DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» MMP20
MMP20
Epithelial-Specific Knockout of the Rac1 Gene Leads to Enamel Defects
Effect of Nanoparticles on the Expression and Activity of Matrix Metalloproteinases
(MMP-12) Correlates with Radiation-Induced Lung Fibrosis
Lipofection of Single Guide RNA Targeting MMP8 Decreases Proliferation and Migration in Lung Adenocarcinoma Cells
Matrix Metalloproteinase-12 Expression Correlates with Local Recurrence and Metastatic Disease in Non–Small Cell Lung Cancer Patients
Biochemical Characterization and Zinc Binding Group (Zbgs) Inhibition Studies on the Catalytic Domains of Mmp7 (Cdmmp7) and Mmp16 (Cdmmp16)
A Genomic Analysis of Rat Proteases and Protease Inhibitors
Association of Genetic Variants in Enamel-Formation Genes with Dental
Metalloproteinases in Biology and Pathology of the Nervous System
Comparative Gene Expression Profiling of Adams, Mmps, Timps, EMMPRIN, EGF-R and VEGFA in Low Grade Meningioma
Matrix Metalloproteases in Pancreatic Ductal Adenocarcinoma: Key Drivers of Disease Progression?
Matrix Metalloproteinases Gene Variants and Dental Caries in Czech
Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Protein
Catalytic Domain of MMP20 (Enamelysin) – the NMR Structure of a New Matrix Metalloproteinase
Roles of 5HT1A Receptor in CNS Neurogenesis and ADAM21 in Spinal Cord Injury
Matrix Metalloproteinase 1 (MMP1) Is Associated with Early-Onset Lung Cancer
Genetic Association of MMP10, MMP14, and MMP16 with Dental Caries
The Role of Matrix Metalloproteinases in Osteoarthritis Pathogenesis An
Top View
(12) United States Patent (10) Patent No.: US 8,993,295 B2 Seed Et Al
In Situ Gene Expression and Localization of Metalloproteinases MMP1, MMP2, MMP3, MMP9, and Their Inhibitors TIMP1 and TIMP2 in Human Renal Cell Carcinoma
Metalloproteinases in Biology and Pathology of the Nervous System
MMP20) in Human Tumors
Supplementary Methods: Primers Sequences Used in Real-Time PCR Analyses: Β-Actin F: GACCTCTATGCCAACACAGT Β-Actin [11] R: AGTAC
Association Between Matrix Metalloproteinases Polymorphisms and Ovarian Cancer Risk: a Meta-Analysis and Systematic Review
DSPP-MMP20 Gene Silencing Downregulates Cancer Stem Cell Markers in Human Oral Cancer Cells Nikolaos G
Screening of Novel Matrix Metalloproteinases (Mmps) in Human Fetal Membranes
Protease Expression Levels in Prostate Cancer Tissue Can Explain Prostate Cancer-Associated Seminal Biomarkers—An Explorative Concept Study
The Evolution of the Vertebrate Metzincins; Insights from Ciona Intestinalis and Danio Rerio
Whole-Genome Sequencing Is More Powerful Than Whole-Exome Sequencing for Detecting Exome Variants
(12) Patent Application Publication (10) Pub. No.: US 2011/0030072 A1 Weinstein Et Al
Enamel Proteins and Proteases in Mmp20 and Klk4 Null and Double-Null Mice
Supplementary Table 4. Copy Number Changes and Regions of LOH in 10
Original Article
Pleiotropic Functions of the Tumor- and Metastasis-Suppressing Matrix
MMP20 Gene Matrix Metallopeptidase 20
Computational Analysis of the Metal Selectivity of Matrix Metalloproteinase 8