 -0.20 0.32 0.11 -0.96 2.22 0.17

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201832_s_at VDP 8615 -0.39 0.53 0.02 -1.16 0.15 -1.69 1.60 0.07 0.85 201833_at HDAC2 3066 -1.57 1.41 0.82 -0.35 0.91 -0.76 -0.55 0.75 -0.65 201834_at PRKAB1 5564 1.31 -0.31 -1.46 1.24 0.77 -1.06 0.44 -0.70 -0.21 201835_s_at PRKAB1 5564 0.01 -0.50 0.73 0.85 0.43 -1.54 -0.04 1.42 -1.37 201836_s_at STAF65 9913 -0.59 1.01 -0.88 -0.62 1.31 0.68 -1.48 -0.36 0.94 201837_s_at STAF65 9913 0.54 0.62 0.12 0.48 -0.18 -1.20 -1.60 -0.46 1.67 201838_s_at STAF65 9913 -0.03 2.06 -0.03 0.78 0.23 -0.38 -0.75 -0.40 -1.47 201839_s_at TACSTD1 4072 0.25 -0.36 0.25 2.45 -0.17 -0.97 -0.60 -0.36 -0.48 201840_at NEDD8 4738 -0.61 -1.27 0.42 0.24 -0.95 0.94 -0.65 1.88 0.00 201841_s_at HSPB1 3315 -1.91 0.63 0.47 -0.87 0.08 1.21 -0.53 1.07 -0.14 201842_s_at EFEMP1 2202 -0.52 0.42 0.22 0.58 -0.20 -1.74 -0.26 -0.45 1.94

258 201843_s_at EFEMP1 2202 -0.96 -1.76 1.17 -0.08 0.31 1.53 -0.13 -0.23 0.16 201844_s_at RYBP 23429 1.26 -1.70 -1.00 0.72 -0.54 -0.19 0.75 -0.28 0.99 201845_s_at RYBP 23429 1.11 0.92 0.08 0.97 0.02 -1.17 0.54 -0.91 -1.56 201846_s_at RYBP 23429 0.47 0.03 2.08 0.26 -0.59 -1.08 -0.48 0.47 -1.16 201847_at LIPA 3988 -0.61 -0.95 -0.47 -0.66 -1.02 1.66 0.02 1.28 0.76 201848_s_at BNIP3 664 -0.31 0.07 -0.40 -1.26 -0.59 1.41 -0.55 -0.19 1.84 201849_at BNIP3 664 -1.19 0.56 -0.12 -1.28 -0.35 0.99 -0.59 0.26 1.74 201850_at CAPG 822 -1.07 -1.98 0.30 -0.01 -0.31 0.57 0.80 0.47 1.22 201851_at SH3GL1 6455 0.78 0.38 -0.38 1.14 0.15 -1.52 -0.25 1.13 -1.43 201852_x_at COL3A1 1281 -0.20 -0.24 0.37 -1.68 0.79 -0.72 0.64 -0.66 1.70 201853_s_at CDC25B 994 1.91 0.28 0.10 -0.14 0.76 -1.05 0.12 -1.50 -0.48 201854_s_at KIAA0431 23300 1.31 0.10 -1.26 -0.60 0.69 -1.65 0.21 0.98 0.19 201855_s_at KIAA0431 23300 0.27 2.14 -0.60 0.32 0.56 -1.02 -0.33 -1.14 -0.21 201856_s_at ZFR 51663 0.18 -1.29 0.96 0.55 1.70 -0.36 -1.34 0.04 -0.44 201857_at ZFR 51663 0.86 0.17 1.04 1.46 0.03 -1.58 -0.86 -0.74 -0.38 201858_s_at PRG1 5552 0.37 -1.63 0.35 0.21 -0.47 -0.58 0.58 1.89 -0.73

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 201859_at PRG1 5552 0.05 -0.59 -0.67 -0.19 0.10 -0.73 0.07 2.50 -0.54 201860_s_at PLAT 5327 -0.20 0.10 -1.13 -0.91 2.03 -0.41 0.52 -0.78 0.78 201861_s_at LRRFIP1 9208 -1.79 -0.45 -0.18 -0.88 0.46 0.61 1.26 1.21 -0.24 201862_s_at LRRFIP1 9208 -1.66 1.31 1.07 -0.56 1.04 -0.04 -0.43 -0.84 0.11 201863_at DKFZP586O0120 26017 0.04 -1.08 -0.45 1.08 -0.99 0.29 0.33 -1.03 1.78 201864_at GDI1 2664 1.62 0.37 0.14 0.79 0.33 -1.17 -1.69 -0.41 0.02 201865_x_at NR3C1 2908 2.00 -0.95 -0.08 0.65 -0.19 -0.58 0.80 -0.45 -1.18 201866_s_at NR3C1 2908 0.78 -0.02 2.00 -0.35 -1.11 -0.54 -1.23 0.08 0.39 201867_s_at TBL1X 6907 0.01 -0.16 -0.86 -0.95 1.08 0.94 -0.49 -1.17 1.61 201868_s_at TBL1X 6907 -0.97 -0.79 -0.65 0.43 2.15 0.61 -0.67 0.34 -0.44 201869_s_at TBL1X 6907 0.46 -0.91 -0.80 0.59 -0.35 2.25 -0.49 -0.67 -0.07

259 201870_at TOMM34 10953 -1.49 0.81 0.64 -0.95 0.39 -0.41 -0.63 -0.08 1.73 201871_s_at LOC51035 51035 1.50 1.54 0.41 -0.34 -0.68 -1.15 -1.10 0.02 -0.18 201872_s_at ABCE1 6059 0.26 1.32 0.40 -0.08 -0.01 -0.80 -1.92 1.22 -0.38 201873_s_at ABCE1 6059 -0.23 1.13 -0.16 0.06 1.87 -0.61 -0.48 -0.01 -1.57 201874_at MPZL1 9019 0.50 1.39 -0.93 -1.48 1.04 0.51 -1.14 0.20 -0.09 201875_s_at FLJ21047 79620 1.41 1.62 -0.65 -0.14 0.26 -1.35 -0.34 0.12 -0.92 201876_at PON2 5445 0.57 0.89 0.16 -0.64 0.42 0.57 -2.41 0.19 0.23 201877_s_at PPP2R5C 5527 0.77 1.54 0.37 0.57 0.58 -0.96 -1.53 -0.78 -0.55 201878_at ARIH1 25820 -0.77 1.03 0.82 1.48 0.67 -0.64 -1.14 -0.43 -1.02 201879_at ARIH1 25820 -1.36 0.75 0.87 0.50 1.02 0.54 -1.72 -0.46 -0.13 201880_at ARIH1 25820 -0.34 0.64 0.04 1.04 1.39 0.46 -0.49 -1.64 -1.11 201881_s_at ARIH1 25820 0.17 0.45 -0.78 1.95 0.72 -1.15 -1.16 -0.33 0.13 201882_x_at B4GALT1 2683 -0.30 1.61 -0.81 -0.94 0.13 -0.37 -0.71 1.72 -0.31 201883_s_at B4GALT1 2683 0.41 -1.09 -1.09 -1.02 -0.58 0.34 1.63 1.04 0.38 201884_at CEACAM5 1048 -0.55 -0.02 -0.23 -1.84 -0.69 1.02 1.31 0.97 0.05 201885_s_at DIA1 1727 -0.30 -1.05 0.83 -1.16 -0.53 1.28 1.42 -0.82 0.31

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201886_at PRO2389 80344 -0.97 0.04 -0.19 -0.11 -0.77 1.86 -0.81 -0.45 1.42 201887_at IL13RA1 3597 1.00 1.59 0.74 -0.11 -0.10 -0.58 0.02 -0.96 -1.60 201888_s_at IL13RA1 3597 -0.05 1.68 0.91 -1.20 -0.10 0.51 -0.73 0.37 -1.38 201889_at FAM3C 10447 1.30 0.11 0.78 0.15 0.55 -1.26 0.79 -1.04 -1.41 201890_at RRM2 6241 -0.89 -0.71 1.38 -0.58 0.28 -0.40 1.87 -0.79 -0.14 201891_s_at B2M 567 -0.67 -0.68 -0.41 -0.86 -0.57 2.07 -0.43 0.98 0.59 201892_s_at IMPDH2 3615 -0.37 1.35 -1.43 -0.73 0.97 -0.92 1.03 -0.46 0.57 201893_x_at DCN 1634 0.78 0.15 0.27 0.02 1.24 -1.73 -1.40 0.83 -0.19 201894_s_at 0.57 0.82 -0.12 0.10 1.22 -1.71 -0.61 0.89 -1.15 201895_at ARAF1 369 -0.04 0.56 -1.02 1.33 1.61 -0.08 -0.51 -0.57 -1.27 201896_s_at -1.29 0.67 -0.69 1.26 -0.16 1.15 -1.17 -0.60 0.82

260 201897_s_at CKS1B 1163 -0.15 -1.02 1.83 0.42 -1.22 0.18 0.78 -1.07 0.25 201898_s_at UBE2A 7319 -0.35 -0.19 -0.50 -0.25 0.26 0.57 -1.56 2.15 -0.10 201899_s_at UBE2A 7319 -0.37 1.23 0.38 -1.68 0.60 -0.36 -0.17 1.36 -0.98 201900_s_at AKR1A1 10327 -1.07 0.39 0.94 0.14 -1.47 0.39 -0.08 -0.87 1.63 201901_s_at YY1 7528 0.13 0.57 0.65 2.00 -0.17 -0.88 -0.56 -0.36 -1.38 201902_s_at -0.99 0.20 -0.19 1.31 0.99 1.12 -1.18 -1.23 -0.02 201903_at UQCRC1 7384 -0.63 -0.28 -0.07 1.72 -0.80 0.55 0.21 -1.63 0.92 201904_s_at HYA22 10217 0.26 -0.06 0.17 1.43 -0.11 0.40 0.17 -2.36 0.09 201905_s_at HYA22 10217 -1.48 0.64 -0.85 0.27 1.75 0.21 -0.71 -0.59 0.76 201906_s_at HYA22 10217 -0.86 1.30 0.02 0.24 0.66 -2.02 0.03 -0.30 0.92 201907_x_at DVL3 1857 -0.72 -0.31 -0.20 1.33 -0.98 1.96 -0.63 0.10 -0.53 201908_at DVL3 1857 0.95 0.67 -0.08 0.67 0.23 -1.13 0.96 -1.94 -0.34 201909_at RPS4Y 6192 1.30 -1.70 0.57 0.18 -1.35 -0.44 0.73 0.65 0.04 201910_at FARP1 10160 0.21 1.68 -1.13 0.30 0.47 -1.16 -0.99 -0.39 1.00 201911_s_at FARP1 10160 0.46 0.32 -1.28 -0.01 -0.85 1.29 -1.21 -0.16 1.45 201912_s_at GSPT1 2935 0.62 1.09 -1.44 0.42 -0.07 0.86 0.49 -1.75 -0.23

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201913_s_at NBP 80347 -1.60 0.56 -0.59 -0.54 -0.23 1.10 -0.11 -0.33 1.75 201914_s_at SEC63L 11231 -1.06 0.53 1.65 0.70 -1.43 0.10 -1.05 0.22 0.31 201915_at SEC63L 11231 -0.83 0.96 0.15 -0.85 0.91 1.36 -0.03 0.02 -1.70 201916_s_at SEC63L 11231 0.64 0.98 0.80 -1.45 -0.33 -1.24 1.36 -0.52 -0.24 201917_s_at FLJ10618 55186 -1.65 0.75 0.25 0.25 1.78 0.32 -0.96 -0.54 -0.22 201918_at FLJ10618 55186 -0.78 1.52 0.20 0.89 0.82 0.00 -1.77 -0.41 -0.46 201919_at FLJ10618 55186 -0.99 0.37 -0.46 -1.06 -0.38 0.07 -0.63 1.23 1.85 201920_at SLC20A1 6574 -1.69 1.04 0.14 -1.04 -0.05 0.10 0.01 -0.19 1.69 201921_at GNG10 2790 -0.11 1.64 -0.38 -1.28 1.38 -1.19 0.29 -0.15 -0.19 201922_at YR-29 10412 0.31 1.09 0.95 0.96 0.59 -0.91 -0.35 -1.44 -1.19 201923_at PRDX4 10549 -0.04 1.11 0.32 -1.63 -1.13 -0.24 1.27 0.86 -0.52

261 201924_at MLLT2 4299 -1.06 1.53 -0.74 -0.62 1.03 -0.40 0.70 -1.15 0.71 201925_s_at DAF 1604 2.04 -0.62 0.33 1.04 -0.87 -0.42 0.10 -0.81 -0.79 201926_s_at DAF 1604 1.55 -0.49 -0.93 1.57 -0.70 -0.92 0.45 0.11 -0.64 201927_s_at PKP4 8502 -1.40 -0.25 1.29 -0.27 -0.41 -0.02 -1.14 1.46 0.75 201928_at PKP4 8502 -0.91 0.21 -0.88 -1.04 0.22 0.67 -0.66 2.04 0.34 201929_s_at PKP4 8502 -0.61 1.67 -1.63 -0.54 -0.21 1.01 -0.45 0.01 0.75 201930_at MCM6 4175 -1.10 0.20 -0.21 -1.02 -0.65 0.89 -0.45 0.35 2.01 201931_at ETFA 2108 1.04 0.15 1.11 -0.35 0.27 -0.63 1.04 -1.81 -0.81 201932_at MUF1 10489 -1.01 1.71 -1.47 0.75 -0.06 0.55 0.53 -0.21 -0.79 201933_at PCOLN3 5119 1.50 -1.04 -0.92 0.44 0.29 -0.55 1.05 -1.33 0.55 201934_at PRO2730 80335 0.07 0.39 0.01 1.39 0.21 -0.49 0.01 0.65 -2.27 201935_s_at EIF4G3 8672 -0.77 1.68 0.11 -0.59 0.53 1.08 -1.05 -1.24 0.23 201936_s_at EIF4G3 8672 -1.46 1.29 0.20 -0.60 -0.85 0.01 0.54 1.52 -0.65 201937_s_at DNPEP 23549 -1.57 0.33 -1.01 -1.00 0.78 -0.03 0.29 0.78 1.43 201938_at CDK2AP1 8099 -0.72 0.24 1.32 -0.12 -0.01 1.03 -1.32 -1.37 0.95 201939_at SNK 10769 1.99 -0.74 0.65 0.44 -0.82 0.09 0.36 -0.82 -1.15

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 201940_at CPD 1362 1.32 -1.05 0.21 1.04 -0.39 0.54 0.67 -1.58 -0.75 201941_at CPD 1362 1.87 -0.76 0.30 0.29 -0.13 -1.04 0.96 -0.21 -1.27 201942_s_at CPD 1362 1.90 -1.47 -0.74 0.43 0.64 0.25 -0.29 0.19 -0.92 201943_s_at CPD 1362 2.20 -0.85 -0.82 0.27 0.03 -0.51 0.27 0.45 -1.05 201944_at HEXB 3074 0.12 -2.11 -0.31 1.39 -0.79 0.53 0.56 0.46 0.13 201945_at FURIN 5045 -1.11 2.09 -0.81 -0.12 0.89 0.16 -0.87 -0.28 0.06 201946_s_at CCT2 10576 -1.06 0.29 -0.08 -0.75 0.90 -0.07 -1.46 1.72 0.50 201947_s_at CCT2 10576 -1.42 1.30 -0.52 -1.33 0.69 0.22 0.34 1.15 -0.43 201948_at HUMAUANTIG 29889 -0.72 1.19 -1.16 0.48 0.93 -0.23 1.19 -1.43 -0.24 201949_x_at CAPZB 832 -0.25 1.84 -1.08 -0.97 0.28 0.85 -0.71 -0.70 0.74 201950_x_at CAPZB 832 -0.40 -0.48 -0.70 -0.51 0.35 1.88 -1.11 -0.35 1.33

262 201951_at ALCAM 214 0.01 0.45 -1.48 -0.77 1.54 -0.53 0.14 1.34 -0.70 201952_at ALCAM 214 -0.60 -0.38 -0.57 -1.53 0.00 0.40 0.27 2.10 0.33 201953_at CIB1 10519 -1.48 -0.36 0.87 0.43 -1.51 0.41 1.49 0.03 0.10 201954_at ARPC1B 10095 0.22 -1.90 -0.96 0.01 -0.68 0.45 1.00 1.01 0.82 201955_at CCNC 892 -0.16 0.64 0.44 1.76 0.24 -1.50 0.25 -0.38 -1.30 201956_s_at GNPAT 8443 -1.52 0.82 -0.22 -0.31 -0.40 0.61 -0.16 -0.74 1.93 201957_at PPP1R12B 4660 -0.02 -0.61 -0.40 1.07 1.24 0.35 -0.42 -1.96 0.75 201958_s_at PPP1R12B 4660 -0.31 -1.02 0.50 -0.67 -0.89 1.96 -0.82 0.57 0.69 201959_s_at KIAA0916 23077 -0.53 1.62 0.28 0.03 1.27 -1.48 0.23 -0.54 -0.89 201960_s_at KIAA0916 23077 0.65 -0.06 0.08 -1.74 0.93 -0.02 1.53 -1.10 -0.27 201961_s_at SBB103 10193 0.01 -1.44 -0.77 -0.72 -0.58 1.08 0.21 0.48 1.73 201962_s_at SBB103 10193 0.13 -1.43 -0.97 0.83 1.08 -0.18 0.84 0.92 -1.23 201963_at FACL2 2180 2.38 0.08 0.00 -0.14 -0.69 -0.89 0.48 -0.60 -0.63 201964_at KIAA0625 23064 -0.04 1.67 -0.47 -0.79 1.71 -0.31 -0.96 -0.56 -0.22 201965_s_at KIAA0625 23064 -0.02 0.96 -1.37 -1.47 -0.34 0.82 -0.52 0.89 1.06 201966_at NDUFS2 4720 -1.41 -0.66 0.46 -0.13 -1.22 1.68 0.27 0.05 0.94

Table D-1. Continued. Probe Set ID Gene Symbol Entrez Gene gp120IIIB gp120SF2 gp120BaL ID 6 15 24 6 15 24 6 15 24 201967_at RBM6 10180 1.05 -0.35 1.27 0.78 -0.95 -1.21 0.55 -1.32 0.17 201968_s_at PGM1 5236 -0.06 -0.92 0.27 -0.42 -1.05 1.17 0.13 -0.96 1.85 201969_at NASP 4678 -1.16 -0.36 1.94 -0.43 -0.14 -0.33 -0.49 1.41 -0.42 201970_s_at NASP 4678 -1.87 0.19 0.84 0.15 -0.41 -0.12 0.53 -0.88 1.56 201971_s_at ATP6V1A1 523 -0.11 0.47 0.23 -0.48 1.46 0.15 -2.10 0.81 -0.45 201972_at ATP6V1A1 523 -0.33 -0.63 0.25 -0.39 -1.43 -0.60 0.90 1.98 0.27 201973_s_at CGI-43 51622 1.23 0.83 -0.51 -0.66 0.48 -1.21 0.42 0.93 -1.52 201974_s_at CGI-43 51622 0.18 -1.00 -0.27 -0.94 -0.13 0.99 -0.44 2.12 -0.50 201975_at RSN 6249 0.53 0.13 -0.46 1.05 -0.73 -0.92 0.69 -1.63 1.34 201976_s_at MYO10 4651 -0.56 -0.27 -1.72 -0.11 -0.15 0.28 -0.20 0.81 1.95 201977_s_at KIAA0141 9812 -1.34 -0.50 0.65 -0.99 -0.29 -0.59 0.34 1.69 1.03

263 201978_s_at KIAA0141 9812 -2.11 -0.63 1.27 -0.35 0.24 0.75 0.85 -0.08 0.06 201979_s_at PPP5C 5536 -0.40 0.64 -1.38 -1.49 0.85 0.91 -0.49 0.17 1.19 201980_s_at RSU1 6251 -0.90 0.21 -0.12 -2.01 0.02 1.34 0.11 0.26 1.08 201981_at -0.50 0.20 -1.27 -1.13 0.18 1.39 -0.85 0.79 1.20 201982_s_at PAPPA 5069 1.14 -1.07 -0.17 -0.88 1.90 0.45 -0.40 -0.83 -0.11 201983_s_at EGFR 1956 1.83 -1.12 0.10 -1.26 -0.93 0.77 0.15 0.52 -0.08 201984_s_at EGFR 1956 -0.30 -1.74 -0.93 0.60 -0.40 1.09 -0.06 0.26 1.48 201985_at KIAA0196 9897 -1.24 1.62 0.24 -1.07 0.86 -0.65 -0.78 0.13 0.88 201986_at TRAP240 9969 0.82 0.67 -0.05 1.32 0.12 -0.67 -1.35 -1.53 0.66 201987_at 1.47 0.68 0.89 0.52 -0.30 -0.71 0.08 -1.03 -1.60 201988_s_at CREBL2 1389 -1.54 0.11 0.69 -1.04 -0.08 0.88 -0.11 -0.59 1.69 201989_s_at CREBL2 1389 -0.62 0.33 1.45 0.78 -1.14 0.13 -0.23 -1.60 0.90 201990_s_at CREBL2 1389 -0.11 2.54 0.12 -0.52 0.01 -0.34 -0.62 -0.81 -0.26 201991_s_at KIF5B 3799 0.74 -0.27 0.08 1.02 -0.20 -1.11 1.73 -0.78 -1.19 201992_s_at KIF5B 3799 -0.78 0.52 0.07 0.64 0.47 -1.49 -1.32 0.34 1.53 201993_x_at HNRPDL 9987 -0.02 0.10 -0.02 -2.03 0.97 -0.75 0.24 1.49 0.01

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 201994_at MRGX 9643 0.82 -1.14 0.16 0.65 0.30 -2.18 0.67 0.33 0.35 201995_at EXT1 2131 -0.50 -0.43 0.09 -0.93 -0.99 1.91 0.15 -0.57 1.27 201996_s_at SHARP 23013 0.21 0.29 -0.50 0.91 0.96 1.05 0.12 -1.43 -1.63 201997_s_at SHARP 23013 1.11 0.46 -0.59 -0.29 -1.30 -1.27 -0.39 1.15 1.13 201998_at SIAT1 6480 0.58 -0.76 -0.74 0.91 -0.04 -0.73 2.01 -0.21 -1.00 201999_s_at TCTEL1 6993 0.69 -0.40 1.23 0.82 -0.41 -0.61 1.10 -0.73 -1.68 202000_at NDUFA6 4700 1.32 0.17 -0.44 -0.07 -0.56 -1.37 -0.38 1.84 -0.49 202001_s_at NDUFA6 4700 -0.84 1.65 0.15 0.42 -0.99 0.03 1.01 0.07 -1.52 202002_at ACAA2 10449 -0.06 -1.07 1.30 0.24 -1.13 -0.58 -0.90 1.44 0.75 202003_s_at ACAA2 10449 1.26 -1.28 1.66 0.71 -0.45 -0.71 -0.51 0.02 -0.70 202004_x_at SDHC 6391 -0.67 0.18 0.68 1.55 -1.60 -0.31 -0.55 -0.45 1.18

264 202005_at ST14 6768 0.60 -0.96 -0.69 0.82 1.15 -0.50 1.40 -1.30 -0.51 202006_at PTPN12 5782 1.71 0.41 0.03 1.13 -0.54 -0.64 0.15 -1.52 -0.74 202007_at NID 4811 1.09 -0.10 0.21 0.19 -1.05 1.89 -0.49 -0.53 -1.21 202008_s_at NID 4811 -0.93 -0.26 -0.21 -0.95 0.72 1.40 -0.52 1.61 -0.83 202009_at PTK9L 11344 -1.06 -0.07 -0.45 -1.44 -0.79 0.68 0.91 1.35 0.87 202010_s_at APA1 57862 -0.09 0.15 1.28 1.42 -0.22 -0.31 -2.02 0.01 -0.22 202011_at TJP1 7082 -0.60 1.03 -1.05 -0.10 0.35 1.02 1.35 -0.55 -1.45 202012_s_at EXT2 2132 0.02 -2.09 -0.23 -0.61 0.20 0.06 0.93 0.24 1.48 202013_s_at EXT2 2132 -0.69 -0.42 0.69 -1.22 0.58 -0.05 0.24 -1.07 1.94 202014_at PPP1R15A 23645 1.35 -0.97 -0.03 1.77 -0.21 -0.96 0.39 -0.79 -0.53 202015_x_at METAP2 10988 -0.31 -0.01 1.38 0.52 0.05 -0.74 -1.14 -1.25 1.50 202016_at MEST 4232 -0.46 -0.18 -0.23 -2.01 -0.01 0.22 0.06 1.09 1.53 202017_at EPHX1 2052 0.19 0.31 0.09 1.50 1.40 -0.41 -0.65 -1.21 -1.23 202018_s_at LTF 4057 -0.34 -1.26 -0.91 -0.22 -0.81 1.30 0.03 0.60 1.63 202019_s_at LANCL1 10314 -0.96 0.05 0.50 -1.14 0.25 0.91 -1.48 0.36 1.50 202020_s_at LANCL1 10314 -0.59 -0.86 0.15 -1.01 0.33 -0.63 -0.54 1.66 1.50

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202021_x_at SUI1 10209 1.37 -1.39 -0.01 1.17 -0.89 -0.62 1.11 -0.20 -0.53 202022_at ALDOC 230 -0.11 -0.82 -0.70 -1.08 -0.43 1.54 -0.34 0.26 1.69 202023_at EFNA1 1942 -0.34 -0.03 -0.67 -1.27 0.85 -0.08 -0.14 2.19 -0.48 202024_at ASNA1 439 -1.02 1.23 0.02 -0.02 -0.05 0.63 -1.55 -0.67 1.45 202025_x_at ACAA1 30 -1.06 -0.20 -0.61 -1.02 -0.41 1.85 0.47 -0.23 1.22 202026_at SDHD 6392 -1.30 -0.84 0.85 1.10 -0.06 -0.28 -0.65 1.69 -0.50 202027_at C22orf5 25829 -0.85 1.51 -1.67 -0.25 0.20 0.40 0.22 -0.71 1.15 202028_s_at RPL38 6169 -0.08 -1.14 -0.28 -1.50 -0.44 0.81 0.22 1.71 0.70 202029_x_at RPL38 6169 0.01 -1.73 -0.31 -0.26 -0.81 0.94 1.06 1.42 -0.31 202030_at BCKDK 10295 -0.50 -0.47 -0.43 -0.99 -0.72 1.53 0.15 -0.36 1.81 202031_s_at DKFZP434J154 26100 -1.56 -0.73 0.36 -0.67 -0.10 -0.50 0.92 0.54 1.73

265 202032_s_at MAN2A2 4122 0.37 -0.78 -0.02 2.17 -0.67 0.09 0.54 -0.48 -1.22 202033_s_at RB1CC1 9821 0.30 -0.14 0.94 1.90 0.00 -0.70 -0.49 -1.61 -0.18 202034_x_at RB1CC1 9821 0.01 0.92 -1.26 0.12 -0.92 -0.22 -0.64 -0.04 2.04 202035_s_at SFRP1 6422 0.48 -0.88 -1.52 -1.34 0.71 0.69 0.00 1.16 0.69 202036_s_at SFRP1 6422 0.25 -0.08 0.96 -1.42 0.17 -1.35 -0.14 -0.12 1.74 202037_s_at SFRP1 6422 -0.60 -1.12 0.81 -0.79 0.64 -0.56 -0.50 0.11 2.01 202038_at UBE4A 9354 -0.34 -0.80 -0.61 0.32 1.74 -0.94 1.07 0.65 -1.09 202039_at TIAF1 9220 -0.60 2.26 -0.54 -0.13 0.74 0.25 -0.24 -0.98 -0.74 202040_s_at RBBP2 5927 1.48 0.63 1.53 -0.05 -1.27 -0.59 -0.43 -0.58 -0.70 202041_s_at FIBP 9158 -0.19 -0.92 2.00 -0.58 -0.68 1.29 0.18 -0.57 -0.50 202042_at HARS 3035 0.87 0.70 -0.05 -1.00 0.11 -0.95 0.26 1.57 -1.50 202043_s_at SMS 6611 -1.01 0.86 -0.04 -1.01 2.01 -0.82 0.49 -0.02 -0.45 202044_at GRLF1 2909 1.51 0.39 -0.41 -1.21 1.26 -0.09 -1.21 0.50 -0.74 202045_s_at GRLF1 2909 -0.76 -0.40 -1.05 -0.87 -0.03 1.26 -0.70 1.17 1.38 202046_s_at GRLF1 2909 -1.30 0.39 0.57 0.34 1.27 -0.14 -1.89 0.07 0.67 202047_s_at CBX6 23466 -0.46 1.75 -0.81 -0.73 0.94 0.14 0.93 -1.11 -0.66

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202048_s_at CBX6 23466 0.98 1.30 -1.43 0.90 0.11 0.00 0.09 -1.48 -0.48 202049_s_at ZNF262 9202 1.41 -0.75 0.45 -1.55 -0.33 1.37 -0.85 0.22 0.02 202050_s_at ZNF262 9202 1.70 1.28 -0.50 -0.67 0.28 -0.50 0.47 -0.87 -1.18 202051_s_at ZNF262 9202 -0.31 2.15 0.44 -1.17 0.41 -0.04 -0.05 -0.20 -1.22 202052_s_at RAI14 26064 0.54 -1.21 -0.74 1.63 0.25 0.01 0.92 0.02 -1.43 202053_s_at ALDH3A2 224 0.01 -0.61 0.22 0.28 0.46 -1.89 -0.15 1.90 -0.22 202054_s_at ALDH3A2 224 0.83 -0.61 -0.21 0.82 0.43 -1.32 0.90 0.81 -1.66 202055_at 2.20 -0.28 -0.42 0.42 0.81 -0.68 -0.99 -0.42 -0.63 202056_at 1.62 0.11 -0.82 0.64 0.95 -1.69 -0.27 0.05 -0.60 202057_at KPNA1 3836 0.53 -1.43 -0.56 1.01 -0.41 -1.22 1.28 -0.15 0.96 202058_s_at KPNA1 3836 -0.56 -1.12 1.26 -0.49 -0.04 0.88 -1.52 1.07 0.53

266 202059_s_at KPNA1 3836 1.02 0.01 0.31 1.09 0.71 -0.44 0.34 -1.80 -1.25 202060_at TSBP 9646 -2.30 0.23 -0.90 0.88 0.37 0.54 0.14 0.37 0.64 202061_s_at SEL1L 6400 1.50 -0.91 0.12 0.50 0.24 -1.30 1.32 -0.58 -0.89 202062_s_at SEL1L 6400 -0.68 -1.96 1.21 1.20 0.36 0.34 -0.47 -0.37 0.37 202063_s_at SEL1L 6400 0.23 0.39 -0.34 -2.13 1.13 1.26 -0.35 0.10 -0.30 202064_s_at SEL1L 6400 1.66 -1.33 -0.02 -0.93 -0.48 1.09 -0.82 0.63 0.22 202065_s_at PPFIA1 8500 0.41 -1.75 1.70 0.67 0.32 -0.69 -0.85 0.19 -0.01 202066_at PPFIA1 8500 0.01 1.49 -0.16 1.51 0.10 -1.06 0.21 -1.16 -0.95 202067_s_at LDLR 3949 0.54 -1.80 -0.69 0.72 -0.10 1.64 -0.02 -0.73 0.45 202068_s_at LDLR 3949 1.55 -1.22 -0.34 0.44 0.24 -1.12 1.29 0.02 -0.86 202069_s_at IDH3A 3419 -0.13 0.25 -0.17 0.23 -0.35 -0.17 -2.03 1.77 0.60 202070_s_at IDH3A 3419 0.28 1.09 -1.13 -1.49 -0.59 0.32 -0.62 1.14 1.01 202071_at SDC4 6385 1.22 -0.63 -0.31 -0.39 -0.34 -0.49 2.17 -0.69 -0.52 202072_at HNRPL 3191 -1.42 0.96 -0.18 -0.90 1.74 0.24 -0.59 0.67 -0.53 202073_at OPTN 10133 -1.10 2.35 -0.33 -0.27 -0.33 0.74 -0.39 -0.30 -0.34 202074_s_at OPTN 10133 0.98 0.64 -0.36 -1.50 0.52 0.01 -0.82 -0.99 1.50

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202075_s_at PLTP 5360 -0.11 0.39 1.10 1.47 -0.42 -0.51 0.54 -1.81 -0.64 202076_at BIRC2 329 2.05 0.35 0.58 0.34 -0.97 -0.82 0.19 -1.01 -0.71 202077_at NDUFAB1 4706 -1.24 -0.09 -0.86 -0.12 1.51 -0.15 1.52 0.39 -0.94 202078_at COPS3 8533 -1.09 1.83 0.22 -1.43 0.31 -0.60 -0.29 0.86 0.18 202079_s_at KIAA1042 22906 0.03 1.45 -0.64 0.73 0.22 -1.31 -0.11 1.04 -1.42 202080_s_at KIAA1042 22906 0.73 0.54 -0.27 1.10 0.22 -1.39 1.23 -1.15 -1.01 202081_at ETR101 9592 1.27 -1.48 0.92 0.95 -0.48 -0.23 -0.43 0.68 -1.20 202082_s_at SEC14L1 6397 -0.81 -1.71 0.56 0.31 0.99 0.33 -1.25 0.89 0.69 202083_s_at SEC14L1 6397 -0.81 -0.57 -0.67 0.17 -0.24 1.61 -0.22 -0.95 1.69 202084_s_at SEC14L1 6397 -1.60 0.00 0.91 -0.88 -0.30 0.32 -0.81 1.42 0.95 202085_at TJP2 9414 1.69 1.20 0.24 -0.04 0.16 -1.14 0.00 -1.14 -0.97

267 202086_at MX1 4599 0.21 -0.08 -0.32 -1.29 -0.24 1.66 -1.30 1.26 0.10 202087_s_at CTSL 1514 0.77 -2.16 0.34 1.01 -0.40 0.01 -0.76 0.35 0.83 202088_at LIV-1 25800 0.50 0.50 0.67 0.50 1.22 -0.59 0.05 -0.83 -2.05 202089_s_at LIV-1 25800 0.80 -0.49 0.73 -0.89 1.90 -0.01 -1.38 -0.40 -0.25 202090_s_at UQCR 10975 0.29 -2.04 -0.18 -0.47 -0.41 0.02 0.70 1.60 0.48 202091_at BART1 23568 -0.05 -0.08 -0.60 -1.16 0.07 -1.19 1.26 1.79 -0.03 202092_s_at BART1 23568 0.48 -0.45 0.18 -1.05 0.43 1.03 -2.01 0.44 0.95 202093_s_at F23149_1 54623 -0.26 0.03 -0.16 -1.69 0.28 1.80 -1.04 0.57 0.48 202094_at BIRC5 332 0.53 -0.99 0.20 -1.06 0.10 -1.06 2.09 0.17 0.01 202095_s_at BIRC5 332 0.74 -1.55 0.69 0.28 -0.50 0.42 1.51 -1.26 -0.33 202096_s_at BZRP 706 -0.20 -0.15 0.16 0.73 -1.62 0.25 1.91 -0.99 -0.08 202097_at NUP153 9972 0.41 1.08 0.64 0.65 -0.45 -1.31 1.17 -0.95 -1.25 202098_s_at HRMT1L1 3275 0.29 -2.20 0.22 0.94 -0.93 0.16 0.05 0.46 0.99 202099_s_at DGCR2 9993 0.11 -1.20 -0.10 0.01 1.98 -0.70 -0.80 -0.41 1.13 202100_at RALB 5899 -0.41 0.30 -1.06 1.22 -0.71 -1.44 1.29 -0.08 0.89 202101_s_at RALB 5899 0.03 1.43 -0.79 1.44 -0.01 0.46 -1.05 -0.14 -1.37

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202102_s_at BRD4 23476 0.22 0.34 1.09 1.36 0.32 -1.27 0.28 -0.94 -1.43 202103_at BRD4 23476 1.09 -1.05 -0.75 1.83 0.46 -1.19 -0.30 -0.11 0.02 202104_s_at SPG7 6687 -1.47 0.28 -0.60 0.39 1.25 1.04 -1.33 -0.36 0.78 202105_at IGBP1 3476 1.72 -0.40 0.87 0.45 -0.07 -1.42 0.51 -1.16 -0.49 202106_at GOLGA3 2802 -0.57 1.61 0.03 -0.68 -1.56 1.21 0.56 -0.59 -0.01 202107_s_at MCM2 4171 -1.36 0.58 -0.14 -1.20 -0.61 0.50 0.34 0.00 1.88 202108_at PEPD 5184 -0.14 -0.76 -0.69 -0.85 -0.48 1.65 -0.64 0.29 1.64 202109_at POR1 23647 0.33 0.19 -1.29 -1.54 0.51 1.32 -0.81 0.26 1.00 202110_at COX7B 1349 1.10 1.22 -0.22 1.06 -0.43 -0.24 -0.21 -0.35 -1.91 202111_at SLC4A2 6522 -0.99 0.05 -1.01 -1.17 1.21 1.57 -0.27 -0.11 0.73 202112_at VWF 7450 -0.16 -0.80 -0.37 0.66 -1.32 1.49 -0.51 -0.48 1.50

268 202113_s_at SNX2 6643 -1.15 0.77 0.73 -0.16 -0.05 0.80 -1.13 -1.23 1.42 202114_at SNX2 6643 -1.67 1.44 -0.18 -1.06 1.09 0.34 0.04 0.54 -0.55 202115_s_at DKFZP564C186 26155 -0.10 1.91 -0.48 -1.67 -0.77 -0.18 0.25 0.52 0.53 202116_at REQ 5977 -0.88 0.50 0.23 -0.94 0.05 0.30 -1.23 2.09 -0.12 202117_at ARHGAP1 392 -1.94 0.82 -0.32 -1.08 0.44 1.32 0.02 0.46 0.26 202118_s_at CPNE3 8895 -1.37 0.31 -0.36 0.17 0.78 1.78 -1.34 -0.32 0.34 202119_s_at CPNE3 8895 -0.53 0.75 -0.99 0.15 0.35 1.75 -0.77 -1.36 0.66 202120_x_at AP2S1 1175 0.48 0.02 -0.55 -0.84 -1.55 0.41 1.54 1.15 -0.66 202121_s_at BC-2 27243 1.14 -0.24 0.69 0.36 -1.01 -1.17 1.47 -0.06 -1.19 202122_s_at TIP47 10226 -1.32 0.71 1.35 -0.19 0.26 0.41 -1.40 -0.80 0.98 202123_s_at ABL1 25 0.90 1.80 -0.83 -0.22 -0.09 0.38 -0.66 -1.58 0.30 202124_s_at ALS2CR3 66008 -1.94 0.63 -0.23 0.22 0.41 0.90 0.80 0.52 -1.33 202125_s_at ALS2CR3 66008 -0.70 1.34 -1.06 -1.60 0.56 -0.37 0.22 1.09 0.53 202126_at PRPF4B 8899 2.31 0.49 -0.64 0.36 -0.64 -0.83 0.15 -0.59 -0.59 202127_at PRPF4B 8899 0.69 1.38 0.87 -0.63 0.94 -0.49 -0.64 -0.53 -1.60 202128_at KIAA0317 9870 0.39 1.14 -0.48 1.35 0.77 -0.75 0.08 -1.42 -1.10

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202129_s_at SUDD 8780 0.44 -1.48 -0.45 0.09 -0.94 1.74 -0.75 0.68 0.65 202130_at SUDD 8780 0.50 -1.00 0.46 1.44 -1.36 -0.43 1.31 -0.81 -0.11 202131_s_at SUDD 8780 0.47 1.36 0.28 0.84 0.58 -0.83 -0.37 -0.43 -1.93 202132_at TAZ 25937 1.76 0.06 -1.27 0.59 -1.23 0.26 -0.28 0.82 -0.72 202133_at TAZ 25937 -1.05 -0.65 -0.83 0.06 0.20 2.21 -0.45 0.74 -0.23 202134_s_at TAZ 25937 0.48 -0.72 -1.53 -0.13 0.84 0.17 1.23 0.94 -1.29 202135_s_at ACTR1B 10120 -0.92 -0.53 0.07 -0.90 -0.04 0.58 -0.11 -0.47 2.33 202136_at BS69 10771 -0.57 2.22 0.40 -0.75 0.72 -0.50 -0.94 -0.03 -0.53 202137_s_at BS69 10771 -1.45 1.29 -0.54 -0.47 0.54 -0.62 -0.82 0.77 1.30 202138_x_at JTV1 7965 -0.54 1.64 -1.15 -0.50 0.70 -0.11 1.31 -0.32 -1.01 202139_at AKR7A2 8574 0.86 -0.56 -1.44 1.24 1.47 0.06 -0.20 -0.54 -0.88

269 202140_s_at CLK3 1198 -0.81 -1.39 0.51 -0.99 0.04 1.11 -0.28 0.14 1.67 202141_s_at COP9 10920 0.52 -0.64 -0.24 -1.34 0.71 -0.53 -0.04 2.09 -0.49 202142_at COP9 10920 0.38 -0.81 -0.80 -1.39 0.02 0.69 -0.62 1.75 0.79 202143_s_at COP9 10920 -1.10 -0.99 1.30 -0.80 0.02 1.24 -0.99 0.60 0.71 202144_s_at ADSL 158 -0.53 -0.53 -0.30 -1.36 -0.26 0.27 -0.45 1.40 1.77 202145_at LY6E 4061 0.33 -0.97 -1.72 0.33 -0.79 1.61 0.21 0.69 0.28 202146_at IFRD1 3475 -1.23 -0.15 1.00 -0.65 1.03 -0.20 0.16 -1.37 1.41 202147_s_at IFRD1 3475 -0.06 -1.29 -0.52 0.43 0.66 -1.13 -0.38 0.32 1.97 202148_s_at PYCR1 5831 -0.73 -0.58 -0.67 -1.18 -0.63 0.36 0.66 0.92 1.84 202149_at -0.47 0.75 -1.35 -0.28 -0.33 0.28 -1.04 0.55 1.92 202150_s_at HEF1 10543 0.38 -0.75 -0.82 -0.94 0.27 1.14 -0.15 -0.96 1.84 202151_s_at GDBR1 10422 -1.02 0.25 -1.07 -0.16 0.03 1.86 -1.16 0.80 0.45 202152_x_at USF2 7392 0.52 0.71 -1.05 1.79 -0.68 0.73 -0.51 -0.28 -1.23 202153_s_at NUP62 23636 -0.16 1.90 1.33 -0.66 -0.32 0.06 -0.23 -0.71 -1.19 202154_x_at TUBB4 10381 -1.17 -0.18 -0.69 -1.41 0.78 1.57 0.01 1.00 0.09 202155_s_at NUP214 8021 0.43 -0.69 -0.10 0.95 0.38 0.26 1.01 0.00 -2.26

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202156_s_at CUGBP2 10659 -0.62 -0.65 0.13 -1.25 0.93 0.81 -0.45 1.82 -0.70 202157_s_at CUGBP2 10659 -1.30 -0.25 0.08 0.14 1.86 -0.42 1.00 -1.23 0.12 202158_s_at CUGBP2 10659 -0.96 0.73 1.51 -1.63 -0.01 1.05 -0.37 -0.51 0.19 202159_at FARSL 2193 -0.74 0.57 -0.91 -1.10 1.25 0.46 1.04 -1.29 0.71 202160_at CREBBP 1387 0.55 0.43 1.34 0.35 0.39 -0.70 0.14 -0.33 -2.18 202161_at PRKCL1 5585 0.18 1.59 -0.91 0.41 0.17 0.74 -0.82 -1.73 0.36 202162_s_at CNOT8 9337 -0.85 -0.65 0.59 -0.08 -0.18 1.82 -0.96 -0.87 1.19 202163_s_at CNOT8 9337 -0.47 0.54 0.38 -1.12 -0.33 0.88 -0.42 -1.27 1.82 202164_s_at CNOT8 9337 -0.45 0.75 0.39 -1.88 0.72 0.15 -0.33 -0.82 1.47 202165_at PPP1R2 5504 0.03 0.02 1.58 0.18 0.00 -0.99 0.37 0.73 -1.94 202166_s_at PPP1R2 5504 1.10 -1.67 -0.84 1.01 0.19 1.24 0.07 -0.52 -0.58

270 202167_s_at MMS19L 64210 -0.85 1.05 -1.00 -1.31 -0.20 1.43 -0.49 0.44 0.93 202168_at TAF9 6880 0.70 -1.53 -0.26 0.22 -0.07 -0.85 0.29 1.99 -0.48 202169_s_at AASDHPPT 60496 -0.30 1.96 1.07 -0.33 0.18 -0.49 -0.34 -0.23 -1.51 202170_s_at AASDHPPT 60496 0.09 -0.21 1.19 -0.20 1.09 -0.73 -1.87 1.03 -0.37 202171_at -0.30 -1.55 0.35 1.57 0.77 0.53 -0.69 0.45 -1.13 202172_at 2.07 -0.49 0.88 -0.26 0.23 -1.13 -0.90 0.23 -0.62 202173_s_at ZNF161 7716 0.68 -1.14 -0.45 2.00 0.80 -0.82 -0.06 -0.76 -0.24 202174_s_at PCM1 5108 -1.63 0.61 -0.69 0.31 0.23 0.97 -1.10 -0.16 1.45 202175_at FLJ22678 79586 -0.50 -1.21 -0.13 -1.04 1.44 0.55 0.21 -0.77 1.45 202176_at ERCC3 2071 0.02 1.34 -2.00 -0.06 -0.08 0.83 0.33 -0.98 0.60 202177_at SC65 10609 -0.42 -0.54 -0.53 -0.75 -0.45 -0.12 -0.42 2.31 0.95 202178_at PRKCZ 5590 0.68 -0.57 -0.43 -1.18 0.01 1.23 -0.19 -1.17 1.62 202179_at BLMH 642 1.07 0.52 0.43 0.71 -0.37 -2.02 0.70 -1.05 0.01 202180_s_at MVP 9961 -1.21 -0.48 -0.26 -0.22 -1.51 1.10 0.83 0.43 1.32 202181_at KIAA0247 9766 1.74 1.25 -0.37 0.07 0.14 -0.94 0.20 -1.23 -0.86 202182_at GCN5L2 2648 -1.51 0.26 -0.35 -0.90 0.82 0.77 -0.93 1.56 0.27

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202183_s_at KNSL4 3835 -1.91 -0.30 -0.22 -0.80 0.16 0.40 0.34 1.66 0.67 202184_s_at NUP133 55746 -1.07 -0.29 -1.02 -0.94 0.67 0.74 -0.45 0.55 1.81 202185_at PLOD3 8985 0.72 -1.26 -0.35 0.19 -0.39 0.53 1.48 -1.60 0.68 202186_x_at PPP2R5A 5525 -0.56 -1.30 -1.32 0.53 0.58 0.95 -0.15 1.60 -0.31 202187_s_at PPP2R5A 5525 -0.53 -0.88 -0.58 -0.25 -1.43 0.70 0.92 0.34 1.73 202188_at KIAA0095 9688 -1.09 0.59 0.11 -0.66 -0.05 0.69 -0.99 2.03 -0.62 202189_x_at PTBP1 5725 0.64 -0.59 -0.05 2.09 -0.36 -1.14 0.62 -0.96 -0.26 202190_at CSTF1 1477 1.75 0.01 0.93 0.84 -0.51 -0.55 -0.94 -0.19 -1.34 202191_s_at GAS7 8522 -1.84 0.76 -0.44 0.53 0.78 0.26 -1.35 0.34 0.94 202192_s_at GAS7 8522 -0.90 0.64 -1.38 -0.02 0.78 1.42 -0.50 -0.99 0.96 202193_at LIMK2 3985 0.73 1.52 -1.12 -1.25 -0.21 0.58 1.03 -0.57 -0.70

271 202194_at CGI-100 50999 1.39 -0.73 0.41 1.18 0.14 -1.32 0.72 -0.93 -0.87 202195_s_at CGI-100 50999 0.73 -1.93 0.20 0.44 0.22 -0.34 -0.35 1.66 -0.64 202196_s_at DKK3 27122 -0.49 -0.84 0.82 -0.55 -1.04 -0.77 1.36 -0.05 1.57 202197_at MTMR3 8897 0.13 -1.76 0.74 0.45 -0.91 0.30 1.57 0.25 -0.79 202198_s_at MTMR3 8897 0.77 -1.38 1.19 -1.42 0.70 0.53 0.14 -1.00 0.46 202199_s_at SRPK1 6732 0.32 0.65 0.50 -1.82 -0.12 0.01 -1.40 1.18 0.68 202200_s_at SRPK1 6732 0.68 1.27 -0.10 -2.08 0.61 -0.83 0.22 -0.32 0.55 202201_at BLVRB 645 0.15 -1.70 -0.46 1.00 -1.24 1.16 -0.01 0.16 0.94 202202_s_at LAMA4 3910 -0.52 0.68 -0.44 -0.74 -0.52 2.05 0.35 -1.29 0.44 202203_s_at AMFR 267 0.92 -0.17 -0.99 1.35 0.81 -0.78 -1.62 -0.10 0.59 202204_s_at AMFR 267 1.04 -0.17 -0.37 0.70 -0.52 -1.15 0.53 -1.49 1.44 202205_at VASP 7408 -1.59 -1.15 -0.17 -0.67 0.42 1.35 0.06 0.65 1.09 202206_at ARL7 10123 -0.05 -0.05 -0.03 -0.89 -0.13 1.07 -0.86 -1.07 2.02 202207_at ARL7 10123 0.05 -0.23 -0.38 -1.42 0.92 0.13 0.72 -1.37 1.57 202208_s_at ARL7 10123 -0.88 -0.42 -0.37 -0.73 -0.42 2.47 0.12 0.11 0.12 202209_at LSM3 27258 0.94 -0.08 1.31 -0.08 -1.97 0.43 0.70 -0.56 -0.69

Table D-1. Continued. Probe Set ID Gene Symbol Entrez gp120IIIB gp120SF2 gp120BaL Gene ID 6 15 24 6 15 24 6 15 24 202210_x_at GSK3A 2931 -0.95 1.11 -0.50 -0.42 -0.95 0.47 0.13 1.90 -0.78 202211_at ARFGAP3 26286 -0.08 1.89 -0.40 -0.85 0.45 -1.37 0.93 0.15 -0.72 202212_at PES1 23481 0.29 0.30 0.64 0.20 -1.86 1.58 -0.68 0.38 -0.87 202213_s_at CUL4B 8450 -1.70 -0.38 -0.26 -1.21 0.48 0.67 0.08 1.05 1.26 202214_s_at CUL4B 8450 -0.77 1.01 -1.36 -0.11 0.03 1.10 0.90 -1.43 0.63 202215_s_at NFYC 4802 -0.62 1.45 0.95 0.31 -0.05 -0.20 -0.27 0.47 -2.03 202216_x_at NFYC 4802 -1.41 -1.41 -0.25 -0.56 0.04 1.24 0.41 0.85 1.07 202217_at C21orf33 8209 -0.64 -1.40 -0.18 1.40 -0.23 0.03 0.28 -0.88 1.63 202218_s_at FADS2 9415 -1.25 1.57 -0.97 -0.69 -0.31 0.20 0.37 -0.36 1.44 202219_at SLC6A8 6535 0.00 0.82 -1.60 1.16 1.21 0.54 -0.73 -0.88 -0.51 202220_at KIAA0907 22889 1.42 -1.31 0.52 1.40 -0.87 -1.02 0.24 0.00 -0.38 202221_s_at 0.15 1.11 -0.27 1.36 0.06 0.76 -1.80 -0.70 -0.67 202222_s_at DES 1674 1.27 0.25 1.81 -0.81 -0.15 -1.35 -0.30 -0.08 -0.64 272 200024_at RPS5 6193 0.37 0.14 1.06 0.71 -1.1 0.62 -0.35 0.57 -2.02 200025_s_at RPL27 6155 -0.28 -0.91 -0.88 -0.29 -1.16 1.26 1.07 1.42 -0.21 200026_at RPL34 6164 1.04 -0.14 1.03 0.64 -0.52 -1.2 1.01 -0.27 -1.59

273

APPENDIX E PROGRAMS AND DATA SOURCES

Throughout my graduate program, I used several programs to analyze my genomic and proteomic experiments. In addition to free and commercial programs from the internet (Table E-

1), I also coded several software packages to perform specific functions. All of the programs that

I designed are written in C# using Microsoft Visual Studios .NET 2005. Two programs,

HPRD_XMLHandler and NCBI_Libraries, are used to bring information from distant databases

(in particular HPRD and NCBI) to a local database server.

The Human Protein Reference Database (HPRD) contains information about every characterized human protein. The HPRD information is publicly available. However, when I downloaded the information, the database was delivered in the form of a single directory that contained a single extensible markup language (XML) file for each individual protein, for a total of 18,839 files (Fig. E-1A). The number of protein entries in the HPRD database is constantly increasing, and there are currently 25,205 protein entries in the database. The website also offers text files, but the information is over-simplified. Therefore, I designed a program that opens every XML file within a single directory, and transfers that information (including protein- protein interactions, accession numbers, post-translational modifications, substrates, and more) to a text file that can then be easily imported into a database (Fig. E-1B). This program transfer the information from a distant, network database, which is searched one protein at a time over the internet, to a local server where multiple proteins can be queried in much less time.

NCBI_Libraries takes advantage of a service offered by the NCBI Entrez Gene database, called HIV Interactions. Entrez Gene classifies interactions between cellular proteins and HIV viral proteins, but as with HPRD, this service is searched one at a time over the internet.

274

Therefore, I designed NCBI_Libraries to import a list of Entrez Gene ID numbers, search the

NCBI database over the internet, and retrieve HIV interactions, including pubmed references.

The output of NCBI_Libraries can also be easily imported into a local database server.

Statistical analysis of high-throughput experiments, such as microarrays and mass- spectrometry data, requires reiterative algorithms that cycle through each data variable measured in the experiment. I wrote a program called CompExpress that imports a 2-dimensional data matrix. The user designates the data into 2 classes, treated and untreated. CompExpress can perform a paired or unpaired T-test across each individual row of data, cycling through the entire matrix. The p-values for each test are recorded, and can be exported to text file designated by the user. The statistics are performed using a freely available program called R.

In collaboration with the Harvard Proteomics Core Facility, we are identifying the macrophage proteome response to LPS and IFN-γ using tandem mass-spectrometry. The raw data from the mass spectrometer are initially analyzed by Mike Chase, the bioinformatist in the core facility at Harvard. Mike generates Excel files, which he sends to us. The proteins are identified by GID accession numbers, the slice in the 1D SDS-PAGE gel the protein was identified in, and a relative measure of abundance across samples. A limitation to the analysis is the difficulty in distinguishing between isoforms. Therefore, proteins with several different isoforms will receive a GID identification number for each possible isoform separated by a semicolon. This type of notation makes linking the identification number with a reference table within a database difficult. Therefore, I designed a software package, called

ProteomicFileHandler, which expands the GID numbers (Fig. E-2A). ProteomicFileHandler expands the GID numbers by reiterating each slice and relative abundance for each sample for each GID accession number. Although, each slice is reported for every detected protein, not

275

every protein was detected in each slice. Not every slice was informative. ProteomicFileHandler removes uninformative slices, slices that fail to detect the protein in any sample (Fig. E-2B).

ProteomicFileHandler generates a text file that can be easily imported into a relational database.

276

Table E-1. Free and commercial software and data sources used to perform pathway analysis. Name Website Biocarta http://www.biocarta.com/ Pathway Lounge http://www.proteinlounge.com/ Kyoto Encyclopedia of Genes and Genomes (KEGG) http://www.genome.jp/kegg/ Spotfire http://www.spotfire.com/ Database for Annotation, Visualization, and Integrated http://david.abcc.ncifcrf.gov/home.jsp Discover (DAVID) Entrez Gene http://www.ncbi.nlm.nih.gov/ entrez/query.fcgi?db=gene GeneSpring http://www.chem.agilent.com/Scripts/ Generic.ASP?lPage=35082&indcol= Y&prodcol=Y Gene Ontology (GO) http://www.geneontology.org/ Prosite http://www.expasy.org/prosite/ Human Protein Reference Database (HPRD) http://www.hprd.org/ International Protein Index (IPI) http://www.ebi.ac.uk/IPI/IPIhelp.html NETAFFX Analysis Center http://www.affymetrix.com/analysis/ index.affx

277

A. B.

Figure E-1. Example of extensible markup language (XML) files downloaded from human protein reference database (HPRD). A) Windows explorer view indicating the large number of XML files (18,839) that are included in the directory downloaded. B) An example of a single XML file, indicating the type of information and how that information is encoded within the file. HPRD_XMLHandler parses through each XML file within the directory, and stores the information in a format that can easily be imported into a relational database.

278

Figure E-2. ProteomicFileHandler formats raw data files generated by the Harvard Proteomic Core facility. A) GID numbers are expanded by ProteomicFileHandler. B) Gel slices that failed to detect the protein are removed by ProteomicFileHandler.

279

LIST OF REFERENCES

Abbas AK, Lichtman AH, Pober JS, 2000 Cellular and Molecular Immunology, 4 Edition. W.B. Saunders Company, Philadelphia, PA.

Adams,D.O., Hamilton,T.A., 1992 Macrophages as destructive cells in host defense. In: Gallin JI, Goldstein IM, Snyderman R (Eds.), Inflammation: Basic Principles and Clinical Correlates. Raven Press, New York, p. 637.

Adams,D.O., Hamilton,T.A., 1984. The cell biology of macrophage activation. Annu. Rev. Immunol. 2, 283-318.

Agace,W.W., Amara,A., Roberts,A.I., Pablos,J.L., Thelen,S., Uguccioni,M., Li,X.Y., Marsal,J., renzana-Seisdedos,F., Delaunay,T., Ebert,E.C., Moser,B., Parker,C.M., 2000. Constitutive expression of stromal derived factor-1 by mucosal epithelia and its role in HIV transmission and propagation. Curr. Biol. 10, 325-328.

Agerberth,B., Charo,J., Werr,J., Olsson,B., Idali,F., Lindbom,L., Kiessling,R., Jornvall,H., Wigzell,H., Gudmundsson,G.H., 2000. The human antimicrobial and chemotactic peptides LL-37 and alpha-defensins are expressed by specific lymphocyte and monocyte populations. Blood 96, 3086-3093.

Akira,S., 2006. TLR signaling. Curr. Top. Microbiol. Immunol. 311, 1-16.

Albini,A., Benelli,R., Giunciuglio,D., Cai,T., Mariani,G., Ferrini,S., Noonan,D.M., 1998. Identification of a novel domain of HIV tat involved in monocyte chemotaxis. J. Biol. Chem. 273, 15895-15900.

Alfano,M., Poli,G., 2005. Role of cytokines and chemokines in the regulation of innate immunity and HIV infection. Mol Immunol 42, 161-182.

Alfano,M., Schmidtmayerova,H., Amella,C.A., Pushkarsky,T., Bukrinsky,M., 1999. The B- oligomer of pertussis toxin deactivates CC chemokine receptor 5 and blocks entry of M- tropic HIV-1 strains. J. Exp. Med. 190, 597-605.

Alfano,M., Sidenius,N., Blasi,F., Poli,G., 2003. The role of urokinase-type plasminogen activator (uPA)/uPA receptor in HIV-1 infection. J. Leukoc. Biol. 74, 750-756.

Alfano,M., Vallanti,G., Biswas,P., Bovolenta,C., Vicenzi,E., Mantelli,B., Pushkarsky,T., Rappuoli,R., Lazzarin,A., Bukrinsky,M., Poli,G., 2001. The binding subunit of pertussis toxin inhibits HIV replication in human macrophages and virus expression in chronically infected promonocytic U1 cells. J. Immunol. 166, 1863-1870.

Alkhatib,G., Locati,M., Kennedy,P.E., Murphy,P.M., Berger,E.A., 1997. HIV-1 coreceptor activity of CCR5 and its inhibition by chemokines: independence from G protein signaling and importance of coreceptor downmodulation. Virology 234, 340-348.

280

Amara,A., Vidy,A., Boulla,G., Mollier,K., Garcia-Perez,J., Alcami,J., Blanpain,C., Parmentier,M., Virelizier,J.L., Charneau,P., renzana-Seisdedos,F., 2003. G protein-dependent CCR5 signaling is not required for efficient infection of primary T lymphocytes and macrophages by R5 human immunodeficiency virus type 1 isolates. J. Virol. 77, 2550-2558.

Aquaro,S., Bagnarelli,P., Guenci,T., De,L.A., Clementi,M., Balestra,E., Calio,R., Perno,C.F., 2002. Long-term survival and virus production in human primary macrophages infected by human immunodeficiency virus. J. Med. Virol. 68, 479-488.

Aquaro,S., Balestra,E., Cenci,A., Francesconi,M., Calio,R., Perno,C.F., 1997. HIV infection in macrophage: role of long-lived cells and related therapeutical strategies. J. Biol. Regul. Homeost. Agents 11, 69-73.

Aramori,I., Ferguson,S.S., Bieniasz,P.D., Zhang,J., Cullen,B., Cullen,M.G., 1997. Molecular mechanism of desensitization of the chemokine receptor CCR-5: receptor signaling and internalization are dissociable from its role as an HIV-1 co-receptor. EMBO J. 16, 4606- 4616.

Argyropoulos,C., Nikiforidis,G.C., Theodoropoulou,M., Adamopoulos,P., Boubali,S., Georgakopoulos,T.N., Paliogianni,F., Papavassiliou,A.G., Mouzaki,A., 2004. Mining microarray data to identify transcription factors expressed in naive resting but not activated T lymphocytes. Genes Immun. 5, 16-25.

Arlt,M.F., Casper,A.M., Glover,T.W., 2003. Common fragile sites. Cytogenet. Genome Res. 100, 92-100.

Arthos,J., Rubbert,A., Rabin,R.L., Cicala,C., Machado,E., Wildt,K., Hanbach,M., Steenbeke,T.D., Swofford,R., Farber,J.M., Fauci,A.S., 2000. CCR5 signal transduction in macrophages by human immunodeficiency virus and simian immunodeficiency virus envelopes. J. Virol. 74, 6418-6424.

Astuti,D., Douglas,F., Lennard,T.W., Aligianis,I.A., Woodward,E.R., Evans,D.G., Eng,C., Latif,F., Maher,E.R., 2001. Germline SDHD mutation in familial phaeochromocytoma. Lancet 357, 1181-1182.

Atchison,R.E., Gosling,J., Monteclaro,F.S., Franci,C., Digilio,L., Charo,I.F., Goldsmith,M.A., 1996. Multiple extracellular elements of CCR5 and HIV-1 entry: dissociation from response to chemokines. Science 274, 1924-1926.

Auer,K.L., Park,J.S., Seth,P., Coffey,R.J., Darlington,G., Abo,A., McMahon,M., Depinho,R.A., Fisher,P.B., Dent,P., 1998. Prolonged activation of the mitogen-activated protein kinase pathway promotes DNA synthesis in primary hepatocytes from p21Cip-1/WAF1-null mice, but not in hepatocytes from p16INK4a-null mice. Biochem. J. 336 ( Pt 3), 551-560.

Baier,M., Werner,A., Bannert,N., Metzner,K., Kurth,R., 1995. HIV suppression by interleukin- 16. Nature 378, 563.

281

Balestra,E., Perno,C.F., Aquaro,S., Panti,S., Bertoli,A., Piacentini,M., Forbici,F., D'Arrigo,R., Calio,R., Garaci,E., 2001. Macrophages: a crucial reservoir for human immunodeficiency virus in the body. J. Biol. Regul. Homeost. Agents 15, 272-276.

Bartz,S.R., Emerman,M., 1999. Human immunodeficiency virus type 1 Tat induces apoptosis and increases sensitivity to apoptotic signals by up-regulating FLICE/caspase-8. J. Virol. 73, 1956-1963.

Bauer,A.M., Sternfeld,T., Horster,S., Schunk,M., Goebel,F.D., Bogner,J.R., 2004. Kinetics of lactate metabolism after submaximal ergometric exercise in HIV-infected patients. HIV. Med. 5, 371-376.

Beignon,A.S., McKenna,K., Skoberne,M., Manches,O., DaSilva,I., Kavanagh,D.G., Larsson,M., Gorelick,R.J., Lifson,J.D., Bhardwaj,N., 2005. Endocytosis of HIV-1 activates plasmacytoid dendritic cells via Toll-like receptor-viral RNA interactions. J. Clin. Invest 115, 3265-3275.

Berger,E.A., Murphy,P.M., Farber,J.M., 1999. Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. Rev. Immunol. 17, 657-700.

Bernasconi,S., Matteucci,C., Sironi,M., Conni,M., Colotta,F., Mosca,M., Colombo,N., Bonazzi,C., Landoni,F., Corbetta,G., ., 1995. Effects of granulocyte-monocyte colony- stimulating factor (GM-CSF) on expression of adhesion molecules and production of cytokines in blood monocytes and ovarian cancer-associated macrophages. Int. J. Cancer 60, 300-307.

Berretta,M., Cinelli,R., Martellotta,F., Spina,M., Vaccher,E., Tirelli,U., 2003. Therapeutic approaches to AIDS-related malignancies. Oncogene 22, 6646-6659.

Bieniasz,P.D., 2003. Restriction factors: a defense against retroviral infection. Trends Microbiol. 11, 286-291.

Biggs,B.A., Hewish,M., Kent,S., Hayes,K., Crowe,S.M., 1995. HIV-1 infection of human macrophages impairs phagocytosis and killing of Toxoplasma gondii. J. Immunol. 154, 6132-6139.

Bjorndal,A., Deng,H., Jansson,M., Fiore,J.R., Colognesi,C., Karlsson,A., Albert,J., Scarlatti,G., Littman,D.R., Fenyo,E.M., 1997. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J. Virol. 71, 7478-7487.

Boren,J., Cascante,M., Marin,S., Comin-Anduix,B., Centelles,J.J., Lim,S., Bassilian,S., Ahmed,S., Lee,W.N., Boros,L.G., 2001. Gleevec (STI571) influences metabolic enzyme activities and glucose carbon flow toward nucleic acid and fatty acid synthesis in myeloid tumor cells. J. Biol. Chem. 276, 37747-37753.

Borges,L., Hsu,M.L., Fanger,N., Kubin,M., Cosman,D., 1997. A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J. Immunol. 159, 5192-5196.

282

Borghi,P., Fantuzzi,L., Varano,B., Gessani,S., Puddu,P., Conti,L., Capobianchi,M.R., Ameglio,F., Belardelli,F., 1995. Induction of interleukin-10 by human immunodeficiency virus type 1 and its gp120 protein in human monocytes/macrophages. J. Virol. 69, 1284- 1287.

Bottazzi,M.E., Zhu,X., Bohmer,R.M., Assoian,R.K., 1999. Regulation of p21(cip1) expression by growth factors and the extracellular matrix reveals a role for transient ERK activity in G1 phase. J. Cell Biol. 146, 1255-1264.

Bovolenta,C., Camorali,L., Mauri,M., Ghezzi,S., Nozza,S., Tambussi,G., Lazzarin,A., Poli,G., 2001. Expression and activation of a C-terminal truncated isoform of STAT5 (STAT5 Delta) following interleukin 2 administration or AZT monotherapy in HIV-infected individuals. Clin. Immunol. 99, 75-81.

Boyle,M.J., Sewell,W.A., Milliken,S.T., Cooper,D.A., Penny,R., 1993. HIV and malignancy. J. Acquir. Immune. Defic. Syndr. 6 Suppl 1, S5-S9.

Brahimi-Horn,M.C., Pouyssegur,J., 2005. The hypoxia-inducible factor and tumor progression along the angiogenic pathway. Int. Rev. Cytol. 242, 157-213.

Briggs,J.A., Grunewald,K., Glass,B., Forster,F., Krausslich,H.G., Fuller,S.D., 2006. The mechanism of HIV-1 core assembly: insights from three-dimensional reconstructions of authentic virions. Structure. 14, 15-20.

Briggs,J.A., Wilk,T., Welker,R., Krausslich,H.G., Fuller,S.D., 2003. Structural organization of authentic, mature HIV-1 virions and cores. EMBO J. 22, 1707-1715.

Brodie,S.J., 2000. Nonlymphoid reservoirs of HIV replication in children with chronic- progressive disease. J Leukoc. Biol 68, 351-359.

Brooks,D.G., Zack,J.A., 2002. Effect of latent human immunodeficiency virus infection on cell surface phenotype. J. Virol. 76, 1673-1681.

Brown,A., Zhang,H., Lopez,P., Pardo,C.A., Gartner,S., 2006. In vitro modeling of the HIV- macrophage reservoir. J. Leukoc. Biol. 80, 1127-1135.

Bukrinskaya,A., Brichacek,B., Mann,A., Stevenson,M., 1998. Establishment of a functional human immunodeficiency virus type 1 (HIV-1) reverse transcription complex involves the cytoskeleton. J. Exp. Med. 188, 2113-2125.

Burke B, Lewis CE, 2002 The Macrophage, 2 Edition. Oxford University Press, Oxford, UK.

Bustamante,E., Pedersen,P.L., 1977. High aerobic glycolysis of rat hepatoma cells in culture: role of mitochondrial hexokinase. Proc. Natl. Acad. Sci. U. S. A 74, 3735-3739.

Cantin,R., Methot,S., Tremblay,M.J., 2005. Plunder and stowaways: incorporation of cellular proteins by enveloped viruses. J. Virol. 79, 6577-6587.

283

Carew,J.S., Huang,P., 2002. Mitochondrial defects in cancer. Mol. Cancer 1, 9.

Carlson,K.A., Ciborowski,P., Schellpeper,C.N., Biskup,T.M., Shen,R.F., Luo,X., Destache,C.J., Gendelman,H.E., 2004. Proteomic fingerprinting of HIV-1-infected human monocyte- derived macrophages: a preliminary report. J. Neuroimmunol. 147, 35-42.

Carr,S., Aebersold,R., Baldwin,M., Burlingame,A., Clauser,K., Nesvizhskii,A., 2004. The need for guidelines in publication of peptide and protein identification data: Working Group on Publication Guidelines for Peptide and Protein Identification Data. Mol. Cell Proteomics. 3, 531-533.

Castro KG, Ward JW, Slutsker L, Buehler JW, Jaffe HW, Berkelman RL. 1992. 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. MMWR 41(RR-17).

Cefai,D., Debre,P., Kaczorek,M., Idziorek,T., Autran,B., Bismuth,G., 1990. Human immunodeficiency virus-1 glycoproteins gp120 and gp160 specifically inhibit the CD3/T cell-antigen receptor phosphoinositide transduction pathway. J. Clin. Invest 86, 2117-2124.

Cella,M., Nakajima,H., Facchetti,F., Hoffmann,T., Colonna,M., 2000. ILT receptors at the interface between lymphoid and myeloid cells. Curr. Top. Microbiol. Immunol. 251, 161- 166.

Chan,G.K., Yen,T.J., 2003. The mitotic checkpoint: a signaling pathway that allows a single unattached kinetochore to inhibit mitotic exit. Prog. Cell Cycle Res. 5, 431-439.

Chen,S., Tuttle,D.L., Oshier,J.T., Knot,H.J., Streit,W.J., Goodenow,M.M., Harrison,J.K., 2005. Transforming growth factor-beta1 increases CXCR4 expression, stromal-derived factor- 1alpha-stimulated signalling and human immunodeficiency virus-1 entry in human monocyte-derived macrophages. Immunology 114, 565-574.

Cherepanov,P., Maertens,G., Proost,P., Devreese,B., Van,B.J., Engelborghs,Y., de,C.E., Debyser,Z., 2003. HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 protein in human cells. J. Biol. Chem. 278, 372-381.

Chertova,E., Bess,J.J., Jr., Crise,B.J., Sowder II,R.C., Schaden,T.M., Hilburn,J.M., Hoxie,J.A., Benveniste,R.E., Lifson,J.D., Henderson,L.E., Arthur,L.O., 2002. Envelope glycoprotein incorporation, not shedding of surface envelope glycoprotein (gp120/SU), Is the primary determinant of SU content of purified human immunodeficiency virus type 1 and simian immunodeficiency virus. J. Virol. 76, 5315-5325.

Chertova,E., Chertov,O., Coren,L.V., Roser,J.D., Trubey,C.M., Bess,J.W., Jr., Sowder,R.C., Barsov,E., Hood,B.L., Fisher,R.J., Nagashima,K., Conrads,T.P., Veenstra,T.D., Lifson,J.D., Ott,D.E., 2006. Proteomic and biochemical analysis of purified human immunodeficiency virus type 1 produced from infected monocyte-derived macrophages. J. Virol. 80, 9039-9052.

284

Cicala,C., Arthos,J., Rubbert,A., Selig,S., Wildt,K., Cohen,O.J., Fauci,A.S., 2000. HIV-1 envelope induces activation of caspase-3 and cleavage of focal adhesion kinase in primary human CD4(+) T cells. Proc. Natl. Acad. Sci. U. S. A 97, 1178-1183.

Cicala,C., Arthos,J., Selig,S.M., Dennis,G., Jr., Hosack,D.A., Van Ryk,D., Spangler,M.L., Steenbeke,T.D., Khazanie,P., Gupta,N., Yang,J., Daucher,M., Lempicki,R.A., Fauci,A.S., 2002. HIV envelope induces a cascade of cell signals in non-proliferating target cells that favor virus replication. Proc Natl Acad Sci U. S. A 99, 9380-9385.

Citri,A., Yarden,Y., 2006. EGF-ERBB signalling: towards the systems level. Nat. Rev. Mol. Cell Biol. 7, 505-516.

Clark,E., Santiago,F., Deng,L., Chong,S., de La,F.C., Wang,L., Fu,P., Stein,D., Denny,T., Lanka,V., Mozafari,F., Okamoto,T., Kashanchi,F., 2000. Loss of G(1)/S checkpoint in human immunodeficiency virus type 1-infected cells is associated with a lack of cyclin- dependent kinase inhibitor p21/Waf1. J. Virol. 74, 5040-5052.

Coberley,C.R., Kohler,J.J., Brown,J.N., Oshier,J.T., Baker,H.V., Popp,M.P., Sleasman,J.W., Goodenow,M.M., 2004. Impact on genetic networks in human macrophages by a CCR5 strain of human immunodeficiency virus type 1. J Virol 78, 11477-11486.

Cocchi,F., DeVico,A.L., Garzino-Demo,A., Arya,S.K., Gallo,R.C., Lusso,P., 1995. Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by CD8+ T cells. Science 270, 1811-1815.

Coffin,J., Hughes,S., Varmus,H., 1997 Retroviruses. Cold Spring Harbor Laboratory Press, Plainview, New York.

Collin,M., Illei,P., James,W., Gordon,S., 1994. Definition of the range and distribution of human immunodeficiency virus macrophage tropism using PCR-based infectivity measurements. J. Gen. Virol. 75 ( Pt 7), 1597-1603.

Collman,R., Balliet,J.W., Gregory,S.A., Friedman,H., Kolson,D.L., Nathanson,N., Srinivasan,A., 1992. An infectious molecular clone of an unusual macrophage-tropic and highly cytopathic strain of human immunodeficiency virus type 1. J. Virol. 66, 7517-7521.

Collman,R.G., Yi,Y., 1999. Cofactors for human immunodeficiency virus entry into primary macrophages. J. Infect. Dis. 179 Suppl 3, S422-S426.

Connor,R.I., Sheridan,K.E., Ceradini,D., Choe,S., Landau,N.R., 1997. Change in coreceptor use coreceptor use correlates with disease progression in HIV-1--infected individuals. J. Exp. Med. 185, 621-628.

Conti,L., Fantuzzi,L., Del,C.M., Belardelli,F., Gessani,S., 2004. Immunomodulatory effects of the HIV-1 gp120 protein on antigen presenting cells: implications for AIDS pathogenesis. Immunobiology 209, 99-115.

285

Correll,P.H., Morrison,A.C., Lutz,M.A., 2004. Receptor tyrosine kinases and the regulation of macrophage activation. J Leukoc. Biol 75, 731-737.

Cosson,P., 1996. Direct interaction between the envelope and matrix proteins of HIV-1. EMBO J. 15, 5783-5788.

Cotter,R.L., Zheng,J., Che,M., Niemann,D., Liu,Y., He,J., Thomas,E., Gendelman,H.E., 2001. Regulation of human immunodeficiency virus type 1 infection, beta-chemokine production, and CCR5 expression in CD40L-stimulated macrophages: immune control of viral entry. J. Virol. 75, 4308-4320.

Coy,J.F., Dressler,D., Wilde,J., Schubert,P., 2005. Mutations in the transketolase-like gene TKTL1: clinical implications for neurodegenerative diseases, diabetes and cancer. Clin. Lab 51, 257-273.

Crowe,S.M., Vardaxis,N.J., Kent,S.J., Maerz,A.L., Hewish,M.J., McGrath,M.S., Mills,J., 1994. HIV infection of monocyte-derived macrophages in vitro reduces phagocytosis of Candida albicans. J. Leukoc. Biol. 56, 318-327.

Cruikshank,W.W., Kornfeld,H., Center,D.M., 2000. Interleukin-16. J. Leukoc. Biol. 67, 757- 766.

Del,C.M., Liu,Q.H., Schols,D., de,C.E., Gessani,S., Freedman,B.D., Collman,R.G., 2001. HIV-1 gp120 and chemokine activation of Pyk2 and mitogen-activated protein kinases in primary macrophages mediated by calcium-dependent, pertussis toxin-insensitive chemokine receptor signaling. Blood 98, 2909-2916.

Del,S.L., DeMartino,A., Biancone,L., Bussolati,B., Conaldi,P.G., Toniolo,A., Camussi,G., 1999. The synthesis of platelet-activating factor modulates chemotaxis of monocytes induced by HIV-1 Tat. Eur. J. Immunol. 29, 1513-1521.

Dhillon,V.S., Husain,S.A., Ray,G.N., 2003. Expression of aphidicolin-induced fragile sites and their relationship between genetic susceptibility in breast cancer, ovarian cancer, and non- small-cell lung cancer patients. Teratog. Carcinog. Mutagen. Suppl 1, 35-45.

Diebold,S.S., Montoya,M., Unger,H., Alexopoulou,L., Roy,P., Haswell,L.E., Al Shamkhani,A., Flavell,R., Borrow,P., Reis e Sousa, 2003. Viral infection switches non-plasmacytoid dendritic cells into high interferon producers. Nature 424, 324-328.

Djordjevic,J.T., Schibeci,S.D., Stewart,G.J., Williamson,P., 2004. HIV type 1 Nef increases the association of T cell receptor (TCR)-signaling molecules with T cell rafts and promotes activation-induced raft fusion. AIDS Res. Hum. Retroviruses 20, 547-555.

Doranz,B.J., Rucker,J., Yi,Y., Smyth,R.J., Samson,M., Peiper,S.C., Parmentier,M., Collman,R.G., Doms,R.W., 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85, 1149- 1158.

286

Elder,R.T., Benko,Z., Zhao,Y., 2002. HIV-1 VPR modulates cell cycle G2/M transition through an alternative cellular mechanism other than the classic mitotic checkpoints. Front Biosci. 7, d349-d357.

Elder,R.T., Yu,M., Chen,M., Zhu,X., Yanagida,M., Zhao,Y., 2001. HIV-1 Vpr induces cell cycle G2 arrest in fission yeast (Schizosaccharomyces pombe) through a pathway involving regulatory and catalytic subunits of PP2A and acting on both Wee1 and Cdc25. Virology 287, 359-370.

Ellerman,V., Bang,O., 1908. Experimentall leukamie bei huhnern. Zentralbl Bakteriol 46, 595- 609.

Elstrom,R.L., Bauer,D.E., Buzzai,M., Karnauskas,R., Harris,M.H., Plas,D.R., Zhuang,H., Cinalli,R.M., Alavi,A., Rudin,C.M., Thompson,C.B., 2004. Akt stimulates aerobic glycolysis in cancer cells. Cancer Res. 64, 3892-3899.

Erroi,A., Sironi,M., Chiaffarino,F., Chen,Z.G., Mengozzi,M., Mantovani,A., 1989. IL-1 and IL-6 release by tumor-associated macrophages from human ovarian carcinoma. Int. J. Cancer 44, 795-801.

Esser,M.T., Graham,D.R., Coren,L.V., Trubey,C.M., Bess,J.W., Jr., Arthur,L.O., Ott,D.E., Lifson,J.D., 2001. Differential incorporation of CD45, CD80 (B7-1), CD86 (B7-2), and major histocompatibility complex class I and II molecules into human immunodeficiency virus type 1 virions and microvesicles: implications for viral pathogenesis and immune regulation. J. Virol. 75, 6173-6182.

Fackler,O.T., Wolf,D., Weber,H.O., Laffert,B., D'Aloja,P., Schuler-Thurner,B., Geffin,R., Saksela,K., Geyer,M., Peterlin,B.M., Schuler,G., Baur,A.S., 2001. A natural variability in the proline-rich motif of Nef modulates HIV-1 replication in primary T cells. Curr. Biol. 11, 1294-1299.

Fakruddin,J.M., Lempicki,R.A., Gorelick,R.J., Yang,J., Adelsberger,J.W., Garcia-Pineres,A.J., Pinto,L.A., Lane,H.C., Imamichi,T., 2007. Noninfectious papilloma virus-like particles inhibit HIV-1 replication: implications for immune control of HIV-1 infection by IL-27. Blood 109, 1841-1849.

Fantuzzi,L., Canini,I., Belardelli,F., Gessani,S., 2001. HIV-1 gp120 stimulates the production of beta-chemokines in human peripheral blood monocytes through a CD4-independent mechanism. J. Immunol. 166, 5381-5387.

Fantuzzi,L., Conti,L., Gauzzi,M.C., Eid,P., Del Corno,M., Varano,B., Canini,I., Belardelli,F., Gessani,S., 2000. Regulation of chemokine/cytokine network during in vitro differentiation and HIV-1 infection of human monocytes: possible importance in the pathogenesis of AIDS. J. Leukoc. Biol. 68, 391-399.

Felzien,L.K., Woffendin,C., Hottiger,M.O., Subbramanian,R.A., Cohen,E.A., Nabel,G.J., 1998. HIV transcriptional activation by the accessory protein, VPR, is mediated by the p300 coactivator. Proc. Natl. Acad. Sci. U. S. A 95, 5281-5286.

287

Fenyo,E.M., Morfeldt-Manson,L., Chiodi,F., Lind,B., von,G.A., Albert,J., Olausson,E., Asjo,B., 1988. Distinct replicative and cytopathic characteristics of human immunodeficiency virus isolates. J. Virol. 62, 4414-4419.

Fiorentini,S., Marini,E., Caracciolo,S., Caruso,A., 2006. Functions of the HIV-1 matrix protein p17. New Microbiol. 29, 1-10.

Fischer-Smith,T., Croul,S., Sverstiuk,A.E., Capini,C., L'Heureux,D., Regulier,E.G., Richardson,M.W., Amini,S., Morgello,S., Khalili,K., Rappaport,J., 2001. CNS invasion by CD14+/CD16+ peripheral blood-derived monocytes in HIV dementia: perivascular accumulation and reservoir of HIV infection. J. Neurovirol. 7, 528-541.

Flier,J.S., Mueckler,M.M., Usher,P., Lodish,H.F., 1987. Elevated levels of glucose transport and transporter messenger RNA are induced by ras or src oncogenes. Science 235, 1492-1495.

Fouchier,R.A., Meyaard,L., Brouwer,M., Hovenkamp,E., Schuitemaker,H., 1996. Broader tropism and higher cytopathicity for CD4+ T cells of a syncytium-inducing compared to a non-syncytium-inducing HIV-1 isolate as a mechanism for accelerated CD4+ T cell decline in vivo. Virology 219, 87-95.

Freed,E.O., 1998. HIV-1 gag proteins: diverse functions in the virus life cycle. Virology 251, 1- 15.

Freedman,B.D., 2006. Mechanisms of calcium signaling and function in lymphocytes. Crit Rev. Immunol. 26, 97-111.

Furtado,M.R., Callaway,D.S., Phair,J.P., Kunstman,K.J., Stanton,J.L., Macken,C.A., Perelson,A.S., Wolinsky,S.M., 1999. Persistence of HIV-1 transcription in peripheral-blood mononuclear cells in patients receiving potent antiretroviral therapy. N. Engl. J. Med. 340, 1614-1622.

Garbuglia,A.R., Zaccarelli,M., Calcaterra,S., Cappiello,G., Marini,R., Benedetto,A., 2001. Dynamics of viral load in plasma and HIV DNA in lymphocytes during highly active antiretroviral therapy (HAART): high viral burden in macrophages after 1 year of treatment. J. Chemother. 13, 188-194.

Garcia,K.C., 1999. Molecular interactions between extracellular components of the T-cell receptor signaling complex. Immunol. Rev. 172, 73-85.

Garner,L.I., Salim,M., Mohammed,F., Willcox,B.E., 2006. Expression, purification, and refolding of the myeloid inhibitory receptor leukocyte immunoglobulin-like receptor-5 for structural and ligand identification studies. Protein Expr. Purif. 47, 490-497.

Gartel,A.L., Radhakrishnan,S.K., 2005. Lost in transcription: p21 repression, mechanisms, and consequences. Cancer Res. 65, 3980-3985.

Gatenby,R.A., Gillies,R.J., 2004. Why do cancers have high aerobic glycolysis? Nat. Rev. Cancer 4, 891-899.

288

Geiss,G.K., Bumgarner,R.E., An,M.C., Agy,M.B., 't Wout,A.B., Hammersmark,E., Carter,V.S., Upchurch,D., Mullins,J.I., Katze,M.G., 2000. Large-scale monitoring of host cell gene expression during HIV-1 infection using cDNA microarrays. Virology 266, 8-16.

Gelderblom H. Fine Structure of HIV and SIV. 1997. Ref Type: Internet Communication

Geleziunas,R., Bour,S., Wainberg,M.A., 1994. HIV-1 associated down-modulation of CD4 gene expression is differentially restricted in lymphocytic and monocytic cell lines. J. Leukoc. Biol. 55, 589-595.

Gendelman,H.E., Orenstein,J.M., Baca,L.M., Weiser,B., Burger,H., Kalter,D.C., Meltzer,M.S., 1989. The macrophage in the persistence and pathogenesis of HIV infection. AIDS 3, 475- 495.

Gendelman,H.E., Orenstein,J.M., Martin,M.A., Ferrua,C., Mitra,R., Phipps,T., Wahl,L.A., Lane,H.C., Fauci,A.S., Burke,D.S., ., 1988. Efficient isolation and propagation of human immunodeficiency virus on recombinant colony-stimulating factor 1-treated monocytes. J. Exp. Med. 167, 1428-1441.

Gessani,S., Borghi,P., Fantuzzi,L., Varano,B., Conti,L., Puddu,P., Belardelli,F., 1997. Induction of cytokines by HIV-1 and its gp120 protein in human peripheral blood monocyte/macrophages and modulation of cytokine response during differentiation. J. Leukoc. Biol. 62, 49-53.

Gessani,S., Fantuzzi,L., Puddu,P., Belardelli,F., 2000 Purification of macrophages. In: Paulnock,D. (Ed.), Macrophages: A Practical Approach (Practical Approach Series). Oxford University Press, pp. 31-60.

Ghaffari,G., Tuttle,D.L., Briggs,D., Burkhardt,B.R., Bhatt,D., Andiman,W.A., Sleasman,J.W., Goodenow,M.M., 2005. Complex determinants in human immunodeficiency virus type 1 envelope gp120 mediate CXCR4-dependent infection of macrophages. J. Virol. 79, 13250- 13261.

Goh,W.C., Manel,N., Emerman,M., 2004. The human immunodeficiency virus Vpr protein binds Cdc25C: implications for G2 arrest. Virology 318, 337-349.

Goh,W.C., Rogel,M.E., Kinsey,C.M., Michael,S.F., Fultz,P.N., Nowak,M.A., Hahn,B.H., Emerman,M., 1998. HIV-1 Vpr increases viral expression by manipulation of the cell cycle: a mechanism for selection of Vpr in vivo. Nat. Med. 4, 65-71.

Goodenow,M.M., Collman,R.G., 2006. HIV-1 coreceptor preference is distinct from target cell tropism: a dual-parameter nomenclature to define viral phenotypes. J. Leukoc. Biol.

Goodenow,M.M., Kohler,J.J., 2007 HIV-1, AIDS, and Related Malignancies. In: Runge,M., Patterson,C. (Eds.), Principles of Molecular Medicine. Humana Press, Totowa, NJ, USA, pp. 818-827.

289

Goodenow,M.M., Rose,S.L., Tuttle,D.L., Sleasman,J.W., 2003. HIV-1 fitness and macrophages. J. Leukoc. Biol. 74, 657-666.

Gordon,S., 2003. Alternative activation of macrophages. Nat. Rev Immunol 3, 23-35.

Gorry,P.R., Bristol,G., Zack,J.A., Ritola,K., Swanstrom,R., Birch,C.J., Bell,J.E., Bannert,N., Crawford,K., Wang,H., Schols,D., de,C.E., Kunstman,K., Wolinsky,S.M., Gabuzda,D., 2001. Macrophage tropism of human immunodeficiency virus type 1 isolates from brain and lymphoid tissues predicts neurotropism independent of coreceptor specificity. J. Virol. 75, 10073-10089.

Gorry,P.R., Churchill,M., Crowe,S.M., Cunningham,A.L., Gabuzda,D., 2005. Pathogenesis of macrophage tropic HIV-1. Curr. HIV. Res. 3, 53-60.

Gorry,P.R., Sterjovski,J., Churchill,M., Witlox,K., Gray,L., Cunningham,A., Wesselingh,S., 2004. The role of viral coreceptors and enhanced macrophage tropism in human immunodeficiency virus type 1 disease progression. Sex Health 1, 23-34.

Gottlinger,H.G., Sodroski,J.G., Haseltine,W.A., 1989. Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. U. S. A 86, 5781-5785.

Gottlob,K., Majewski,N., Kennedy,S., Kandel,E., Robey,R.B., Hay,N., 2001. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev. 15, 1406-1418.

Gould,S.J., Booth,A.M., Hildreth,J.E., 2003. The Trojan exosome hypothesis. Proc. Natl. Acad. Sci. U. S. A 100, 10592-10597.

Graziani-Bowering,G., Filion,L.G., Thibault,P., Kozlowski,M., 2002. CD4 is active as a signaling molecule on the human monocytic cell line Thp-1. Exp. Cell Res. 279, 141-152.

Gummuluru,S., Emerman,M., 1999. Cell cycle- and Vpr-mediated regulation of human immunodeficiency virus type 1 expression in primary and transformed T-cell lines. J. Virol. 73, 5422-5430.

Guntermann,C., Murphy,B.J., Zheng,R., Qureshi,A., Eagles,P.A., Nye,K.E., 1999. Human immunodeficiency virus-1 infection requires pertussis toxin sensitive G-protein-coupled signalling and mediates cAMP downregulation. Biochem. Biophys. Res. Commun. 256, 429- 435.

Gupta,S., Aggarwal,S., Kim,C., Gollapudi,S., 1994. Human immunodeficiency virus-1 recombinant gp120 induces changes in protein kinase C isozymes--a preliminary report. Int. J. Immunopharmacol. 16, 197-204.

Guse,A.H., Roth,E., Broker,B.M., Emmrich,F., 1992. Complex inositol polyphosphate response induced by co-cross-linking of CD4 and Fc gamma receptors in the human monocytoid cell line U937. J. Immunol. 149, 2452-2458.

290

Harris,R.S., Bishop,K.N., Sheehy,A.M., Craig,H.M., Petersen-Mahrt,S.K., Watt,I.N., Neuberger,M.S., Malim,M.H., 2003. DNA deamination mediates innate immunity to retroviral infection. Cell 113, 803-809.

Hasnain,S.E., Begum,R., Ramaiah,K.V., Sahdev,S., Shajil,E.M., Taneja,T.K., Mohan,M., Athar,M., Sah,N.K., Krishnaveni,M., 2003. Host-pathogen interactions during apoptosis. J. Biosci. 28, 349-358.

Heil,F., Hemmi,H., Hochrein,H., Ampenberger,F., Kirschning,C., Akira,S., Lipford,G., Wagner,H., Bauer,S., 2004. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303, 1526-1529.

Henderson,A.J., Calame,K.L., 1997. CCAAT/enhancer binding protein (C/EBP) sites are required for HIV-1 replication in primary macrophages but not CD4(+) T cells. Proc. Natl. Acad. Sci. U. S. A 94, 8714-8719.

Ho,W.Z., Cherukuri,R., Douglas,S.D., 1994. The macrophage and HIV-1. Immunol. Ser. 60, 569-587.

Hobbs,W.E., DeLuca,N.A., 1999. Perturbation of cell cycle progression and cellular gene expression as a function of herpes simplex virus ICP0. J. Virol. 73, 8245-8255.

Honda,K., Takaoka,A., Taniguchi,T., 2006. Type I interferon [corrected] gene induction by the interferon regulatory factor family of transcription factors. Immunity. 25, 349-360.

Huang,S., 2004. Back to the biology in systems biology: what can we learn from biomolecular networks? Brief. Funct. Genomic. Proteomic. 2, 279-297.

Huentelman,M.J., Zubcevic,J., Hernandez Prada,J.A., Xiao,X., Dimitrov,D.S., Raizada,M.K., Ostrov,D.A., 2004. Structure-based discovery of a novel angiotensin-converting enzyme 2 inhibitor. Hypertension 44, 903-906.

Huthoff,H., Malim,M.H., 2005. Cytidine deamination and resistance to retroviral infection: towards a structural understanding of the APOBEC proteins. Virology 334, 147-153.

Isaacs,A., Lindenmann,J., 1957. Virus interference. I. The interferon. Proc. R. Soc. Lond B Biol. Sci. 147, 258-267.

Janeway,C., Travers,P., Walport,M., Shlomchik,M., 2001 Immunobiology, 5 Edition. Garland Publishing, New York, NY.

Jeang,K.T., Yedavalli,V., 2006. Role of RNA helicases in HIV-1 replication. Nucleic Acids Res. 34, 4198-4205.

Jin,S., Antinore,M.J., Lung,F.D., Dong,X., Zhao,H., Fan,F., Colchagie,A.B., Blanck,P., Roller,P.P., Fornace,A.J., Jr., Zhan,Q., 2000. The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J. Biol. Chem. 275, 16602-16608.

291

Joint United Nations Programme on HIV/AIDS, World Health Organization. AIDS epidemic update. 2006.

Jung,A., Maier,R., Vartanian,J.P., Bocharov,G., Jung,V., Fischer,U., Meese,E., Wain-Hobson,S., Meyerhans,A., 2002. Multiply infected spleen cells in HIV patients. Nature 418, 144.

Keller,A., Nesvizhskii,A.I., Kolker,E., Aebersold,R., 2002. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal. Chem. 74, 5383-5392.

Khati,M., James,W., Gordon,S., 2001. HIV-macrophage interactions at the cellular and molecular level. Arch. Immunol. Ther. Exp. (Warsz. ) 49, 367-378.

Kim,F.M., Kolson,D.L., Balliet,J.W., Srinivasan,A., Collman,R.G., 1995. V3-independent determinants of macrophage tropism in a primary human immunodeficiency virus type 1 isolate. J. Virol. 69, 1755-1761.

Kinoshita,N., Yamano,H., Niwa,H., Yoshida,T., Yanagida,M., 1993. Negative regulation of mitosis by the fission yeast protein phosphatase ppa2. Genes Dev. 7, 1059-1071.

Kinoshita,S., Chen,B.K., Kaneshima,H., Nolan,G.P., 1998. Host control of HIV-1 parasitism in T cells by the nuclear factor of activated T cells. Cell 95, 595-604.

Kinter,A., Catanzaro,A., Monaco,J., Ruiz,M., Justement,J., Moir,S., Arthos,J., Oliva,A., Ehler,L., Mizell,S., Jackson,R., Ostrowski,M., Hoxie,J., Offord,R., Fauci,A.S., 1998. CC- chemokines enhance the replication of T-tropic strains of HIV-1 in CD4(+) T cells: role of signal transduction. Proc. Natl. Acad. Sci. U. S. A 95, 11880-11885.

Kinter,A.L., Ostrowski,M., Goletti,D., Oliva,A., Weissman,D., Gantt,K., Hardy,E., Jackson,R., Ehler,L., Fauci,A.S., 1996. HIV replication in CD4+ T cells of HIV-infected individuals is regulated by a balance between the viral suppressive effects of endogenous beta-chemokines and the viral inductive effects of other endogenous cytokines. Proc. Natl. Acad. Sci. U. S. A 93, 14076-14081.

Kirkland,P.A., Busby,J., Stevens S Jr, Maupin-Furlow,J.A., 2006. Trizol-based method for sample preparation and isoelectric focusing of halophilic proteins. Anal. Biochem. 351, 254- 259.

Knight,S.C., Macatonia,S.E., 1991. Effect of HIV on antigen presentation by dendritic cells and macrophages. Res. Virol. 142, 123-128.

Kohler,J.J., Tuttle,D.L., Coberley,C.R., Sleasman,J.W., Goodenow,M.M., 2003. Human immunodeficiency virus type 1 (HIV-1) induces activation of multiple STATs in CD4+ cells of lymphocyte or monocyte/macrophage lineages. J Leukoc. Biol 73, 407-416.

Komano,J., Futahashi,Y., Urano,E., Miyauchi,K., Murakami,T., Matsuda,Z., Yamamoto,N., 2005. The interaction of HIV-1 with the host factors. Jpn. J. Infect. Dis. 58, 125-130.

292

Konopka,K., Duzgunes,N., 2002. Expression of CD4 controls the susceptibility of THP-1 cells to infection by R5 and X4 HIV type 1 isolates. AIDS Res. Hum. Retroviruses 18, 123-131.

Koot,M., van,L.R., de Goede,R.E., Keet,I.P., Danner,S., Eeftinck Schattenkerk,J.K., Reiss,P., Tersmette,M., Lange,J.M., Schuitemaker,H., 1999. Conversion rate towards a syncytium- inducing (SI) phenotype during different stages of human immunodeficiency virus type 1 infection and prognostic value of SI phenotype for survival after AIDS diagnosis. J. Infect. Dis. 179, 254-258.

Kootstra,N.A., Schuitemaker,H., 1998. Proliferation-dependent replication in primary macrophages of macrophage-tropic HIV type 1 variants. AIDS Res. Hum. Retroviruses 14, 339-345.

Kootstra,N.A., Zwart,B.M., Schuitemaker,H., 2000. Diminished human immunodeficiency virus type 1 reverse transcription and nuclear transport in primary macrophages arrested in early G(1) phase of the cell cycle. J Virol 74, 1712-1717.

Kotov,A., Zhou,J., Flicker,P., Aiken,C., 1999. Association of Nef with the human immunodeficiency virus type 1 core. J. Virol. 73, 8824-8830.

Koziel,H., Eichbaum,Q., Kruskal,B.A., Pinkston,P., Rogers,R.A., Armstrong,M.Y., Richards,F.F., Rose,R.M., Ezekowitz,R.A., 1998. Reduced binding and phagocytosis of Pneumocystis carinii by alveolar macrophages from persons infected with HIV-1 correlates with mannose receptor downregulation. J. Clin. Invest 102, 1332-1344.

Krautwald,S., 1998. IL-16 activates the SAPK signaling pathway in CD4+ macrophages. J. Immunol. 160, 5874-5879.

Krek,W., Nigg,E.A., 1991. Mutations of p34cdc2 phosphorylation sites induce premature mitotic events in HeLa cells: evidence for a double block to p34cdc2 kinase activation in vertebrates. EMBO J. 10, 3331-3341.

Kuhn,L., Coutsoudis,A., Moodley,D., Mngqundaniso,N., Trabattoni,D., Shearer,G.M., Clerici,M., Coovadia,H.M., 2001. Interferon-gamma and interleukin-10 production among HIV-1-infected and uninfected infants of HIV-1-infected mothers. Pediatr. Res. 50, 412-416.

Lapham,C.K., Zaitseva,M.B., Lee,S., Romanstseva,T., Golding,H., 1999. Fusion of monocytes and macrophages with HIV-1 correlates with biochemical properties of CXCR4 and CCR5. Nat. Med. 5, 303-308.

Latella,L., Sacco,A., Pajalunga,D., Tiainen,M., Macera,D., D'Angelo,M., Felici,A., Sacchi,A., Crescenzi,M., 2001. Reconstitution of cyclin D1-associated kinase activity drives terminally differentiated cells into the cell cycle. Mol. Cell Biol. 21, 5631-5643.

Lathey,J.L., Brambilla,D., Goodenow,M.M., Nokta,M., Rasheed,S., Siwak,E.B., Bremer,J.W., Huang,D.D., Yi,Y., Reichelderfer,P.S., Collman,R.G., 2000. Co-receptor usage was more predictive than NSI/SI phenotype for HIV replication in macrophages: is NSI/SI phenotyping sufficient? J. Leukoc. Biol. 68, 324-330.

293

Le,B.T., Goh,T., Stewart,I.I., Salter,A.M., Bukhman,Y.V., Dharsee,M., Ewing,R., Wisniewski,J.R., 2006. Differential analysis of membrane proteins in mouse fore- and hindbrain using a label-free approach. J. Proteome. Res. 5, 2701-2710.

Lee,C., Liu,Q.H., Tomkowicz,B., Yi,Y., Freedman,B.D., Collman,R.G., 2003. Macrophage activation through CCR5- and CXCR4-mediated gp120-elicited signaling pathways. J. Leukoc. Biol. 74, 676-682.

Lee,C., Tomkowicz,B., Freedman,B.D., Collman,R.G., 2005. HIV-1 gp120-induced TNF-alpha production by primary human macrophages is mediated by phosphatidylinositol-3 (PI-3) kinase and mitogen-activated protein (MAP) kinase pathways. J. Leukoc. Biol. 78, 1016- 1023.

Lee,E.S., Kalantari,P., Tsutsui Section, Klatt,A., Holden,J., Correll,P.H., Power Section, Henderson,A.J., 2004. RON receptor tyrosine kinase, a negative regulator of inflammation, inhibits HIV-1 transcription in monocytes/macrophages and is decreased in brain tissue from patients with AIDS. J Immunol 173, 6864-6872.

Levy JA, 1998 HIV and the Pathogenesis of AIDS. American Society for Microbiology, Washington, D.C.

Levy,J.A., Mackewicz,C.E., Barker,E., 1996. Controlling HIV pathogenesis: the role of the noncytotoxic anti-HIV response of CD8+ T cells. Immunol. Today 17, 217-224.

Lewin,S.R., Kirihara,J., Sonza,S., Irving,L., Mills,J., Crowe,S.M., 1998. HIV-1 DNA and mRNA concentrations are similar in peripheral blood monocytes and alveolar macrophages in HIV-1-infected individuals. AIDS 12, 719-727.

Li,S., Juarez,J., Alali,M., Dwyer,D., Collman,R., Cunningham,A., Naif,H.M., 1999. Persistent CCR5 utilization and enhanced macrophage tropism by primary blood human immunodeficiency virus type 1 isolates from advanced stages of disease and comparison to tissue-derived isolates. J. Virol. 73, 9741-9755.

Lin,Y.L., Mettling,C., Portales,P., Reant,B., Clot,J., Corbeau,P., 2005. G-protein signaling triggered by R5 human immunodeficiency virus type 1 increases virus replication efficiency in primary T lymphocytes. J. Virol. 79, 7938-7941.

Lin,Y.L., Mettling,C., Portales,P., Reant,B., Robert-Hebmann,V., Reynes,J., Clot,J., Corbeau,P., 2006. The efficiency of R5 HIV-1 infection is determined by CD4 T-cell surface CCR5 density through G alpha i-protein signalling. AIDS 20, 1369-1377.

Liu,Q.H., Williams,D.A., McManus,C., Baribaud,F., Doms,R.W., Schols,D., de,C.E., Kotlikoff,M.I., Collman,R.G., Freedman,B.D., 2000. HIV-1 gp120 and chemokines activate ion channels in primary macrophages through CCR5 and CXCR4 stimulation. Proc. Natl. Acad. Sci. U. S. A 97, 4832-4837.

294

Liu,S., Bishop,W.R., Liu,M., 2003. Differential effects of cell cycle regulatory protein p21(WAF1/Cip1) on apoptosis and sensitivity to cancer chemotherapy. Drug Resist. Updat. 6, 183-195.

Macatonia,S.E., Gompels,M., Pinching,A.J., Patterson,S., Knight,S.C., 1992. Antigen- presentation by macrophages but not by dendritic cells in human immunodeficiency virus (HIV) infection. Immunology 75, 576-581.

Malmgaard,L., Melchjorsen,J., Bowie,A.G., Mogensen,S.C., Paludan,S.R., 2004. Viral activation of macrophages through TLR-dependent and -independent pathways. J Immunol 173, 6890- 6898.

Manna,S.K., Aggarwal,B.B., 2000. Differential requirement for p56lck in HIV-tat versus TNF- induced cellular responses: effects on NF-kappa B, activator protein-1, c-Jun N-terminal kinase, and apoptosis. J. Immunol. 164, 5156-5166.

Mantovani,A., Bottazzi,B., Colotta,F., Sozzani,S., Ruco,L., 1992. The origin and function of tumor-associated macrophages. Immunol. Today 13, 265-270.

Marechal,V., Prevost,M.C., Petit,C., Perret,E., Heard,J.M., Schwartz,O., 2001. Human immunodeficiency virus type 1 entry into macrophages mediated by macropinocytosis. J. Virol. 75, 11166-11177.

Margolis,L., Shattock,R., 2006. Selective transmission of CCR5-utilizing HIV-1: the 'gatekeeper' problem resolved? Nat. Rev. Microbiol. 4, 312-317.

Martin,A.M., Kulski,J.K., Witt,C., Pontarotti,P., Christiansen,F.T., 2002. Leukocyte Ig-like receptor complex (LRC) in mice and men. Trends Immunol. 23, 81-88.

Martin,F., Roth,D.M., Jans,D.A., Pouton,C.W., Partridge,L.J., Monk,P.N., Moseley,G.W., 2005. Tetraspanins in viral infections: a fundamental role in viral biology? J. Virol. 79, 10839- 10851.

Marzio,P.D., Sherry,B., Thomas,E.K., Franchin,G., Schmidtmayerova,H., Bukrinsky,M., 2003. beta-Chemokine production in CD40L-stimulated monocyte-derived macrophages requires activation of MAPK signaling pathways. Cytokine 23, 53-63.

Mayne,M., Holden,C.P., Nath,A., Geiger,J.D., 2000. Release of calcium from inositol 1,4,5- trisphosphate receptor-regulated stores by HIV-1 Tat regulates TNF-alpha production in human macrophages. J. Immunol. 164, 6538-6542.

McDonald,D., Vodicka,M.A., Lucero,G., Svitkina,T.M., Borisy,G.G., Emerman,M., Hope,T.J., 2002. Visualization of the intracellular behavior of HIV in living cells. J. Cell Biol. 159, 441- 452.

McGrath,M.S., Kodelja,V., 1999. Balanced macrophage activation hypothesis: a biological model for development of drugs targeted at macrophage functional states. Pathobiology 67, 277-281.

295

Melar,M., Ott,D.E., Hope,T.J., 2007. Physiological levels of virion-associated human immunodeficiency virus type 1 envelope induce coreceptor-dependent calcium flux. J. Virol. 81, 1773-1785.

Meuret,G., Hoffman,G., 1973. Monocyte kinetic studies in normal and disease states. British Journal of Haematology 24, 275-285.

Michie,C.A., McLean,A., Alcock,C., Beverley,P.C., 1992. Lifespan of human lymphocyte subsets defined by CD45 isoforms. Nature 360, 264-265.

Montmayeur,J.P., Valius,M., Vandenheede,J., Kazlauskas,A., 1997. The platelet-derived growth factor beta receptor triggers multiple cytoplasmic signaling cascades that arrive at the nucleus as distinguishable inputs. J. Biol. Chem. 272, 32670-32678.

Muthumani,K., Wadsworth,S.A., Dayes,N.S., Hwang,D.S., Choo,A.Y., Abeysinghe,H.R., Siekierka,J.J., Weiner,D.B., 2004. Suppression of HIV-1 viral replication and cellular pathogenesis by a novel p38/JNK kinase inhibitor. AIDS 18, 739-748.

Nermut,M.V., Fassati,A., 2003. Structural analyses of purified human immunodeficiency virus type 1 intracellular reverse transcription complexes. J. Virol. 77, 8196-8206.

Nermut,M.V., Hockley,D.J., Jowett,J.B., Jones,I.M., Garreau,M., Thomas,D., 1994. Fullerene- like organization of HIV gag-protein shell in virus-like particles produced by recombinant baculovirus. Virology 198, 288-296.

Nesvizhskii,A.I., Aebersold,R., 2004. Analysis, statistical validation and dissemination of large- scale proteomics datasets generated by tandem MS. Drug Discov. Today 9, 173-181.

Neumann,H.P., Pawlu,C., Peczkowska,M., Bausch,B., McWhinney,S.R., Muresan,M., Buchta,M., Franke,G., Klisch,J., Bley,T.A., Hoegerle,S., Boedeker,C.C., Opocher,G., Schipper,J., Januszewicz,A., Eng,C., 2004. Distinct clinical features of paraganglioma syndromes associated with SDHB and SDHD gene mutations. JAMA 292, 943-951.

Ng,V.L., McGrath,M.S., 1998. The immunology of AIDS-associated lymphomas. Immunol. Rev. 162, 293-298.

Nguyen,D.G., Hildreth,J.E., 2003. Involvement of macrophage mannose receptor in the binding and transmission of HIV by macrophages. Eur. J. Immunol. 33, 483-493.

Nguyen,D.H., Hildreth,J.E., 2000. Evidence for budding of human immunodeficiency virus type 1 selectively from glycolipid-enriched membrane lipid rafts. J. Virol. 74, 3264-3272.

Norbury,C., Blow,J., Nurse,P., 1991. Regulatory phosphorylation of the p34cdc2 protein kinase in vertebrates. EMBO J. 10, 3321-3329.

Nydegger,S., Foti,M., Derdowski,A., Spearman,P., Thali,M., 2003. HIV-1 egress is gated through late endosomal membranes. Traffic. 4, 902-910.

296

O'Brien,W.A., Namazi,A., Kalhor,H., Mao,S.H., Zack,J.A., Chen,I.S., 1994. Kinetics of human immunodeficiency virus type 1 reverse transcription in blood mononuclear phagocytes are slowed by limitations of nucleotide precursors. J. Virol. 68, 1258-1263.

Okamoto,M., Hattori,K., Oyasu,R., 1997. Interleukin-6 functions as an autocrine growth factor in human bladder carcinoma cell lines in vitro. Int. J. Cancer 72, 149-154.

Ott,D.E., 2002. Potential roles of cellular proteins in HIV-1. Rev. Med. Virol. 12, 359-374.

Pandori,M.W., Fitch,N.J., Craig,H.M., Richman,D.D., Spina,C.A., Guatelli,J.C., 1996. Producer- cell modification of human immunodeficiency virus type 1: Nef is a virion protein. J. Virol. 70, 4283-4290.

Parada,N.A., Cruikshank,W.W., Danis,H.L., Ryan,T.C., Center,D.M., 1996. IL-16- and other CD4 ligand-induced migration is dependent upon protein kinase C. Cell Immunol. 168, 100- 106.

Pawlu,C., Bausch,B., Neumann,H.P., 2005. Mutations of the SDHB and SDHD genes. Fam. Cancer 4, 49-54.

Pelchen-Matthews,A., Kramer,B., Marsh,M., 2003. Infectious HIV-1 assembles in late endosomes in primary macrophages. J. Cell Biol. 162, 443-455.

Pelicano,H., Martin,D.S., Xu,R.H., Huang,P., 2006. Glycolysis inhibition for anticancer treatment. Oncogene 25, 4633-4646.

Peng,T., Kotla,S., Bumgarner,R.E., Gustin,K.E., 2006. Human rhinovirus attenuates the type I interferon response by disrupting activation of interferon regulatory factor 3. J. Virol. 80, 5021-5031.

Perez-Bercoff,D., David,A., Sudry,H., Barre-Sinoussi,F., Pancino,G., 2003. Fcgamma receptor- mediated suppression of human immunodeficiency virus type 1 replication in primary human macrophages. J. Virol. 77, 4081-4094.

Piedimonte,G., Corsi,D., Paiardini,M., Cannavo,G., Ientile,R., Picerno,I., Montroni,M., Silvestri,G., Magnani,M., 1999. Unscheduled cyclin B expression and p34 cdc2 activation in T lymphocytes from HIV-infected patients. AIDS 13, 1159-1164.

Poggioli,G.J., DeBiasi,R.L., Bickel,R., Jotte,R., Spalding,A., Johnson,G.L., Tyler,K.L., 2002. Reovirus-induced alterations in gene expression related to cell cycle regulation. J. Virol. 76, 2585-2594.

Poles,M.A., Elliott,J., Taing,P., Anton,P.A., Chen,I.S., 2001. A preponderance of CCR5(+) CXCR4(+) mononuclear cells enhances gastrointestinal mucosal susceptibility to human immunodeficiency virus type 1 infection. J. Virol. 75, 8390-8399.

Poli,G., Fauci,A.S., 1992. The role of monocyte/macrophages and cytokines in the pathogenesis of HIV infection. Pathobiology 60, 246-251.

297

Popik,W., Pitha,P.M., 1998. Early activation of mitogen-activated protein kinase kinase, extracellular signal-regulated kinase, p38 mitogen-activated protein kinase, and c-Jun N- terminal kinase in response to binding of simian immunodeficiency virus to Jurkat T cells expressing CCR5 receptor. Virology 252, 210-217.

Popik,W., Pitha,P.M., 2000a. Exploitation of cellular signaling by HIV-1: unwelcome guests with master keys that signal their entry. Virology 276, 1-6.

Popik,W., Pitha,P.M., 2000b. Inhibition of CD3/CD28-mediated activation of the MEK/ERK signaling pathway represses replication of X4 but not R5 human immunodeficiency virus type 1 in peripheral blood CD4(+) T lymphocytes. J. Virol. 74, 2558-2566.

Pumiglia,K.M., Decker,S.J., 1997. Cell cycle arrest mediated by the MEK/mitogen-activated protein kinase pathway. Proc. Natl. Acad. Sci. U. S. A 94, 448-452.

Qiu,M.R., Campbell,T.J., Breit,S.N., 2002. A potassium ion channel is involved in cytokine production by activated human macrophages. Clin Exp Immunol 130, 67-74.

Ramanathan,A., Wang,C., Schreiber,S.L., 2005. Perturbational profiling of a cell-line model of tumorigenesis by using metabolic measurements. Proc. Natl. Acad. Sci. U. S. A 102, 5992- 5997.

Rana,S., Besson,G., Cook,D.G., Rucker,J., Smyth,R.J., Yi,Y., Turner,J.D., Guo,H.H., Du,J.G., Peiper,S.C., Lavi,E., Samson,M., Libert,F., Liesnard,C., Vassart,G., Doms,R.W., Parmentier,M., Collman,R.G., 1997. Role of CCR5 in infection of primary macrophages and lymphocytes by macrophage-tropic strains of human immunodeficiency virus: resistance to patient-derived and prototype isolates resulting from the delta ccr5 mutation. J. Virol. 71, 3219-3227.

Raposo,G., Moore,M., Innes,D., Leijendekker,R., Leigh-Brown,A., Benaroch,P., Geuze,H., 2002. Human macrophages accumulate HIV-1 particles in MHC II compartments. Traffic. 3, 718-729.

Reardon,C.C., Kim,S.J., Wagner,R.P., Koziel,H., Kornfeld,H., 1996. Phagocytosis and growth inhibition of Cryptococcus neoformans by human alveolar macrophages: effects of HIV-1 infection. AIDS 10, 613-618.

Rempel,A., Mathupala,S.P., Griffin,C.A., Hawkins,A.L., Pedersen,P.L., 1996. Glucose catabolism in cancer cells: amplification of the gene encoding type II hexokinase. Cancer Res. 56, 2468-2471.

Rohdewohld,H., Weiher,H., Reik,W., Jaenisch,R., Breindl,M., 1987. Retrovirus integration and chromatin structure: Moloney murine leukemia proviral integration sites map near DNase I- hypersensitive sites. J. Virol. 61, 336-343.

Rohr,O., Marban,C., Aunis,D., Schaeffer,E., 2003. Regulation of HIV-1 gene transcription: from lymphocytes to microglial cells. J. Leukoc. Biol. 74, 736-749.

298

Rosenberg,N., Jolicoeur,P., 1997 Retroviral Pathogenesis. In: Coffin,J., Hughes,S., Varmus,H. (Eds.), Retroviruses. Cold Spring Harbor Laboratory Press, Plainview, New York, pp. 475- 585.

Roshal,M., Kim,B., Zhu,Y., Nghiem,P., Planelles,V., 2003. Activation of the ATR-mediated DNA damage response by the HIV-1 viral protein R. J. Biol. Chem. 278, 25879-25886.

Rous,P., 1911. A sarcoma of the fowl transmissible by an agent separable from the tumor cells. Journal of Experimental Medicine 13, 397-411.

Rudd,C.E., Trevillyan,J.M., Dasgupta,J.D., Wong,L.L., Schlossman,S.F., 1988. The CD4 receptor is complexed in detergent lysates to a protein-tyrosine kinase (pp58) from human T lymphocytes. Proc. Natl. Acad. Sci. U. S. A 85, 5190-5194.

Ryo,A., Suzuki,Y., Ichiyama,K., Wakatsuki,T., Kondoh,N., Hada,A., Yamamoto,M., Yamamoto,N., 1999b. Serial analysis of gene expression in HIV-1-infected T cell lines. FEBS Lett. 462, 182-186.

Ryo,A., Suzuki,Y., Ichiyama,K., Wakatsuki,T., Kondoh,N., Hada,A., Yamamoto,M., Yamamoto,N., 1999a. Serial analysis of gene expression in HIV-1-infected T cell lines. FEBS Lett. 462, 182-186.

Scarlatti,G., Tresoldi,E., Bjorndal,A., Fredriksson,R., Colognesi,C., Deng,H.K., Malnati,M.S., Plebani,A., Siccardi,A.G., Littman,D.R., Fenyo,E.M., Lusso,P., 1997. In vivo evolution of HIV-1 co-receptor usage and sensitivity to chemokine-mediated suppression. Nat. Med. 3, 1259-1265.

Schacker,T., Little,S., Connick,E., Gebhard,K., Zhang,Z.Q., Krieger,J., Pryor,J., Havlir,D., Wong,J.K., Schooley,R.T., Richman,D., Corey,L., Haase,A.T., 2001. Productive infection of T cells in lymphoid tissues during primary and early human immunodeficiency virus infection. J Infect Dis 183, 555-562.

Scheuring,U.J., Corbeil,J., Mosier,D.E., Theofilopoulos,A.N., 1998. Early modification of host cell gene expression induced by HIV-1. AIDS 12, 563-570.

Schuitemaker,H., Kootstra,N.A., Fouchier,R.A., Hooibrink,B., Miedema,F., 1994a. Productive HIV-1 infection of macrophages restricted to the cell fraction with proliferative capacity. EMBO J 13, 5929-5936.

Schuitemaker,H., Kootstra,N.A., Fouchier,R.A., Hooibrink,B., Miedema,F., 1994b. Productive HIV-1 infection of macrophages restricted to the cell fraction with proliferative capacity. EMBO J. 13, 5929-5936.

Schuitemaker,H., Kootstra,N.A., van Oers,M.H., van,L.R., Tersmette,M., Miedema,F., 1990. Induction of monocyte proliferation and HIV expression by IL-3 does not interfere with antiviral activity of zidovudine. Blood 76, 1490-1493.

299

Schwartz,O., Marechal,V., Danos,O., Heard,J.M., 1995. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J. Virol. 69, 4053- 4059.

Selak,M.A., Armour,S.M., MacKenzie,E.D., Boulahbel,H., Watson,D.G., Mansfield,K.D., Pan,Y., Simon,M.C., Thompson,C.B., Gottlieb,E., 2005. Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase. Cancer Cell 7, 77-85.

Selliah,N., Finkel,T.H., 2001. HIV-1 NL4-3, but not IIIB, inhibits JAK3/STAT5 activation in CD4(+) T cells. Virology 286, 412-421.

Serkova,N., Boros,L.G., 2005. Detection of resistance to imatinib by metabolic profiling: clinical and drug development implications. Am. J. Pharmacogenomics. 5, 293-302.

Shapiro,L., Heidenreich,K.A., Meintzer,M.K., Dinarello,C.A., 1998. Role of p38 mitogen- activated protein kinase in HIV type 1 production in vitro. Proc. Natl. Acad. Sci. U. S. A 95, 7422-7426.

Sheehy,A.M., Gaddis,N.C., Choi,J.D., Malim,M.H., 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418, 646-650.

Sheeter,D., Du,P., Rought,S., Richman,D., Corbeil,J., 2003. Surface CD4 expression modulated by a cellular factor induced by HIV type 1 infection. AIDS Res. Hum. Retroviruses 19, 117- 123.

Sherman,M.P., de Noronha,C.M., Williams,S.A., Greene,W.C., 2002. Insights into the biology of HIV-1 viral protein R. DNA Cell Biol. 21, 679-688.

Shi,L., Adkins,J.N., Coleman,J.R., Schepmoes,A.A., Dohnkova,A., Mottaz,H.M., Norbeck,A.D., Purvine,S.O., Manes,N.P., Smallwood,H.S., Wang,H., Forbes,J., Gros,P., Uzzau,S., Rodland,K.D., Heffron,F., Smith,R.D., Squier,T.C., 2006. Proteomic analysis of Salmonella enterica serovar typhimurium isolated from RAW 264.7 macrophages: identification of a novel protein that contributes to the replication of serovar typhimurium inside macrophages. J. Biol. Chem. 281, 29131-29140.

Shiramizu,B., Herndier,B.G., McGrath,M.S., 1994. Identification of a common clonal human immunodeficiency virus integration site in human immunodeficiency virus-associated lymphomas. Cancer Res. 54, 2069-2072.

Shrikant,P., Benos,D.J., Tang,L.P., Benveniste,E.N., 1996. HIV glycoprotein 120 enhances intercellular adhesion molecule-1 gene expression in glial cells. Involvement of Janus kinase/signal transducer and activator of transcription and protein kinase C signaling pathways. J. Immunol. 156, 1307-1314.

Singh,K.K., 2004. Mitochondrial dysfunction is a common phenotype in aging and cancer. Ann. N. Y. Acad. Sci. 1019, 260-264.

300

Singh,S.P., Tungaturthi,P., Cartas,M., Tomkowicz,B., Rizvi,T.A., Khan,S.A., Kalyanaraman,V.S., Srinivasan,A., 2001. Virion-associated HIV-1 Vpr: variable amount in virus particles derived from cells upon virus infection or proviral DNA transfection. Virology 283, 78-83.

Sleasman,J.W., Aleixo,L.F., Morton,A., Skoda-Smith,S., Goodenow,M.M., 1996. CD4+ memory T cells are the predominant population of HIV-1-infected lymphocytes in neonates and children. AIDS 10, 1477-1484.

Sleasman,J.W., Leon,B.H., Aleixo,L.F., Rojas,M., Goodenow,M.M., 1997. Immunomagnetic selection of purified monocyte and lymphocyte populations from peripheral blood mononuclear cells following cryopreservation. Clin. Diagn. Lab Immunol. 4, 653-658.

Sleasman,J.W., Nelson,R.P., Goodenow,M.M., Wilfret,D., Hutson,A., Baseler,M., Zuckerman,J., Pizzo,P.A., Mueller,B.U., 1999. Immunoreconstitution after ritonavir therapy in children with human immunodeficiency virus infection involves multiple lymphocyte lineages. J. Pediatr. 134, 597-606.

Sorin,M., Kalpana,G.V., 2006. Dynamics of virus-host interplay in HIV-1 replication. Curr. HIV. Res. 4, 117-130.

Stafford,J.L., Neumann,N.F., Belosevic,M., 2002. Macrophage-mediated innate host defense against protozoan parasites. Crit Rev Microbiol. 28, 187-248.

Stantchev,T.S., Broder,C.C., 2001. Human immunodeficiency virus type-1 and chemokines: beyond competition for common cellular receptors. Cytokine Growth Factor Rev. 12, 219- 243.

Stantchev,T.S., Markovic,I., Telford,W.G., Clouse,K.A., Broder,C.C., 2007. The tyrosine kinase inhibitor genistein blocks HIV-1 infection in primary human macrophages. Virus Res. 123, 178-189.

Stetson,D.B., Medzhitov,R., 2006a. Antiviral defense: interferons and beyond. J. Exp. Med. 203, 1837-1841.

Stetson,D.B., Medzhitov,R., 2006b. Type I interferons in host defense. Immunity. 25, 373-381.

Stowell D. 3D HIV. SourceForge . 2007. Ref Type: Internet Communication

Subbramanian,R.A., Kessous-Elbaz,A., Lodge,R., Forget,J., Yao,X.J., Bergeron,D., Cohen,E.A., 1998. Human immunodeficiency virus type 1 Vpr is a positive regulator of viral transcription and infectivity in primary human macrophages. J. Exp. Med. 187, 1103-1111.

Sudakin,V., Chan,G.K., Yen,T.J., 2001. Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J. Cell Biol. 154, 925-936.

301

Swingler,S., Easton,A., Morris,A., 1992. Cytokine augmentation of HIV-1 LTR-driven gene expression in neural cells. AIDS Res. Hum. Retroviruses 8, 487-493.

Swingler,S., Morris,A., Easton,A., 1994. Tumour necrosis factor alpha and interleukin-1 beta induce specific subunits of NFKB to bind the HIV-1 enhancer: characterisation of transcription factors controlling human immunodeficiency virus type 1 gene expression in neural cells. Biochem. Biophys. Res. Commun. 203, 623-630.

Takasaki,T., Kurane,I., Aihara,H., Ohkawa,N., Yamaguchi,J., 1997. Electron microscopic study of human immunodeficiency virus type 1 (HIV-1) core structure: two RNA strands in the core of mature and budding particles. Arch. Virol. 142, 375-382.

Takikawa,O., 2005. Biochemical and medical aspects of the indoleamine 2,3-dioxygenase- initiated L-tryptophan metabolism. Biochem. Biophys. Res. Commun. 338, 12-19.

Tamaskovic,R., Bichsel,S.J., Hemmings,B.A., 2003. NDR family of AGC kinases--essential regulators of the cell cycle and morphogenesis. FEBS Lett. 546, 73-80.

Taylor,R.W., Turnbull,D.M., 2005. Mitochondrial DNA mutations in human disease. Nat. Rev. Genet. 6, 389-402.

Taylor,W.R., Stark,G.R., 2001. Regulation of the G2/M transition by p53. Oncogene 20, 1803- 1815.

Todorov,I.T., Pepperkok,R., Philipova,R.N., Kearsey,S.E., Ansorge,W., Werner,D., 1994. A human nuclear protein with sequence homology to a family of early S phase proteins is required for entry into S phase and for cell division. J. Cell Sci. 107 ( Pt 1), 253-265.

Towers,G.J., Goff,S.P., 2003. Post-entry restriction of retroviral infections. AIDS Rev. 5, 156- 164.

Tremblay,M.J., Fortin,J.F., Cantin,R., 1998. The acquisition of host-encoded proteins by nascent HIV-1. Immunol. Today 19, 346-351.

Trubey,C.M., Chertova,E., Coren,L.V., Hilburn,J.M., Hixson,C.V., Nagashima,K., Lifson,J.D., Ott,D.E., 2003. Quantitation of HLA class II protein incorporated into human immunodeficiency type 1 virions purified by anti-CD45 immunoaffinity depletion of microvesicles. J. Virol. 77, 12699-12709.

Tsuchiya,S., Yamabe,M., Yamaguchi,Y., Kobayashi,Y., Konno,T., Tada,K., 1980. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int. J. Cancer 26, 171-176.

Turner,B.G., Summers,M.F., 1999. Structural biology of HIV. J. Mol. Biol. 285, 1-32.

Tuttle,D.L., Anders,C.B., quino-De Jesus,M.J., Poole,P.P., Lamers,S.L., Briggs,D.R., Pomeroy,S.M., Alexander,L., Peden,K.W., Andiman,W.A., Sleasman,J.W., Goodenow,M.M., 2002. Increased replication of non-syncytium-inducing HIV type 1 isolates

302

in monocyte-derived macrophages is linked to advanced disease in infected children. AIDS Res. Hum. Retroviruses 18, 353-362.

Tuttle,D.L., Coberley,C.R., Xie,X., Kou,Z.C., Sleasman,J.W., Goodenow,M.M., 2004. Effects of human immunodeficiency virus type 1 infection on CCR5 and CXCR4 coreceptor expression on CD4 T lymphocyte subsets in infants and adolescents. AIDS Res. Hum. Retroviruses 20, 305-313.

Tuttle,D.L., Harrison,J.K., Anders,C., Sleasman,J.W., Goodenow,M.M., 1998. Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1. J. Virol. 72, 4962-4969.

Vahey,M.T., Nau,M.E., Jagodzinski,L.L., Yalley-Ogunro,J., Taubman,M., Michael,N.L., Lewis,M.G., 2002. Impact of viral infection on the gene expression profiles of proliferating normal human peripheral blood mononuclear cells infected with HIV type 1 RF. AIDS Res. Hum. Retroviruses 18, 179-192.

Vairapandi,M., Balliet,A.G., Hoffman,B., Liebermann,D.A., 2002. GADD45b and GADD45g are cdc2/cyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J. Cell Physiol 192, 327-338. van Boxel-Dezaire,A.H., Rani,M.R., Stark,G.R., 2006. Complex modulation of cell type-specific signaling in response to type I interferons. Immunity. 25, 361-372. van Ravenswaay Claasen,H.H., Kluin,P.M., Fleuren,G.J., 1992. Tumor infiltrating cells in human cancer. On the possible role of CD16+ macrophages in antitumor cytotoxicity. Lab Invest 67, 166-174. van't Wout,A.B., Kootstra,N.A., Mulder-Kampinga,G.A., brecht-van,L.N., Scherpbier,H.J., Veenstra,J., Boer,K., Coutinho,R.A., Miedema,F., Schuitemaker,H., 1994. Macrophage- tropic variants initiate human immunodeficiency virus type 1 infection after sexual, parenteral, and vertical transmission. J. Clin. Invest 94, 2060-2067.

Van,D.C., Jenkins,A., Ledwich,L., Ryan,T.C., Mashikian,M.V., Brazer,W., Center,D.M., Cruikshank,W.W., 2000. Desensitization of CXC chemokine receptor 4, mediated by IL- 16/CD4, is independent of p56lck enzymatic activity. J. Immunol. 165, 6356-6363. van,F.R., Sluiter,W., 1986. Distribution of blood monocytes between a marginating and a circulating pool. J. Exp. Med. 163, 474-479.

Vazquez,N., Greenwell-Wild,T., Marinos,N.J., Swaim,W.D., Nares,S., Ott,D.E., Schubert,U., Henklein,P., Orenstein,J.M., Sporn,M.B., Wahl,S.M., 2005. Human immunodeficiency virus type 1-induced macrophage gene expression includes the p21 gene, a target for viral regulation. J. Virol. 79, 4479-4491.

Veillette,A., Bookman,M.A., Horak,E.M., Bolen,J.B., 1988. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyrosine-protein kinase p56lck. Cell 55, 301-308.

303

Verani,A., Gras,G., Pancino,G., 2005. Macrophages and HIV-1: dangerous liaisons. Mol. Immunol. 42, 195-212.

Verani,A., Scarlatti,G., Comar,M., Tresoldi,E., Polo,S., Giacca,M., Lusso,P., Siccardi,A.G., Vercelli,D., 1997. C-C chemokines released by lipopolysaccharide (LPS)-stimulated human macrophages suppress HIV-1 infection in both macrophages and T cells. J. Exp. Med. 185, 805-816.

Verani,A., Sironi,F., Siccardi,A.G., Lusso,P., Vercelli,D., 2002. Inhibition of CXCR4-tropic HIV-1 infection by lipopolysaccharide: evidence of different mechanisms in macrophages and T lymphocytes. J. Immunol. 168, 6388-6395.

von Lindern,J.J., Rojo,D., Grovit-Ferbas,K., Yeramian,C., Deng,C., Herbein,G., Ferguson,M.R., Pappas,T.C., Decker,J.M., Singh,A., Collman,R.G., O'Brien,W.A., 2003. Potential role for CD63 in CCR5-mediated human immunodeficiency virus type 1 infection of macrophages. J. Virol. 77, 3624-3633.

Wahl,S.M., Greenwell-Wild,T., Peng,G., Ma,G., Orenstein,J.M., Vazquez,N., 2003. Viral and host cofactors facilitate HIV-1 replication in macrophages. J. Leukoc. Biol. 74, 726-735.

Wainberg,Z., Oliveira,M., Lerner,S., Tao,Y., Brenner,B.G., 1997. Modulation of stress protein (hsp27 and hsp70) expression in CD4+ lymphocytic cells following acute infection with human immunodeficiency virus type-1. Virology 233, 364-373.

Wang,X., Lewis,D.E., 2001. CD86 expression correlates with amounts of HIV produced by macrophages in vitro. J. Leukoc. Biol. 69, 405-413.

Wang,Z., Morris,G.F., Reed,J.C., Kelly,G.D., Morris,C.B., 1999. Activation of Bcl-2 promoter- directed gene expression by the human immunodeficiency virus type-1 Tat protein. Virology 257, 502-510.

Wende,H., Colonna,M., Ziegler,A., Volz,A., 1999. Organization of the leukocyte receptor cluster (LRC) on human chromosome 19q13.4. Mamm. Genome 10, 154-160.

Williams,K.C., Corey,S., Westmoreland,S.V., Pauley,D., Knight,H., deBakker,C., Alvarez,X., Lackner,A.A., 2001. Perivascular macrophages are the primary cell type productively infected by simian immunodeficiency virus in the brains of macaques: implications for the neuropathogenesis of AIDS. J. Exp. Med. 193, 905-915.

World Health Organization. Conference on Retroviruses and Opportunistic Infections: Briefing Not - HIV Drug Resistance. 2007. 2-25-2007.

Xaus,J., Comalada,M., Valledor,A.F., Cardo,M., Herrero,C., Soler,C., Lloberas,J., Celada,A., 2001. Molecular mechanisms involved in macrophage survival, proliferation, activation or apoptosis. Immunobiology 204, 543-550.

Yang,P., Henderson,A.J., 2005. Nef enhances c-Cbl phosphorylation in HIV-infected CD4+ T lymphocytes. Virology 336, 219-228.

304

Yang,Z., Engel,J.D., 1993. Human T cell transcription factor GATA-3 stimulates HIV-1 expression. Nucleic Acids Res. 21, 2831-2836.

Yarden,R.I., Pardo-Reoyo,S., Sgagias,M., Cowan,K.H., Brody,L.C., 2002. BRCA1 regulates the G2/M checkpoint by activating Chk1 kinase upon DNA damage. Nat. Genet. 30, 285-289.

Yi,Y., Rana,S., Turner,J.D., Gaddis,N., Collman,R.G., 1998. CXCR-4 is expressed by primary macrophages and supports CCR5-independent infection by dual-tropic but not T-tropic isolates of human immunodeficiency virus type 1. J Virol 72, 772-777.

You,J.C., McHenry,C.S., 1993. HIV nucleocapsid protein. Expression in Escherichia coli, purification, and characterization. J. Biol. Chem. 268, 16519-16527.

Zack,J.A., 1995. The role of the cell cycle in HIV-1 infection. Adv. Exp Med Biol 374, 27-31.

Zhang,L., Ramratnam,B., Tenner-Racz,K., He,Y., Vesanen,M., Lewin,S., Talal,A., Racz,P., Perelson,A.S., Korber,B.T., Markowitz,M., Ho,D.D., 1999. Quantifying residual HIV-1 replication in patients receiving combination antiretroviral therapy. N. Engl. J. Med. 340, 1605-1613.

Zhang,L., Yu,W., He,T., Yu,J., Caffrey,R.E., Dalmasso,E.A., Fu,S., Pham,T., Mei,J., Ho,J.J., Zhang,W., Lopez,P., Ho,D.D., 2002. Contribution of human alpha-defensin 1, 2, and 3 to the anti-HIV-1 activity of CD8 antiviral factor. Science 298, 995-1000.

Zhu,P., Chertova,E., Bess,J., Jr., Lifson,J.D., Arthur,L.O., Liu,J., Taylor,K.A., Roux,K.H., 2003. Electron tomography analysis of envelope glycoprotein trimers on HIV and simian immunodeficiency virus virions. Proc. Natl. Acad. Sci. U. S. A 100, 15812-15817.

Zhu,P., Liu,J., Bess,J., Jr., Chertova,E., Lifson,J.D., Grise,H., Ofek,G.A., Taylor,K.A., Roux,K.H., 2006. Distribution and three-dimensional structure of AIDS virus envelope spikes. Nature 441, 847-852.

Zhu,T., Mo,H., Wang,N., Nam,D.S., Cao,Y., Koup,R.A., Ho,D.D., 1993. Genotypic and phenotypic characterization of HIV-1 patients with primary infection. Science 261, 1179- 1181.

Zuk,J.A., Walker,R.A., 1987. Immunohistochemical analysis of HLA antigens and mononuclear infiltrates of benign and malignant breast. J. Pathol. 152, 275-285.

305

BIOGRAPHICAL SKETCH

Joseph Nichols Brown was born on May 14, 1976, in New Port News, VA to George and

Darnell Brown. He was raised in Niceville, FL were he finished high school. In May 2000,

Joseph graduated from the University of West Florida in Pensacola with a Bachelor of Science degree in molecular biology. With an interest in computer programming, he began completing prerequisite computer science courses required to enter the graduate school. In 2001, Joseph

suspended the computer science path to pursue his biological research interests as a Ph.D.

student at the University of Florida College of Medicine. Hoping to intertwine both computer

science and molecular biology, Joseph entered the laboratory of Maureen M. Goodenow. During

his graduate studies, he was supported by an NIH T32 cancer training grant.

306