DOCSLIB.ORG

Comparative Gene Expression Profiling of Adams, Mmps, Timps, EMMPRIN, EGF-R and VEGFA in Low Grade Meningioma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comparative Gene Expression Profiling of Adams, Mmps, Timps, EMMPRIN, EGF-R and VEGFA in Low Grade Meningioma INTERNATIONAL JOURNAL OF ONCOLOGY 49: 2309-2318, 2016 Comparative gene expression profiling of ADAMs, MMPs, TIMPs, EMMPRIN, EGF-R and VEGFA in low grade meningioma HARCHARAN K. ROOPRAI1, ANDREW J. MARTIN2, ANDREW KING3, USHA D. APPADU4, HUW JONES4, RICHARD P. SELWAY1, RICHARD W. GULLAN1 and GEOFFREY J. PILKINGTON5 1Department of Neurosurgery, King's College Hospital, London SE5 9RS; 2Department of Neurosurgery, St. George's Hospital, London SW17 0QT; 3Department of Clinical Neuropathology, King's College Hospital, London SE5 9RS; 4School of Science and Technology, Middlesex University, London NW4 4BT; 5School of Pharmacy and Biomedical Sciences, University of Portsmouth, Portsmouth PO1 2DT, UK Received April 17, 2016; Accepted June 6, 2016 DOI: 10.3892/ijo.2016.3739 Abstract. MMPs (matrix metalloproteinases), ADAMs (a Introduction disintegrin and metalloproteinase) and TIMPs (tissue inhibi- tors of metalloproteinases) are implicated in invasion and Meningiomas are tumours of neoplastic arachnoid cap cells angiogenesis: both are tissue remodeling processes involving which can arise from the dura at any site. This is, however, regulated proteolysis of the extracellular matrix, growth factors most commonly the skull vault, from the skull base and at sites and their receptors. The expression of these three groups and of dural reflections, whereas those which arise from the spine their correlations with clinical behaviour has been reported in account for only 10% of meningiomas. In addition, they are gliomas but a similar comprehensive study in meningiomas the most frequently encountered benign, non-glial, neoplasms is lacking. In this study, we aimed to evaluate the patterns of within the skull, accounting for nearly a quarter of all primary expression of 23 MMPs, 4 TIMPs, 8 ADAMs, selective growth intracranial tumours (1) and have an estimated annual inci- factors and their receptors in 17 benign meningiomas using dence of 2-7 per 100,000 women and 1-5 per 100,000 men (2). a quantitative real-time polymerase chain reaction (qPCR). Meningiomas are typically benign tumours but have a broad Results indicated very high gene expression of 13 proteases, spectrum of clinical characteristics and histologically distinct inhibitors and growth factors studied: MMP2 and MMP14, subsets which are associated with high risk of recurrence, TIMP-1, -2 and -3, ADAM9, 10, 12, 15 and 17, EGF-R, even after complete resection. According to the WHO clas- EMMPRIN and VEGF-A, in almost every meningioma. sification, benign meningiomas (Grade I) have a low risk of Expression pattern analysis showed several positive correla- recurrence and aggressive growth with 22 subtypes, including tions between MMPs, ADAMs, TIMPs and growth factors. meningothelial, fibroblastic, transitional and psammomatous Furthermore, our findings suggest that expression of MMP14, meningiomas. Atypical meningiomas (Grade II) are more ADAM9, 10, 12, 15 and 17, TIMP-2, EGF-R and EMMPRIN likely to recur whereas anaplastic meningiomas (Grade III) reflects histological subtype of meningioma such that fibro- have the greatest likelihood of recurrence and/or have more blastic subtype had the highest mRNA expression, transitional aggressive behaviour (3). subtype was intermediate and meningothelial type had the Although histologically benign meningiomas differ in their lowest expression. In conclusion, this is the first comprehen- patterns of invasion from atypical meningiomas, they can still sive study characterizing gene expression of 8 ADAMs in invade the dura, dural sinuses, skull and extracranial compart- meningiomas. These neoplasms, although by histological ments because of their ability to extend into mesenchymal definition benign, have invasive potential. Taken together, the tissues. They are not, however, considered to be atypical or selected elevated gene expression pattern may serve to identify malignant. In contrast, brain invasion is associated with recur- targets for therapeutic intervention or indicators of biological rence and mortality rates similar to atypical meningiomas, even progression and recurrence. if the neoplasm appears to be otherwise completely benign (4). A critical step of tumour progression and recurrence is the infiltrative invasion into the contiguous tissue. Metallo­ proteinases (MMPs) are a family of 23 structurally related, zinc-dependent endopeptidases in man. For many years, some Correspondence to: Dr Harcharan Kaur (Bali) Rooprai, Depart- ment of Neurosurgery, King's College Hospital NHS Foundation of the MMPs have been widely implicated as mediators of Trust, Denmark Hill, London SE5 9RS, UK invasion and angiogenesis with a role in degradation of the E-mail: [email protected] extracellular matrix (ECM). It is now evident that the func- tions of MMPs are much more complex than was initially Key words: ADAMs, growth factors, matrix metalloproteases, gene thought since they also have other roles such as regulation of expression, meningiomas cell adhesion (5), and control of apoptosis via release of death or survival factors. MMPs are also known to regulate the 2310 ROOPRAI et al: GENE EXPRESSION OF ADAMS, TIMPS AND GROWTH FACTORS IN MENINGIOMAS bioavailability and/or activity of growth factors by mediating Ethical permission (LREC No 00-173), from the Department receptor turnover or by cleaving matrix proteins associated of Neurosurgery, King's College Hospital, London in 2000 and with growth factors. EMMPRIN (extracellular matrix metal- 2001. The tumour was diagnosed, according to the World Health loproteinase inducer), which is also known as CD147, basigin Organisation criteria by a neuropathologist. Cells were cultured or M6, is thought to induce tumour invasion by activating as monolayers in small plastic culture flasks (Marathon) at production of various MMPs. The ability of MMP-9 to trigger 37˚C, 5% CO2 in a standard humidified incubator. Cells were the release of vascular endothelial growth factor (VEGF) routinely maintained in Dulbecco's modified Eagle's medium which regulates angiogenesis and vascular permeability is (DMEM) supplemented with antibiotics/antimycotic at the also well documented (6). Additionally, the epidermal growth final concentration of 100 IU penicillin, 100 µg amphotericin factor receptor (EGFR) family of membrane-bound receptor per ml and 10% fetal calf serum (FCS; Sigma-Aldrich). tyrosine kinases which comprise 4 structurally related recep- The remaining five samples used were frozen biopsies tors, (EGFR, HER2, HER3/ErbB3 and HER4/ErbB4), plays (numbers 13-17, with a prefix, BT). These were collected an important role in tumour invasion (7). between 1991 and 1997 and kindly provided by Dr Peter The expression of some MMPs has been well studied in Forsyth, University of Calgary, Canada. Tissue was collected, gliomas (8-12) and meningiomas (13-19) particularly in rela- under local Ethical permission, in the operating theatre imme- tion to invasion or recurrence. Closely related to the MMPs is diately after removal and snap frozen in liquid nitrogen. The the ADAM (a disintegrin and metalloproteinase) family which meningiomas were classified and graded by a neuropathologist has also been implicated in cancer, particularly via ADAM- at this institution. Samples, having been previously frozen in mediated activation of EGFR signalling (20). ADAM8 and liquid nitrogen, were homogenized in RNAzol, and frozen at ADAM19 have also been reported to be overexpressed in ­20˚C until the RNA was isolated. Dr Robert Nuttall carried various brain tumours (21) as well as ADAM10 in gliomas (22) out the qPCR at the School of Biological Sciences, University and have been implicated in local invasion. of East Anglia, Norwich. RECK (reversion-inducing cysteine-rich protein with kazal motifs) is a tumour and metastatic suppressor protein which is RNA isolation and reverse transcription. Total RNA was a negative regulator of MMPs and has been implicated in the isolated from cell culture and tissue lysates according to the regulation of both tumour invasion and angiogenesis. The four instructions provided with the RNAzol. RNA was resuspended members of the tissue inhibitors of matrix metalloproteinases in diethyl pyrocarbonate-treated (Sigma-Aldrich) water. The (TIMPs) family which were previously thought to be endog- concentrations were then determined by spectrophotometry enous inhibitors of MMPs alone are now known to inhibit using a GeneQuant pro RNA/DNA calculator (Amersham several ADAMs and to be involved independently in modula- Pharmacia Biotech, Little Chalfont, UK). One microgram tion of various biological activities including cell proliferation, of total RNA was reverse transcribed using 2 µg random migration, invasion, angiogenesis and apoptosis (23). hexamers (Amersham Pharmacia Biotech) and SuperScript Although there are several reports of elevated levels of II reverse transcriptase (Life Technologies, Paisley, UK) some ADAMs in gliomas, there is a lack of studies for the according to the supplier's instructions. Complementary DNA co-expression of these with MMPs, TIMPs, various growth copy (cDNA) was stored at ­20˚C until required for the poly- factors and their receptors in benign meningiomas. The aim merase chain reaction (PCR). of this study was to characterize RNA expression of the MMP family, 4 TIMPs, RECK as well as 8 ADAMs and selective Quantitative real-time PCR. Sequences for 100 nM probes and growth factors and/or receptors implicated as modulators of 200 nM primers used in the present study for MMPs, TIMPs, invasion
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Linc-DYNC2H1-4 Promotes EMT and CSC Phenotypes by Acting As a Sponge of Mir-145 in Pancreatic Cancer Cells
    Citation: Cell Death and Disease (2017) 8, e2924; doi:10.1038/cddis.2017.311 OPEN Official journal of the Cell Death Differentiation Association www.nature.com/cddis Linc-DYNC2H1-4 promotes EMT and CSC phenotypes by acting as a sponge of miR-145 in pancreatic cancer cells Yuran Gao1, Zhicheng Zhang2,3, Kai Li1,3, Liying Gong1, Qingzhu Yang1, Xuemei Huang1, Chengcheng Hong1, Mingfeng Ding*,2 and Huanjie Yang*,1 The acquisition of epithelial–mesenchymal transition (EMT) and/or existence of a sub-population of cancer stem-like cells (CSC) are associated with malignant behavior and chemoresistance. To identify which factor could promote EMT and CSC formation and uncover the mechanistic role of such factor is important for novel and targeted therapies. In the present study, we found that the long intergenic non-coding RNA linc-DYNC2H1-4 was upregulated in pancreatic cancer cell line BxPC-3-Gem with acquired gemcitabine resistance. Knockdown of linc-DYNC2H1-4 decreased the invasive behavior of BxPC-3-Gem cells while ectopic expression of linc-DYNC2H1-4 promoted the acquisition of EMT and stemness of the parental sensitive cells. Linc-DYNC2H1-4 upregulated ZEB1, the EMT key player, which led to upregulation and downregulation of its targets vimentin and E-cadherin respectively, as well as enhanced the expressions of CSC makers Lin28, Nanog, Sox2 and Oct4. Linc-DYNC2H1-4 is mainly located in the cytosol. Mechanically, it could sponge miR-145 that targets ZEB1, Lin28, Nanog, Sox2, Oct4 to restore these EMT and CSC-associated genes expressions. We proved that MMP3, the nearby gene of linc-DYNC2H1-4 in the sense strand, was also a target of miR-145.
    [Show full text]
  • Epithelial-Specific Knockout of the Rac1 Gene Leads to Enamel Defects
    Eur J Oral Sci 2011; 119 (Suppl. 1): 168–176 Ó 2011 Eur J Oral Sci DOI: 10.1111/j.1600-0722.2011.00904.x European Journal of Printed in Singapore. All rights reserved Oral Sciences Zhan Huang1, Jieun Kim2, Rodrigo Epithelial-specific knockout of the Rac1 S. Lacruz1, Pablo Bringas Jr1, Michael Glogauer3, Timothy G. gene leads to enamel defects Bromage4, Vesa M. Kaartinen2, Malcolm L. Snead1 1The Center for Craniofacial Molecular Biology, Huang Z, Kim J, Lacruz RS, Bringas P Jr, Glogauer M, Bromage TG, Kaartinen VM, Herman Ostrow School of Dentistry, University of Southern California, Los Angeles, CA, USA; Snead ML. Epithelial-specific knockout of the Rac1 gene leads to enamel defects. 2 Eur J Oral Sci 2011; 119 (Suppl. 1): 168–176. Ó 2011 Eur J Oral Sci Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, MI, USA; 3Matrix The Ras-related C3 botulinum toxin substrate 1 (Rac1) gene encodes a 21-kDa GTP- Dynamics Group, Faculty of Dentistry, binding protein belonging to the RAS superfamily. RAS members play important University of Toronto, Toronto, Ontario, roles in controlling focal adhesion complex formation and cytoskeleton contraction, Canada; 4New York University College of activities with consequences for cell growth, adhesion, migration, and differentiation. Dentistry, New York, NY, USA To examine the role(s) played by RAC1 protein in cell–matrix interactions and enamel matrix biomineralization, we used the Cre/loxP binary recombination system to characterize the expression of enamel matrix proteins and enamel formation in Rac1 knockout mice (Rac1)/)). Mating between mice bearing the floxed Rac1 allele and mice bearing a cytokeratin 14-Cre transgene generated mice in which Rac1 was absent Zhan Huang, The Center for Craniofacial from epithelial organs.
    [Show full text]
  • 2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition
    [Frontiers in Bioscience 13, 2335-2355, January 1, 2008] Roles of molecules involved in epithelial/mesenchymal transition during angiogenesis Giulio Ghersi Dipartimento di Biologia Cellulare e dello Sviluppo, Universita di Palermo, Italy TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Extracellular matrix 3.1. ECM and integrins 3.2. Basal lamina components 4. Cadherins. 4.1. Cadherins in angiogenesis 5. Integrins. 5.1. Integrins in angiogenesis 6. Focal adhesion molecules 7. Proteolytic enzymes 7.1. Proteolytic enzymes inhibitors 7.2. Proteolytic enzymes in angiogenesis 8. Perspective 9. Acknowledgements 10. References 1.ABSTRACT 2. INTRODUCTION Formation of vessels requires “epithelial- Growth of new blood vessels (angiogenesis) mesenchymal” transition of endothelial cells, with several plays a key role in several physiological processes, such modifications at the level of endothelial cell plasma as vascular remodeling during embryogenesis and membranes. These processes are associated with wound healing tissue repair in the adult; as well as redistribution of cell-cell and cell-substrate adhesion pathological processes, including rheumatoid arthritis, molecules, cross talk between external ECM and internal diabetic retinopathy, psoriasis, hemangiomas, and cytoskeleton through focal adhesion molecules and the cancer (1). Vessel formation entails the “epithelial- expression of several proteolytic enzymes, including matrix mesenchymal” transition of endothelial cells (ECs) “in metalloproteases and serine proteases. These enzymes with vivo”; a similar phenotypic exchange can be induced “in their degradative action on ECM components, generate vitro” by growing ECs to low cell density, or in “wound molecules acting as activators and/or inhibitors of healing” experiments or perturbing cell adhesion and angiogenesis. The purpose of this review is to provide an associated molecule functions.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Effect of Nanoparticles on the Expression and Activity of Matrix Metalloproteinases
    Nanotechnol Rev 2018; 7(6): 541–553 Review Magdalena Matysiak-Kucharek*, Magdalena Czajka, Krzysztof Sawicki, Marcin Kruszewski and Lucyna Kapka-Skrzypczak Effect of nanoparticles on the expression and activity of matrix metalloproteinases https://doi.org/10.1515/ntrev-2018-0110 Received September 14, 2018; accepted October 11, 2018; previously 1 Introduction published online November 15, 2018 Matrix metallopeptidases, commonly known as matrix Abstract: Matrix metallopeptidases, commonly known metalloproteinases (MMPs), are zinc-dependent proteo- as matrix metalloproteinases (MMPs), are a group of pro- lytic enzymes whose primary function is the degradation teolytic enzymes whose main function is the remodeling and remodeling of extracellular matrix (ECM) compo- of the extracellular matrix. Changes in the activity of nents. ECM is a complex, dynamic structure that condi- these enzymes are observed in many pathological states, tions the proper tissue architecture. MMPs by digesting including cancer metastases. An increasing body of evi- ECM proteins eliminate structural barriers and allow dence indicates that nanoparticles (NPs) can lead to the cell migration. Moreover, by hydrolyzing extracellularly deregulation of MMP expression and/or activity both in released proteins, MMPs can change the activity of many vitro and in vivo. In this work, we summarized the current signal peptides, such as growth factors, cytokines, and state of knowledge on the impact of NPs on MMPs. The chemokines. MMPs are involved in many physiological literature analysis showed that the impact of NPs on MMP processes, such as embryogenesis, reproduction cycle, or expression and/or activity is inconclusive. NPs exhibit wound healing; however, their increased activity is also both stimulating and inhibitory effects, which might be associated with a number of pathological conditions, such dependent on multiple factors, such as NP size and coat- as diabetes, cardiovascular diseases and neurodegenera- ing or a cellular model used in the research.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Polymorphisms of the Matrix Metalloproteinase Genes
    www.nature.com/scientificreports OPEN Polymorphisms of the matrix metalloproteinase genes are associated with essential hypertension in a Caucasian population of Central Russia Maria Moskalenko1, Irina Ponomarenko1, Evgeny Reshetnikov1*, Volodymyr Dvornyk2 & Mikhail Churnosov1 This study aimed to determine possible association of eight polymorphisms of seven MMP genes with essential hypertension (EH) in a Caucasian population of Central Russia. Eight SNPs of the MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, and MMP12 genes and their gene–gene (epistatic) interactions were analyzed for association with EH in a cohort of 939 patients and 466 controls using logistic regression and assuming additive, recessive, and dominant genetic models. The functional signifcance of the polymorphisms associated with EH and 114 variants linked to them (r2 ≥ 0.8) was analyzed in silico. Allele G of rs11568818 MMP7 was associated with EH according to all three genetic models (OR = 0.58–0.70, pperm = 0.01–0.03). The above eight SNPs were associated with the disorder within 12 most signifcant epistatic models (OR = 1.49–1.93, pperm < 0.02). Loci rs1320632 MMP8 and rs11568818 MMP7 contributed to the largest number of the models (12 and 10, respectively). The EH-associated loci and 114 SNPs linked to them had non-synonymous, regulatory, and eQTL signifcance for 15 genes, which contributed to the pathways related to metalloendopeptidase activity, collagen degradation, and extracellular matrix disassembly. In summary, eight studied SNPs of MMPs genes were associated with EH in the Caucasian population of Central Russia. Cardiovascular diseases are a global problem of modern healthcare and the second most common cause of total mortality1,2.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Importance of Altered Gene Expression of Metalloproteinases 2, 9, and 16 in Acute Myeloid Leukemia: Preliminary Study
    Hindawi Journal of Oncology Volume 2021, Article ID 6697975, 8 pages https://doi.org/10.1155/2021/6697975 Research Article Importance of Altered Gene Expression of Metalloproteinases 2, 9, and 16 in Acute Myeloid Leukemia: Preliminary Study Jacek Pietrzak , Marek Mirowski , Rafał S´wiechowski , Damian Wodzin´ ski , Agnieszka Wosiak , Katarzyna Michalska , and Ewa Balcerczak Department of Pharmaceutical Biochemistry and Molecular Diagnostics, Laboratory of Molecular Diagnostics and Pharmacogenomics, Medical University of Lodz, Muszynskiego 1, Lodz 90-151, Poland Correspondence should be addressed to Jacek Pietrzak; [email protected] Received 14 December 2020; Revised 13 April 2021; Accepted 29 April 2021; Published 7 May 2021 Academic Editor: Liren Qian Copyright © 2021 Jacek Pietrzak et al. +is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Acute myeloid leukemia is a group of hematological neoplasms characterized by a heterogeneous course and high mortality. +e important factor in the neoplastic process is metalloproteinases, proteolytic enzymes capable of degrading various components of the extracellular matrix, which take an active part in modifying the functioning of the cell, including transformation to cancer cell. +ey interact with numerous signaling pathways responsible for the process of cell growth, proliferation, or apoptosis. In the present study, changes in the expression of MMP2, MMP9, and MMP16 genes between patients with AML and people without cancer were examined. +e impact of cytogenetic changes in neoplastic cells on the expression level of MMP2, MMP9, and MMP16 was also assessed, as well as the impact of the altered expression on the effectiveness of the first cycle of remission- inducing therapy.
    [Show full text]
  • GATA2 Regulates Mast Cell Identity and Responsiveness to Antigenic Stimulation by Promoting Chromatin Remodeling at Super- Enhancers
    ARTICLE https://doi.org/10.1038/s41467-020-20766-0 OPEN GATA2 regulates mast cell identity and responsiveness to antigenic stimulation by promoting chromatin remodeling at super- enhancers Yapeng Li1, Junfeng Gao 1, Mohammad Kamran1, Laura Harmacek2, Thomas Danhorn 2, Sonia M. Leach1,2, ✉ Brian P. O’Connor2, James R. Hagman 1,3 & Hua Huang 1,3 1234567890():,; Mast cells are critical effectors of allergic inflammation and protection against parasitic infections. We previously demonstrated that transcription factors GATA2 and MITF are the mast cell lineage-determining factors. However, it is unclear whether these lineage- determining factors regulate chromatin accessibility at mast cell enhancer regions. In this study, we demonstrate that GATA2 promotes chromatin accessibility at the super-enhancers of mast cell identity genes and primes both typical and super-enhancers at genes that respond to antigenic stimulation. We find that the number and densities of GATA2- but not MITF-bound sites at the super-enhancers are several folds higher than that at the typical enhancers. Our studies reveal that GATA2 promotes robust gene transcription to maintain mast cell identity and respond to antigenic stimulation by binding to super-enhancer regions with dense GATA2 binding sites available at key mast cell genes. 1 Department of Immunology and Genomic Medicine, National Jewish Health, Denver, CO 80206, USA. 2 Center for Genes, Environment and Health, National Jewish Health, Denver, CO 80206, USA. 3 Department of Immunology and Microbiology, University of Colorado Anschutz Medical Campus, Aurora, ✉ CO 80045, USA. email: [email protected] NATURE COMMUNICATIONS | (2021) 12:494 | https://doi.org/10.1038/s41467-020-20766-0 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-20766-0 ast cells (MCs) are critical effectors in immunity that at key MC genes.
    [Show full text]