AN ABSTRACT OF THE THESIS OF

Walter Kevin Vogel for the degree of Doctor of Philosophy in Biochemistry and Biophysics presented on August 21 1997. Title: Site-Directed Mutagenesis of the m2 Muscarinic Acetylcholine Receptor

Abstract approved:

Michael I. Schimerlik

When the m2 muscarinic receptor was expressed in Chinese hamster ovary cells the EC50 of adenylyl cyclase inhibition decreased but the extent remained constant with increasing receptor levels. The EC50 for phosphatidylinositol metabolism stimulation was unaffected but its extent increased with increasing receptor levels. The ternary complex model was expanded to explicitly include composite G protein activation steps from receptorG protein and agonistreceptorG protein complexes. This expanded model explained these effects, partial agonism that disappeared at high receptor level, and negative antagonism.

The model explained the results observed with the site-directed mutant Y403F, a conserved residue in the sixth transmembrane helix, and resolved apparently conflicting results seen with the homologous mutation in the m3 muscarinic receptor. In the m3 subtype the mutation resulted in decreased agonist affinity and decreased functional activity. In the m2 subtype agonist affinity was more affected but functional activity was wild-type-like except for pilocarpine, where the functional activity was reduced in one assay and eliminated in another. These effects observed in both subtypes were explained by changes in the ratio of high affinity to low affinity agonist equilibrium constants that increased in the m2 subtype but decreased with pilocarpine in the m2 and for comparable agonists in the m3 subtype.

Conserved aspartate residues in the second and third transmembrane domains were mutated individually and in pairs to asparagine. D69N eliminated high and preserved low affmity agonist binding and altered agonist-specific functional activation; some of these effects were observed with D69.97N. D97N had a small effect on agonist binding and functional activity. Double mutant cycles indicate that D69N and D97N mutations are additive but D103N-containing double mutants are not. D103N had a dramatic effect on expression and ligand binding. D97.103N double mutation eliminated functional activity at saturating agonist concentrations at receptor expression levels at which full wild-type-like functional activity was observed in D97N. Results from

D97.103N suggest that D97 and D103 have separate noncooperative roles in ligand binding. Thermal inactivation studies suggest that these mutants have at most a small effect on receptor structure. © Copyright by Walter Kevin Vogel August 21, 1997 All Rights Reserved Site-Directed Mutagenesis of the m2 Muscarinic Acetylcholine Receptor

by

Walter Kevin Vogel

A THESIS

submitted to

Oregon State University

in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

Completed August 21, 1997 Commencement June 1998 Doctor of Philosophy thesis of Walter Kevin Vogel presented on August 21. 1997

APPROVED:

Major Professor, representing Biochemistry and Biophysics

Chair of Department of Biochemistry and Biophysics

Dean of Grad c School

I understand that my thesis will become part of the permanent collection of Oregon State

University libraries. My signature below authorizes release of my thesis to any reader upon request.

Redacted for privacy

Walter Kevin Vogel, Author Acknowledgments

I would like to acknowledge the contributions made to this work by the following people: my advisor, Professor Michael I. Schimerlik, in whose laboratory this work was performed, for suggesting these studies, his sound advice and constructive criticism; Gary L. Peterson, David J. Broderick, and Michael H. Nesson for patiently instructing me in many of the experimental techniques used during this project; Dylan A.

Bulseco, Birgit T. Hirschberg, Valerie A. Mosser, Thomas F. Murray, and Charles H.

Robert for many helpful discussions; and Glenda Fox, David M. Sheehan, Kirsten

Wolthers, and Anne Zimmerman for valuable assistance.

I would like to thank Christopher K. Mathews, George J. Mpitsos, Thomas F. Murray, and Kensal E. van Holde for serving on my committee.

This work was supported by the National Institutes of Health Grants HL23632 and ES00210. Contribution of Authors

Chapter 2 was originally published in the Journal of Biological Chemistry 270,

15485-15493, (1995) entitled "Porcine m2 Muscarinic Acetylcholine ReceptorEffector

Coupling in Chinese Hamster Ovary Cells" by Walter K. Vogel, Valerie A. Mosser, Dylan A. Bulseco, and Michael I. Schimerlik. V. A. Mosser and D. A. Bulseco did the phosphatidylinositol metabolism stimulation experiments and M. I. Schimerlik conceived of describing the different effects observed in functional assays by a concerted mechanism and pointed the way toward the derivation that is described.

Chapter 3 is a forthcoming paper in Molecular Pharmacology (1997), entitled

"Site-Directed Mutagenesis on the m2 Muscarinic Acetylcholine Receptor. The

Significance of Tyrosine 403 in the binding of agonists and functional coupling" by Walter K. Vogel, David M. Sheehan, and Michael I. Schimerlik. D. M. Sheehan contributed some of the binding data that appear in Table 3.1.

Chapter 4 is in preparation for publication (1997), entitled "The Role of Aspartate

69, 97, and 103 in Ligand Binding and Signal Transduction of the m2 Muscarinic

Acetylcholine Receptor. A Site-Directed Mutagenesis Study" by Walter K. Vogel, Gary

L. Peterson, David J. Broderick, Valerie A. Mosser, and Michael I. Schimerlik. G. L.

Peterson contributed some of the binding data that appears in Table 4.1 and some of the thermal inactivation data that appear in Table 4.3, D. J. Broderick contributed some of the phosphatidylinositol stimulation data that appear in Table 4.4, V. A. Mosser was responsible for obtaining analyzable expression of the D69.103N mutant and some of the binding data on that mutant that appear in Table 4.1, and M. I. Schimerlik did some of the molecular biology involved in producing the site-directed mutants. Table of Contents

Chapter 1. Introduction 1

History of muscarinic acetylcholine receptor discovery and background on its action 1

G protein coupling discovery and action 4

Receptor classification

Structure of G protein-coupled receptors 10

G protein structure 14

Muscarinic receptor function 18

References 21

Chapter 2. Porcine m2 Muscarinic Acetylcholine ReceptorEffector Coupling in Chinese Hamster Ovary Cells 32

Abstract 32

Introduction 33

Experimental Procedures 34

Results 38

Discussion 52

Appendix 61

References 64

Chapter 3. Site-Directed Mutagenesis on the m2 Muscarinic Acetylcholine Receptor. The Significance of Tyrosine 403 in the binding of agonists and functional coupling 68

Summary 68

Introduction 69

Materials and Methods 72

Results 76

Discussion 78 Table of Contents, Continued

References 90

Chapter 4. The Role of Aspartate 69, 97, and 103 in Ligand Binding and Signal Transduction of the m2 Muscarinic Acetylcholine Receptor. A Site-Directed Mutagenesis Study 95

Summary 95

Introduction 96

Materials and Methods 99

Results 103

Discussion 124

References 135

Chapter 5. Summary 142

Bibliography 154

Appendix 173 List of Figures Figure Page

1.1 Compounds derived from Amanita muscaria 2

1.2 Muscarinic agonists 4

1.3 Muscarinic antagonists 5

1.4 Transmembrane helical structure of m2 muscarinic receptor 12

1.5 ReceptorG protein activation cycle 16

2.1. Coupling of the pm2 mAcChR to effectors in CHO cells and membranes 39

2.2. The effect of pm2 mAcChR on the maximal inhibition of forskolin­ stimulated cAMP formation in whole cells 44

2.3. The effect of pm2 mAcChR on the EC50 for cAMP inhibition in whole cells 44

2.4. The effect of pm2 mAcChR on fold maximal response for PI stimulation in whole cells 44

2.5. The effect of pm2 mAcChR on the EC50 for PI stimulation in whole cells assays 44

2.6. [3H]NMS displacement by carbachol in CHO cell membranes expressing high, intermediate, and low levels of pm2 mAcChR 50

3.1. Ternary complex model describing the binding of agonist and G protein to G protein-coupled receptors 72

3.2. [3H]NMS displacement by carbachol in Y403F CHO cell membranes 80

3.3. Irreversible thermal inactivation of Y403F m2 muscarinic receptor 82

3.4. Ternary complex model with kinetic pathways toward G protein activation and inactivation 85 List of Figures, Continued Figure Page

4.1. Agonist displacement by oxotremorine M of wild-type and asparagine mutant muscarinic receptors in CHO cell membranes 108

4.2. Stimulation of phosphatidylinositol metabolism by aspartate mutant muscarinic receptors 119

4.3. Effect of aspartate mutant muscarinic receptors on cAMP formation 119

5.1. Ternary complex model with kinetic pathways toward G protein activation and inactivation 145 List of Tables

Table Page

1.1 Molecularly identified G protein-coupled receptors 8

2.1. Agonist binding data for pm2 mAcChR expressed in CHO cell membranes 52

3.1. Ligand binding properites of Y403F mutant and wild-type m2 muscarinic receptor 79

3.2. The effect of Y403F mutant on phosphatidylinositol stimulation in whole cell assays 83

3.3. The effect of Y403F mutation on adenylyl cyclase inhibition in whole cell assays 83

4.1. Equilibrium dissociation constants for wild-type and mutant m2 muscarinic receptor 106

4.2. A(AG°) for m2 muscarinic receptor aspartate mutants 111

4.3. Irreversible thermal inactivation of mutant and wild-type m2 muscarinic receptor in presence and absence of saturating QNB 113

4.4. Effect of aspartate mutant muscarinic receptor on phosphatidylinositol stimulation 115

4.5. Effect of aspartate mutant muscarinic receptor on adenylyl cyclase activity 117 To my parents

Margaret and Irving Vogel Site-Directed Mutagenesis of the m2 Muscarinic Acetylcholine Receptor

Chapter 1

Introduction

History of muscarinic acetylcholine receptor discovery and background on its action

Eighteenth century visitors to the Koryak tribe in northeastern Siberia reported tribe members being, "subject to various visions, terrifying or felicitous...owing to which some jump, some dance, others cry and suffer great terrors, while some deem a small crack to be as wide as a door, and a tub of water as deep as the sea."1 This was the result of eating (or drinking the urine of someone who has) the fly agaric Amanita muscaria, the white-spotted red mushroom sometimes found in the illustrations of children's fairy-tales.

Accounts like these led to studies in 1869 by Schmiedeberg and Koppe (2) who showed that extracts from Amanita muscaria could slow, and high concentrations stop frog heart beat. They produced an enriched preparation of the active alkaloid and called it muscarine (Figure 1.1). They further showed that muscarinic effects on the heart were similar to vagal stimulation of the heart and that atropine (Atropa belladonna) blocked vagal stimulation.

Similar work on the effects of curare (Chondrodendron tomentosum) by Claude

Bernard and later on nicotine (Nicotiana tabacum) by Langley (3) led to the classification of acetylcholine effects as either being muscarinic or nicotinic by Dale (4). Muscarinic

'from the account of Stephen Krasheninnikov, published 1755, and translated in Wasson R. G. (1) 2

Figure 1.1 Compounds derived from Amanita muscaria effects were blocked by atropine and nicotinic effects were nicotine-like acetylcholine effects not blocked by atropine. Loewi first suggested that acetylcholine acted as a chemical messenger. In 1921 he showed that a substance in frog hearts he called vagusstoff transferred from one heart would inhibit the beating of a second (5). Loewi and Navaaratil later speculated that the substance was acetylcholine (6) and showed that physostigmine (Physostigma venenosa), an inhibitor of the enzyme that breaks down acetylcholine, sensitized the heart to vagusstoff (7). Dale and Dudley isolated acetylcholine from tissue (8) in 1929 proving that it is a natural constituent (for historical reviews see Burgen (9, 10) and Whittaker (11)). Henry Dale and Otto Loewi shared the

Nobel Prize in 1936 for their work on acetylcholine.

Agonist effects

Muscarinic agonists (Figure 1.2) have effects on the heart, smooth muscle, exocrine glands, eye, and the central nervous system. They slow the rate and decrease the force of contraction of the heart and result in vasodilatation, the combined effect of which is the probable origin of the toxic effect of Amanita muscaria when consumed in excess.

The hallucinogenic effect is probably due to muscimol and ibotenic acid (12), which activate GABAA and metabotropic glutamate receptors, respectively, rather than muscarine itself (Figure 1.1). Muscarinic agonists cause the smooth muscle of the bronchia to contract and increase bronchial secretions; the combined effect can interfere 3 with breathing, severely. Contraction of smooth muscle in the bladder and increased peristaltic action in the gut, which can result in sharp abdominal pain, excess sweating, lacrimation, and salivation, are additional side-effects of muscarinic agonists limiting their potential as pharmaceuticals. An exception is the use of pilocarpine (Pilocarpus jaborandi) to treat glaucoma in the form of eye drops, which reduces the intraocular pressure by promoting outflow of the aqueous humor. Muscarinic agonists that can cross the bloodbrain barrier, such as arecoline, have the ability to improve short-term memory (13).

Antagonist effects

Muscarinic antagonists have proved to be more useful as pharmaceuticals than agonists in measured amounts and no less deadly if taken in greater quantities. The berries of Atropa belladonna when squeezed into the eye cause the pupils to dilate imparting the so-called doe-eyed beauty look to Renaissance women, and hence the name belladonna; this however, would have resulted in blurry vision for these beautiful women. The same berry ingested would kill, a use that was not ignored, giving us the genus name Atopa after the oldest of the three Fates in Greek mythology, who cut the thread of life. In the current pharmacopoeia atropine (or in optically pure form

()hyoscyamine) is effective as an antispasmodic in relaxing smooth muscle in the gut.

Other effects include an increase in the heart rate and decrease in exocrine secretions.

Scopolamine (Hyoscyamus niger) is used as an antiemetic to prevent motion sickness.

Ipratropium, an atropine derivative with a quaternary amine so that it does not pass the bloodbrain barrier, is inhaled by asthma sufferers for its bronchodilative effect. The original version of this therapy involved the smoking of herbal cigarettes containing jimson weed (Datura stamonium) produced by the Spanish Cigarette Company (12).

Antagonist effects in the central nervous system include an increase in body temperature, loss of short-term memory, delirium, sedation, and hallucinations. Some of these effects 4

0 +. NO).LNH2 HO

(+)-muscarine acetylcholine carbachol

/ 0 / 0

oxotremorine M oxotremorine pilocarpine

_OH 2 0, CI

arecoline McN-A-343

Figure 1.2 Muscarinic agonists were sought for military purposes and found in 3-quinuclidinyl benzilate, known as agent BZ to the military and referred to here as QNB. This incapacitating agent's effects are stronger than atropine and last longer while being less deadly (14).

G protein coupling discovery and action

The general mechanism of muscarinic receptor action was not understood except in parallel with other receptors that appeared to have opposing effects. In the 1950s Earl

Sutherland's group discovered that the hormones epinephrine and glucagon acted via a 5

S()-hyoscyamine S()-N-methyl scopolamine

-N,--700

R()-quinuclidyl benzilate gallamine

H N

/ \ / N\ / N N pirenzepine AF-DX 116 ____t--\

Figure 1.3 Muscarinic antagonists 6 second messenger cAMP (15) and that acetylcholine acted in the heart to decrease cAMP levels (16). Earl Sutherland received the Nobel prize in 1971 for working out this second messenger system. The mechanism by which hormone binding at cell surface receptors affects adenylyl cyclase activity via G proteins was worked out primarily in the laboratory of Martin Rodbell in the late 1960s and early 1970s. Birnbaumer and Rodbell

(17) observed that several different receptors stimulated adenylyl cyclase by a common mechanism and postulated that a regulatory element existed between the hormone binding receptor and the adenylyl cyclase effector (18). Guanine nucleotides were found to affect the affinity of glucagon for its receptor (19) and to be essential for adenylyl cyclase activity (20) suggesting that the regulatory element bound guanine nucleotide.

Subsequent results indicated that stimulation and inhibition of adenylyl cyclase occurred via different guanine nucleotide binding proteins (21) that were later identified as the G proteins Gs and Gi.

Rodbell's group had shown by the early 1970s that signal transduction elements that bind guanine nucleotides existed and were capable of affecting both receptors and effectors but they did not know what they were or how they worked. Casell and Se linger

(22) observed that 0-adrenergic agonists stimulated a GTPase and proposed that the hydrolysis of GTP was responsible for suspending the signal, and Pfeuffer (23) first identified a G protein by photoaffmity labeling of detergent extracts of avian erythrocytes and showed that the partially-purified detergent-solubilized protein resolved from receptor and adenylyl cyclase reconstituted adenylyl cyclase activity. Parallel experiments in Alfred Gilman's laboratory using a mutant leukemia cell line devoid of adenylyl cyclase activity but containing P-adrenergic receptors (24) identified a heat stable component that was necessary for adenylyl cyclase activity (25) and later purified this component (26). This protein was later termed G. Subsequently Gi (27), which inhibited adenylyl cyclase, and Go (28, 29), which had no obvious function at the time, 7 were also purified. The heterotrimeric nature of G proteins became evident as a consequence of purification (see Gilman review (30)). Rodbell and Gilman received the

Nobel prize in 1994 for their work on the discovery of G proteins and their role in signal transduction.

Receptor classification

Muscarinic acetylcholine receptors have been classified into three subtypes pharmacologically and five genetically. The three pharmacological subtypes, M1

(neural), M2 (cardiac), and M3 (glandular), are distinguishable by their selective binding of pirenzepine (31) (M1 selective) and AF-DX 116 (32) and gallamine (33) (M2 selective) , and p-fluorohexahydrosiladifenidol (34) (M3 selective). Five vertebrate muscarinic receptor genes are known and are designated subtypes mlm5 (35-43), and a sixth gene from Drosophila melanogaster is designated mdl (44, 45). mRNA blotting and cDNA cloning experiments on mammalian tissue indicate that in the brain all five subtypes are present (36, 38, 39, 43, 46-51), in the heart m2 is present (35, 37, 38, 47) while in chick heart m2 predominates followed by m4 and m3 (additionally m3 is a developmentally regulated and present in higher concentrations in early developmental stages) (49, 52, 53), in glandular tissue ml and m3 and in smooth muscle m2 and m3 are present (47), and in a human melanoma cell line only m5 is present (54).

Muscarinic receptors are members of a diverse homologous group of membrane proteins that are distinguished structurally by seven hydrophobic domains that are assigned as transmembrane a-helices and functionally by their ability to interact with G proteins. G protein-coupled receptors are responsible for our sense of smell, sight, and taste, they bind neuropeptides, biogenic amines, and glycoprotein hormones; additional receptors (orphan receptors in Table 1.1) have no known purpose. Their common purpose is transmembrane communication. Distinct members of the superfamily of G protein-coupled receptors that have been identified by DNA cloning are listed in Table 8

Table 1.1 Molecularly identified G protein-coupled receptors

Family I: Rhodopsin-like thyrotropin receptor probable glycoprotein hormone receptor Amine binding gonadotropin-releasing hormone receptor thyrotropin-releasing hormone receptor adrenergic receptors (10)a growth hormone secretalogue receptor dopamine receptors (13) prostanoids receptors (8) histamine receptors (2) 5-hydroxytryptamine receptors (12) Other molecules muscarinic acetylcholine receptors (6) adenosine receptors (4) octopamine receptor purinoceptors (5) Sensory cannabinoids receptors (4) melanocortins receptors (3) olfactory receptors (48+) adrenocorticotropic hormone receptor gustatory receptors (8) melanocyte-stimulating hormone receptor rhodopsins and opsins neurotensin receptors (2) rhodopsin and red, green, and blue opsin in melanotonin receptors (4) humans orphan receptors (51) rhodopsin and red, green, blue, violet, and viral receptors (12) pineal opsin in chicken Peptide binding Family II: Secretin-like angiotensin receptors (4) calcitonin receptor neuromedin B receptor calcitonin gene-related peptide 1 receptor gastrin-releasing peptide receptor corticotropin releasing factor receptors (2) bombesin receptors (2) diuretic hormone receptor neuropeptide Y receptors (8) gastric inhibitory peptide receptor opioid receptors (4) glucagon receptor somatostatin receptors (5) glucagon-like peptide 1 receptor neurokinin receptors (4) growth hormone-releasing hormone receptor platelet activating factor receptor parathyroid hormone receptor galanin receptor pituitary adenylyl cyclase activating peptide I vasopressin receptors (3) receptor oxytocin receptor secretin receptor thrombin receptor vasoactive intestinal peptide receptors (2) proteinase activated receptor orphan receptors (4) bradykinin receptors (2) orthinthokinin receptor Family III: Metabotropic glutamate endothelin receptors (3) and calcium receptors complement anaphylatoxin chemotactic receptors (2) metabotropic glutamate receptors (9) fMet-Leu-Phe receptor and related receptors (3) extracellular calcium-sensing receptor leukotriene B4 receptor CXC chemokine receptors (4) Family IV: cAMP receptors Duffy antigen (DARC) (slime mold) CC chemokine receptors (5) macrophage inflammatory protein-la cAMP receptors from Dictyostelium chemokine receptor discoideum (3) D6 chemokine receptor STRL33 chemokine receptor Family V: Pheromone receptors cholecystokinin / gastrin receptors (2) (fungal) follicle-stimulating hormone receptor lutropin-choriogonadotropic hormone receptor pheromone receptors (8) avalues in parentheses are the number of distinct molecular species represented by the entry 9

1.1. Approximately 800 protein sequences of G protein-coupled receptors have been identified representing in excess of 300 distinct molecular entities. It is estimated that approximately 1000 of the genome's 100,000 genes encode G protein-coupled receptors

(55). The primary sequence of bovine rhodopsin was the first of these structures available (56, 57) and its structural similarity to bacteriorhodopsin was immediately evident and applied to structural models of rhodopsin based on the seven transmembrane a-helices of bacteriorhodopsin (58). However, there is no sequence homology between these proteins, and bacteriorhodopsin unlike rhodopsin is an ion channel. While primary structures of the four human visual pigments, rhodopsin (59) and red, green, and blue opsins (60), indicated a close phylogenetic relationship it was not until the primary structure of13-adrenergic receptor became available (61) that it was recognized that the entire class of G protein-coupled receptors might share a similar related structure.

Sequence alignments reveal that the majority of the homology resides in the seven hydrophobic transmembrane domains (62-64). G protein-coupled receptors have been divided into five phylogenetic families (Table 1.1) (65)2.

2A large amount of information on G protein-coupled receptors resides in specialized secondary databases that have the results of primary database searches, sequence alignments, structure modeling tools, databases of site-directed mutants and their effects. The following is a list of the publicly available secondary databases relevant to reasearch on G protein-coupled receptors:

GPCRDB: Information system for G http://swift-embl-heidelberg.de/7tm protein-coupled receptors GCRDb: The G protein-coupled receptor http://receptor.mgh.harvard.edu/ database (65) GCRDBHOME.html ORDB: Olfactory database http://senselab.med.yale.edu/ordb Mutation database at NIH http://mgddkl.niddk.nih.gov:8000/ GPCR.html ExPASy: The swiss-model 7TM http://www.espasy.ch/cgi-bin/ ProMod-GPCR.pl GRAP Mutant database at Troms0, http://www-grap.fagmed.uit.no/GRAP/ Norway (66) homepage.html 10 Structure of G protein-coupled receptors

Atomic resolution structural information on G protein-coupled receptors is unavailable and low-resolution projection structures of G protein-coupled rhodopsin have only recently reached a level of refinement that allows a tentative model of the transmembrane helices to be proposed (67). This 6 A frog rhodopsin projection structure suggests that the seven transmembrane helices are packed into a rough circle with helix 4 and especially helix 1 pushed toward the outside. Helices 1, 2, 3, and 5 are tilted while 4,

6, and 7 are perpendicular to the plane of the membrane. The putative helices are amphipathic with helices 1 and 4 being the most hydrophobic and helix 7 the least.

Helix 3 is amphipathic only near the extracellular end consistent with projection structures. Helices 4, 5, 6, and 7 have conserved prolines suggesting that they are bent or have a degree conformational flexibility. The cluster of helices are bundled funnel-like, wider at the intradiscal (extracellular homologous) and narrower at the cytoplasmic face with helix 3 tilted toward the center of the circle of helices on the cytoplasmic face. See

Baldwin (68) for a review of the helix arrangement based on the then available 9 A bovine rhodopsin projection structure (69). The relevance of this structural information to other members of the G protein- coupled receptor family is unclear. The requirements for the incorporation of visual pigment 11-cis-retinal and its isomerization may be particular to rhodopsin. The core structural requirements of G protein-coupled receptors are not well enough understood to allow rhodopsin to be considered a reliable model for other G protein-coupled receptors.

Indeed, the funnel-like arrangement of the helices of rhodopsin might be to accommodate the relatively large retinal; acetylcholine could be accommodated by more narrowly bundled helices in the muscarinic receptor. In the absence of high-resolution structures of G protein-coupled receptors, most insights into structure and function have been inferred from chemical modification and site-directed mutagenesis experiments. 11

Hydropathicity analysis of the primary sequence suggests that muscarinic receptors cross the cell membrane seven times (35, 37). The receptor is oriented in the cell membrane with the amino-terminal extracellular and the carboxyl-terminal intracellular. Two highly conserved motifs that could conceivably interact are found at the intracellular ends of helices 2 and 3. The aspartate at the bottom of helix 2 (D69 in the m2 muscarinic receptor) is conserved with a few exceptions in the rhodopsin-like family of G protein-coupled receptors (Table 1.1) and is surrounded by other residues that are highly conserved or have a restricted variability (Figure 1.4). At the intracellular end of helix 3 there is a patch of residues with restricted variability followed by the conserved sequence DRY. Evidence for the close proximity of the helix 2 aspartate and a conserved asparagine in helix 7 (N436 in m2 muscarinic receptor), in the conserved NPXXY motif, comes from the gonadotropin-releasing hormone receptor where these residues are switched. The reciprocal double mutation that restored the typical arrangement of aspartate in helix 2 and asparagine in helix 7 restored high affmity agonist and antagonist binding lost in the single helix 2 mutation (70). Similar experiments in the

5-hydroxytryptamine2A receptor showed that high affinity agonist binding and functional activity lost in the single were restored in the reciprocal double mutant (71) suggesting that this might be a general feature of the rhodopsin-like G protein-coupled receptors. At the extracellular end of helix 3 and the extracellular loop between helices 4 and 5 is a pair of highly conserved cysteine residues. An aspartate in the middle of helix 3 (D103 in m2 muscarinic receptor) is conserved among receptors that bind biogenic amines and the opioid and somatostatin peptide-binding receptors. A second aspartate at the extracellular end of helix 3 (D97 in m2 muscarinic receptor) is conserved less strictly among receptors that bind biogenic amines. It is conserved among the muscarinic receptors, most dopamine, and some 5-hydroxytrypamine and a-adrenergic receptors; glutamate is conserved at this homologous site in the 0-adrenergic and some a-adrenergic receptors 12

Figure 1.4 Transmembrane helical structure of m2 muscarinic receptor. Consensus N-glycosylation sites (residues 2, 3, and 6) are indicated with small branched structures and the palmitoylation site (residue 457) is indicated with a zig-zagged line. The circled residues are positions that are highly conserved or have restricted variability in or near the transmembrane helices in the rhodopsin-like family of G protein-coupled receptors (68). T KT N N N N M P G S E D E S K Q T C I K I V AD R P A KG NOIKNH N KED K S HG LSTSVT NEDOTI E D DR K A P R D A V T E N CV Q G E E K E S S N D S T S V S AV AS NM 14 while acidic residues are missing in the histamine and octopamine receptors. There is a large concentration of aromatic residues in the extracellular ends of the transmembrane helices and the extracellular loops: W90, W148, F195, F396, Y403, and W400 are highly conserved in the rhodopsin-like G protein-coupled receptors, W99, Y196, Y430, and W427 among receptors that bind biogenic amines, and F75, Y80, Y83, W156,

F162, W163, W165, F180, F188, F412, and Y426 among muscarinic receptors.

Three consensus sequences for N-glycosylation appear in the extracellular amino terminus, but site-directed mutagenesis experiments on these sites in the m2 muscarinic receptor suggest that the glycosylation is not required for cell surface expression, ligand binding, or functional activity (72). Chemical modification and sequencing experiments

(73) and site-directed mutagenesis studies (74) on the ml muscarinic receptor suggest that a disulfide bond exists between the extracellular end of helix 3 and second extracellular loops and that this bond is important for the formation of the ligand binding site. Serine and threonine phosphorylation sites occur in the third intracellular loop and the carboxyl-terminal tail of muscarinic receptors and are phosphorylated in both agonist-dependent and agonist-independent mechanisms (75-82). G protein-coupled receptors are typically palmitoylated post-translationally at one or two conserved cysteine residues in the carboxyl-terminal tail approximately 15 residues following the seventh transmembrane helix, and a single palmitoylation at residue 457 has been identified in the m2 muscarinic receptor (83) (Figure 1.4).

G protein structure

Agonist binding at G protein-coupled receptors results in the activation of one or more different types of G proteins that carry the extracellular signal to one or more intracellular effector sites. The most extensively studied system is the production of cAMP by adenylyl cyclase, which is stimulated by Gs and inhibited by Gi. Other G proteins activate phospholipase C, guanylyl cyclase, cGMP phosphodiesterase, calcium 15 channels, and potassium channels. G proteins are membrane-associated heterotrimeric proteins consisting of an a subunit, which has the guanine nucleotide binding site and the GTPase activity, and the dimeric fily subunit. There are 23 distinct a subunits (the alternative splicing products of 17 genes), in four families (nf-5, -110, aq 1, and a12), 613 subunits (84), and 12 y subunits (85). In the inactive form the a subunit is bound to

GDP and is associated with the 137 subunit on the intracellular face of the plasma membrane or associated with receptor. The active receptor conformation, stabilized by receptor binding of ligand with a relatively high affinity, promotes the exchange of bound GDP for GTP on the a subunit and results in the dissociation of the a and the fry subunits. GTP hydrolysis results in subunit reassociation. G protein activation results in bifurcating signaling by both a and fily subunits (Figure 1.5). There are nine isoforms (types IIX) of membrane bound adenylyl cyclase (see Taussig and Gilman (86) and Houslay and Milligan (87) for reviews), and as stimulates all of them, ai inhibits types I, V, and VI (88, 89), 13y inhibits type I (90, 91) but stimulates types II (91) and type IV (92) synergistically with as. Phospholipase Cr3 isozymes PLCI31, PLC[33, and PLC134 are stimulated by members of the actin family

(93-97) and less so PLC 32. fay subunits stimulate PLCI32 and PLCI33 (98-102) and less so PLCf31, (see Exton (103, 104) for reviews). G protein-gated inwardly-rectifying potassium channels (GIRK1, 2, 3, 4)3 are activated by fry (105-109). The ail subunit, but not ai2 or 043, inhibits 13172-activated GIRK1 (110). Voltage-gated N-type calcium channels are inhibited by 13y (111-114). An additional role for the fry subunit is to promote homologous receptor desensitization by facilitating agonist-dependent receptor phosphorylation. Cytosolic G protein-coupled receptor kinases GRK2 and GRK3 are caused to associate near active receptors by binding to free membrane-associated fry

3According to the standardized nomenclature also currently in use these are identifified as Kir3.1, 3.2, 3.3, and 3.4; additionally, GIRK4 (Kir3.4) was previously identified as CIR and rcKATP. 16

Figure 1.5 ReceptorG protein activation cycle. Inactive G proteins (G Gfly) freely GDP associate with either agonist-bound or unbound receptor (R). The receptor promotes the exchange of GTP for GDP by accelerating the dissociation rate of bound GDP. GTP- bound heterotrimeric G protein dissociates into Ga and Gsr subunits that activate effector systems. GTP hydrolysis on the Ga subunit increases the GaGsr affinity and the reassociated heterotrimeric G protein rejoins the pool of G proteins capable of associating with receptors. Receptors are thought to be in two states with respect to G proteins, inactive and active. In the active state the receptor is more effective in promoting guanine nucleotide exchange on the bound G protein and this active conformation has a higher affinity for agonists. In the presence of agonist the active conformation of the receptor is selectively bound, its concentration increases, and rate of GTP exchange through the cycle increases. This results in an increased steady-state concentration of active G protein subunits G and Gm,. GTP 17

Figure 1.5 18 subunits (115-117), (see Bohm et al. (118) for review). Perhaps as significant as the differences in specificity between a and 137 subunits are the differences in binding affinity of these subunits for their effectors. 13y subunits bind their effectors with approximately 100-fold lower affinity than a subunits and require higher concentrations to be effective. The Gi10 family are the most abundant G proteins, far exceeding the cellular concentration of other G protein families; in the brain Go is estimated to make up

1-2% of membrane proteins (119). The combined effects of subunit effector affinities and relative G protein abundance effectively limit 07 effects to the Gvo family of G proteins, with some exceptions.

Muscarinic receptor function

Functionally the muscarinic receptor subtypes falls into two groups. The even numbered receptors (m2 and m4) inhibit adenylyl cyclase at low acetylcholine concentrations and at higher acetylcholine concentrations, modestly stimulate phospholipase C(3, activate inwardly-rectifying potassium currents, and inhibit voltage- gated calcium channels. These effects are mediated by pertussis toxin-sensitive G proteins Gi and/or Go. The effects on adenylyl cyclase are via ai while the [37 subunits are responsible for the stimulation of phospholipase cp, stimulation of the inwardly- rectifying potassium channels and the inhibition of voltage-gated calcium channels. The odd-numbered receptors (ml, m3, and m5) do not inhibit adenylyl cyclase but stimulate phospholipase C robustly via the pertussis and cholera toxin-insensitive aqi11 family. In addition to these primary effects there are numerous down-stream effects that result from muscarinic activation. The decreased cAMP concentration, mediated by m2 and m4 subtypes, has a negative effect on the cAMP-dependent protein kinase A. The increase in intracellular calcium concentration, the result of phospholipase Cf3 stimulation by m2 and m4 and especially ml, m3, and m5 subtypes, activates calmodulin while 19 protein kinase C is synergistically activated by calcium and diacylglycerol, the second product of phospholipase CI3 stimulation.

Receptor desensitization, which is the result of regulatory uncoupling of receptor from G protein and receptor endocytosis, is another down-stream effect of receptor activation and occurs via two pathways that result in receptor phosphorylation on serine and threonine residues. Homologous desensitization results from agonist-dependent phosphorylation on the same receptor and is mediated by G protein-coupled receptor kinases (GRKs). Heterologous desensitization is agonist-independent, the result of second-messenger-dependent protein kinase A and protein kinase C and can result from the activity of other receptors (see Bohm et al. (118) for review). GRKs include rhodopsin kinase (GRK1), 13-adrenergic receptor kinases 1 and 2 (GRK2 and GRK3), and GRK4, GRK5, and GRK6. GRK2 and GRK3 are activated by 13y subunits directly and unlike other 13y mediated effects can result from activity of low abundance G protein such as Gs irrespective of its typically high dissociation constant for fry subunits (120).

The Py mediated activation occurs by promoting the membrane association of the enzyme from the cytosol. This can be achieved with low abundance G proteins because unlike phospholipase C13 and ion channel binding, which require the fly subunit to diffuse away from the receptor, a local high concentration of 13'y exists around the site of active receptor; it is the G protein receptor kinase that diffuses in the cytosol and is anchored to the membrane (117, 121). GRK2 and GRK3 are additionally inhibited by calcium-calmodulin (122, 123) and stimulated by protein kinase C phosphorylation

(124). High specificity is usually achieved by high affinity in biological systems. The fry promoted translocation of GRK2 and GRK3 is one of the few examples of high specificity achieved in part because of the low affinity interaction of fry with these protein kinases. The high local concentration of 13y subunits occurs only near active receptors and quickly dissipates once the receptor becomes inactive. If the affinity of the 20 protein kinases for fly was high then it would associate with receptors that were only occasionally active in addition to the highly active receptors, which are their appropriate site of action.

The mechanism by which agonist binding on the cell surface is coupled to the activation of membrane associated G proteins was addressed by Rodbell (125) and De

Lean et al. (126). Essentially the same idea that Rodbell called the disaggregation- coupling model and De Lean et al. called the ternary complex model described a three component system made up of hormone, receptor, and G protein that are free to interact by mass-action to form a complex that activates effector systems. The model, now known only as the ternary complex model, is capable of explaining several observed aspects of hormone activation and inhibition of adenylyl cyclase including the dependence of hormone activation on the presence of GTP, the ability of sub-saturating concentrations of hormone to fully activate/inhibit the effector, and the heterotrophic binding of hormone/agonists to receptors and the effect of GTP on this binding. The application of this model to the explanation of muscarinic receptor stimulation of phosphatidylinositol and inhibition of adenylyl cyclase is the subject of Chapter 2. The best understood functional role of muscarinic receptors is in the heart, where the m2 subtype is expressed. Sympathetic and parasympathetic innervation of cardiac muscle and pacemaker cells of the sinoatrial node are responsible for the regulation of heart beat and force of contraction. Norepinephrine released from cardiac sympathetic neurons mediates the sympathetic response, increasing the rate and the force of contraction, while acetylcholine released from the vagus nerve mediates the parasympathetic response decreasing the rate and the force of contraction. 01-Adrenergic receptors in these cells respond to the increased extracellular concentration of norepinephrine by stimulating the production of cAMP. In turn, cAMP-dependent phosphorylation of L-type calcium channels causes the calcium current to increase. 21 m2 Muscarinic receptors respond to low concentrations of acetylcholine by inhibiting the production of cAMP and to relatively high concentrations by stimulating inwardly- rectifying potassium channels via direct binding of the fry subunit of Gi. It is thought that activation of this potassium channel is responsible for the decreased heart rate that

Loewi first described in 1921, the result of stimulating the vagus nerve of isolated frog hearts.

References

1. Wasson, R. G. (1971) Soma: Divine Mushroom of Immortality, Harcourt, Brace, and Jovanovich, New York

2. Schmiedeberg, 0., and Koope, R. (1869) Das Muscarin. Das giftige Alkaloid des Fliegenpilzes, Vogel, Leipzig

3. Langley, J. N. (1906) On nerve endings and on special excitable substances in cells. J. Physiol. 33, 170-194

4. Dale, H. H. (1914) The action of certain esters and ethers of choline, and their reaction to muscarine. J. Pharmacol. Exp. Ther. 6, 147-190

5. Loewi, 0. (1921) Uber humorale Ubertragbarkeit der Herznervenwirkung (Mitterilung I). Arch. Ges. Physiol. 189, 239-242

6. Loewi, 0., and Navaratil, E. (1926) Uber humorale Ubertragbarkeit der Herznervenwirkung (Mitteilung X). Arch. Ges. Physiol. 214, 678-688

7. Loewi, 0., and Navaratil, E. (1926) Uber humorale Ubertragbarkeit der Herznervenwirkung (Mitteilung IX). Arch. Ges. Physiol 214, 689-696

8. Dale, H. H., and Dudley, F. H. (1929) The presence of histamine and acetylcholine in the spleen of the ox and the horse. J. Physiol. 68, 97-123

9. Burgen, A. S. V. (1989) in The Muscarinic Receptors (J. H. Brown, ed), Humana Press, Clifton, New Jersey

10. Burgen, A. S. V. (1995) The background of the muscarinic system. Life Sci. 56, 801-806

11. Whittaker, V. P. (1990) The contribution of drugs and toxins to understanding of cholinergic function. Trends Pharmacol. Sci. 11, 8-13

12. Mann, J. (1992) Murder, Magic, and Medicine, Oxford University Press, New York 22

13. Smith, R. D., Kistler, M. K., Cohen Williams, M., and Coffin, V. L. (1996) Cholinergic improvement of a naturally-occurring memory deficit in the young rat. Brain Res. 707, 13-21

14. Department of the Army. (1996) Handbook on the medical aspects of NBC defensive operations. Department of the Army Field Manual 8-9, Department of the Army, Washington, D. C.

15. Rall, T., Sutherland, E. W., and Berthet, J. (1957) The relationship of epinephrine and glucagon to liver phosphorylase. IV. Effect of epinephrine and glucagon on the reactivation of phosphorylase in liver homogenates. J. Biol. Chem. 224, 463-475

16. Murad, F., Chui, Y. M., Rall, R. W., and Sutherland, E. W. (1962) Adenylcyclase HI. The effects of catecholamines and choline esters on the formation of 3',5'-phosphate by preparations from cardic muscle and liver. J. Biol. Chem. 237, 1233-1238

17. Bimbaumer, L., and Rodbell, M. (1969) Adenyl cyclase in fat cells II. Hormone receptors. J. Biol. Chem. 244, 3477-3482

18. Birnbaumer, L., Pohl, S. L., Michiel, H., Krans, J., and Rodbell, M. (1970) The actions of hormones on the adenyl cyclase system. Adv. Biochem. PsychopharmacoL 3, 185-208

19. Rodbell, M., Krans, H. M. J., Pohl, S. L., and Birnbaumer, L. (1971) The glucagon-sensitive adenyl cyclase system in plasma membranes of rat liver. IV. Effects of guanyl nucleotides on binding of 1251-glucagon. J. Biol. Chem. 246, 1872-1876

20. Rodbell, M., Birnbaumer, L., Pohl, S. L., and Krans, H. M. J. (1971) The glucagon-sensitive adenyl cyclase system in plasma membranes of rat liver. V. An obligatory role of guanyl nucleotides in glucagon action. J. Biol. Chem. 246, 1877-1882

21. Cooper, D. M. F., Schlegel, W., Lin, M. C., and Rodbell, M. (1979) The fat cell adenylate cyclase system. Characterization and manipulation of its bimodal regulation by GTP. J. Biol. Chem. 254, 8927-8931

22. Cassel, D., and Selinger, Z. (1976) Catecholamine-stimulated GTPase activity in turkey erythrocyte membranes. Biochim. Biophys. Acta 252, 538-551

23. Pfeuffer, T. (1977) GTP-binding proteins in membranes and the contol of adenylate cyclase activity. J. Biol. Chem. 252, 7224-7234

24. Bourne, H. R., Coffino, P., and Tompkins, G. M. (1975) Selection of a variant lymphoma cell line deficient in adenylate cyclase. Science 187, 750-752 23

25. Ross, E. M., and Gilman, A. G. (1977) Resolution of some components of adenylate cyclase necessary for catalytic activity. J. Biol. Chem. 252, 6966-6969

26. Northup, J. K., Sternweis, P. C., Smigel, M. D., Schleifer, L. S., Ross, E. M., and Gilman, A. F. (1980) Purification of the regulatory component of adenylate cyclase. Proc. Natl. Acad. Sci. U. S. A. 77, 6516-6520

27. Bokoch, G. M., Katada, T., Northup, J. K., Hewlett, E. L., and Gilman, A. G. (1983) Identification of the predominant substrate for ADP-ribsoylation by islet activating protein. J. Biol. Chem. 258, 2072-2075

28. Sternweis, P. C., and Robishaw, J. D. (1984) Isolation of two proteins with high affinity for guanine nucleotides from membranes of bovine brain. J. Biol. Chem. 259, 13806-13813

29. Neer, E. J., Lok, J. M., and Wolf, L. G. (1984) Purification and properties of the inhibitory guanine nucleotide regulatory unit of brain adenylate cyclase. J. Biol. Chem. 259, 14222-14229

30. Gilman, A. G. (1987) G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56, 615-649

31. Hammer, R., Berrie, C. P., Birdsall, N. J. M., Burgen, A. S. V., and Hulme, E. C. (1980) Pirenzepine distinguishes between different subclasses of muscarinic receptors. Nature 283, 90-92

32. Hammer, R., Giraldo, E., Schiavi, G. B., Monferini, E., and Ladinsky, H. (1986) Binding profile of a novel cardioselective muscarine receptor antagonist, AF-DX 116, to membranes of peripheral tissues and brain in the rat. Life Sci. 38, 1653-1662

33. Riker, W. F., and Wescoe, W. C. (1951) The pharmacology of flaxedil with observations on certain analogs. Ann. N. 1'. Acad. Sci. 54, 373-394

34. Lambrecht, G., Feifel, R., Forth, B., Strohmann, C., Tacke, R., and Mutschler, E. (1988) p-fluoro-hexahydro-sila-difenidol: the first M2 beta-selective muscarinic antagonist. Eur. J. Pharmacol. 152, 193-194

35. Kubo, T., Maeda, A., Sugimoto, K., Akiba, I., Mikami, A., Takahashi, H., Haga, T., Haga, K., Ichiyama, A., Kangawa, K., Matsuo, H., Hirose, T., and Numa, S. (1986) Primary structure of porcine cardiac muscarinic acetylcholine receptor deduced from the cDNA sequence. FEBS Lett. 209, 367-372

36. Kubo, T., Fukuda, K., Mikami, A., Maeda, A., Takahashi, H., Mishina, M., Haga, T., Haga, K., Ichiymama, A., Kangawa, K., Kojima, M., Matsuo, H., Hirose, T., and Numa, S. (1986) Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetylcholine receptor. Nature 323, 411-416 24

37. Peralta, E. G., Winslow, J. W., Peterson, G. L., Smith, D. H., Ashkenazi, A., Ramachandran, J., Schimerlik, M. I., and Capon, D. J. (1987) Primary structure and biochemical properties of an M2 muscarinic receptor. Science 236, 600-605

38. Peralta, E. G., Ashkenazi, A., Winslow, J. W., Smith, D. H., Ramachandran, J., and Capon, D. J. (1987) Distinct primary structures, ligand-binding properties and tissue-specific expression of four human muscarinic acetylcholine receptors. EMBO J. 6, 3923-3929

39. Bonner, T. I., Buckley, N. J., Young, A. C., and Brann, M. R. (1987) Identification of a family of muscarinic acetylcholine receptor genes. Science 237, 527-532,1628

40. Gocayne, J., Robinson, D. A., Fitz Gerald, M. G., Chung, F.-Z., Kerlavage, A. R., Lentes, K.-U., Lai, J., Wang, C.-D., Fraser, C. M., and Venter, J. C. (1987) Primary structure of rat cardiac 13-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family. Proc. Natl. Acad. Sci. U. S. A. 84, 8296-8300

41. Bonner, T. I., Young, A. C., Brann, M. R., and Buckley, N. J. (1988) Cloning and expression of the human and rat m5 muscarinic acetylcholine receptor genes. Neuron 1, 403-410

42. Akiba, I., Kubo, T., Maeda, A., Bujo, H., Nakai, J., Mishina, M., and Numa, S. (1988) Primary structure of porcine muscarinic acetylcholine receptor III and antagonist binding studies. FEBS Lett. 235, 257-261

43. Liao, C.-F., Themmen, A. P. N., Joho, R., Barberis, C., Birnbaumer, M., and Birnbaumer, L. (1989) Molecular cloning and expression of a fifth muscarinic acetylcholine receptor. J. Biol. Chem. 264, 7328-7337

44. Shapiro, R. A., Wakimoto, B. T., Subers, E. M., and Nathanson, N. M. (1989) Characterization and functional expression in mammalian cells of genomic and cDNA clones encoding a Drosophila muscarinic acetylcholine receptor. Proc. Natl. Acad. Sci. U. S. A. 86, 9039-9043

45. Onai, T., Fitz Gerald, M. G., Arakawa, S., Gocayne, J. D., Urquhart, D. A., Hall, L. M., Fraser, C. M., McCombie, W. R., and Venter, J. C. (1989) Cloning, sequence analysis and chromosome localization of a Drosophila muscarinic acetylcholine receptor. FEBS Lett. 255, 219-225

46. Buckley, N. J., Bonner, T. I., and Brann, M. R. (1988) Localization of a family of muscarinic receptor mRNAs in rat brain. J. Neuosci. 8, 4646-4652

47. Maeda, A., Kubo, T., Mishina, M., and Numa, S. (1988) Tissue distribution of mRNAs encoding muscarinic acetylcholine receptor subtypes. FEBS Lett. 239, 339-342 25

48. Vilaro, M. T., Palacios, J. M., and Mengod, G. (1990) Localization of m5 muscarinic receptor mRNA in rat brain examined by in situ hybridization histochemistry. Neurosci. Lett. 114, 154-159

49. Tietje, K. M., Goldman, P. S., and Nathanson, N. M. (1990) Cloning and functional analysis of a gene encoding a novel muscarinic acetylcholine receptor expressed in chick heart and brain. J. Biol. Chem. 265, 2828-2834

50. Vilaro, M. T., Wiederhold, K. H., Palacios, J. M., and Mengod, G. (1991) Muscarinic cholinergic receptors in the rat caudate-putamen and olfactory tubercle belong predominantly to the m4 class: in situ hybridization and receptor autoradiography evidence. Neuroscience 40, 159-167

51. Vilaro, M. T., Wiederhold, K. H., Palacios, J. M., and Mengod, G. (1992) Muscarinic M2 receptor mRNA expression and receptor binding in cholinergic and non-cholinergic cells in the rat brain: a correlative study using in situ hybridization histochemistry and receptor autoradiography. Neuroscience 47, 367-393

52. Tietje, K. M., and Nathanson, N. M. (1991) Embryonic chick heart expresses multiple muscarinic acetylcholine receptor subtypes. Isolation and characterization of a gene encoding a novel m2 muscarinic acetylcholine receptor with high affinity for pirenzepine. J. Biol. Chem. 266, 17382-17387

53. McKinnon, L. A., and Nathanson, N. M. (1996) Tissue-specific regulation of muscarinic acetylcholine receptor expression during embryonic development. J. Biol. Chem. 270, 20636-20642

54. Kohn, E. C., Alessandro, R., Probst, J., Jacobs, W., Brilley, E., and Felder, C. C. (1996) Identification and molecular characterization of a m5 muscarinic receptor in A2058 human melanoma cells. Coupling to inhibition of adenylyl cyclase and stimulation of phospholipase A2. J. Biol. Chem. 271, 17476-17484

55. Clapham, D. E. (1996) The G-protein nanomachine. Nature 379, 297-299

56. Ovchinnikov, Y. A., Abdulaeh, N. G., Feigina, M. Y., Artamonov, I. D., Zolotereve, A. S., Kostina, M. B., Bogachuk, A. S., Miroshnikov, A. I., Martinov, V. I., and Kudelin, A. B. (1982) The complete amino acid sequence of visual rhodopsin. Bioorg. Khim. 8, 1011-1014

57. Hargrave, P. A., McDowell, J. H., Curtis, D. R., Wang, J. K., Juszczak, E., Fong, S.-L., Rao, J. K. M., and Argos, P. (1983) The structure of bovine rhodopsin. Biophys. Struct. Mech. 9, 235-244

58. Hargrave, P. A., McDowell, J. H., Feldmann, R. J., Atkinson, P. H., Rao, J. K., and Argos, P. (1984) Rhodopsin's protein and carbohydrate structure: selected aspects. Vision Res. 24, 1487-1499 26

59. Nathans, J., and Hogness, D. S. (1984) Isolation and nucleotide sequence of the gene encoding human rhodopsin. Proc. Natl. Acad. Sci. U. S. A. 81,4851-4855

60. Nathans, J., Thomas, D., and Hogness, D. S. (1986) Molecular genetics of human color vision: the genes encoding blue, green, and red pigments. Science 232, 193-202

61. Dixon, R. A. F., Kobilka, B. K., Strader, D. J., Benovic, J. L., Doh lman, H. G., Friel le, T., Bolanowski, M. A., Bennett, C. D., Rands, E., Diehl, R. E., Mumford, R. A., Skater, E. E., Sigal, I. S., Caron, M. G., Lefkowitz, R. J., and Strader, C. D. (1986) Cloning of the gene and cDNA for mammalian 13­ adrenergic receptor and homology with rhodopsin. Nature 321, 75-79

62. Dohlman, H. G., Caron, M. G., and Lefkowitz, R. J. (1987) A family of receptors coupled to guanine nucleotide regulatory proteins. Biochemistry 26, 2657-2664

63. Probst, W. C., Snyder, L. A., Schuster, D. I., Brosius, J., and Sealfon, S. C. (1992) Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol. 11, 1-20

64. Olvieira, L., Paiva, A. C. M., and Vriend, G. (1993) A common motif in G- protein-coupled seven transmembrane helix receptors. J. Comp. Aid. Mol. Des. 7, 649-658

65. Kolakowski, L. F., Jr. (1994) GCRDb: a 0-protein-coupled receptor database. Receptors Channels 2,1-7

66. Kristiansen, K., Dahl, S. G., and Edvardsen, 0. (1996) A database of mutants and effects of site-directed mutagenesis experiments on G protein-coupled receptors. Protein-Struct. Funct. Genet. 26, 81-94

67. Schertler, G. F. X., and Hargrave, P. A. (1995) Projection structure of frog rhodopsin in two crystal forms. Proc. Natl. Acad. Sci. U. S. A. 92, 11578-11582

68. Baldwin, J. M. (1993) The probable arrangement of the helices in G protein- coupled receptors. EMBO J. 12, 1693-1703

69. Schertler, G. F. X., Villa, C., and Henderson, R. (1993) Projection structure of rhodopsin. Nature 362, 770-772

70. Zhou, W., Flanagan, C., Ballesteros, J. A., Konvicka, K., Davidson, J. S., Weinstein, H., Millar, R. P., and Sealfon, S. C. (1994) A reciprocal mutation supports helix 2 and helix 7 proximity in the gonadotropin-releasing hormone receptor. Mol. Pharmacol. 45, 165-170

71. Sealfon, S. C., Chi, L., Ebersole, B. J., Rodic, V., Zhang, D., Ballesteros, J. A., and Weinstein, H. (1995) Related contribution of specific helix 2 and 7 residues 27

to conformational activation of the serotonin 5 -HT2A receptor. J. Biol. Chem. 270, 16683-16688

72. van Koppen, C. J., and Nathanson, N. M. (1990) Site-directed mutagenesis of the m2 muscarinic acetylcholine receptor. Analysis of the role of N-glycosylation in receptor expression and function. J. Biol. Chem. 265, 20887-20892

73. Curtis, C. A. M., Wheatley, M., Bansal, S., Birdsall, N. J. M., Eveleigh, P., Pedder, E. K., Poyner, D., and Hulme, E. C. (1989) Propylbenzilylcholine mustard labels an acidic residue in transmembrane helix 3 of the muscarinic receptor. J. Biol. Chem. 264, 489-495

74. Savarese, T. M., Wang, C.-D., and Fraser, C. M. (1992) Site-directed mutagenesis of the rat m1 muscarinic acetylcholine receptor. Role of conserved cysteines in receptor function. J. Biol. Chem. 267, 11439-11448

75. Haga, K., Kameyama, K., and Haga, T. (1994) Synergistic activation of a G protein-coupled receptor kinase by G protein Dy subunits and mastoparan or related peptides. J. Biol. Chem. 269, 12594-12599

76. Kwatra, M. M., Benovic, J. L., Caron, M. G., Lefkowitz, R. J., and Hosey, M. M. (1989) Phosphorylation of chick heart muscarinic cholinergic receptors by the 13-adrenergic receptor kinase. Biochemistry 28, 4543-4547

77. Lameh, J., Philip, M., Sharma, Y. K., Moro, 0., Ramachandran, J., and Sadee, W. (1992) Hml muscarinic cholinergic receptor internalization requires a domain in the third cytoplasmic loop. J. Biol. Chem. 267, 13406-13412

78. Haga, K., Uchiyama, H., Haga, T., Ichiyama, A., Kangawa, K., and Matsuo, H. (1989) Cerebral muscarinic acetylcholine receptors interact with three kinds of GTP-binding proteins in a reconstitution system of purified components. MoL Pharmacol. 35, 286-294

79. Haga, K., Haga, T., and Ichiyama, A. (1990) Phosphorylation by protein kinase C of the muscarinic acetylcholine receptor. J. Neurochem. 54, 1639-1644

80. Haga, T., Haga, K., Kameyama, K., and Nakata, H. (1993) Phosphorylation of muscarinic receptors: regulation by G proteins. Life Sci. 52, 421-428

81. Haga, K., Kameyama, K., Haga, T., Kikkawa, U., Shiozaki, K., and Uchiyama, H. (1996) Phosphorylation of human ml muscarinic acetylcholine receptors by G protein-coupled receptor kinase 2 and protein kinase C. J. Biol. Chem. 271, 2776-2782

82. Rosenbaum, L. C., Malencik, D. A., Anderson, S. R., Tota, M. R., and Schimerlik, M. I. (1987) Phosphorylation of the porcine atrial muscarinic acetylcholine receptor by cyclic AMP dependent protein kinase. Biochemistry 26, 8183-8188 28

83. Hayashi, M. K., and Haga, T. (1997) Palmitoylation of muscarinic acetylcholine receptor m2 subtypes: reduction in their ability to activate G proteins by mutation of a putative palmitoylation site, cysteine 457, in the carboxyl-terminal tail. Arch. Biochem. Biophys. 340, 376-382

84. Watson, A. J., Aragay, A. M., Slepak, V. Z., and Simon, M. I. (1996) A novel form of the G protein [3 subunit GI35 is specifically expressed in the vertebrate retina. J. Biol. Chem. 271, 28154-28160

85. Ray, K., Kunsch, C., Bonner, L. M., and Robishaw, J. D. (1995) Isolation of cDNA clones encoding eight different human G protein y subunits, including three novel forms designated the 14, subunits. J. Biol. Chem. 270, 110, andil1 21765-21771

86. Taussig, R., and Gilman, A. G. (1995) Mammalian membrane-bound adenylyl cyclases. J. Biol. Chem. 270, 1-4

87. Houslay, M., and Milligan, G. (1997) Tailoring cAMP-signalling responses through isoform multiplicity. Trends Biochem. Sci. 22, 217-224

88. Taussig, R., Iiiiguez-Lluhi, J. A., and Gilman, A. G. (1993) Inhibition of adenylyl cyclase by Gi a. Science 261, 218-221

89. Taussig, R., Tang, W. J., Hepler, J. R., and Gilman, A. G. (1994) Distinct patterns of bidirectional regulation of mammalian adenylyl cyclases. J. Biol. Chem. 269, 6093-6100

90. Smigel, M. D. (1986) Purification of the catalyst of adenylate cyclase. J. Biol. Chem. 261, 1976-1982

91. Tang, W.-J., and Gilman, A. G. (1991) Type-specific regulation of adenylyl cyclase by G protein fry subunits. Science 254, 1500-1503

92. Gao, B. N., and Gilman, A. G. (1991) Cloning and expression of a widely distributed (type IV) adenylyl cyclase. Proc. Natl. Acad. Sci. U. S. A. 88, 10178­ 10182

93. Taylor, S. J., Smith, J. A., and Exton, J. H. (1990) Purification from bovine liver membranes of a guanine nucleotide-dependent activator of phosphoinositide­ specific phospholipase C. Immunologic identification as a novel G-protein alpha subunit. J. Biol. Chem. 265, 17150-17156

94. Taylor, S. J., and Exton, J. H. (1991) Two a subunits of the Gq class of G proteins stimulate phosphoinositide phospholipase C-131 activity. FEBS Lett. 286, 214-216 29

95. Smrcka, A. V., Hepler, J. R., Brown, K. 0., and Stemweis, P. C. (1991) Regulation of polyphosphoinositide-specific phospholipase C activity by purified G9. Science 251, 804-807

96. Smrcka, A. V., and Sternweis, P. C. (1993) Regulation of purified subtypes of phosphatidylinositol-specific phospholipase cp by G protein a and 137 subunits. J. Biol. Chem. 268, 9667-9674

97. Jiang, H., Wu, D., and Simon, M. I. (1994) Activation of phospholipase C 134 by heterotrimeric GTP-binding proteins. J. Biol. Chem. 269, 7593-7596

98. Camps, M., Hou, C., Sidiropoulos, D., Stock, J. B., Jakobs, K. H., and Gierschik, P. (1992) Stimulation of phospholipase C by guanine-nucleotide­ binding protein 13y subunits. Eur. J. Biochem. 206, 821-831

99. Camps, M., Carozzi, A., Schnabel, P., Scheer, A., Parker, P. J., and Gierschik, P. (1992) Isozyme-selective stimulation of phospholipase C-132 by G protein 13y subunits. Nature 360, 684-686

100. Blank, J. L., Brattain, K. A., and Exton, J. H. (1992) Activation of cytosolic phosphoinositide phospholipase C by G-protein (3y subunits. J. Biol. Chem. 267, 23069-23075

101. Katz, A., Wu, D., and Simon, M. I. (1992) Subunits 13y of heterotrimeric G protein activate 132 isoform of phospholipase C. Nature 360, 686-689

102. Park, D., Jhon, D.-Y., Lee, C.-W., Lee, K.-H., and Rhee, S. G. (1993) Activation of phospholipase C isozymes by G protein 13-y subunits. J. Biol. Chem. 268, 4573-4576

103. Exton, J. H. (1996) Regulation of phosphoinositide phospholipases by hormones, neurotransmitters, and other agonists linked to G proteins. Annu. Rev. Pharmacol. Toxicol. 36, 481-509

104. Exton, J. H. (1997) Cell signalling through guanine-nucleotide-binding regulatory proteins (G proteins) and phospholipases. Eur. J. Biochem. 243, 10­ 20

105. Logothetis, D. E., Kurachi, Y., Galper, J., Neer, E. J., and Clapham, D. E. (1987) The subunits of GTP-binding proteins activate the muscarinic K± channel in heart. Nature 325, 321-326

106. Wickman, K. D., Ifiiguez-Lluhl, J. A., Davenport, P. A., Taussig, R., Krapivinsky, G. B., Linder, M. E., Gilman, A. G., and Clapham, D. E. (1994) Recombinant G-protein (3y-subunits activate the muscarinic-gated atrial potassium channel. Nature 368, 255-257

107. Reuveny, E., Slesinger, P. A., Inglese, J., Morales, J. M., Iiiiguez-Lluhi, J. A., Lefkowitz, R. J., Bourne, H. R., Jan, Y. N., and Jan, L. Y. (1994) Activation of 30

the cloned muscarinic potassium channel by G protein fry subunits. Nature 370, 143-146

108. Huang, C.-L., Slesinger, P. A., Casey, P. J., Jan, Y. N., and Jan, L. Y. (1995) Evidence that direct binding of G137 to the GIRK1 G protein-gated inwardly rectifying K+ channel is important for channel activation. Neuron 15, 1133-1143

109. Velimirovic, B. M., Gordon, E. A., Lim, N. F., Navarro, B., and Clapham, D. E. (1996) The K+ channel inward rectifier subunits form a channel similar to neuronal G protein-gated K+ channel. FEBS Lett. 379, 31-37

110. Schreibmayer, W., Dessauer, C. W., Vorobiov, D., Gilman, A. G., Lester, H. A., Davidson, N., and Dascal, N. (1996) Inhibition of an inwardly rectifying K+ channel by G-protein a-subunits. Nature 380, 624-627

111. Ikeda, S. R. (1996) Voltage-dependent modulation of N-type calcium channels by G-protein fry subunits. Nature 380, 255-258

112. Herlitze, S., Garcia, D. E., Mackie, K., Hine, B., Scheuer, T., and Catterall, W. A. (1996) Modulation of Ca2+ channels by G-protein fry subunits. Nature 380, 258-262

113. Zamponi, G. W., Bourinet, E., Nelson, D., Nargeot, J., and Snutch, T. P. (1997) Crosstalk between G proteins and protein kinase C mediated by the calcium channel a subunit. Nature 385, 442-446 1

114. De Waard, M., Liu, H., Walker, D., Scott, V. E. S., Gurnett, C. A., and Campbell, K. P. (1997) Direct binding of G-protein fry complex to voltage- dependent calcium channels. Nature 385, 446-450

115. Haga, K., and Haga, T. (1990) Dual regulation by G proteins of agonist- dependent phosphorylation of muscarinic acetylcholine receptors. FEBS Lett. 268, 43-47

116. Haga, K., and Haga, T. (1992) Activation by G protein fry subunits of agonist- or light-dependent phosphorylation of muscarinic acetylcholine receptors and rhodopsin. J. Biol. Chem. 267, 2222-2227

117. Pitcher, J. A., Inglese, J., Higgins, J. B., Arriza, J. L., Casey, P. J., Kim, C., Benovic, J. L., Kwatra, M. M., Caron, M. G., and Lefkowitz, R. J. (1992) Role of fry subunits of G proteins in targeting the P-adrenergic receptor kinase to membrane-bound receptors. Science 257, 1264-1267

118. Bohm, S. K., Grady, E. F., and Bunnett, N. W. (1997) Regulatory mechanism that modulate signalling by G-protein-coupled receptors. Biochem. J. 322, 1-18

119. Hepler, J. R., and Gilman, A. G. (1992) G proteins. Trends Biochem. Sci. 17, 383-387 31

120. Kameyama, K., Haga, K., Haga, T., Kontani, K., Katada, T., and Fukada, Y. (1993) Activation by G protein 137 subunits of P-adrenergic and muscarinic receptor kinase. J. Biol. Chem. 268, 7753-7758

121. Daaka, Y., Pitcher, J. A., Richardson, M., Stoffel, R. H., Robishaw, J. D., and Lefkowitz, R. J. (1997) Receptor and Gi3T isoform-specific interactions with G protein- coupled receptor kinases. Proc. Natl. Acad. Sci. U. S. A. 94, 2180-2185

122. Chuang, T. T., Paolucci, L., and De Blasi, A. (1996) Inhibition of G protein- coupled receptor kinase subtypes by Ca2+/calmodulin. J. Biol. Chem. 271, 28691-28696

123. Haga, K., Tsuga, H., and Haga, T. (1997) Ca2+-dependent inhibition of G protein-coupled receptor kinase 2 by calmodulin. Biochemistry 36, 1315-1321

124. Chuang, T. T., Le Vine, H., III, and De Blasi, A. (1995) Phosphorylation and activation of 13-adrenergic receptor kinase by protein kinase C. J. Biol. Chem. 270, 18660-18665

125. Rodbell, M. (1980) The role of hormone receptors and GTP-regulatory proteins in membrane transduction. Nature 284, 17-22

126. De Lean, A., Stadel, J. M., and Lefkowitz, R. J. (1980) A ternary complex model explains the agonist-specific binding properties of the adenylate cyclase coupled 0-adrenergic receptor. J. Biol. Chem. 255, 7108-7117 32 Chapter 21

Porcine m2 Muscarinic Acetylcholine Receptor-Effector Coupling in Chinese Hamster Ovary Cells2

Abstract

The relationship between porcine m2 muscarinic receptor coupling to inhibition of cAMP formation and stimulation of phosphatidylinositol metabolism in Chinese hamster ovary cells was examined. Reduction of the number of receptors per cell with the slowly dissociating antagonist ()-quinuclidinyl benzilate caused a decrease in maximal response with no effect on EC50 for coupling to phosphatidylinositol metabolism. Inhibition of cAMP formation showed the opposite dependence with no effect on maximal response but an increase in EC50 value as receptor density decreased.

Pilocarpine appeared to be a partial agonist at low cell receptor density but displayed full agonism at higher receptor density. These results are compatible with a two-state model describing m2 muscarinic receptor acting via two different G proteins. This model is compatible with observations of negative antagonism where antagonists stimulated cAMP formation in adenylyl cyclase inhibition assays, and can also be used to estimate receptor affinities for G proteins in systems which display negative antagonism.

1This chapter was originally published in the Journal of Biological Chemistry 270, 15485-15493, © 1995 by The American Society for Biochemistry and Molecular Biology, Inc., and is reprinted with permission.

2This work was supported by the National Institutes of Health Grants HL23632 and ES00210. 33 Introduction

mAcChRs3 belong to the family of G protein-coupled hormone receptors. The genes coding for five different mAcChR subtypes (ml to m5) have been cloned and expressed (1-3). The even-numbered subtypes couple preferentially to inhibition of cAMP formation and the odd-numbered subtypes to stimulation of phospholipid metabolism (4). The m2 subtype also couples to activation of inwardly-rectifying potas­ sium channels in the heart (4). When cloned genes for mAcChR subtypes are expressed in cell lines not normally containing mAcChRs the nature of receptor-effector coupling becomes unclear, presumably depending on the complement of G proteins and effector systems in the cell line and the level of expression of the exogenous receptor (5-8).

The interpretation of the agonist binding properties of mAcChRs has been challenging because data often did not conform to accepted models. Muscarinic agonists appear to displace radiolabeled antagonists over 5-8 orders of magnitude in concentration and a careful analysis of the ligand binding properties of m2 receptors in hamster heart homogenates suggested that the ternary complex model was not compatible with experimental observations (9).

13-adrenergic receptor coupling to Gs has been analyzed using the ternary complex model (10) initially proposed by Rodbell (11) and a mobile receptor model proposed by Whaley et al. (12). The ternary complex model was extended to describe negative antagonism (13), inverse agonist activity (14), and a constitutively active 13­ adrenergic receptor mutant (15). It was also used to explain coupling of m2 mAcChR to inhibition of cAMP formation in rabbit myocardium (16).

3The abbreviations used are: mAcChR, muscarinic acetylcholine receptor; CHO, Chinese hamster ovary; G protein, guanine nucleotide-binding protein; NMS, S- ( )- N- methylscopolamine; PI, phosphatidylinositol; PTX, pertussis toxin; QNB, benzilate; Gpp(NH)p, guanyl­ imidodiphosphate; GDP13S, Guanosine-5'-0-(2-thiodiphosphate); KL, KM, and KH, the low, medium, and high affinity dissociation constants, respectively. 34

Because the pm2 mAcChR subtype expressed in CHO cells couples to inhibition of cAMP formation and stimulation of hormone-sensitive phospholipase C, it provided an attractive system to study the relationship between receptor-effector coupling and agonist binding properties. The results of this study suggest that although the manner in which the EC50 and maximum response for the two effector systems depends on receptor density is different, both results are compatible with a two-state model that allows for a stronger affinity of the receptor-agonist complex for the G protein that mediates cAMP inhibition than the G protein that couples to PI stimulation. The model also accounts for partial agonism and negative antagonism. Allowing for a receptor state that is not physiologically competent gave agreement between ligand binding results and physiological assays.

For more than 30 years similar results were explained in terms of spare receptors or receptor reserves and spare mediators or G protein reserves (17-19). These explanations were useful in rationalizing the link between receptor occupancy and physiological response but lacked a clearly defined mechanistic interpretation. The model presented here expands spare receptor theory to quantitatively account for the role of G protein mediators in receptoreffector coupling.

Experimental Procedures

Stably transfected CHO cells overexpressing pm2 mAcChR (2), mAcChR­ enriched membrane preparations (20)4, and ligand binding procedures (21) were previously described.

4G. L. Peterson, A. Toumadje, W. C. Johnson, Jr., and M. I. Schimerlik, submitted for publication. 35

Materials

Radioisotopes were purchased from DuPont-NEN, pertussis toxin and cholera toxin from List Biological Laboratories, G protein antagonist-2 (Lot P1746) and Ro 20­ 1724 from Biomol Research Labs, and EGTA-AM from Molecular Probes. Polyclonal antibody against Gai1 /i2 and the calcium ionophore A23187 were obtained from

Calbiochem. Polyclonal antibodies to the G protein a subunits of Gol (Z811), G13

(B860), Gz (X264), and GOB (B597) were the kind gift of Paul Sternweis.

Effector Coupling

PI stimulation was determined in CHO cells expressing pm2 mAcChR plated at

2 x 105 per 35-mm plate and incubated in 1 tCi/ml [3H]myo-inositol at 37 °C for 48 h.

Ligands were added and inositol 1-phosphate accumulation was measured after 30 min at 37 °C as described by Lee et al. (22). cAMP production in fresh membrane preparations was determined by monitoring the conversion of [32P]ATP to [32P]cAMP at 30 °C for 15 min following the addition of 10 tM forskolin according to the method of Johnson and Salomon (23). Adenylyl cyclase activity was determined in attached cells in the presence of 10011M isobutylmethylxanthine and 50 p,M Ro 20-1724 after exposing the cells to 8 liCihnl [3H]adenine for 2-3 h. The 20 min assay at 37 °C was started by the addition of 40 p.M forskolin. Some assays used cholera toxin (500 ng/ml for 2 h) in place of forskolin; these resulted in identical EC50 values but the maximal response was less. [3H]cAMP was determined according to the method of Salomon

(24).

To examine receptoreffector coupling as a function of receptor number, attempts were made to isolate cell lines stably expressing pm2 mAcChRs at varying levels. These were unsuccessful, as were attempts to reduce receptor number with the alkylating agent benzilylcholine mustard, which removed only 80-90% of the total

[3H]NMS binding sites from cell lines containing 1-2 x 106 receptors/cell. An alternative 36 approach using the slowly dissociating antagonist QNB was adopted. Varying amounts of QNB were added and after 1 h at 37 °C the plates were rinsed twice with media to remove free QNB. Functional assays were then initiated and [3H]NMS binding sites determined in a parallel experiment. Receptors and G proteins exist in a two-dimensional environment while ligands are in three-dimensional solution. In order to assess the data in the proper dimensional context, receptor and G protein concentrations and receptorG protein dissociation constants are given as two-dimensional parameters. The two- dimensional receptor concentration was calculated by dividing the receptors expressed on the cell surface by the estimated cell surface area (10-7 dm2).

Data Analysis

Functional assays were fit to Equation 1, where [x] is the agonist concentration, maxi,2 are the maxima of the inhibitory and stimulatory portions of the curve, min is the minimum of the curve, and p1,2 are the respective slope factors. For adenylyl cyclase assays that showed only an inhibitory phase the first two terms were used and for assays of PI stimulation the first and last terms were used.

max min max 2 min CPM = min + 131 [x] 1±((EC50s) P2 [x] (EC50i) (Eq. 2.1)

Ligand binding data were analyzed by nonlinear regression to a hyperbolic binding equation for [3H]NMS and [3H]QNB or by competition with either radiolabeled antagonist. Agonist binding data were fit assuming three noninteracting classes of agonist sites that bound antagonist with the same dissociation constant. Under these assumptions the total labeled antagonist specifically bound, [RI,], is the sum of that bound at each subclass of agonist binding sites: 37

[RoiX[L,0] [NM [Ril = L i=1 K + [A]+[L01[RL] (Eq. 2.2)

[Roi] equals the total concentration of receptor site i; [L0], the total labeled antagonist concentration; [A], the total agonist concentration (equal to the free concentration since no displacement occurs until [A] > X[Roi] ); K, the dissociation constant for radiolabeled antagonist and Ki the dissociation constant for the agonist at site i (referred to as Kw KM, and KL, the high, medium, and low affinity constants)5.

A simpler model of two noninteracting classes of sites gave inadequate fits to most of our agonist binding data. In our analysis K and [Lo] are supplied from independent determinations and held constant. Values for F,, the fraction of each class of site, were calculated from the fitted parameters R0 . Some agonist binding data were fit to a two-state model (11), often referred to as the ternary complex model, that was expanded to account for a class of receptors that are incapable of interacting with G proteins. This model is presented in Scheme 2.1, where R is the receptor state capable of associating with G protein and R' is not. M is the dissociation constant of the RG complex (equal to K1 in the Appendix to this Chapter), KM and KL have the same meaning as above, and a is a dimensionless parameter relating M and KM to the other two binding constants in this closed thermodynamic cycle. Data fitting to this model required an iterative numerical method to calculate the bound labeled antagonist (LR +

LRG + LR'). The parameters in Equations 2.1 and 2.2 and the model in Scheme 2.1 were estimated by nonlinear least-squares procedures using Marquardt's algorithm (25) and are reported as the mean and standard deviation of several determinations.

5Expanded solutions of these equations appear in the Appendix to this dissertation. 38 A K LRG cm RG yot ARG L G M G)H G Im/oc A LR R AR Km L A K AR' LR' ""glIC"' KL L

Scheme 2.1

Results

Muscarinic agonists decreased cAMP levels at low agonist concentrations. A stimulatory phase at high agonist concentrations was observed in cells overexpressing receptor (Figure 2.1A) and in membrane preparations from those cells (Figure 2.1C).

The agonist-induced stimulation of cAMP production was prevented by the addition of

10 I_tM ()-hyoscyamine, a muscarinic antagonist. The effect was not seen in cells expressing less than 1 x 105 sites/cell or in membrane preparations with less than 10 pmol [3H]NMS sites/mg protein. Unlike the inhibitory phase, the magnitude of the stimulatory phase was strongly dependent on pm2 mAcChR expression levels. Similar to the effect of receptor number on the EC50 for the inhibitory phase, decreasing receptor site density increased the EC50for stimulation. The stimulation of cAMP formation was mediated by G proteins since it was eliminated in membrane preparations in the presence of GDPOS (Figure 2.1C). 39

Figure 2.1. Coupling of the pm2 mAcChR to effectors in CHO cells and membranes. The cells were expressing mAcChR at levels approximately 10-fold greater than porcine atrial tissue (20), while the enriched membranes were approximately 60-fold greater. The data were analyzed according to Equation 2.1 and parameter values for the fitted lines are shown ± asymptotic standard errors. The values in parentheses are the % inhibition = 100 x (1 min/maxi) when following the EC50i value, the % stimulation = 100 x ( (max2 min)I(maxi min)) when following the EC50s. value, or fold stimulation when following the EC50 for PI stimulation. A, Inhibition and stimulation of cAMP accumulation in CHO cells at different receptor site densities: , 1.8 x 106 [3H]NMS sites/cell (3.9 x 10-11 moldm-2), EC50i = 26.3 ± 3.0 nM (65.8 ± 1.6%), EC50s = 6.96 ± 0.62 .1.M (234 ± 12%); 0 , 9.4 x105 sites/cell (2 x 10-11 moldm-2), EC50i = 69.3 ± 5.5 nM (71.4 ± 1.3%), EC50,s. = 18.1 ± 1.9 1.IM (118 ± 4%); (X) 3.6 x 105 sites/cell (7.7 x 10-12 moldm-2), EC50i = 225 ± 18 nM (66.3 ± 1.2%), EC50s = 117 ± 33 tM (37.3 ± 2.0%); , 1.3 x 105 sites/cell (5.5 x 10­ 12 mdm-2), EC50i = 753 ± 53 nM (65.7 ± 0.6%). Data were fit with slope factors pl and p2 = 1. B, Stimulation of PI metabolism in CHO cells at different receptor site densities: , 1.8 x 106 sites/cell (3.6 x 10-11 moldm-2), ECK). 0.61 ± 0.31 µM (2.22-fold); 0, 1.6 x 106 sites/cell (3.2 x 10-11 moldm-2), EC50= 0.90 ± 0.31 plvl (2.26-fold); X, 7.6 x 105 sites/cell (1.5 x 10-11 moldm-2), ECK, = 1.2 ± 0.7 tM (1.82-fold); , 1.9 x 105 sites/cell (3.8 x 10-12 moldm-2), EC50= 1.2 ± 0.8 i_tM (1.82-fold); IN, 1.0 x 105 sites/cell (2 x 10-12 moldm-2), EC50= 0.91 ± 0.27 tM (1.58-fold). Data were fit with slope factor p2 = 0.6. C, Inhibition and stimulation of cAMP accumulation in membranes prepared from CHO cells. In membranes expressing 257 pmol sites/mg protein the fitted parameter were: EC50i = 0.138 ± 0.07311M (50.8 ± 6.0%), pl = 0.5 (fixed), EC50s = 52.9 ± 7.0 tiM (194 ± 14%), p2 = 0.864 ± 0.009 with 10 !_tM GTP in the assay, and EC50i = 1.79 ± 0.18 µM (60.9 ± 0.6%), pl = 0.675 ± 0.038 with 50 i_tM GDP13S. D, The effect of antagonist on cAMP accumulation measured in whole cells. The parameters were: QNB, EC50i = 3.5 ± 0.7 nM, p2 = 1.5 (fixed); NMS, EC50i = 5.2 ± 0.9 nM, p2 = 1.6 ± 0.3; and hyoscyamine, EC50i = 7.8 ± 1.2 nM, p2 = 1.3 ± 0.2. The receptor site density was 1.4 x 106 sites/cells (4.7 x 10-11 moldm-2). 40

1.8

1.6

1.4

1.2

1.0

0.8

0.6

0.4 10 9 8 7 6 5 4 3 log [carbachol] (M)

700

600

ai E 500

400

300

9 8 7 6 5 4 3 2 log [carbachol] (M)

Figure 2.1 41

o b 0.20

0.18

0.16

0.14

0.12

0.10 10 AIM GTP 0 50 pM GDP13S 0.08

11 10 9 8 7 6 5 4 3 2 log [carbachol] (M)

D 0 X x 1.6 x

1.4

1.2 O QNB NMS x hyoscyamine 1.0 I I I I I I L 12 10 9 8 7 6 5 4 log [antagonist] (M)

Figure 2.1, continued 42

The inhibition and stimulation of adenylyl cyclase in CHO cells were most easily seen when the cyclase was stimulated with forskolin or cholera toxin. In the absence of these exogenous stimulators inhibition and stimulation were evident but near the limit of sensitivity of our assay (data not shown). If the stimulatory phase was the direct result of strong Gs activation then a large increase in cAMP in the absence of forskolin or cholera toxin should have been observed similar to the effect seen in CHO cells expressing the

P-adrenergic receptor (26). Treating the CHO cells with 100 ng/ml pertussis toxin, which ADP-ribosylates and inactivates Gi and Go, for 12 h prior to assay eliminated the

Gi-mediated inhibition while not affecting the stimulatory phase. Antibody preparations were unable to block the stimulatory phase: anti-ai raised to the common carboxyl-terminal decapeptide of Giat and Gica (27); anti-ococ, raised to the common carboxyl-terminal 12 amino acid peptide of aq and an; anti-az, -a13, and -a0B , raised to carboxyl-terminal 17, 16, and 15 amino acid peptides, respectively, of their corresponding a subunits (28). G protein antagonist-2 (29), a peptide capable of competing with receptors for Gi, Go, and Gs was also unable to affect the stimulation of adenylyl cyclase at concentrations up to 10011M.

Since intracellular Ca2+ released due to pm2 mAcChR-mediated activation of PI turnover stimulates Type I and III adenylyl cyclases, the effect of the Ca2+ ionophore

A23187 (30) and the Ca2+ chelator EGTA-AM (31) on pm2 mAcChR-mediated cAMP accumulation was examined. The cAMP level was elevated less than 15% in the presence of 10 µM A23187 and extracellular [Call equal to 300 µM, conditions that produced the maximum effect. Extracellular [Ca24-] in excess of 1 mM reduced cAMP accumulation. EGTA-AM at 90 [IM had no effect on cAMP levels in the presence of the phosphodiesterase inhibitor isobutylmethylxanthine (100 liM).

The stimulatory effect seen in CHO cells expressing the pm2 mAcChR was also seen in CHO cells expressing the hml mAcChR subtype and in membrane preparations 43 from those cells. Pertussis toxin did not affect cAMP stimulation in hm 1 expressing CHO cells and the EC50 for stimulation with carbachol (4.6 ± 1.4 jiM, 1 x 106

[3H]NMS sites/cell) occurred at similar EC50 for PI stimulation in those cells (3.3 ± 1.8

[tM). Our results are similar to those reported by Peralta et al. (32) for human ml mAcChR expressed in a cloned human kidney cell line. Additional evidence that the stimulatory effect did not involve a G protein primarily coupled to PI turnover came from experiments on a site directed mutant (D69N) which coupled to the inhibition of cAMP accumulation when oxotremorine M was the agonist and to stimulation of cAMP accumulation when acetylcholine was the agonist while not coupling to PI turnover at al1.6 The stimulation was not a result of an agonist-dependent inhibition of a cAMP­ specific phosphodiesterase. Control experiments in membranes conducted in the presence of [3H]cAMP showed no change in [311]cAMP while [32P]cAMP production first decreased and then increased with increasing carbachol.

The relationship between receptor site density and coupling to physiological effectors is presented in Figures 2.1A and 2.1B. Figures 2.2-2.5 show the relationship between EC50, maximal effect, and receptor density. Over the receptor levels examined, the maximal percent inhibition of cAMP formation (Figures 2.1A and 2.2) was unaffected by receptor density for the full agonists acetylcholine, oxotremorine M, and carbachol. The partial agonist pilocarpine gave the same maximal inhibitory cAMP response at receptor densities greater than 2 x 10-11 moldm-2 and a significantly lower response at receptor densities less than 5 x 10-12 moldm-2. The EC50i values for the four agonists were dependent on the receptor density, decreasing as receptor density increased. Data were analyzed as plots of EC50i versus 1/[R0] (Figure 2.3) according to the model in Scheme 2.2. Initial slopes were taken to equal Equation 2.A13. Antagonists

6W. K. Vogel and M. I. Schimerlik, unpublished observation. 44

Figure 2.2. The effect of pm2 mAcChR on the maximal inhibition of forskolin­ stimulated cAMP formation in whole cells. Data are from Figure 2.1A and other experiments. Average values (line plotted over the range averaged) were 80.0 ± 3.6%, 65.4 ± 5.1%, 76.2 ± 2.5%, and 62 ± 11% for acetylcholine (AcCh), carbachol (Garb), oxotremorine M (Oxo M), and pilocarpine (Pilo), respectively.

Figure 2.3. The effect of pm2 mAcChR on the EC50 for cAMP inhibition in whole cells. Data are from Figure 2.1A and other experiments. The data near the origin were fit to a linear function resulting in slope values of 2.3 ± 0.3 x 10-19 mo12dm-5, 5.4 ± 2.5 x 10-19 mo12dm-5, 4 ± 6 x 10-20 mo12dm-5, and 7.6 ± 0.7 x 10-17 mo12dm-5, and intercept values of 8 ± 16 x 10-10 M, 2 + 1 x 10-8 M, 7 ± 3 x 10-9 M, and 5 ± 97 x 10-8 M for acetylcholine (AcCh), carbachol (Garb), oxotremorine M (Oxo M), and pilocarpine (Pilo), respectively.

Figure 2.4. The effect of pm2 mAcChR on fold maximal response for PI stimulation in whole cells. Data are from Figure 2.1B and other experiments. The lines in the plot are to show the trend in the data and were not interpreted mechanistically. AcCh, acetylcholine; Garb, carbachol; Oxo M, oxotremorine M; Pilo, pilocarpine.

Figure 2.5. The effect of pm2 mAcChR on the EC50 for PI stimulation in whole cells assays. Data are from Figure 2.1B and other experiments. Average values were 0.4 ± 0.2 [tM, 1.2 ± 0.51.tM, 1.0± 0.5 µM, and 10 ± 41.IM for acetylcholine (AcCh), carbachol (Garb), oxotremorine M (Oxo M), and pilocarpine (Pilo), respectively. 45

100 I I I 80

60

40 20 AcCh

0 100

80 44 .. 60 40 Carb 20

10 1 0

8 )­

6 ) ­

4 ) ­ 2 ) - Oxo M

) 100

_ 80

60

--, 40 ii Pilo 20

I I I 0 0 20 40 60 0

[R0] (pmol dm 2)

Figure 2.2 46

I I 80 AcCh

SC 60 40

20

0 50 100 150 200 250 300 4 I- Oxo M 200 C 0 OP Ct.)r) Lu 100

0-raft0 1­ 0 50 100 150 200 250

soo - Carb S 400

(S9w 200

0 50 100 150 200 250

I I I I I I 20 Pilo 2^ 15 _

s 10

Lar 5

0 I I 0 50 100 150 200 250 Figure 2.3 [1/R0] (nmori dm2) 47

4.0 I I I 3.5 3.0 AcCh 2.5 2.0 1.5 1.0 _ 4.0 3.5 - 3.0 Carb - 2.5 2.0 _ 1.5

4.0 1.0 3.5 3.0 Oxo M 2.5 2.0 1.5 -do 1.0 4.0 3.5 - 3.0 Pilo _ 2.5 2.0 1.5

I I 1.0 0 10 20 30 40 [Ro] (pmol dm2)

Figure 2.4 48

1.0 I I I 0.8 AcCh 0.6 dos 0.4 _

0.2 _

0.0 5

4 Carb 3

_ 2

I

3.0 . 0 2.5 _ oxo m 2.0 - 1.5 _ 1.0 - O. 0.5 _ 0.0 30 25 Pilo 20

15

_ 10 5

I I I 0 0 10 20 30 40 [Rol (pmol dm-2)

Figure 2.5 49 stimulated cAMP accumulation above basal level with EC50 values that were greater than their dissociation constants. The dissociation constants determined in cells were 13.7 ± 2.4 pM (n = 4) for QNB and 239 ± 37 pM (n = 11) for NMS (hyoscyamine was not determined). The effect of antagonists on basal PI turnover could not be reliably assessed because of base line variability.

Coupling of pm2 mAcChRs to PI stimulation in CHO cells behaved in a different manner than coupling to inhibition of cAMP formation. Fold maximum stimulation appeared to increase with increasing receptor density (Figure 2.4). The EC50 values did not depend on receptor concentration for PI stimulation for all four agonists (Figure 2.5).

Ligand binding data for agonists were also analyzed for isolated cell lines expressing pm2 mAcChRs at three different levels; results are shown for carbachol

(Figure 2.6), where data were analyzed according to Equation 2.2 in the presence or absence of Gpp(NH)p. The values of the dissociation constants for the three classes of sites were relatively constant for all expression levels; however the value of F1, the fraction of high affinity sites, decreased from 56% at the lowest specific activity to 9% at the highest level of expression. The class of sites having intermediate affinity for carbachol, F2, increased from 24 to 68% as expression levels increased, while the lowest affinity site, F3, remained constant at about 20% of the total [311]NMS sites. Addition of

Gpp(NH)p resulted in a loss of the high affinity sites and an equivalent increase in the sites having intermediate affinity for carbachol. Oxotremorine M and acetylcholine also appeared to interact with three classes of sites while data for pilocarpine were best fit assuming only two classes of binding sites. The dissociation constants for agonists are summarized in Table 2.1. 50

Figure 2.6. [3H]NMS displacement by carbachol in CHO cell membranes expressing high, intermediate, and low levels of pm2 mAcChR. The top pair: 150 pmol/mg pm2 mAcChR ± 50 pM Gpp(NH)p, FH = 9 ± 1%, FM = 68 ± 1%, FL = 23 ± 1%, in the absence of Gpp(NH)p, FH = 0, FM = 77 ± 1%, FL = 23 ± 1% in the presence of Gpp(NH)p; KH = 1.6 ± 1.2 nM, KM = 1.99 ± 0.10 p.M, KL = 27 ± 14M. The center pair: 38 pmol/mg pm2 mAcChR ± 50 pM Gpp(NH)p, FH = 27 ± 1%, FM = 52 ± 1%, FL = 21 ± 1%, in the absence of Gpp(NH)p, FH = 0, FM = 82 ± 1%, FL = 18 ± 1% in the presence of Gpp(NH)p; KH = 1.9 ± 0.5 nM, KM = 1.34 ± 0.08 gM, KL = 19.5 ± 0.9 The bottom pair: 5 pmol/mg pm2 mAcChR ± 100 pM Gpp(NH)p, Fri = 56 ± 2%, FM = 24 ± 2%, FL = 20 ± 3%, in the absence of Gpp(NH)p, FH = 0, FM = 81 ± 2%, FL = 19 ± 2% in the presence of Gpp(NH)p; KH = 17 ± 3 nM, KM = 1.0 ± 0.1 pM, KL = 31 ± 1 ILIM. In the presence of Gpp(NH)p no significant FH fraction was found and the data were fit to two independent classes of sites. The parameter values for the fitted lines are shown ± asymptotic standard errors. 51

100

80

60

40

20

7 6 5 4 log [carbachol] (M) Figure 2.6 52

Table 2.1. Agonist binding data for pm2 mAcChR expressed in CHO cell membranes

Agonist Kg (nM) n KM (1.1,M)a it KL (.tM) n acetylcholine 1.18 ± 0.34 4 0.30 ± 0.15 7 7.4 ± 5.4 6 oxotremorine M 1.6 ± 1.6 5 0.32 ± 0.23 7 9.9 ± 5.1 5 carbachol 3.3 ± 2.8 9 1.05 ± 0.37 19 20.2 ± 8.5 19 pilocarpine 252 ± 87 4 18.6 ± 8.7 4 _b aKM values determined in cells at 37 °C in culture media, while not strictly at equilibrium, are comparable: 0.26 ± 0.06 (n = 4), 0.51 ± 0.33 (n = 5), 2.5 ± 1.3 (n = 5), and 17.4 ± 9.0 pM (ft = 3) for acetylcholine, oxotremorine M, carbachol, and pilocarpine respectively. bThe partial agonist pilocarpine fits to two rather than three independent sites; of these two only the lower affinity KM is seen in the presence of Gpp(NH)p. Binding constants are reported as the mean and standard deviation of several determinations (n) .

Discussion

The coupling of mAcChRs to both stimulation of PI metabolism and inhibition of cAMP formation in CHO cells was examined during a previous study (5); however, the results presented here differ from the earlier results. The previous study found that the EC50 and the maximum percent inhibition for cAMP formation both appeared constant, while for the stimulation of PI metabolism the EC50 decreased and the maximal response increased with increasing receptor concentration. The reason for the differing results is not certain; however, the two studies used different approaches. In the previous study, responses were measured for an average number of receptors/cell during continuous amplification of pm2 mAcChR expression, while in this study clonal cell lines were used and receptor concentration reduced with antagonist. An alternative explanation is that the two CHO cell lines used simply had different properties. The previous results do not show a stimulatory phase in cAMP formation assays; a robust stimulatory phase is reported here under similar conditions. The possibility of differences in CHO cell lines is also supported by the observation that the CHO cell line 53 used for these studies contained Gaz 7 not found by Dell'Acqua et al. (33) in their CHO cell line.

Data suggest that the stimulation of cAMP formation seen at high agonist and receptor concentrations was mediated by the pm2 mAcChR and an unidentified G protein. The high agonist and receptor concentration requirement further suggests that the interaction is weak. Dittman et al. (34) examined mAcChR stimulation of cAMP formation in a well-defined system in which HEK 293 cells were transfected with the chick m4 mAcChR and calmodulin-sensitive type I and type III adenylyl cyclases. Their observations were similar to those reported here and because the adenylyl cyclase isoforms used were not stimulated by G protein fry subunits, they were able to attribute the stimulatory phase to direct receptor interactions with Gs. Since the adenylyl cyclase isoforms present in CHO cells are not yet known, it is not possible to resolve the question for this system. A direct stimulation via Gs, however, is not consistent with the model presented in the Appendix to this Chapter, which predicts EC50s values less than or equal to the highest agonist dissociation constant observed. A possible explanation for the stimulatory phase seen in CHO cells is that this stimulation was the result of a G protein fry subunit. The model in the Appendix to this Chapter must be extended to account for the stimulatory phase we observe in adenylyl cyclase assays.

A major goal of this research was to try to find a common general mechanism that could explain the differing dependence of PI stimulation and inhibition of cAMP formation on pm2 mAcChR density and to relate these results to agonist binding data from CHO cell membranes. Agonist binding data over all levels of receptor expression were not compatible with a simple two-state mechanism as shown previously by Wong et al. (9). Data could however be fit assuming either three noninteracting classes of sites

7J. Robishaw, unpublished results. 54 or an extended ternary complex model. In the three-site model the highest agonist affinity state is attributable to receptors complexed with G proteins and the intermediate affinity to free receptors. This assignment is based on the ability of Gpp(NH)p to quantitatively convert F1 to F2 in the agonist competition curves. The lowest affmity state is undefined molecularly but is not capable of interacting with G proteins. Possible explanations for this are differences in compartmentalization, posttranslational modification, or state of aggregation. Using the three-site model simplified data analysis since fitting routines converged satisfactorily, however, it lacked an underlying mechanistic basis. Therefore, fitting agonist binding data to an extended ternary complex model was explored. There were two disadvantages to this approach. First, the value for

[G0], the total amount of accessible G protein, was solved as a fitting parameter and could not be determined experimentally. Second, data fitting to the model often resulted in local minima, gave poorly determined values, or failed to converge. Comparison of the two approaches indicates that the fitted values for KL = [R] [A] l[AR1 and KM =

[R][A]l[AR] apply for both analyses. In the three-site model, KH = [RG][A]l[ARG] which equals KM /a in the extended ternary complex model. Thus the value for a from the extended ternary complex model equals Km/KH from the three-site fits. The ternary complex model fit also provides a value for M, the binding constant of G to R; however, this parameter is ambiguous since the local concentrations of R and G are unknown and exist in a two-dimensional, rather than three-dimensional system. Since there were few practical advantages of fitting to the ternary complex model binding data were routinely analyzed assuming three classes of noninteracting sites. The model presented in Scheme 2.2 describes pm2 mAcChRG protein interactions in terms of two states assuming that the lowest affinity receptor state is not physiologically competent. The assumptions of the derivation are that binding steps equilibrate rapidly and that the activated G protein (G) is in a steady state. Since the time 55

Scheme 2.2 courses of cAMP and inositol 1-phosphate formation are linear over the assay time periods, these assumptions would appear to be reasonable. Model simulations at two different receptor-G protein affinities are presented in Figure 2.7. The shape of the function depends on the G protein concentration relative to its affinity for the receptor, and the affinity of the G protein for the receptor relative to the affinity of the agonist for the receptor. Figure 2.7A illustrates conditions where the receptor affmity for G is 105 greater than receptor affinity for agonists while in Figure 2.7B the affinity is 10-fold greater. If experimental conditions allowed the determination of EC50, [G 'J., and

[G 1 over a 10-fold range of [Ro], then the model predicts that a G protein-coupled receptor eliciting multiple responses via different G proteins can exhibit different types of behavior depending on the affinity of receptor for G proteins. Coupling to a relatively high affinity G protein would result in an EC50 that decreases with increasing receptor concentration while the [G'ss]max remains unchanged. Coupling to a low affinity G protein would result in both the EC50 decreasing and the [G J. increasing with 56 increasing receptor concentration. Coupling to a lower affinity G protein would result in a constant EC50 while [Gcs]. increases with increasing receptor concentration.

Decreasing the G protein concentration has an effect similar to decreased receptor affinity for G. The inhibitory cyclase response can be explained by coupling via a relatively high affinity G protein, while the stimulation of PI metabolism can be explained by coupling via a different, lower affinity G protein.

Partial agonists are ligands that result in less than the maximal physiological response seen with another ligand termed a full agonist. A ligand that appears to be a partial agonist in one system can appear elsewhere to be a full agonist (35-37). At high receptor concentrations pilocarpine appeared to be a full agonist, having about the same maximal cyclase inhibition as acetylcholine, oxotremorine M, and carbachol. At lower receptor concentrations pilocarpine, unlike the full agonists, resulted in decreasing maximal cyclase inhibition with decreasing receptor concentration (Figure 2.2). The model in the Appendix to this Chapter explains both of these observations. The maximal response, [G cs,ffm.,1 reaches a maximum that is independent of agonist as receptor concentration approaches infinity (Equation 2.A15). Provided that the receptor affinity for G is much greater than receptor affinity for A, K3<< K2, the maximal response is independent of agonist at finite but relatively high receptor concentrations. Maximal response is dependent on agonist at lower receptor concentrations; and the placement and sharpness of the transition from agonist-independent to agonist-dependent maximal response is also dependent on the ratio of K3 to K2 (Figure 2.7A). The full agonists were found to have KH = K2 2 nM while the value for pilocarpine was 125-fold greater

(Table 2.1). A limited range of receptor concentrations was examined and since the maximal inhibition of cyclase was constant for the three full agonists, our experiments were conducted in the agonist-independent range of receptor concentrations for this ratio of K3 to K2. For pilocarpine, the 125-fold difference in the ratio of K3 to K2 resulted in a 57

4 A

2 4

3 ­

1

. s ---1...... 4 - ­ 0 9II 10 11 12 13 14 log [1/R0] (mol1dm2) 1.0

4 0.8 B 3 5- 0.6

O 3 2 O u.j 0.4 0_ 3 EC50

0.2 [G3s]min 1 [Gss]max 0.0 ...... 1_ 1 1 - - - .1. 0 8 9 10 11 12 13 14 log [1/Ro] (moi1dm2)

Figure 2.7. Theoretical relationship for the EC50, [G-ss]min, and [G'sj. vs 1/[Rol for the model. The model was calculated with the following parameter values: K2 = 2 nM, K4 = 1 1-049 [GO] = 1 x 10-11 MOIM-2, k5= 0.8 s-1, k, = 1 s-1, k9 = 0.2 s-1, K1= 1 x 10-11 moldm-2 (A) and 1 x 10--7 moldm-2 (B), K3 = 2 x 10-14 moldm-2 (A) and 1 x 10-10 moldm-2 (B). 58 transition from agonist-independent to agonist-dependent maximal response that was broader and shifted to higher receptor concentrations than for the three higher affinity agonists. Thus pilocarpine requires a greater receptor concentration to reach the same limit of maximal inhibition than the higher affinity agonists.

The model predicts that k5, a composite rate constant for G protein activation via the ARG complex, is agonist independent. Since k7, the rate of inactivation of G', and K1, the dissociation constant of the RG complex, are ligand independent, the initial asymptotic slope of an EC50 vs 14Ro] plot is proportional to K2 (Equation 2.A13). The ratio of the slopes in Figure 2.3 to the KH = K2 values in Table 2.1 are: 2.0 ± 0.6 x 10-10 moldm-2, 1.6 ± 1.6 x 10-10 moldm-2, 2.5 ± 5.0 x 10-10 moldm-2, 3.0 ± 1.1 x 10-10 moldm-2, for acetylcholine, carbachol, oxotremorine M, and pilocarpine, respectively, values that are equal within experimental error. The system did not allow effector coupling to be assessed over a sufficiently large receptor concentration range to estimate the model parameters independently, but was sufficient to confirm previous studies in a reconstituted system (38) which indicated that the difference between the full agonist carbachol and the partial agonist pilocarpine was the affinity of the receptor-agonist complex for G,, not the rate constant for G protein activation. In that study it was also found that the receptor-carbachol complex had a 4-fold higher affinity for G, than the receptor-pilocarpine complex (i.e. (K3)pilocaipine/(Klarbachoi= 3.73 1.35). While this ratio cannot be obtained from the model in the Appendix to this Chapter, it is possible to obtain it from ligand binding data. Substituting the values from Table 2.1, the ratio equals 4.3 ± 4.7. Although poorly determined, it agrees well with the value obtained from the reconstituted system.

The model accounts for the negative antagonism observed in cyclase inhibition assays (Figure 2.1D). According to Scheme 2.2 the RG complex is the only route to G' in the absence of agonist. In the presence of agonist the more productive route (provided 59 k5 > k9) via ARG contributes to the net production of G' while an antagonist draws receptor away from the RG complex to the nonproductive IRG complex and results in less G. It is experimentally easier to estimate the receptor affinity for G, K1, and the rate k9 (relative to k7) in this type of experiment than in an agonist inhibition assay. This is because there is only one activation rate constant, one receptor-G protein affinity, and one receptor-ligand affinity to consider in the absence of agonist. There is insufficient experimental data to estimate these parameters reliably but the data do demonstrate the utility of applying the model to this problem. The EC50 for NMS (K6 = 239 pM) was determined at two different receptor densities: 1.62 ± 0.27 nM at 4.7 x 10-11 moldm-2 and 5.2 ± 0.9 nM at 5.1 x 10-11 moldm-2 (both of these concentrations are within the linear region for the agonists studied). The line connecting these points on a EC50 vs

1/[/?0] plot has a slope of -2 x 10-18 mo12dm-5 and an intercept of 44 nM. Using

Equation 2.A25, k9 is calculated from the intercept to be 183-fold greater than k7. Using this value for k9 and the slope, K1 is calculated to be 4.5 x 10-11 moldm-2 from Equation 2.A26.

Stimulation of adenylyl cyclase in the absence of agonist can also be seen in Figure 2.1C. Here the action of GDIVS uncouples activation via the RG complex by converting most of the active RG complex to inactive RG-GDPOS. This is similar to the binding of antagonist (I) which increases the concentration of inactive IRG at the expense of RG complex. Agonist-mediated inhibition of adenylyl cyclase was evident in the presence of GDPOS because inhibition of cyclase requires only a low concentration of activated Gi. The slight shift in EC50i has the same mechanistic origin as the effect of different total receptor sites had on EC50i seen in Figure 2.1A. Negative antagonism is rationalized differently here than elsewhere (13, 15, 39, 40). Costa et al. (39) suggested that the parameter a should be less than unity and applied to the thermodynamic cycle involved in the binding of antagonist (I) to the receptor (R). This would predict 60 heterologous binding of antagonists to the receptor. Their model further suggests that the antagonist bound ternary complex is as capable as agonist bound complex in promoting coupling to effector systems (IRG = ARG in Scheme 2.2). Antagonists appear to bind all sites with equal affinity (41). Based on biophysical characterization the IR and AR complexes (Scheme 2.2) appear to be distinguishable states. Far-UV CD spectra of detergent-solubilized pm2 mAcChR were indistinguishable in the unliganded versus agonist bound states, however, the antagonist bound state contained 4% less a-helix and

4% more 13-sheet than the unliganded state.4 The model presented here does not consider the IRG complex competent to transduce signal via G proteins. Coupling occurs via the agonist-bound ternary complex ARG and it is the ability of an agonist to promote the formation of this complex over the AR complex that distinguishes a full from a partial agonist.

In summary, this paper describes studies of pm2 mAcChR coupling to effector systems in CHO cells. Data for all agonists appeared to be consistent with a two-state model that, with appropriate allowances for differences in coupling strength, accounts for the different dependencies of EC50 and maximal response on receptor number per cell observed for PI stimulation and inhibition of cAMP formation. Ligand binding data were not consistent with a simple two-state scheme but agreed well with the physiological determinations if a third site, not competent for coupling, was invoked.

The model can account for partial agonism, negative antagonism, and under favorable conditions can be used to experimentally determine the affinity of G proteins for receptors.

Acknowledgments

The authors would thank to thank J. Robishaw for determining the Ga subtypes present in our CHO cell membranes, D. Capon for the pm2 mAcChR clone and the 61 pSVE expression vector, D. J. Broderick, G. L. Peterson, B. T. Hirschberg, and D. M.

Sheehan for experimental assistance, and T. F. Murray for critical reading of this paper.

Appendix

Two-State Model

Scheme 2.2 describes a simplified two-state system where binding of agonist

(A), antagonist (/), and G protein (G) to the pm2 mAcChR (R) equilibrate rapidly. The activated G protein (G') arises from ARG and RG and is in a steady state during the time the response is measured. Effector activation or inhibition is proportional to [G'].

In the above model, K1K4, and K6 are dissociation constants, k5 and 1c9 are the rate constants for agonist dependent and independent G formation, respectively, and k7 is the rate constant for G' inactivation. KJC2 = K3K4 in this closed thermodynamic cycle.

The mass balance equations are,

[G0]= [G]+[G']+[RG]+ [ARG] (2.A1)

[RO]=[R]+[AR]+[RG]+[ARG] (2.A2) when [Go] and [R0] are the total G protein and receptor concentrations. Under conditions where [A] [Ao] and [I] = 0, the following relationship holds,

d[C] = k5[ARG] + k9[RG]k7[C]= 0 (2.A3) dt Solving for the steady-state concentration of [G1 gives this quadratic solution.

2[Go][Ro]lc ([05 + K2k9 )2 [G,:s (2.A4) (b+ 11b2 4[Go ][Ro ]K42k7 ([A]+ K2 )([05 + K2k9 )2 ([05 + [A]k7 + 1(2k7 K2k9)) where

b =([A]k5 + K2k9)([A]lC4(k7(K3+ [Go ]) [Bo ]( ks Ic7))± K2K4(k7([Go]+ K1)+[Ro](k7 k9))) (2.A5) 62

Where agonist concentration is saturating, [G']=[G'ss]max and the maximum response is given by Equation 2.A6; the basal response in the absence of agonist is given by Equation 2.A7.

2k5 [Go ][Ro [G,:s]max = (2.A6) (k7 (K3 + [GO D [RO i(k5 ))2 k7 (K3 + [Go]) + [RoKk5 1(7) +1+2k7[Ro]([Ro](ks(k7 1)) 2[Go](ks + 1(7))

[G,;s1min

2k9 [G0][R0] (2.A7)

k7(1C1 + [Go]) + [Ro](k7 + k9) + V-41(7 (k7 + k9)[G0][Ro] + (k7 (K1 + [G0]) + [Ro](k7 + k9 ))2

The EC50 value for agonist A is given by the [A] when [G'] = 0.5([G cs]max [G Ss]min-) + [G-]min A general relationship for the EC50 cannot be found but asymptotic values at extremes of [R0] can be. Ignoring the highest order [G1 terms in the solution of

Equation 2.A3 results in a simplified solution.

[Go Po l([05 K2k9) (2.A8) [q:s kmPlified [ A 1(k7 (K3 + [Go ]) [R0 ]( k5 + k7))+ K2 (k7(KI + [Go]) ±[Ro](1(7 k9))

Simplified minimal and maximal values from Equation 2.A8 are,

[G's, = k9[Go][R0] (2.A9) 11 1c7 + [Go ])+ LR0 +k9)

k5N[Rol = (2.A10) max k7 (K3 + [Go 1) [Ro ](k5 and the simplified half-maximal value is,

K2 (k7 (Ki + [Go ]) [Ro ](k7 -4- k9 )) EC 50 ( 2.A11) k7 (K3 + [GOD+ [Ro + k7)

The simplified solutions approximate the general solutions near the extremes of [R0] and were used to derive the following relationships. As [R0] approaches infinity a plot of

EC50 versus 1/[R0] has the following asymptotic values, 63

k9 EC50 = K2 (2.Al2) k5

k7 slope = K1K2 (2.A13) k5 + k7

[q, Lin = [Go ]k9 (2.A14) k7 + k9 and

[G.:, Lax [Go] k5 (2.A15) k5 + k7 and as [R0] approaches zero the plot plateaus at the value defined by Equation 2.A16 and

[G cs]miii and [G'ss]max are equal to Equations 2.A9 and 2.A10.

K1+ [Go] EC50 = K2 (2.A16) K3 + 190r 1

Equation Al6 simplifies to K4 when [G0] << K1, K3 .

Negative Antagonism

Antagonist (I) binds to R and RG with the same affinity and RG gives rise to activated G protein with rate constant k9.

Under conditions where [1] Vol and in the absence of A the mass balance equations are,

[G0 = [C] + [G] + [RG] + [IRG] (2.A17)

[R0 ]= [R] + [/R] + [RG] + [/RG] (2.A18) and assuming that [G1 is at a steady state,

d[G'] k9 [RG] k7 [G'] = 0 (2.A19) dt Solving for the steady state concentration of [G1 gives,

2[Go [Kok92 [G,:s (2.A20) (b + b2 4[G0 ][Ro ]k7k92 + K6 )(Mk) ± K6 (k2 +k9))) 64 where

b = k9(k7([0[G0]+[R0]+ KO+ K6 ([G0 [ + K1)) + K6 [Ro ](k7 + k9)) (2.A21)

Equation 2.A20 predicts that [G '] will decrease from a maximal value at [I] = 0 of,

2k9[G0][R0] (2.A22)

1c7 (K1 + [Go]) + [Ro](k7 + k9)+ .11-41c7(k7 + k9)[Go ][Ro ] + (k7(Ki + [GO]) + [Ro ](k7 +k9))2 to zero at saturating [I]. A simplified solution, derived as above, is valid near the extremes of [R0].

[G0 ][R0 ]K6k9 = ]simplified (2.A23) [I]([ G01±[R0]± K1)± K6(1c7(Ki ±[G0])±[R0}(k7 k9))

K6(k7(Ki + [GO]) +[R0](k7 k9)) (2.A24) (EC50 )simplified k7 (K, 1-[Go]+ [Ro])

As [R0] approaches infinity a plot of EC50 versus 1/[R0] has an intercept defined by

Equation 2.A25, a slope by Equation 2.A26, and as [R0] approaches zero the EC50 plateaus at K6.

+ k9 EC50 = K6 (2.A25) 1c7 and

slope = (2.A26)

References

1. Kubo, T., Fukuda, K., Mikami, A., Maeda, A., Takahashi, H., Mishina, M., Haga, T., Haga, K., Ichiymama, A., Kangawa, K., Kojima, M., Matsuo, H., Hirose, T., and Numa, S. (1986) Nature 323, 411-416

2. Peralta, E. G., Winslow, J. W., Peterson, G. L., Smith, D. H., Ashkenazi, A., Ramachandran, J., Schimerlik, M. I., and Capon, D. J. (1987) Science 236, 600­ 605 65

3. Bonner, T. I., Buckley, N. J., Young, A. C., and Brann, M. R. (1987) Science 237, 527-532,1628

4. Hi lle, B. (1992) Neuron 9, 187-195

5. Ashkenazi, A., Winslow, J. W., Peralta, E. G., Peterson, G. L., Schimerlik, M. I., Capon, D. J., and Ramachandran, J. (1987) Science 238, 672-675

6. Stein, R., Pinkas- Kramarski, R., and Sokolovsky, M. (1988) EMBO J. 7, 3031­ 3005

7. Tietje, K. M., Goldman, P. S., and Nathanson, N. M. (1990) J. Biol. Chem. 265, 2828-2834

8. Tietje, K. M., and Nathanson, N. M. (1991) J. Biol. Chem. 266, 17382-17387

9. Wong, H.-M. S., Sole, M. J., and Wells, J. A. (1986) Biochemistry 25, 6995-7008

10. De Lean, A., Stadel, J. M., and Lefkowitz, R. J. (1980) J. Biol. Chem. 255, 7108­ 7117

11. Rodbell, M. (1980) Nature 284, 17-22

12. Whaley, B. S., Yuan, N., Birnbaumer, L., Clark, R. B., and Barber, R. (1994) Mol. Pharmacol. 45, 481-489

13. Samama, P., Pei, G., Costa, T., Cotecchia, S., and Lefkowitz, R. J. (1994) Mol. Pharmacol. 45, 390-394

14. Chidiac, P., Herbert, T. E., Valiquette, M., Dennis, M., and Bouvier, M. (1994) Mol. Pharmacol. 45, 490-499

15. Samama, P., Cotecchia, S., Costa, T., and Lefkowitz, R. J. (1993) J. Biol. Chem. 268, 4625-4636

16. Ehlert, F. (1985) Mol. Pharmacol. 28, 410-421

17. Furchgott, R. F. (1964) Ann. Rev. Pharm. 4, 21-50

18. Dai, Y., and Baum, B. J. (1993) Am. J. Physiol. 265, G1122G1127

19. Yocca, F. D., Iben, L., and Me ller, E. (1992) Mol Pharmacol 41, 1066-1072

20. Peterson, G. L., and Schimerlik, M. I. (1984) Prep. Biochem. 14, 33-74

21. Hirschberg, B. T., and Schimerlik, M. I. (1994) J. Biol. Chem. 269, 26127-26135

22. Lee, W., Nicklaus, K. J., Manning, D. R., and Wolfe, B. B. (1990) J. Pharmacol. Exp. Ther. 252, 482-490 66

23. Johnson, R. A., and Salomon, Y. (1991) Methods Enzymol. 195, 3-21

24. Salomon, Y. (1979) Adv. Cyclic Nucleotide Res. 10, 35-55

25. Marquardt, D. W. (1963) J. Soc. Ind. AppL Math. 11, 431-441

26. Cheung, A. H., Huang, R.-R. C., and Strader, C. D. (1992) Mol. Pharmacol. 41, 1061-1065

27. Goldsmith, P., Gierschik, P., Milligan, G., Unson, C. G., Vinitsky, R., Malech, H. L., and Spiegel, A. M. (1987) J. Biol. Chem. 262, 14683-14688

28. Gutowski, S., Smrcka, A., Nowak, L., Wu, D., Simon, M., and Sternweis, P. C. (1991) J. Biol. Chem. 266, 20519-20524

29. Mukai, H., Munekata, E., and Higashijima, T. (1992) J. Biol. Chem. 267, 16237­ 16243

30. Choi, E.-J., Wong, S. T., Hinds, T. R., and Storm, D. R. (1992) J. Biol. Chem. 267, 12440-12442

31. De Bernardi, M. A., Seki, T., and Brooker, G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9257-9261

32. Peralta, E. G., Ashkenazi, A., Winslow, J. W., Ramachandran, J., and Capon, D. J. (1988) Nature 334, 434-437

33. Dell'Acqua, M. L., Carroll, R. C., and Peralta, E. G. (1993) J. Biol. Chem. 268, 5676-5685

34. Dittman, A. H., Weber, J. P., Hinds, T. R., Choi, E.-J., Migeon, J. C., Nathanson, N. M., and Storm, D. R. (1994) Biochemistry 33, 943-951

35. Fisher, S. K., Klinger, P. D., and Agranoff, B. W. (1983) J. Biol. Chem. 258, 7358-7363

36. Fisher, S. K., Figueiredo, J. C., and Bartus, R. T. (1984) J. Neurochem. 43, 1171­ 1179

37. Delhaye, M., De Smet, J. M., Taton, G., De Neff, P., Camus, J. C., Fontaine, J., Waelbroeck, M., Robberecht, P., and Christophe, J. (1984) Naunyn­ Schmiedeberg's Arch. Pharmacol. 325, 170-175

38. Tota, M. R., and Schimerlik, M. I. (1990) Mol. Pharmacol. 37, 996-1004

39. Costa, T., Ogino, Y., Munson, P. J., Onaran, 0., and Rodbard, D. (1992) Mol. Pharmacol. 41, 549-560 67

40. Bond, R. A., Leff, P., Johnson, T. D., Milano, C. A., Rockman, H. A., McMinn, T. R., Apparsundaram, S., Hyek, M. F., Kenakin, T. P., Allen, L. F., and Lefkowitz, R. J. (1995) Nature 374, 272-276

41. Schimerlik, M. I., and Searles, R. P. (1980) Biochemistry 19, 3407-3413 68 Chapter 31

Site-Directed Mutagenesis on the m2 Muscarinic Acetylcholine Receptor. The Significance of Tyrosine 403 in the binding of agonists and functional coupling 2

Summary

The first step in the transmembrane signal mediated by G protein-coupled receptors is binding of agonist to receptors at the cell surface. The mechanism of the resulting receptor activation is not clear, but models based on the ternary complex model are capable of explaining most of the observations that have been reported in G protein- coupled receptors. This model suggests that a single agonistreceptorG protein complex capable of activating G protein is formed as the result of agonist binding.

Extensions of this basic model differ primarily in whether an equilibrium between active and inactive conformations is required to explain experimental results. We report results on ligand binding and coupling to physiological effector systems of the m2 muscarinic acetylcholine receptor site-directed mutant Y403F expressed in Chinese hamster ovary cells and compare our results with results reported for the homologous Y506F mutation in the m3 muscarinic receptor (Wess, J., Maggio, R., Palmer, J. R., and Vogel, Z.

(1992) J. Biol. Chem. 267:19313-19319). The mutation in the m2 muscarinic receptor reduced absolute agonist affinities more dramatically than in the m3 muscarinic receptor.

1This chapter is a forthcoming paper in Molecular Pharmacology © 1997 by The American Society for Pharmacology and Experimental Therapeutics, and is reprinted with permission.

2This work was supported by the National Institutes of Health Grants HL23632 and ES00210.

Abbreviations: CHO, Chinese hamster ovary; G protein, guanine nucleotide-binding protein; KL, KM, and Kii, the low, medium, and high affinity equilibrium dissociation constants, respectively; NMS, S- ( )- N- methylscopolamine; QNB, R-()-quinuclidinyl benzilate; Y403F, residue 403 mutated from tyrosine to phenylalanine. 69

Unlike the results reported for the m3 subtype mutant, where coupling to physiological effector systems was reduced, coupling to effector systems for the mutant in the m2 subtype was robust. In the Y403F m2 muscarinic receptor the difference between the two agonist binding affinities was greater than in the wild-type receptor while in the m3 subtype the effect of the mutation was to decrease this difference. A prediction of the ternary complex model is that relative binding affinities will affect the steady-state concentration of the agonistreceptorG protein complex and as the result the extent of G protein coupling. These results can best be rationalized by this model, which suggests that the activation of G protein-coupled receptors is achieved by the relative affinity of agonist for two receptor states and does not require the existence of multiple states in conformational equilibrium.

Introduction

Muscarinic acetylcholine receptors are members of a diverse group of receptors and sensory proteins that are characterized structurally by a pattern of hydrophobic residues suggesting seven transmembrane domains, and functionally by coupling the binding of an extracellular activator to intracellular effector via G proteins. Five muscarinic receptor subtypes (ml m5) have been cloned and expressed (1-5). The odd- numbered subtypes couple preferentially to the stimulation of phospholipid metabolism and the even-numbered subtypes couple preferentially to the inhibition of cAMP formation. The m2 subtype is widely distributed in mammalian tissue and is the only subtype found in mammalian heart (3), where it acts via the cardiac pacemaker cells to activate inwardly-rectifying potassium channels in addition to the inhibition of adenylyl cyclase and stimulation of phospholipid metabolism (6). Two results of agonist binding to the cardic m2 muscarinic receptor are a decrease in heart rate, due to the activation of inwardly-rectifying potassium channels, and a decrease in the force of contraction, due to the reduction in voltage-gated calcium currents regulated indirectly via cAMP levels (7). 70

The agonist binding site of G protein-coupled receptors is thought to lie in the transmembrane bundle of amphipathic a-helices. Photochemical cross-linking with an analog of 11-cis-retinal predominantly labeled the third and sixth transmembrane helices suggesting that they make up part of the retinal binding site of rhodopsin (8). Among G protein-coupled receptors that bind biogenic amines a conserved aspartate residue in the third transmembrane helix is critical for the binding of ligand (9-11). We report results from the site-directed mutant Y403F in the m2 muscarinic receptor, located in the sixth transmembrane helix one residue beyond a highly conserved proline. Results from the

13-adrenergic (12) and bradykinin (13) receptors where the homologous residue is a phenylalanine and from the m3 muscarinic receptor (14, 15), rhodopsin (16), and the neurokinin-2 receptor (17) where the homologous residue is a tyrosine suggest that these residues are part of or near the agonist/retinal binding sites of these G protein-coupled receptors.

The nature of the relationship between agonist binding to G protein-coupled receptors and the activation of G proteins is poorly understood. Models of G protein activation differ in the number of states of the receptor. The simplest models rely on two receptor states with respect to agonist and G protein binding (scheme in Figure 3.1).

Agonist binds free receptor and G protein-complexed receptor that have different agonist affinities, and G protein binds free receptor and agonist-complexed receptor that have different G protein affinities. This ternary complex model results in two G protein­ complexed states: the receptorG protein binary complex and the agonistreceptorG protein ternary complex. G protein activation occurs via the ternary complex (18, 19) or via both the binary and the ternary complexes at different rates (20). The basic model was extended to explain a constitutively active D-adrenergic receptor mutant (21), negative antagonism (22), inverse agonist activity (23), and these extensions have been generalized into the cubic ternary complex model where each state represented in the 71 scheme in Figure 3.1 is proposed to exist in an active and inactive conformation. These models describe G protein-coupled receptors as existing in multiple states of activity where agonists promote the more active state and inverse agonists promote the less active state by mass action. The simpler model suggests that agonists activate G protein- coupled receptors by occupancy. The binding of agonist to the two linked states of the receptor results in greater concentrations of the agonistreceptorG protein complex as the ratio of agonist affinities increases and is a measure of intrinsic efficacy of an agonist in a given receptor/G protein system (19). Here efficacy is defined as the ability of an agonist to promote a physiological response independent of the absolute affinity of the agonist for the receptor.

The difference between the above models is whether receptor occupancy, and therefore the maintenance of a steady-state concentration of agonistreceptorG protein complex, is the primary mode of receptor activation. The alternative is that a conformational equilibrium between active and inactive receptor states plays the primary role and receptor occupancy plays a secondary role. The choice of model has a practical consideration in the drug design process in the attention paid to agonist-receptor binding characteristics.

The m2 muscarinic receptor expressed at high levels in CHO cells is an especially well suited system for the evaluation of models of G protein-coupled receptors because the agonist affmities are well separated and clearly defined in competition binding assays. A relationship between the ratio of agonist affinities in muscarinic receptors and apparent efficacy was first reported by Birdsall et al. (24). Our results identify a specific tyrosine residue that is important for agonist binding in the m2 muscarinic receptor. Similar but less dramatic effects on agonist binding were reported for the homologous mutation in the m3 muscarinic receptor (14, 15). Unlike the results in the m3 subtype where mutating this tyrosine resulted in diminished coupling to 72

Figure 3.1. Ternary complex model describing the binding of agonist and G protein to G protein-coupled receptors. A is agonist, G is G protein, R is the free receptor, AR is the agonist bound receptor, RG is the G protein bound receptor, and ARG is the agonistG proteinreceptor ternary complex. effector systems, this mutation in the m2 subtype resulted in increased coupling. The effects of these mutations correlate with changes in the ratio of agonist affinities for RG compared to R (scheme in Figure 3.1) that increase in the m2 subtype but decrease in the m3 subtype. The correlation of decreased agonist affinity with decreased coupling to an effector system led Wess et al. (15) to conclude that this tyrosine is part of a binding and trigger mechanism in the m3 subtype serving both in agonist binding and in the activation of G proteins. We argue against this explanation of the results for the m3 mutation and suggest that the ternary complex model provides an adequate explanation of the results from both subtypes.

Materials and Methods

The procedures used to produce stably transfected clonal CHO cell lines overexpressing wild-type and mutant receptor (2) and enriched membrane preparations (25, 26) were previously described. 73 Materials

[41]()NB, [3H]NMS, and [14C]cAMP were purchased from DuPont NEN,

[3H]adenine and [3H]myo- inositol from American Radio labeled Chemicals, acetylcholine from Sigma, carbachol and pilocarpine from Aldrich, oxotremorine M from Research Biochemicals, Ro 20-1724 from Biomol, and guanylyl­ imidodiphosphate from Boehringer Mannheim.

Site-directed mutagenesis

The Y403F mutant porcine m2 muscarinic receptor was produced by oligonucleotide-directed mutagenesis by the method of Vandeyar et al. (27) except that

E. coli ER1451 was used. The mutation was introduced by priming second strand synthesis with the antisense oligonucleotide: 5'- ATGACGTTGAACGGGGCCCAA -3'

(the base change is underlined). The wild-type coding region was ligated into M13mp18 as a HindlIIIEcoRI fragment derived from the pSVE expression vector (2) kindly provided by Dr. Daniel Capon, Genentech. The sequence of the Y403F was confirmed by dideoxy sequencing (28). The mutated coding region was ligated into the pSVE expression vector and used to transfect CHO cells.

Effector Coupling

Phosphatidylinositol stimulation was determined in attached CHO cells expressing Y403F muscarinic receptor plated at 2 x 104/mm2 and incubated in 4 pCi/m1

[3H]myo-inositol for 72 h. Agonists were added and inositol 1-phosphate accumulation was measured after 30 min at 37 °C as described by Lee et al. (29). Inhibition of forskolin-stimulated adenylyl cyclase activity was determined in attached confluent CHO cells in the presence of 100 pM isobutylmethylxanthine, 50 pM Ro 20-1724, and agonist after exposing the cells to 8 ilCi/m1 [3H]adenine for 2-3 h. The 20 min assay at 37 °C was started by the addition of 40 pM forskolin and [3111cAMP was determined 74 according to the method of Salomon (30). Results for Y403F mutant and wild-type were compared at similar levels of expression in cloned cells lines.

Ligand binding

Ligand binding to enriched membrane preparations was assessed in 10 mM HEPES, 5 mM MgC12, 1 mM EDTA, 1 mM EGTA, pH 7.4 at 25 °C. After 4-6 h samples were filtered through Schleicher & Schuell #32 glass-fiber filter membranes pretreated with 0.1% (w/v) polyethylenimine on a Brandel Harvester (Gaithersburg,

Maryland) and washed with approximately 10 ml ice-cold 50 mM sodium phosphate, 1 mM EDTA, pH 7.4. Nonspecific binding was assessed in the presence of 1-4 x 104 fold excess unlabeled ligand. In direct binding experiments on the Y403F mutant the receptor site concentration was 140-350 pM ([3H]NMS) and 60-110 pM ([3H]QNB).

In competition binding experiments with [3H]NMS (2.5-6.5 nM) the receptor site concentration was 60-390 pM.

Protein stability

Resistance to thermal inactivation was assessed in enriched membrane preparations in the presence and absence of saturating [3H]QNB. Membranes were exposed to different temperatures for 1 h and quenched on ice and residual [3H]QNB binding was determined.

Data Analysis

Functional assays were fit to Equation 1, where [x] is the agonist concentration, max1,2 are the maxima of the inhibitory and stimulatory portions of the curve, min is the minimum of the curve, and p1,2 are the respective slope factors. For adenylyl cyclase assays that showed only an inhibitory phase the first two terms were used and for assays of phosphatidylinositol metabolism stimulation the first and last terms were used. 75

max min max 2 min CPM = min + p1 p2 (1) [x] r(Ec50) 1 (EC50i) [x] )

In direct saturation binding experiments total bound radioligand was analyzed as the sum of specific, [RL], and nonspecifically, N[L], bound ligand according to the quadratic solution of Equation 2 and Equation 3 where [Rd and [Lo] are the total receptor and ligand concentrations, K is the equilibrium dissociation constant and N is the proportionality constant of nonspecifically bound ligand to free ligand concentration. Po] [Rn)([4] [Rn = [RL]) (2) K(N +1)

N([4] [R11) N[L] = (3) N + 1

Agonist binding was assessed in competition with radiolabeled antagonist.

Agonist binding data were fit to two or three noninteracting classes of sites that bound antagonist with the same dissociation constant. Total labeled antagonist specifically bound, [RU], is the sum of that bound at each subclass of agonist binding sites according to the polynomial solutions of Equation 4,3

Fi[R011,01[Rn) [Rn= (4) 1-1 K(N + 1)(1 +V)+ [Lo] [Rn where [Ro] equals the total concentration of receptor, Fi is the fraction of [R0] in site i,

[L0] is the total labeled antagonist concentration, [A] is the total agonist concentration

(equal to the free concentration since no displacement occurs until [A] > {Rd), K is the dissociation constant for radiolabeled antagonist, and Ki is the dissociation constant for the agonist at site i (referred to as KH, KM, and KL, the high, medium, and low affmity

3Expanded solutions of these equations appear in the Appendix to this dissertation. 76 constants).2 Data were fit by nonlinear least-squares procedures using Marquardt's algorithm (31) and parameter values are reported as the mean and 95% confidence interval of several determinations.

Ligand binding energetics

The difference in ligand binding energy between Y403F mutant and wild-type muscarinic receptor was calculated with Equation 5,

A(AG°) = AG°mutant AG°Wild type = RT ln(Kmutantl Kwildtype) (5) where AG° is the standard Gibbs free-energy change, R is the gas constant, T is the absolute temperature, and K is the equilibrium dissociation constant. A(AG°) is the apparent binding energy contributed by the tyrosine hydroxyl (32); it does not take into account the changes in solvation of the mutant receptor or potential changes in receptor stability. A(AG°) is defined such that positive values indicate that the mutant binds ligand less strongly.

Results

Ligand binding properties of Y403F m2 muscarinic receptor were assessed in sucrose gradient enriched membrane preparations. Antagonists [3H]NMS and [3H]QNB bound to a single class of sites with affinities that were 2.5- and 1.7-fold lower than wild-type receptor. Agonists appeared to bind to two classes of sites, compared to three for wild-type, with affinities (KM values) that were 200-300-fold lower for acetylcholine and carbachol than wild-type. The binding affinities for the agonists oxotremorine M and pilocarpine were less dramatically affected being reduced by less than 100-fold (Table

3.1). Competition binding assays were conducted in the presence and absence of guanylyl-imidodiphosphate, a nonhydrolyzable analog of GTP; results for carbachol are shown in Figure 3.2. Data in the presence and absence of guanine nucleotide were fit so that values for KH and KM were shared in the analysis of a given experiment (20). The 77 highest affinity site, Kll, was sensitive to the presence of guanine nucleotide, consistent with binding to the G protein-receptor complex.

Among G protein-coupled receptors, agonists can be characterized by their affinity for free receptor and by their ability to promote the formation of the agonist receptorG protein ternary complex over the agonistreceptor binary complex. Agonist affinity for free receptor is quantified by KM values while the ability to promote the ternary complex is described by the parameter a (19, 20) which is calculated as the quotient of KM and Kll values (Table 3.1). The a values for Y403F were approximately

4, 2, 3, and 0.6 times greater than for wild-type receptor for acetylcholine, carbachol, oxotremorine M, and pilocarpine, respectively.

When comparing a mutant and wild-type protein it is difficult to attribute differences in ligand affinity to a specific interaction between the mutated residue and the ligand if the mutation also results in altered protein structure. Resistance to irreversible thermal inactivation in the presence and absence of the antagonist QNB was used to assess the effects of the mutation on m2 muscarinic receptor structure. Y403F was indistinguishable from wild-type receptor in its resistance to thermal inactivation suggesting that loss of the tyrosine hydroxyl did not significantly destabilize receptor structure (Figure 3.3).

Functional coupling of the mutant receptor was assessed in attached tissue culture cells and the results compared to data for wild-type receptor at similar expression levels

(20). Acetylcholine, carbachol, and oxotremorine M stimulated phosphatidylinositol metabolism to a slightly greater extent than wild-type while the EC50 values were greater than wild-type by 150, 120, and 40, respectively (Table 3.2). These increases in EC50 are similar to the increase in KM values: 290, 180, and 65, for acetylcholine, carbachol, and oxotremorine M, respectively (Table 3.1). The values of KM and the EC50 for stimulation of phosphatidylinositol metabolism were found to be approximately equal 78 for the wild-type receptor and this was rationalized as coupling via a G protein that has a relatively low affinity for the receptor (20). The mutant receptor appeared to stimulate phosphatidylinositol metabolism to a greater extent than wild-type with acetylcholine, carbachol, and oxotremorine M but in six experiments pilocarpine failed to stimulate phosphatidylinositol metabolism significantly (Table 3.2).

Acetylcholine, carbachol, and oxotremorine M inhibited cAMP formation to an extent indistinguishable from wild-type while pilocarpine inhibited cAMP formation less than wild-type at comparable receptor densities. The EC50 for adenylyl cyclase inhibition was inversely dependent on the receptor density as was found for wild-type (20) and the slope of this relationship was greater than that for wild-type, consistent with the observed two orders of magnitude lower affinity of agonists for the receptor (Table 3.3). The relationship between the EC50 for adenylyl cyclase inhibition and the affinity of agonists for the receptor is more complicated than the relationship between EC50 for stimulation of phosphatidylinositol metabolism and agonist affinity (20), making a comparison of

EC50 differences and affinity differences more difficult. The limiting slope and intercept of these plots are interpretable in terms of simple relationships as was done with wild- type (20). However, the lower agonist affinity observed with the Y403F mutant requires that receptor sites density be greater for the mutant than for wild-type to allow a similar analysis. The experimentally accessible range of receptor concentrations was less than that available for wild-type and this type of analysis was not possible.

Discussion

Substituting phenylalanine for the conserved tyrosine in the sixth transmembrane helix appears to meet the general criteria of a nondisruptive deletion (34). The mutation removes a side chain functional group that is involved in a specific interaction and replaces it with a smaller group that does not appear to be involved in overall structural stability. The calculated A(AG°) values of approximately 0.5 kcal/mol for antagonists Table 3.1. Ligand binding properites of Y403F mutant and wild-type m2 muscarinic receptor.Values are the weightedmean ± 95% confidence interval; the number of experimental determinations are indicated in parentheses. A(AG°) values are presented ± 95% confidence interval.

Y403F Wild-type A(AG°) (kcal-morl)

Antagonists K (pM) K (pM) Kb

[3H]NMS 630 ± 240 (5) 253 ± 45 (15) 0.54 ± 0.22

[3H]QNB 29.3 ± 3.4 (3) 17.4 ± 2.8 (16) 0.31 ± 0.10

act Agonists KH (nM) KM (1.1M) KH (nM) KM (11M) KT, (NM) as K Hb Km b acetylcholine 107 ± 51(3) 101 ± 36 (4) 950 ± 560 1.45 ± 0.49 0.350 ± 11.1 ± 3.9 240 ± 100 2.55 ± 0.25 3.36 ± 0.21 (12) 0.087 (15) (13) carbachol 390 ± 170 (5) 248 ± 68 (5) 630 ± 320 3.6 ± 0.80 1.37 ± 0.16 21.7 ± 3.7 380 ± 100 2.77 ± 0.26 3.08 ± 0.16 (19) (38) (37) oxotremorine M 51 ± 43 (5) 25.8 ± 4.5 (5) 500 ± 430 2.16 ± 0.89 0.40 ± 0.14 13.0 ± 8.2 (9) 190 ± 100 1.88 ± 0.49 2.47 ± 0.22 (10) (16) pilocarpine 2370 ± 680 149 ± 52 (7) 63 ± 29 27 ± 17 (8) 2.78 ± 0.73 25 ± 16 (9) 100 ± 70 2.65 ± 0.39 2.36 ± 0.24 (6) (14) as is calculated as the quotient of the parameters KM and KH. Indicates the equilibrium constant for which the A(AG°) values are calculated. 80

Figure 3.2. [3H]NMS displacement by carbachol in Y403F CHO cell membranes. Data were fit to two independent classes of sites, described in Materials and Methods. The parameter values for the fitted lines are shown ± asymptotic standard errors. KH = 0.64 ± 0.14 pM, KM = 238 ± 9 pM, FH = 39.9 ± 1.4% in the absence of guanylyl­ imidodiphosphate ( ), and 13.6 ± 2.0% in the presence of 200 pM guanylyl­ imidodiphosphate (0 ). Inset, [3H]NMS binding to the same membrane preparation presented as a Scatchard plot (33) K = 813 ± 29 pM. The concentration of [3H]NMS for the carbachol competition was 5.7 nM and the receptor site concentration for both the competition and the direct binding of [3H]NMS was 190 pM. 1­'11 CfQZ 1-1 CD (.....)

.C.-) 100

80

60

40

20 20 40 60 80 Specifically Bound NMS (%) 0 I I 10 8 6 4 2 log [carbachol] (M) 82

40 50 60 70 Temperature (°C)

Figure 3.3. Irreversible thermal inactivation of Y403F m2 muscarinic receptor. Experiments were done in the absence (0 , , A) and presence ( , , ) of saturating antagonist [3H]QNB. The TO 5s were 51.8 ± 1.0° (n = 3) in the absence and 59.1 ± 1.8° (n = 3) in the presence of saturating QNB. The horizontal bars represent the mean and 95% confidence interval of results from wild-type receptor, 54.1 ± 1.6° (n = 15) in the absence and 60.2 ± 1.3° (n = 16) in the presence of saturating QNB. These differences were not significantly less than wild-type (P = 0.05). QNB stabilized the receptor by 7.3 ± 1.3° in a paired sample analysis, a value not significantly different from wild-type (6.2 ± 0.9°). 83

Table 3.2. The effect of Y403F mutation on phosphatidylinositol stimulation in whole cell assays. Values for EC50 and fold maximal stimulation of phosphatidylinositol metabolism are shown for the indicated receptor site densities. These values are compared to the wild-type values for the same range of receptor site densities observed in wild-type expressing CHO cells, from data previously published (20). Results with pilocarpine were not significant.

Agonist n EC50 Fold [R] (pmol Wild-type Wild-type Fold (.tM) Stimulationa .dm -2) EC50 (NM) Stimulation acetylcholine 2 60 ± 4 1.6-2.6 1.3-5.0 0.4 ± 0.2 1.2-1.4 carbachol 4 140 ± 70 2.4-3.0 5.0-33 1.2 ± 0.5 1.6-2.4 oxotremorine M 2 40 ± 3 1.6-2.6 1.3-5.0 1.0 ± 0.5 14-1.5 pilocarpine 6 ns ns 0.7-10.8 10 ± 4 1.1-1.3 aFold maximal stimulation increased with increasing [R] as in wild type. EC50 values are presented ± standard deviation.

Table 3.3. The effect of Y403F mutation on adenylyl cyclase inhibition in whole cell assays. EC50 values for the inhibition of adenylyl cyclase activity are reported as a range that varies inversely with [R]. Maximal inhibition is reported as mean ± standard deviation except for pilocarpine where inhibition was variable and increased with increasing [R] as in wild type. These values are compared to the wild-type values for the same range of receptor site densities observed in wild-type expressing CHO cells, from data previously published (20).

Agonist n EC50 Inhibition [R] (pmol Wild-type Wild-type (PM) (%) dm2) EC50 (04) Inhibition (%) acetylcholine 3 1.7-4.9 71.3 ± 4.9 5.0-17 0.014-0.07 80.0 ± 3.6 carbachol 6 1.3-37 70.8 ± 5.1 5.0-33 0.036-0.5 65.4 ± 5.1 oxotremorine M 5 0.6-4.9 74.4 ± 3.7 5.0-23 0.0087-0.28 76.2 ± 2.5 pilocarpine 4 10-110 19-43 5.0-23 3.4-15 37-62 84 and 2.5 kcal/mol for agonists are consistent with the elimination of a hydrogen bond in the ligand bound mutant receptor state that exists in the wild-type receptor (Table 3.1)

(32). An alternative explanation for the role for this tyrosine is as part of an aromatic cation -it binding site for the ligand amine, as was proposed based on molecular modeling (35). Since tyrosine is predicted to be a stronger locus of cation -it binding potential than phenylalanine due to the negative electrostatic potential of the hydroxyl oxygen (36) the distinction between the tyrosine hydroxyl being involved in a hydrogen bond or contributing negative electrostatic potential to a cation -1t site is not possible with the available data. The absence of high resolution structures of the receptor and receptor ligand complexes necessarily limits any interpretation. A reasonable explanation of these data is that the tyrosine hydroxyl in muscarinic receptors forms a hydrogen bond, the strength of which is important to the binding of the native agonist acetylcholine.

Results presented here and elsewhere (14) confirm the importance of tyrosine residues in the binding of agonists, especially the native agonist acetylcholine and its close analog carbachol, and their relative unimportance in the binding of antagonists. The contrast between the importance of this tyrosine residue in agonist and antagonist binding suggests a role for this residue in the mechanism of receptor activation of G proteins since its absence in m3 muscarinic receptor was coincident with a negative effect on receptor activation. Wess et al. (1992) proposed such a role for the conserved tyrosine in the sixth transmembrane helix of the m3 muscarinic receptor while results presented here suggest little or no role in receptor activation of G proteins for this residue in the m2 muscarinic receptor.

Site-directed mutagenesis of each of four transmembrane tyrosine residues in the m3 muscarinic receptor resulted in receptors with decreased affinity for acetylcholine and carbachol. The largest decrease in agonist affinity among these tyrosine mutants occurred at residue 506, 58- and 27-fold for acetylcholine and carbachol, respectively, while 85 antagonist affinities were reduced only a few fold (15). We mutated the homologous residue in the m2 muscarinic receptor, tyrosine-403, and found that antagonist affinities decreased by twofold but agonist affinities were decreased by approximately 280- and

180-fold for acetylcholine and carbachol. In contrast to the results from the m3 muscarinic receptor functional coupling, the inhibition of adenylyl cyclase did not appear to be affected beyond that expected from the decrease in receptor affinity for acetylcholine and carbachol. Stimulation of phosphatidylinositol metabolism was affected consistent with the decreased agonist affinity while the maximal response was greater than wild-type at comparable receptor densities.

The scheme in Figure 3.4 is an extension of the ternary complex equilibrium binding model (Figure 3.1) to take into account coupling via both the agonistreceptor

A RG ARG

G G R AR

Figure 3.4. Ternary complex model with kinetic pathways toward G protein activation and inactivation. G' is the activated G protein, see legend to Figure 3.1 for explanation of receptor states pictured. 86 binary complex and the agonistreceptorG protein ternary complex (20). The model describes the effect of G protein-coupled receptor activation on the steady-state concentration of activated G protein (G') as a function of agonist, receptor, and G protein concentrations, the affinities for each of these for each other, and the rate constants for G protein activation and inactivation. If effector coupling is proportional to activated G protein concentration then the model describes the effect of G protein- coupled receptor activation on effector coupling. The model predicts a pattern of behavior for the two parameters observable in effector coupling assays, the maximal response and the concentration of agonist that produce a half-maximal response (EC50). As receptor density increases maximal response increases while the EC50 is unchanged, and equal to the lower affinity agonist dissociation constant, until G protein concentration becomes limiting. When G protein concentration is limiting, further increase in receptor concentration has no effect on maximal response but the EC50 decreases as less agonist is required for a given response. Between the extremes of limiting receptor concentration and limiting G protein concentration both parameters are predicted to vary with varying receptor density. The placement, breadth, and shape of this transition depend on the receptorG protein affinity and the ratio of the agonistreceptorG protein affinity and the agonistreceptor affinity (a parameter referred to as a).

The scheme in Figure 3.4 explained the observed effects of variable cell-surface receptor density on effector coupling in m2 muscarinic receptor expressing CHO cells (20). The EC50 of the inhibition of adenylyl cyclase was found to be inversely proportional to receptor density while the maximal response was constant with varying receptor density for full agonists acetylcholine, carbachol, and oxotremorine M.

Pilocarpine displayed the same effect of receptor density on EC50; the maximal effect however was reduced relative to the other agonists (partial agonism) at the low end of the receptor density range examined and was indistinguishable from the other agonist effect 87 at the high end of receptor density. In contrast the EC50 for the stimulation of phosphatidylinositol metabolism was constant and approximately equal to the KM binding constant for each agonist, with varying receptor density but the maximal response increased with receptor density. The different pattern of behavior of the two effector coupling systems over the same receptor density range was rationalized as the muscarinic receptor coupling to adenylyl cyclase via a relatively high-affinity G protein and coupling to phosphatidylinositol metabolism via a relatively low-affinity G protein.

The model rationalized the partial agonism observed with pilocarpine and the negative antagonist observed with QNB, NMS, and hyoscyamine in adenylyl cyclase assays.

The pilocarpine results in the Y403F mutant differ from the other agonists in two respects that have interpretable significance on the effects of the Y403F mutation. The a values, a measure of intrinsic efficacy, calculated from data in Table 3.1 were found to be greater than wild-type for acetylcholine, carbachol, and oxotremorine M but less than wild-type for pilocarpine. The maximal response observed in both physiological assays for pilocarpine was less than that found for wild-type at comparable receptor density, while the response found with acetylcholine, carbachol, and oxotremorine M was the same or better than wild-type. The a value is related to the ability of an agonist to produce a physiological response since it is a measure of the ability of the agonist to promote the formation of the agonistreceptorG protein complex at the expense of the agonistreceptor complex. The predicted effect of these changes in a values is that the maximal response in physiological assays would be equal to or greater than wild-type for acetylcholine, carbachol, and oxotremorine M and equal to or less than wild-type for pilocarpine.

Not included in the scheme in Figure 3.4 are possible effects of multiple G proteins, coupling via a and 13y G protein subunits, or multiple active conformational states that are differentially stabilized by agonist. In addition, differences between the 88 wild-type and Y403F clonal cell lines in G protein concentration or in the ratio of multiple G proteins or mutational alterations in the composite rate constant for G protein activation would be expected to affect the maximal response. The effect of a change in a value on maximal response is predicted to be sensitive to differences in the affinity of the receptor for G protein such that an effect visible in one assay may not be visible in another if it was coupled via a different G protein. The same effect can be explained by a single G protein activating via a and fry G protein subunits. This would require expanding the model in Figure 3.4 at the composite activation steps to include separate activation routes and different subuniteffector concentration dependencies.

The change in single G protein concentration or ratio of G proteins that act similarly or in the composite rate constant for G protein activation cannot explain our results since they would affect the maximal response to a similar extent for all agonists and would affect the inhibition of cAMP formation and the stimulation of phosphatidylinositol metabolism similarly. Results from a reconstituted system of purified m2 muscarinic receptor and Gi indicated that pilocarpine and carbachol promoted GTPase activity similarly (37) suggesting that if multiple active conformations that activate G protein agonist-specifically exist they are not significant in wild-type, however, this may not be true for the Y403F mutant. The cell lines used for these studies contain a mixture of Gi2 and Gi3, Gil and Go are not present3 which limits the potential for changes in G protein ratio having a differential effect on the wild-type and mutant expressing cell lines. Differential effects of O'y subunit stimulation of phospholipase C appear unlikely in two respects. This effect would require agonist-specific stimulation of G proteins in the mutant that is not observed in wild-type. If this occurred in our experiments then the differential mixture of fry subunits that might result would have to

3J. Robishaw, unpublished data 89 have a differential effect on phospholipase Cr3 isozymes. Recent results with phospholipase CI33 indicate that there is little difference in the potencies among different fry subunits, apart from the very low activity of 13171, (38). While there are many factors, some difficult to control for, that have the potential to complicate the interpretation of the results, the simplest explanation is that the observed agonist-specific change in a value between wild-type and the mutant receptor is the best explanation of the agonist-specific changes observed in functional assays.

The Y403F mutation in m2 muscarinic receptor appears to have affected only the ligand binding affinities of the receptor. Our data are consistent with this tyrosine hydroxyl being involved in a hydrogen bond important in the stability of the agonist bound state. This tyrosine also appears to be more important in the free receptor than in the G protein associated receptor state for acetylcholine, carbachol, and oxotremorine M.

Effects observed in physiological assays can be explained by reductions in the absolute receptoragonist affmity and the relative affinity of agonists for the free receptor and the receptorG protein complex.

These results help explain an otherwise difficult to rationalize result from mutagenesis experiments on the proline residue in the sixth transmembrane domain of the m3 muscarinic receptor. This proline is one residue away from the tyrosine and is conserved in virtually all G protein-coupled receptors (the major exception being the olfactory receptors). If the tyrosine is part of a binding and trigger mechanism for G protein activation, as was suggested (15), then it seems reasonable to expect that the adjacent proline, with its conformational flexibility, is also an integral part of the trigger.

Support for this model can be found in the results of molecular dynamics simulations on the transmembrane segments of 5-hydroxytryptamine receptor that suggested agonist but not antagonist binding would result in large movements in the transmembrane helices five and six (39). A trigger mechanism of receptor activation suggests that the 90 agonistreceptorG protein complex can assume an active and inactive conformation. However, mutating this proline residue in the m3 muscarinic receptor had no effect on antagonist binding, little effect on agonist binding, and no effect on its ability to stimulate phosphatidylinositol metabolism (40). In the Y403F m2 muscarinic receptor agonist binding to the higher affinity G protein-coupled receptor state was sensitive to guanine nucleotides and the mutant receptor was capable of eliciting a functional response similar to wild-type, while in the Y506F m3 muscarinic receptor (15) agonist binding was not sensitive to guanine nucleotides and the mutant receptor was less capable than wild-type of eliciting a functional response. This lack of sensitivity to guanine nucleotides in the m3 subtype mutant suggests a relative decrease in a values for acetylcholine and carbachol where in the m2 subtype the values increase. An explanation of the results from the m3 muscarinic receptor is that, as in the m2 muscarinic receptor, the conserved tyrosine residue is primarily involved in an interaction that stabilizes the agonist bound state; its reduced ability to stimulate phosphatidylinositol metabolism having the same mechanistic origin as a similar effect seen only with pilocarpine in the m2 subtype. There is no reason to believe that a single mutation could not have multiple effects but the data suggest that these mutations in or near the putative agonist binding site effect only binding. The trigger mechanism, if it exists at all, lies elsewhereperhaps involving the seventh transmembrane helix, as the proline in that helix had the most dramatic effect on coupling in the m3 subtype (40).

Acknowledgments

The authors would like to thank D. J. Broderick and G. L. Peterson for experimental assistance.

References

1. Kubo, T., K. Fukuda, A. Mikami, A. Maeda, H. Takahashi, M. Mishina, T. Haga, K. Haga, A. Ichiymama, K. Kangawa, M. Kojima, H. Matsuo, T. Hirose, 91

and S. Numa. Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetylcholine receptor. Nature 323:411-416 (1986).

2. Peralta, E. G., J. W. Winslow, G. L. Peterson, D. H. Smith, A. Ashkenazi, J. Ramachandran, M. I. Schimerlik, and D. J. Capon. Primary structure and biochemical properties of an M2 muscarinic receptor. Science 236:600-605 (1987).

3. Peralta, E. G., A. Ashkenazi, J. W. Winslow, D. H. Smith, J. Ramachandran, and D. J. Capon. Distinct primary structures, ligand-binding properties and tissue-specific expression of four human muscarinic acetylcholine receptors. EMBO J. 6:3923-3929 (1987).

4. Bonner, T. I., N. J. Buckley, A. C. Young, and M. R. Brann. Identification of a family of muscarinic acetylcholine receptor genes. Science 237:527 -532, 1628 (1987).

5. Bonner, T. I., A. C. Young, M. R. Brann, and N. J. Buckley. Cloning and expression of the human and rat m5 muscarinic acetylcholine receptor genes. Neuron 1:403-410 (1988).

6. Nathanson, N. M. Molecular proterties of the muscarinic acetylcholine receptor. Ann. Rev. Neurosci. 10:195-236 (1987).

7. Hille, B. Ionic channels of excitable membranes. Sinauer, Sunderland, Massachusetts, (1992).

8. Nakayama, T. A., and H. G. Khorana. Orientation of retinal in bovine rhodopsin determined by cross-linking using a photoactivatable analog of 11-cis-retinal. J. Biol. Chem. 265:15762-15769 (1990).

9. Strader, C. D., I. S. Sigal, M. R. Candelore, E. Rands, W. S. Hill, and R. A. F. Dixon. Conserved aspartic acid residues 79 and 113 of the 13-adrenergic receptor have different roles in receptor function. J. Biol. Chem. 263:10267-10271 (1988).

10. Fraser, C. M., S. Arakawa, W. R. McCombie, and J. C. Venter. Cloning, sequence alalysis, and permanent expression of a2-adrenergic receptor in Chinese hamster ovary cells. J. Biol. Chem. 264:11754-11761 (1989).

11. Page, K. M., C. A. M. Curtis, P. G. Jones, and E. C. Hulme. The functional role of the binding site aspartate in muscarinic acetylcholine receptors, probed by site- directed mutagenesis. Eur. J. PharmacoL 289:429-437 (1995).

12. Dixon, R. A. F., I. S. Sigal, and C. D. Strader. Structure-function analysis of the 13-adrenergic receptor. Cold Spring Harbor Symp. Quant. Biol. 53:487-497 (1988). 92

13. Nardone, J., and P. G. Hogan. Delineation of a region in the B2 bradykinin receptor that is essential for high-affinity agonist binding. Proc. Natl. Acad. Sci. U. S. A. 91:4417-4421 (1994).

14. Wess, J., D. Gdula, and M. R. Brann. Site-directed mutagenesis of the m3 muscarinic receptor: identification of a series of threonine and tyrosine residues involved in agonist but not antagonist binding. EMBO J. 10:3729-3734 (1991).

15. Wess, J., R. Maggio, J. R. Palmer, and Z. Vogel. Role of conserved threonine and tyrosine residues in acetylcholine binding and muscarinic receptor activation. A study with m3 muscarinic receptor point mutants. J. Biol. Chem. 267:19313­ 19319 (1992).

16. Nakayama, T. A., and H. G. Khorana. Mapping of the amino acids in membrane-embedded helices that interact with the retinal chromophore in bovine rhodopsin. J. Biol. Chem. 266:4269-4275 (1991).

17. Huang, R.-R. C., P. P. Vicario, C. D. Strader, and T. M. Fong. Identification of residues involved in ligand binding to the neurokinin-2 receptor. Biochemistry 34:10048-10055 (1995).

18. De Lean, A., J. M. Stadel, and R. J. Lefkowitz. A ternary complex model explains the agonist-specific binding properties of the adenylate cyclase coupled f3- adrenergic receptor. J. Biol. Chem. 255:7108-7117 (1980).

19. Costa, T., Y. Ogino, P. J. Munson, 0. Onaran, and D. Rodbard. Drug efficacy at guanine nucleotide-binding regulatory protein-linked receptors: thermodynamic interpretation of negative antagonism and of receptor activity in the absence of ligand. Mol. Pharmacol. 41:549-560 (1992).

20. Vogel, W. K., V. A. Mosser, D. A. Bulseco, and M. I. Schimerlik. Porcine m2 muscarinic acetylcholine receptor-effector coupling in Chinese hamster ovary cells. J. Biol. Chem. 270:15485-15493 (1995). Chapter 2 of this dissertation

21. Samama, P., S. Cotecchia, T. Costa, and R. J. Lefkowitz. A mutation-induced activated state of the 132 -adrenergic receptor. Extending the ternary complex model. J. Biol. Chem. 268:4625-4636 (1993).

22. Samama, P., G. Pei, T. Costa, S. Cotecchia, and R. J. Lefkowitz. Negative antagonist promote an inactive conformation of the 132-adrenergic receptor. Mol. Pharmacol. 45:390-394 (1994).

23. Chidiac, P., T. E. Herbert, M. Valiquette, M. Dennis, and M. Bouvier. Inverse agonist activity of 13-arenergic antagonists. Mol. Pharmacol. 45:490-499 (1994).

24. Birdsall, N. J. M., A. S. V. Burgen, and E. C. Hulme. The binding of agonists to brain muscarinic receptors. Mol. Pharmacol. 14:723-736 (1978). 93

25. Peterson, G. L., and M. I. Schimerlik. Large scale preparation and characterization of membranes-bound and detergent-solublized muscarinic acetylcholine receptor from pig atria. Prep. Biochem. 14:33-74 (1984).

26. Peterson, G. L., A. Toumadje, W. C. Jonhson, Jr., and M. I. Schimerlik. Purification of recombinant porcine m2 muscarinic acetylcholine receptor from Chinese hamster ovary cells. Circular dichrosim spectra and ligand binding properties. J. Biol. Chem. 270:17808-17814 (1995).

27. Vandeyar, M. A., M. P. Weiner, C. J. Hutton, and C. A. Batt. A simple and rapid method for the selection of oligodeoxynucleotide-directed mutants. Gene 65:129-133 (1988).

28. Sanger, F., S. Nicklen, and A. R. Coulson. DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74:5463-5467 (1977).

29. Lee, W., K. J. Nicklaus, D. R. Manning, and B. B. Wolfe. Ontogeny of cortical muscarinic receptor subtypes and muscarinic receptor-mediated responses in rat. J. Pharmacol. Exp. Ther. 252:482-490 (1990).

30. Salomon, Y. Adenylate Cyclase Assay, in Advances in Cyclic Nucleotide Research. Raven Press, New York, pp. 35-55 (1979).

31. Marquardt, D. W. An algorith for least-squares estimation of nonlinear parameters. J. Soc. Ind. Appl. Math. 11:431-441 (1963).

32. Fersht, A. R. Relationships between apparent binding energies measured in site- directed mutagenesis experiments and energetics of binding and catalysis. Biochemistry 27:1577-1580 (1988).

33. Scatchard, G. The attractions of proteins for small molecules and ions. Ann. N. Y. Acad. Sci. 51:600-672 (1949).

34. Fersht, A. R., R. J. Leatherbarrow, and T. N. C. Wells. Structureactivity relationships in engineered proteins: analysis of use of binding energy by linear free energy relationships. Biochemistry 26:6030-6038 (1987).

35. Trumpp-Kallmeyer, S., J. Hoflack, A. Bruinvels, and M. Hibert. Modeling of G- protein-coupled receptors: application to dopamine, adrenaline, serotonin, acetylcholine, and mammalian opsin receptors. J. Med. Chem. 35:3448-3462 (1992).

36. Dougherty, D. A. Cation-ic interactions in chemistry and biology: a new view of benzene, Phe, Tyr, and Trp. Science 271:163-168 (1996).

37. Tota, M. R., and M. I. Schimerlik. Partial agonist effects on the interaction between the atrial muscarinic receptor and the inhibitory guanine nucleotide- binding protein in a reconstituted system. MoL Pharmacol. 37:996-1004 (1990). 94

38. Exton, J. H. Cell signalling through guanine-nucleotide-binding regulatory proteins (G proteins) and phospholipases. Eur. J. Biochem. 243:10-20 (1997).

39. Zhang, D., and H. Weinstein. Signal transduction by a 5-HT2 receptor: a mechanistic hypothesis from molecular dynamics simulations of the three- dimensional model of the receptor complexed to ligands. J. Med Chem. 36:934­ 938 (1993).

40. Wess, J., S. Nanavati, Z. Vogel, and R. Maggio. Functional role of proline and tryptophan residues highly conserved among G protein-coupled receptors studied by mutational analysis of the m3 muscarinic receptor. EMBO J. 12:331-338 (1993). 95 Chapter 4

The Role of Aspartate 69, 97, and 103 in Ligand Binding and Signal Transduction of the m2 Muscarinic Acetylcholine Receptor. A Site-Directed Mutagenesis Study'

Summary

To understand the role of the conserved aspartate residues in the second and third transmembrane domains of the porcine m2 muscarinic acetylcholine receptor, these residues were mutated individually and in pairs to asparagine and stably expressed in Chinese hamster ovary cells. D69N (helix 2) eliminated high affinity guanine nucleotide-sensitive agonist binding for acetylcholine, carbachol, oxotremorine M, and pilocarpine. Coupling of acetylcholine, carbachol, and pilocarpine to adenylyl cyclase inhibition and phospholipase C stimulation were eliminated but oxotremorine M was partially activite. Pertussis toxin-insensitive adenylyl cyclase stimulation was only observed with acetylcholine and carbachol, although at lower levels than seen for wild-type receptors. This altered agonist-specific

G protein coupling is explained by three active receptor conformational states. D97N (extracellular end, helix 3) reduced ligand affinity; i(AG °) values were approximately

1 kcal/mol for agonists and slightly less for antagonists. Agonist-promoted functional activity was similar to wild-type in extent and altered in EC50 consistent with the

'This work was supported by the National Institutes of Health Grants HL23632 and ES00210.

The abbreviations used are: DxN, an aspartate to asparagine mutation where the number x indicates the position that mutation was introduced; Dx.yN, an aspartate to asparagine double mutant where x and y indicated the two positions that mutations were introduced; CHO, Chinese hamster ovary; G protein, guanine nucleotide-binding protein; Kb KM, and KH, the low, medium, and high affinity equilibrium dissociation constants, respectively; Gpp(NH)p, guanylyl-imidodiphosphate; hyoscyamine, S -( )­ hyoscyamine; NMS, S-()-N-methylscopolamine; QNB, R-()-quinuclidinyl benzilate. 96 reduced agonist affinity. Due to poor expression D103N (helix 3) was characterized in better expressed double mutants. The D103 anion appeared to contribute 3-6 kcal/mol of binding energy to the stabilization of agonistreceptor complexes. Typical results from mutating the homologous residue in amine-binding G protein-coupled receptors is that functional activity is preserved with EC50s that are affected, consistent with the dramatically reduced agonist affinity when mutant receptors are expressed at appropriately high levels. In addition to its typical effect on ligand binding affinity,

D97.103N eliminated functional activity at saturating agonist concentrations and at receptor expression levels at which wild-type-like functional activity was observed in

D97N. Results from D69.97N indicated that the effects of D69N and D97N were approximately additive. Since the single mutant data was not available for D103, double mutant binding data from D69.103N and D97.103N were more difficult to interpret but the D103N mutation was not additive with D69N or D97N. Results from

D97.103N suggest that D97 and D103 have separate noncooperative roles in ligand binding. D97N displayed reduced expression compared to wild-type and D103N was very poorly expressed in CHO cells, however D97.103N was expressed as well as

D97N. Thermal inactivation studies suggested that these mutations had a small effect on receptor structure.

Introduction

Muscarinic acetylcholine receptors are members of a diverse group of receptors that are characterized structurally by a pattern of hydrophobic residues suggesting seven transmembrane domains, and functionally by coupling the binding of an extracellular activator to intracellular effector via G proteins. Five muscarinic receptor subtypes (ml m5) have been cloned and expressed (1-4). The odd-numbered subtypes couple preferentially to the stimulation of phospholipase C and the even-numbered subtypes couple preferentially to the inhibition of cAMP formation. The m2 subtype is 97 widely distributed in mammalian tissue and is the only subtype found in mammalian heart (3), where in the cardiac pacemaker cells it inhibits adenylyl cyclase and stimulates inwardly-rectifying potassium channels and phospholipid metabolism via pertussis toxin-sensitive G proteins. Agonist binding to the cardic m2 muscarinic receptors slows the rate and decreases the force of contraction of the heart by at least two mechanisms. Voltage-gated calcium currents, regulated via cAMP levels, are reduced and inwardly-rectifying potassium currents are increased directly by the binding of Gh (5).

The aspartate in transmembrane a-helix 2, residue D69 in the m2 muscarinic receptor, is conserved with some exceptions in the rhodopsin-like family of G protein- coupled receptors. D103 in helix 3 is conserved in the class of receptors that bind the biogenic amines acetylcholine, dopamine, histamine, 5-hydroxytrypamine, norepinephrine, and octopamine and in the opioid and somatostatin peptide-binding receptors. D97 at the extracellular end of helix 3 is conserved less strictly among receptors that bind biogenic amines. It is conserved among the muscarinic receptors, most dopamine, and some 5-hydroxytrypamine and a-adrenergic receptors; glutamate is found at the homologous site in the P-adrenergic and some a-adrenergic receptors, while acidic residues are missing in the histamine and octopamine receptors.

Double mutations involving the helix 2 aspartate have proved useful in other G protein-coupled receptors in identifying a spatial proximity between helix 2 and helix 7 near the cytoplasmic face. A reciprocal double mutant between the conserved helix 2 aspartate and a conserved asparagine in helix 7 of 5-hydroxytrypamine2A receptor

(N436 in m2 muscarinic receptor) restored the high affinity agonist binding and functional activity lost in the single aspartate to asparagine mutation (6). Combined with similar reciprocal double mutant data from the gonadotropin-releasing hormone receptor (7), where these residues are switched in the native receptor and the mutant 98 restored the typical arrangement of aspartate in helix 2 and asparagine in helix 7, led to the conclusion that these two residues are in close proximity and involved in a common hydrogen bond network (6). Helices 3 and 7 are in close proximity in rhodopsin where retinal is attached to a lysine in the middle of helix 7 via a protonated Schiff base the counterion for which is a glutamate at the intradiscal (extracellular homologous) end of helix 3 (8-10). Helices 3 and 6 are related to each other by the binding of agonist and perhaps functionally. A photoactivatable cross-linking analog of 11-cis-retinal predominantly labeled helices 3 and 6 (11); further studies led to a model of the light activation of rhodopsin that requires the relative rigid-body motion of helices 3 and 6 (12, 13). A tyrosine residue near the extracellular end of helix 6 was identified in the m3 (14) and m2 (15) muscarinic receptors as being involved in differential agonist binding to the active and inactive receptor conformations and affecting functional activity as the result (15). Rhodopsin projection structures (16, 17) suggest a close proximity of helices 2 and 3, and two highly conserved motifs that could conceivably interact are found at the intracellular ends of these helices and are thought to be involved in the signal transduction (18).

The conserved aspartates in helices 2 and 3 are suspected of having effects on functional activity (D69, helix 2) and agonist binding (D97 and D103, helix 3). To gain insight into how these effects might be related we examined the contribution these conserved aspartate residues make to the binding of receptor ligands and the roles they play in promoting the receptor state that is capable of activating G proteins both individually and in combination by examining both single and double mutants for each combination. To the best of our knowledge this is the first report of the examination of how these sites interact in any G protein-coupled receptor. 99 Materials and Methods Materials

[3H]QNB, [3H]NMS, [3H]oxotremorine M, and [14C]cAMP were purchased from DuPont NEN, [3H]adenine and [3H]myo-inositol from American Radio labeled Chemicals, acetylcholine and gallamine from Sigma, carbachol and pilocarpine from Aldrich, oxotremorine M and pirenzepine from Research Biochemicals, Gpp(NH)p from Boehringer Mannheim, Ro 20-1724 from Biomol, tissue culture media from

Gibco/BRL, and the pcDNA3 expression vector from Invitrogen. The pSVE expression vector was kindly provided by Genentech and AF-DX 116 was a kind gift from Boehringer Mannheim.

Tissue culture

CHO cells deficient in dihydrofolate reductase activity (dhfr) (19) were transfected by the calcium phosphate method (20) with the pSVE expression vector (2) containing the coding region of the porcine m2 muscarinic acetylcholine receptor. The pSVE expression vector contains a mouse dihydrofolate reductase gene that permits the establishment of stable transfected cell lines under the selective pressure of methotrexate (0.5-5 p,M). Clonal cell lines were grown in Dulbecco's modified Eagle's media/Ham's F-12 (DMEM/F12) minus glycine, hypoxanthine, and thymidine, plus

10% dialyzed calf serum and 10 tg/ml insulin. Cell lines were adapted to spinner culture as above except with 1 tg/ml insulin. For large scale preparations CHO cells were grown in DMEM/F12 plus 10% calf serum without selective pressure for 3-4 days prior to harvesting to allow more rapid growth. The addition of sodium butyrate (5 mM) in the last 12-24 h prior to harvesting increased receptor expression 2-9-fold

(21). CHO K1 cells, grown in DMEM/F12 plus 10% calf serum, were transfected by the lipofectase method with pcDNA3 expression vector containing D69.103N mutant 100 muscarinic receptor gene. The transfected clonal CHO K1 cells were maintained under the selective pressure of 400 tg/m1 geneticin.

Site-directed mutagenesis

The aspartate mutant porcine m2 muscarinic receptors D69N, D97N, D103N, and D97.103N were produced by oligonucleotide-directed mutagenesis by the method of Kunkel et al. (22), while D69.97N and D69.103N were produced by the method of

Vandeyar et al. (23). Double mutants were produced by sequential mutagenesis from single mutant templates. The wild-type coding region was ligated into M13mp18 as a

HindlIllEcoRI fragment derived from the pSVE expression vector (2). The mutations were introduced by priming second strand synthesis with the antisense oligonucleotides: 5"-GATGAGGTTAGCACAGGC-3' (D69N), 5'-CCAAAGGTTACACACCAC-3' (D97N), and 5'-CACGTAGTTCAGAGCTAG-3' (D103N) (base changes are underlined). Mutant sequences were confirmed by dideoxy sequencing (24).

Ligand binding

Ligand binding to enriched membrane preparations (25, 26) was assessed in 10 mM HEPES, 5 mM MgC12, 1 mM EDTA, 1 mM EGTA, pH 7.4 at 25 °C. After 4-6 h samples were filtered through Schleicher & Schuell #32 glass-fiber filter membranes, pretreated with 0.1% (w/v) polyethylenimine, on a Brandel Harvester (Gaithersburg,

Maryland) and washed with approximately 10 ml ice-cold 50 mM sodium phosphate,

1 mM EDTA, pH 7.4. Filter binding assays on D103N-containing mutants were done on samples that were chilled on ice briefly prior to 6 ml wash with ice-cold buffer. Nonspecific binding was assessed in the presence of excess unlabeled ligand. NMS and

QNB binding results are from direct binding of the radiolabeled ligand except for the

D97.103N mutant, where NMS affinity was determined in competition with [3H]QNB. 101

Other ligand affinities were determined in competition with either [3H]NMS or [3H]QNB or both.

Protein stability

Resistance to thermal inactivation was assessed in enriched membrane preparations in the presence and absence of saturating [3H]QNB (10-fold or greater K &. Membranes were exposed to different temperatures for 1 h, quenched on ice, and residual [3H]QNB binding determined.

Effector Coupling

Phosphatidylinositol stimulation was determined in attached CHO cells expressing mutant muscarinic receptor plated at 2 x 104/mm2 and incubated in 4

[3H]myo- inositol for 72 h. Agonists were added and inositol 1-phosphate accumulation was measured after 30 min at 37 °C as described by Lee et al. (27). Inhibition of forskolin-stimulated adenylyl cyclase activity was determined in attached confluent CHO cells in the presence of 100 [tM isobutylmethylxanthine, 50 [IM Ro 20­

1724, and agonist after exposing the cells to 8 pCi/m1 [3H]adenine for 2-3 h. The 20 min assay at 37 °C was started by the addition of 40 [tM forskolin and [3H]cAMP was determined according to the method of Salomon (28). In order to have comparable receptor densities, wild-type receptor levels were reduced in some experiments by incubating the cells 1 h at 37 °C with varying concentrations of the slowly dissociating antagonist QNB (29).

Data Analysis

Functional assays were fit to Equation 1, where [x] is the agonist concentration, max1,2 are the maxima of the inhibitory and stimulatory portions of the curve, min is the minimum of the curve, and p1,2 are the respective slope factors. For adenylyl cyclase assays that showed only an inhibitory phase the first two terms were used and 102 for assays of phosphatidylinositol metabolism stimulation the first and last terms were used.

max min max min CPM =min + 2 x [] (EC50S)2 1 + (EC50i) [x] ) (1)

In direct saturation binding experiments total bound radioligand was analyzed as the sum of specific, [RL], and nonspecifically, N[L], bound ligand according to the quadratic solution of Equation 2 and Equation 3, where [Ro] and [Lo] are the total receptor and ligand concentrations, K is the equilibrium dissociation constant, and N is the proportionality constant of nonspecifically bound ligand to free ligand concentration. [Rn) [Rn=([1?°][Rn)([1,0] (2) K(N +1)

[R1-]) N[n= N`[L0 (3) N + 1 Agonist and unlabeled antagonist binding was assessed in competition with radiolabeled antagonist. Agonist binding data were fit to one to three noninteracting classes of sites that bound antagonist with the same dissociation constant. Total labeled antagonist specifically bound, [RI], is the sum of that bound at each subclass of agonist binding sites according to the polynomial solutions to Equation 4,2

[RL] n F i[RolL01[Rn) K(N + 1)(1+ fp)+[4 ]_[Rn (4)

2Expanded solutions of these equations appear in the Appendix to this dissertation. 103 where [Rd equals the total concentration of receptor, Fi is fraction of [Ro] at site i, [Lo] is the total labeled antagonist concentration, [A] is the total agonist concentration (equal to the free concentration since no displacement occurs until [A] > [Rd), K is the dissociation constant for radiolabeled antagonist, and Ki is the dissociation constant for the agonist at site i (referred to as Kw Km, and KL, the high, medium, and low affinity constants).2 Data were fit by nonlinear least-squares procedures using Marquardt's algorithm (30) and parameter values are reported as the mean and 95% confidence interval of several determinations.

Ligand binding energetics

The difference in standard free energies for ligand binding between mutant and wild-type muscarinic receptors was calculated with Equation 5,

= AG°Mutant AG °Wild-type = RT ln(KmutantiKwi Id-type) (5) where AG° is the standard Gibbs free-energy change, R is the gas constant, T is the absolute temperature, and K is the equilibrium dissociation constant. A(AG°) is the apparent difference in binding energy contribution between the carboxylate anion of aspartate and the neutral asparagine amide (31); it does not take into account the changes in solvation of the mutant receptor or potential changes in receptor stability. A(AG°) is defined such that positive values indicate that the mutant binds ligand more weakly than wild-type.

Results

Mutagenesis and expression

Three aspartate residues located in the putative transmembrane region of the m2 muscarinic receptor were mutated individually and in pairs to asparagine and stably expressed in cloned CHO cells. Experiments on D103N and D69.103N expressing cell 104 lines were hampered by poor expression of antagonist binding sites. Similar problems precluded the characterization of the D103N homologous mutation in the ml muscarinic receptor (32). The limited data obtained on the D69.103N mutant was obtained from CHO cells transfected with an alternative expression vector (pcDNA3) and although clonal cell lines were isolated, expression of antagonist binding sites were not stable. Fortunately, the D97.103N mutant was stably expressed at high enough levels; since the D97N mutant was nearly fully functional (below) it was possible to characterize the effect of mutating residue 103 to asparagine. Except for an estimation of QNB affinity the D103N mutation was not characterized directly; an alternate expression vector was not pursued.

Binding studies

Ligand binding properties were assessed in sucrose gradient-enriched membrane preparations from spinner culture-adapted CHO cells. Characterization of the D103N-containing mutants was complicated by the high dissociation rate of radiolabeled antagonists QNB and NMS and the requirement for high-level expression due to the resulting low antagonist affinity of these mutants. The rate constant for QNB dissociation from D97.103N mutant at 0 °C was approximately 5 x 10-3 s-1 and 5-fold faster for NMS (data not shown). Because of this rate D103N-containing mutants were characterized with QNB via a slightly altered filter procedure (see Materials and

Methods). In control experiments QNB affinity constants were determined by an alternate procedure that used an air-driven ultracentrifuge to separate bound from free ligand and results were indistinguishable from those obtained by the modified filter assay.

The results of ligand binding studies are presented in Table 4.1. Antagonists

AF-DX 116, hyoscyamine, NMS, pirenzepine, and QNB bound to a single class of sites in both the wild-type and mutant receptors. Gallamine binds to a competitive site 105 and an allosteric site, which has the effect of reducing the dissociation rate of other ligands (33), but only the affinity for the competitive site was determined. Agonists appeared to bind to three classes of sites in membrane preparations containing wild- type m2 muscarinic receptor. The highest affinity site, KH, was sensitive to guanine nucleotide consistent with binding to the receptorG protein complex; the lower affinity site, KM, appeared to be the free receptor since its relative proportion increased in the presence of guanine nucleotides. The concentration of the lowest affinity site, KL, was not affected by guanine nucleotides and its role has not been assigned (29).

Agonist competition binding assays were conducted in the presence and absence of Gpp(NH)p, a nonhydrolyzable analog of GTP. Data obtained in the presence and absence of guanine nucleotides were fit so that values for KH, KM, and KL were shared in the analysis of a given experiment. Examples of some of these experiments appear in

Figure 4.1. Mutations incorporating D69N and/or D103N did not display high affinity guanine nucleotide-sensitive agonist binding in competition binding experiments; this site was evident only in wild-type and the D97N mutant. Additionally, no high affinity guanine nucleotide-sensitive [3H]oxotremorine M was detectable in the D69N mutant- expressing membrane preparations (data not shown). Values for A(AG°) between the asparagine mutant and the wild-type aspartate derived from the data in Table 4.1 are presented in Table 4.2 as are the double mutant cycle results for D69N , D97N, and D69.97N. The A(AG°)s for the D103N mutant were calculated as the difference between the D69.103N and D69N and between D97.103N and D97N: the A(AG°)s values calculated using D69.103N and D69N were significantly greater than the values calculated using D97.103N and D97N. 90T oicrej, umpqmnbg uopeposstp siumsuoa Joj -ppmadd pue welnui zw apnaBasntu ..unclaaaJ satuA NU alp paitiRIam LWOW ohg6 00uopuuoo um!4u/ alp Joquinu Jo pivawpadxa suoputquumap aae palvoTpuI ur sasatpuand

l-pllm ad, N69C1 NL6G NCOICI sIspiavviv

SINN INd CSZ -T St (SI) L6Z -T 09 (CI) ZLZ -T St (9)

SINZ) INd t'LT T 87 (90 9'81 T C'C (CI) +96 CT (VI) 000'IC -T 000`OLZ (z) - xa-iv 911 TATu IZ I T- 56 (L) OIZ T OTT (t) +9L9 CCI (Z) atnrclazualId juju 08Z T- 081 (8) OOL T OTC (9) OZL T 001 (t) auturEADsoiN TAlu Zt'I T- 9t0 (ZI) 56'0 T- LI*0 (t) II'Z T It'0 (C) aulurege2 1Alu 6t T- ZI (L) 08C -T OLT (5) Z.6t -T FL (Ti)

Fixs/sFuoBv auffolpikpor TAlu WI -T Gt.() (ZI) tC T CC (9)

Taptcfreo kV 9.0 -T 08'0 (6.1) ttI T 85* (t)

DUTIOUL1.110X0 IAI lAlu 9I -T 68'0 (01) t'CI -T 6'9 (t) au!drepoild Wu LZ -T- LI (8) 99Z T- 06 (i)

JAIffgis,mo.4( auffolpgiapt lArli 5C*0 T 60'0 (Si) 99'0 -T 61'0 (8) 8'L T- 5'5 (9) impecixeD INTI ILC' :- 9V0 (8C) CC T I C' (6) VC T CC (L) aupourDuoxo IA,t WTI Ot.0 T tI*0 (90 CC -T 5.0 (5) 0'5 -T C'Z (Z) auretrepoild TAIT! 8L7 :4-- WO (tI) Z7t :I: 86'0 (6) C*5 4-- 07 (C) quarilxs4

- - - aullotpiklaye IA111 FIT -T 6.0 (CI) O'CI T 9.8 (9) T 91 T 66 (9)

TOTTYBCI.TeD WTI LIZ T- L'C (LC) L'5Z T r6 (5) TOT T- 6t (L) oxo311110-wall IN TAIrl O'CI -T Z'8 (6) VOZ -T C'L (5) OLC T- OCCI (Z) auIclarpoild WTI 5Z T- 91 (6) Ct 'I- 9Z (t) 05C T 05Z (C) 107

Table 4.1, continued

D69.97N D69.103N D97.103N

Antagonists

NMS pM 675 ± 108 (5) 32,600 ± 7200 (9)

QNB pM 116 ± 51(7) 32,500 ± 5200 (3) 12,200 ± 2080 (13) AF-DX 116 nM 227 ± 191(3) 17,000 ± 7000 (5)

pirenzepine nM 1280 ± 110 (3) 9000 ± 1600 (5)

hyoscyamine nM 5.7 ± 4.6 (3) 110 ± 37 (5)

gallamine nM 110 ± 61(2) 12,200 ± 2080 (13)

AgonistsKH

acetylcholine nM

carbachol nM oxotremorine M nM

pilocarpine nM

AgonistsKm

acetylcholine .tM 1.9 ± 1.4 (4) 22,700 ± 16,000 (3) 21,700 ± 10,500 (5)

carbachol 11M 8.1 ± 3.1 (7) 30,000 ± 120,000 (2) 8800 ± 2000 (16)

oxotremorine M 1AM 3.2 ± 3.1 (4) 16,700 ± 15,700 (2) 1250 ± 350 (11) pilocarpine .tM 5.0 ± 3.1 (3) 740 ± 4300 (2) 1040 ± 130 (7) AgonistsKL acetylcholine i.tM 35 ± 10 (4) carbachol 1.tM 110 ± 27 (8) 183,000 ± 73,000 (8) oxotremorine M [tM 270 ± 160 (4) 133,000 ± 2.6x106 (2) pilocarpine .tM 120 ± 170 (3) 34,000 ± 21,000 (4) 108

Figure 4.1. Agonist displacement by oxotremorine M of wild-type and asparagine mutant muscarinic receptors in CHO cell membranes. Data were fit to independent classes of sites, described in Materials and Methods. The parameter values for the fitted lines are shown ± asymptotic standard errors. Wild-type KH= 3.0 ± 0.7 nM, Km= 0.18 ± 0.02 gM, KL = 7.5 ± 1.0 pm, total [3H]NMS = 2.1 nM, total receptor = 100 pM, Fri = 51.6 ± 2.2%, FM = 30.7 ± 2.8%, in the absence of Gpp(NH)p ( ), and FH = 0% (fixed), FM = 84.2 ± 1.6%, in the presence of 100 µM Gpp(NH)p (0 ). D69N KM = 8.1 ± 0.9 gM, KL = 166 ± 10 pM, total [3H]NMS = 4.1 nM, total receptor = 500 pM, FM = 55.7 ± 2.2%, in the absence of Gpp(NH)p ( ), and FM = 54.1 ± 2.3%, in the presence of 100 pm Gpp(NH)p (0 ). D97N KH = 12.9 ± 3.1 nM, KM = 4.8 ± 0.3 gm, KL = 488 ± 9 pM, total [3H]NMS = 1.7 nM, total receptor = 390 pM, FH = 37.9± 1.6%, FM = 57.7 ± 1.6%, in the absence of Gpp(NH)p (0 ), and FH = 19.4 ± 2.2%, FM = 76.1± 2.1%, in the presence of 100 pM Gpp(NH)p (0 ). D97.103N KM = 1000 ± 80 gm, total [3H]NMS = 35.7 nM, total receptor = 6.5 nM, in the absence of (9 ) and presence of 100 gM Gpp(NH)p (0 ). Fraction of total receptor specifically bound is plotted. 109

0.8­

0.6­

0.4­

0.2­

0.0­

1 i 1 10 8 6 4

0.8­

0.6­

a 4­

0.2

7 6 5 4 3 2 Iog[oxotremorine M] (M)

Figure 4.1 110

10 8 6 4 2

0.6 a5

0.4 a3

0.2 ­ a1­

0.0 I i 7 6 5 4 3 2 1

Iog[oxotremorine M] (M)

Figure 4.1, continued 111

Table 4.2. A(AG°) for m2 muscarinic receptor aspartate mutants. A(AG°) = AG° (mutant) AG° (wild-type). A(AG°) values were calculated from data in Table 4.1 and are presented kcal/mol ± 95% confidence interval; ns, indicates value not significantly different from zero.

D69N D97N D103N D69.97N D69.103N Antagonists

NMS ns ns 0.58 ± 0.13

QNB ns 1.01 ± 0.12 4.44 ± 5.15 1.12 ± 0.26 4.46 ± 0.11

AF-DX 116 ns 0.69 ± 0.27 ns

pirenzepine 0.53 ± 0.41 0.55 ± 0.37 0.89 ± 0.37

hyoscyamine ns ns 0.82 ± 0.48

gallamine 1.21 ± 0.28 ns 0.48 ± 0.27

Agonists-KHa

acetylcholine 1.86 ± 0.60

carbachol 0.83 ± 0.32

oxotremorine M 1.08 ± 0.32

pilocarpine 1.35 ± 0.38

Agonists-Kma

acetylcholine 0.38 ± 0.21 1.84 ± 0.43 0.99 ± 0.43 6.57 ± 0.12 carbachol 0.55 ± 0.22 0.54 ± 0.59 1.05 ± 0.24 5.92 ± 2.47

oxotremorine M 1.28 ± 0.61 1.50 ± 0.21 1.23 ± 0.45 6.31 ± 0.23 pilocarpine ns 0.38 ± 0.20 0.34 ± 0.29 3.31 ± 3.57 Agonists-ka

acetylcholine ns 1.39 ± 0.52 0.68 ± 0.24

carbachol ns 0.91 ± 0.30 0.96 ± 0.17

oxotremorine M ns 1.98 ± 0.75 1.80 ± 0.43 pilocarpine ns 1.56 ± 0.43 0.95 ± 0.64 a Indicates the equilibrium constant for which the A(AG°) values were calculated. A(iG°) for D103N mutation calculated from the difference between the double and single mutants. 112

Table 4.2, continued

D69.103N D97.103N D69.103N D97.103N D69.97N D69Nb D97Nb (D69N + D97N)

Antagonists

NMS 2.88 ± 0.16 2.84 ± 0.06 0.445 ± 0.076

QNB 4.46 ± 0.11 3.88 ± 0.13 4.42 + 0.08 2.87 ± 0.06 ns

AF-DX 116 2.60 ± 0.32 1.91 ± 0.16 -0.73 ± 0.19

pirenzepine 2.05 ± 0.38 1.50 ± 0.21 0.83 ± 0.25

hyoscyamine 2.57 ± 0.35 2.34 ± 0.15 ns

gallamine 2.10 ± 0.23 2.10 ± 0.06 -0.64 ± 0.22

Agonists-KHa

acetylcholine carbachol

oxotremorine M pilocarpine

Agonists-Kma

acetylcholine 6.57 ± 0.12 6.54 ± 0.29 6.19 ± 0.23 4.70 ± 0.34 -1.23 ± 0.39

carbachol 5.92 ± 2.47 5.19 ± 0.15 5.4 ± 2.6 4.66 ± 0.54 ns oxotremorine M 6.31 ± 0.23 4.77 ± 0.25 5.03 ± 0.50 3.27 ± 0.07 -1.56 ± 0.47 pilocarpine 3.31 ± 3.57 3.51 ± 0.17 ns 3.13 ± 0.09 ns

Agonists-KLa acetylcholine -0.81 ± 0.25 carbachol 5.36 ± 0.25 4.44 ± 0.24 ns oxotremorine M ns 3.49 ± 0.48 -0.44 ± 0.35 pilocarpine 4.27 ± 0.45 2.71 ± 0.20 -0.94 ± 0.40 aIndicates the eauilibrium constant for which the MAG°1 values were calculated bA(AG°1 for Dl OW mutation calculated from the difference between the double and single mutants. 113

Thermal inactivation

Resistance to irreversible thermal inactivation in the presence and absence of the antagonist QNB was used to assess the effects of the mutations on m2 muscarinic receptor structure (Table 4.3). The QNB-bound receptor state was clearly more stable to thermal inactivation than the unliganded state in the wild-type receptor. The D69N mutant was indistinguishable from wild-type receptor in its resistance to thermal inactivation of ligand binding. The loss of this aspartate charge did not significantly destabilize receptor structure. In the absence of QNB the differences between all mutants were either small or not significant. The effect of mutations was mainly seen in the receptor state that was stabilized in wild-type by QNB binding. In mutants missing the anionic charge at residue 103 (D69.103N and D97.103N) the stabilizing effect of QNB binding on thermal inactivation was eliminated. For mutants missing the aspartate charge at residue 97 (D97N and D69.97N) the results are less dramatic but the amount of stabilization to thermal inactivation by QNB was reduced.

Table 4.3. Irreversible thermal inactivation of mutant and wild-type m2 muscarinic receptor in presence and absence of saturating QNB. Mean T05 (°C) are presented ± 95% confidence interval and the number of experiments are indicated in parentheses.

-QNB +QNB Apairwisea

Wild-type 54.1 ± 1.6 (15) 60.2 ± 1.3 (16) 6.2 ± 0.9 (15)

D69N 56.1 ± 1.9 (3) 62.1 ± 0.8 (3) 6.1 ± 2.9 (3)

D97N 53.8 ± 1.5 (3) 57.6 ± 2.7 (3) 3.8 ± 1.0 (3)

D69.97N 51.0 ± 4.8 (4) 55.4 ± 4.1 (4) 4.6 ± 2.5 (4)

D69.103N 52.9 ± 1.4 (3) 53.1 ± 0.7 (3) ns (3)

D97.103N 50.4 ± 4.9 (3) 50.3 ± 4.3 (3) ns (2) aThe stabilizing effect of QNB calculated as the paired difference for experiments that simultaneously determined the Ta5 in the presence and absence of QNB; ns indicates that QNB did not significantly affect stability. 114

Functional activity

Functional coupling of the mutant receptor was analyzed in attached tissue culture cells and the results compared to wild-type receptor at similar expression levels. Results with the wild-type expressing cell line varied with receptor density. To provide a valid basis of comparison the receptor density of the wild-type expressing cell line was reduced with the slowly dissociating antagonist QNB (29). The m2 muscarinic receptor-expressing cell line stimulated phosphatidylinositol metabolism to a maximal extent that varied proportionally with receptor density while the concentration of agonist that produced a half-maximal response (EC50) was independent of receptor density (Table 4.4). In contrast, the EC50 for the inhibition of adenylyl cyclase was inversely proportional to receptor density while the maximal response did not vary significantly with acetylcholine, carbachol, and oxotremorine M. Maximal response with pilocarpine was less than the other agonists at low receptor density, displaying partial agonism, and equal in extent to the other agonists at high receptor density

(Table 4.5). In addition, the effect on cAMP levels was biphasic, inhibitory at low agonist concentration and stimulatory at high agonist concentrations. The pertussis toxin-insensitive stimulatory phase was only observed at relatively high expression levels and increased proportionally with receptor level; the EC50 for stimulation of adenylyl cyclase was inversely proportional to receptor density. The D97N mutant was the most wild-type-like of the asparagine mutant receptors. The D97N mutant inhibited cAMP formation to an extent indistinguishable from wild-type and stimulated phosphatidylinositol metabolism to an extent slightly less than wild-type at comparable receptor densities. The stimulation of cAMP formation observed in wild-type was also observed in the D97N mutant but only at the highest receptor density examined. The highest receptor density available in cells expressing the D97N mutant was approximately half the density required in the 115

Table 4.4. Effect of aspartate mutant muscarinic receptor on phosphatidylinositol stimulation. Values for ECK, and fold maximal stimulation of phosphatidylinositol metabolism are shown for the indicated receptor site densities; n, indicates the number of experimental determinations; ns, indicates that no significant stimulation was observed. 116

n EC50 a Fold Stimulation" [R]

(,11\11) (pmol.dm-2)

acetylcholine 19 0.13 ± 0.11 1.2-2.3 0.3-32

carbachol 27 1.4 ± 0.8 1.2-2.7 1.6-42

oxotremorine M 34 0.45 ± 0.64 1.2-2.4 1.2-42

pilocarpine 12 14 ± 12 1-1.8 1.6-32 D69N

acetylcholine 5 ns 15-120

carbachol 5 ns 65-120

oxotremorine M 5 1.0 ± 1.4 1.41 ± 0.13 65-120

pilocarpine 2 ns 65-69 D97N

acetylcholine 4 23 ± 28 2.13 ± 0.29 7-10

carbachol 6 10.2 ± 2.0 1.73 ± 0.24 7-38

oxotremorine M 4 4.2 ± 2.2 1.79 ± 0.23 7-10

pilocarpine 2" 31 ± 17 1.47 ± 0.09 10 D69.97N

acetylcholine 3 ns 10-27

carbachol 7 ns 10-27

oxotremorine M 7 17 ± 14 1.42 ± 0.12 6-25

pilocarpine 2 ns 14

D97.103N

acetylcholine 5 ns 3.8-15.9

carbachol 4 us 3.8-15.9

oxotremorine M 5 ns 3.8-15.9

pilocarpine 4 ns 3.8-15.9 aEC50 and fold maximal stimulation values are presented ± standard deviation or for wild-type fold maximal stimulation as a range that increased with [R]. bWild-type data include experiments where the cell surface receptor density was reduced by incubating the cells with QNB to provide a wide range of receptor densities for comparison with mutants. cln two additional experiments pilocarpine failed to stimulate phosphatidylinositol metabolism significantly ([R] = 7-9 pmol.dm-2). 117

Table 4.5. Effect of aspartate mutant muscarinic receptor on adenylyl cyclase activity. Values for EC50, percent inhibition, and fold stimulation of adenylyl cyclase are shown for the indicated receptor site densities; n, indicates the number of experimental determinations; ns, indicates that no significant effect was observed.

n EC50i (PO Inhibition EC50s (1.1M)d Fold [R] (%)b stimulationb (pmoldm-2)

wild -types

acetylcholine 7 0.005-0.093 78.3 ± 9.6 1.3-33,000 0-1.6 4-50

carbachol 18 0.0002-39 63.2 ± 8.1 4.8-180 0-2.6 1-60

oxotremorine M 11 0.003-0.45 76.0 ± 4.4 1.6-10,000 0-1.2 4-73

pilocarpine 17 0.8-60 30-79 ns 3-52 D69N

acetylcholine 6 ns 0.56 ± 0.53d 1.29 ± 0.12 20-200

carbachol 4 ns 1.15 ± 0.72d 1.35 ± 0.14 20-200

oxotremorine M 10 10.2 ± 8.6d 40.6 ± 4.7 ns 20-200

pilocarpine 2 ns ns 84 D97N

acetylcholine 2 0.13-0.39e 75.9 ± 3.5 10f 0.5f 15-26

carbachol 5 0.49-10e 75.6 ± 6.1 730f 0.7f 4.7-26

oxotremorine M 4 0.1-3e 80.3 ± 2.7 36f 0.61 4.7-26 pilocarpine 5 19-200e 28-74 ns 4.7-26 dEC50 values for the inhibitory (EC50i) and the stimulatory phase (EC50s) that are reported as a range varied inversely with [R] while values that are reported ± standard deviation appeared to be constant over the indicated range of [R]. bInhibition and stimulation values that are reported as a range varied proportionally with [R] while values that are reported ± standard deviation appeared to be constant over the indicated range of [R]. cWild-type data include experiments where the cell surface receptor density was reduced by incubating the cells with QNB to provide a wide range of receptor densities for comparison with mutants. dThe observed wild-type oxotremorine M EC50i for this receptor site density is 7-9 nM; the observed wild-type EC50s is 1-10 [IM for acetylcholine and 4-20 aM for carbachol. efhe observed wild-type EC50i for [R] = 26 pmol dm-2 is 9.6 nM, 40 nM, 8.5 nM, and 3 pM for acetylcholine, carbachol, oxotremorine M, and pilocarpine, respectively. (Data are the results of a single experiment at 26 pmol dm-2; in addition oxotremorine M stimulates at 15 pmol dm-2 (150 KM, 0.3 fold) while acetylcholine and carbachol did not. 118

Table 4.5, continued

EC50i (1-1Mr Inhibition EC50s (113,4)a Fold [R] (%)b stimulationb (pmoldm-2)

D69.97N acetylcholine 7 ns ns 4-27 carbachol 9 ns ns 4-27 oxotremorine M 8 167 ± 1008 41 ± 16 ns 4-27 pilocarpine 2 ns ns 12

D97.103N acetylcholine 3 ns ns 2-33 carbachol 3 ns ns 2-33 oxotremorine M 5 ns ns 2-33 pilocarpine 2 ns ns 2-23 aEC50 values for the inhibitory (EC50i) and the stimulatory phase (EC50s) that are reported as a range varied inversely with [R] while values that are reported ± standard deviation appeared to be constant over the indicated range of [R]. bInhibition and stimulation values that are reported as a range varied proportionally with [R] while values that are reported ± standard deviation appeared to be constant over the indicated range of [R]. gThe observed wild-type EC50i for [R] =27 pmol dm-2 is 8.5 nM. 119

Figure 4.2. Stimulation of phosphatidylinositol metabolism by aspartate mutant muscarinic receptors. Illustrated experiments were conducted on whole attached CHO cells expressing mutant receptor at the following levels (pmol dm-2): D69N, 120 (0 , ), 69 (A , V ); D97N, 10; D69.97N, 14; and D97.103N, 10 (0, ), 16 (A , V ). The lines represent logistic fits of the data where significant stimulation was observed, as described in Materials and Methods. Symbols: acetylcholine (0), carbachol ( ), oxotremorine M (A ), pilocarpine (V ), filled symbols indicate response in the presence of the antagonist hyoscyamine.

Figure 4.3. Effect of aspartate mutant muscarinic receptors on cAMP formation. Illustrated experiments were conducted on whole attached CHO cells expressing mutant receptor at the following levels (pmol dm-2): D69N, 200 (0 , 0, A), 84 (V ); D97N, 26; D69.97N, 20 (0 ), 17 (0, A , V) and D97.103N, 33 (0 , , A ), 23 (V ). The lines represent logistic fits of the data where significant stimulation was observed, as described in Material and Methods. Fitted parameters are summarized in Table 4.5. Symbols: acetylcholine (0), carbachol ( ), oxotremorine M (A ), pilocarpine (V ), filled symbols indicate response in the presence of the antagonist hyoscyamine. 120

2.5

2.0 N

0"D 1.5 u..,

1.0

10 8 6 4 2

2.5 D69.97N

2.0 a)

0 1.5 U­

A 1.0 V

8 6 4 2 Iog[agonist] (M)

Figure 4.2 121

2.5

2.0 a) IJ 0 1.5 U­

1.0

10 8 6 4 2

2.5 D97.1 03N

0 A8 v v40 W v0 Va 1.0 v 1 0 v A o 0 O t 9 t il

1 I I I 1

5 4 3 2 1 0 log[agonist] (M)

Figure 4.2, continued 122

1.4 a 0 v 1.2 v a Ve 1.0 0 0 V VA V. v =a) AV vw w -0 0.8 A '4 0 v u_ A 0.6

0.4 _ D69N

10 8 6 4 2

1.4

1.2 v v v 0 i 0 V o rz V 0 8 2 Do o 8 8 0

0.6 A

0.4 D69.97N

1 1 8 6 4 2 Iog[agonist] (M)

Figure 4.3 123

1.4

1.2

45 1.0 w 0 0.8 0.6

0.4

10 8 6 4 2

1.4 0 A A 1.2 V 8 0 A 0 V 0 A 0 8 i i 1-..) 1.0 3 0 0 A 0 a) V V 8 v 0 V 0 @ t 9 0 El A 0 -o 0.8 - 0 3 A 0 A u_ 0.6

0.4 D97.1 03N

6 5 4 3 2 1 Iog[agonist] (M)

Figure 4.3, continued 124 wild-type-expressing cell line needed to accurately quantitate this effect, making a comparison unreliable. The changes in EC50s for agonist stimulation of phosphatidyl­ inositol metabolism and inhibition of cAMP formation are consistent with the decreased agonist affinity (Table 4.1).

The D69N and D69.97N mutant-expressing cell lines did not stimulate phosphatidylinositol metabolism or inhibit adenylyl cyclase activity with the agonists acetylcholine, carbachol, or pilocarpine. In contrast, oxotremorine M partially activated both effector systems (Figures 4.2 and 4.3, Tables 4.4 and 4.5). The changes in EC50 for both effects are consistent with the decreased agonist affinity (Table 4.1). Acetylcholine and carbachol stimulated adenylyl cyclase activity in the D69N expressing cell line to an extent that was less than the similar stimulation observed in the wild-type expressing cell line with an EC50 that was similar to that observed in wild-type. As was found for this effect in wild-type (29), pertussis toxin did not eliminate it suggesting that it was not a Gi or Go dependent process. The EC50 observed in D69N for the stimulation of adenylyl cyclase was not significantly different from wild-type but the maximal effect was less than found in wild-type at comparable receptor density.

The D97.103N mutant was alone among the three D103N-containing mutants in that, as measured by antagonist binding, it was expressed at high enough levels to allow valid comparisons of its ability to activate effector systems. The D97.103N mutant at saturating agonist concentrations did not appear to stimulate phosphatidylinositol metabolism or inhibit adenylyl cyclase activity at receptor densities where these responses are observable for the D97N mutant.

Discussion

In seeking to understand the relationship between agonist binding and receptor activation double mutants of the conserved aspartate in the second transmembrane 125 helix and the conserved aspartates in the third transmembrane helixwere examined.

Potential interactions between the two helix 3 aspartates were also examined. The conserved aspartate residue in helix 2 (D69 in the m2 muscarinic receptor) is known to be involved mainly in signal transduction. The conserved aspartate residue in helix 3 (D103 in the m2 muscarinic receptor) plays a significant role in the binding of ligands in the amine-binding receptors, while the aspartate at the extracellular end of helix 3 (D97 in the m2 muscarinic receptor), conserved in the muscarinic receptors and less strictly among other amine-binding receptors, plays a less significant role in ligand binding. Neither of these two helix 3 residues was thought to play a significant role in the receptor signal transduction that could not be ascribed to reduced agonist affinity. We found this to be true for D97 but not true for D103.

The role of D103

Among G protein-coupled receptors that bind biogenic amines the carboxylate residue in the third transmembrane helix (D103 in the m2 muscarinic receptor) has been shown to be critical for binding of agonists and antagonists (34-41). In the x2­

(36) and 02-adrenergic (35), 5-hydroxytrypaminem (41), and 5-hydroxytrypamine2

(37) receptors the effect of mutating this site to asparagine appears limited to ligand affinity. The functional activity of these receptors was preserved and their EC50s were affected consistent with their dramatically decreased agonist affinity. In muscarinic receptors this site is critical for both agonist binding and functional activity. The homologous mutation in the ml muscarinic receptor eliminated acetylcholine- promoted phosphatidylinositol stimulation while the glutamate mutation preserved partial activity (39). Results with the D97.103N double mutant when compared with the D97N mutant indicate that the incorporation of asparagine at residue 103 eliminated both high affinity agonist binding and receptor functional activity. 126

The dramatic decrease in ligand affinity that occurs when this negatively charged group is substituted by an uncharged polar group (Tables 4.1 and 4.2) suggests that D103 is the ligand amine counterion. This conclusion is supported by experiments in the ml muscarinic receptor where agonist (42) and antagonist (43, 44) affinity alkylating agents modified and sequencing experiments identified the homologous aspartate as being in the binding pocket. However, this conclusion must be considered tentative in the absence of high resolution structures of the receptor and receptor ligand complexes and an alternative mechanism for the binding of amine ligands.

Aromatic cation-ic binding of acetylcholine was observed in the high resolution structure of acetylcholinesterase (45), implicated in the binding of acetylcholine to the nicotinic acetylcholine receptor (46, 47), and proposed for m2 muscarinic receptor in combination with an anionic site (48). In the acetylcholinesterase crystal structure a conserved glutamate residue is positioned at the bottom of a solvent-accessible pit lined with aromatic residues. The structure indicated that the quaternary ammonium ion on acetylcholine interacted with the TC ring current on the aromatic residues not the conserved glutamate (45). Subsequent site-directed mutagenesis experiments on this glutamate provided support to the conclusion that it is not part of the acetylcholine binding site (49, 50). The muscarinic receptor also has a large number of aromatic residues in and near the transmembrane a-helices that could conceivably form a similar aromatic lined pit with aspartate at the bottom, but unlike the mutagenesis results on acetylcholinesterase, eliminating the charge dramatically affects binding in muscarinic receptors. Aromatic residues do play a role in the binding of amine ligands as indicated by site-directed mutagenesis studies on transmembrane aromatic residues in the m3

(14, 51) and m2 muscarinic receptors (15), but evidence to date indicates that role to be secondary to the role of the anionic site D103. 127

The lack of a functional response in the cell line expressing the D97.103N mutant and the lack of guanine nucleotide-sensitive agonist binding suggest two possible explanations of the role of D103 with respect to receptor activity. First, the active receptor conformation exists in equilibrium with the inactive conformation but agonist cannot differentially stabilize it, D103 being significantly more important to the active agonist-bound receptor conformation that interacts with G protein than to the inactive agonist-bound conformation. At the extreme where agonist binds to both conformations with equal affinity, agonist binding would have no effect on the distribution of active and inactive receptor conformational states. Although the total concentration of active receptor would be unaffected, the formation of agonist receptorG protein ternary complex from receptorG protein binary complex could result in functional activity in the absence of measurable guanine nucleotide-sensitive agonist binding. A second possibility is that the active conformation of the receptor is dependent on the presence of an anionic residue at position 103. In its absence the conformational transition to the active state does not occur so that only the inactive conformation exists in the mutant receptor. In light of the results from the D69N­ containing mutants, where partial activity was preserved in the absence of high affinity guanine nucleotide-sensitive agonist binding, the second possibility appears to be the best explanation. Poor expression of antagonist binding sites prevented direct characterization of the D103N mutation in CHO cells. When the D103 homologous residue was mutated to asparagine in the ml muscarinic receptor mRNA blots from stably transfected CHO cells indicated that gene transcription was unaffected; specific [3H]QNB binding however was undetectable (32). Agonist affinities for this cell line were later determined by competition binding when specific [3H]NMS binding was detected (39). Mutant proteins containing glutamate at this site were better expressed (38, 39) while 128 expression of an alanine mutant was undetectable (38). These results and those reported here lead to the conclusion that the absence of a carboxylate-bearing functional group at this location introduced a barrier to proper protein folding or processing in muscarinic receptors but leaves unexplained the compensating effect of the mutation at residue 97 observed in the double mutant D97.103N. The involvement of this conserved residue in protein folding or processing is not a general characteristic of this class of receptors, as homologous mutations in 02-adrenergic (34), a2A-adrenergic

(36), 5-hydroxytrypamine2 (37), and histamine H1 (40) receptors, other G protein- coupled receptors that bind biogenic amines, appeared to be well tolerated. Asparagine mutations at this homologous site in the histamine H2 (52) and the dopamine D2 (53) receptors also resulted in undetectable cell surface expression; however, it is unclear if this was due to poor protein expression or dramatically decreased ligand affinity.

The role of D69

The D69N and D69.97N mutant-expressing cell lines display agonist-specific functional activity and agonist-specific changes in the specificity of functional activity. D69N and D69.97N failed to stimulate phospholipase C or inhibit adenylyl cyclase via acetylcholine, carbachol, or pilocarpine but were capable of eliciting a functional response with oxotremorine M. High affinity guanine nucleotide-sensitive agonist binding was not observed in competition experiments with any agonist or in the more sensitive direct binding of [3H]oxotremorine M. Except for the lack of detectable guanine nucleotide-sensitive high affinity agonist binding, D69 does not contribute significant energy to the binding of ligands with the exception of the antagonist gallamine and the agonist oxotremorine M (Table 4.2).

The explanation that is most consistent with the data is that an acidic residue at position 69 is critical to the binding of agonist to the high affinity guanine nucleotide- sensitive agonist binding site. Microscopically, D69 might contribute binding energy to 129 the stabilization of agonist in the binding pocket when the receptor is in its active conformation and bound to G protein or by stabilizing the active receptorG protein complex. Since this aspartate is conserved across the rhodopsin-like family of G protein-coupled receptors, the possibility that D69 stabilizes the active conformation of the receptor is the more likely explanation.

Until now there has been little reason to suspect there was more than a single active receptor conformation. Phospholipase C stimulation and the biphasic inhibition and stimulation of adenylyl cyclase could be adequately explained by different G proteins interacting with a single active receptor conformation. Different agonist-bound states, although formally distinct, appeared to activate G proteins in a manner that was approximately dependent on the binding characteristics of the specific agonist. This was not so with the D69N and D69.97N mutants. The receptor conformation that results in high affinity guanine nucleotide-sensitive agonist binding was either lost or its affinity was dramatically altered in the D69N-containing mutants; the simplest explanation is that any effects originating from this state would be lost or similarly altered. This adequately explains the loss of adenylyl cyclase inhibition and phospholipase C stimulation promoted by acetylcholine, carbachol, and pilocarpine and the loss of adenylyl cyclase stimulation promoted by oxotremorine M. The observed oxotremorine M-promoted adenylyl cyclase inhibition and phospholipase C stimulation and the adenylyl cyclase stimulation promoted by acetylcholine and carbachol suggest alternative or additional agonist-specific routes to these effects were available. The results with the D69N and D69.97N mutants can best be explained by three active receptor conformations, at least two of which are strongly agonist-dependent. The loss of high affinity guanine nucleotide-sensitive agonist binding was correlated with the loss of adenylyl cyclase inhibition and phospholipase C stimulation by acetylcholine, carbachol, and pilocarpine but not by oxotremorine M. Oxotremorine M appeared to 130 stabilize an active receptor conformation in the mutants that was different from the conformation associated with high affinity guanine nucleotide-sensitive agonist binding in wild-type.

An alternative explanation is that the active receptor conformations are essentially the same qualitatively but are diminished quantitatively between the wild- type and the mutant. This is possible but cannot easily explain the relatively small change in the extent of phospholipase C stimulation observed in D69N-containing mutants. Since the EC50s for adenylyl cyclase inhibition and phospholipase C stimulation were different in wild-type they could have resulted from different G proteins that have different affinities for the active receptor conformation. A decrease in this affinity would affect all G proteins interacting with this receptor conformation. A dramatic loss in receptorG protein affinity, observed as the loss of high affinity guanine nucleotide-sensitive agonist binding, would be expected to have a dramatic effect on EC50 for adenylyl cyclase inhibition, a smaller effect on the EC50 for phospholipase C stimulation, and a dramatic effect on the extent of phospholipase C stimulation. In the D69N mutant the EC50 for phospholipase C stimulation was unchanged. If there were two G proteins with different receptor affinities responsible for these effects, then phospholipase C stimulation (the lower affinity effect) should not have been observable in a mutant that results in a dramatic decrease in receptorG protein affinity (29). A second alternative involves a single G protein (or a repertoire of

G proteins that act similarly) stimulating both the inhibition of adenylyl cyclase and the stimulation of phospholipase C. Pertussis toxin-sensitive stimulation of phospholipase

Cfr is thought to occur via G protein fry subunits and to require a relatively high concentration (54) while adenylyl cyclase inhibition occurs principally via the ai subunit. As in the first alternative the EC50s for both effects should have been shifted and phospholipase C stimulation should have been the more difficult effect to observe. 131

Phospholipase C stimulation was observable and its EC50 was not significantly shifted in the D69N mutant. An agonist-specific active receptor conformation best explains the adenylyl cyclase stimulation observed in the D69N mutant, which occurs via a pertussis toxin- insensitive G protein, unlike the other effects. This effect in wild-type was the weakest and was observed only at high receptor levels. In the D69N mutant, which expressed receptor at very high levels, adenylyl cyclase stimulation was observed only with acetylcholine and carbachol. This stimulation was unlikely to have occurred via the same active receptor conformation that was responsible for high affinity guanine nucleotide-sensitive agonist binding because that would also result in adenylyl cyclase inhibition and phospholipase C stimulation, which were not observed with these agonists. It was also unlikely to occur via the second active receptor conformation, which oxotremorine M stabilizes, because acetylcholine and carbachol do not stabilize a similar conformation. There is little evidence that these additional agonist-specific active receptor conformations exist and are significant routes to receptor activation in the wild-type receptor; however, they are present and significant in the D69N mutant.

The mutagenesis of the D69 homologous residues in the rhodopsin-like family of G protein-coupled receptors has typically resulted in reduced agonist affinity, especially the guanine nucleotide-sensitive component of agonist binding, and functional activity that was either eliminated or reduced (6, 32, 34-37, 55-61). The D69N mutant exhibits an agonist-specific change in the specificity of functional activity, a characteristic shared with the a2-adrenergic receptor. The mutation in the a2-adrenergic receptor resulted in the elimination of the wild-type ability to stimulate inwardly-rectifying potassium currents but the inhibition of adenylyl cyclase and voltage-gated calcium currents were relatively unaffected (57). The m2 muscarinic receptor and the a2-adrenergic receptor share a similarity that most effects are 132 mediated by pertussis toxin-sensitive G proteins. The change in specificity observed in the m2 muscarinic receptor and in the a2-adrenergic receptor suggest that this homologous aspartate plays an additional role in G protein specificity that may be limited to G protein-coupled receptors that mediate their effects predominantly through pertussis toxin-sensitive G proteins.

The role of D97

This conserved residue is thought to contribute moderately to the stabilization of the ligand-bound receptor state. When similarly mutated in the 132-adrenergic receptor (EA) there was no effect on antagonist or agonist affinity but in the ml muscarinic receptor (D -*N) these effects were greater (32). The effects reported here for this conserved site in the m2 muscarinic receptor are similar to the ml subtype results. The m2 muscarinic receptor is better suited than the ml subtype to evaluate effects on agonist binding because agonist affinities are well separated and clearly defined in competition binding assays.

The results of functional coupling assays (Tables 4.4 and 4.5) agree with decreased binding affinity (Table 4.1) for agonists for the D97N mutant. The agonist binding affinities to the guanine nucleotide-sensitive high affinity site (KH values,

Table 4.1) were decreased by an average 11-fold for the four agonists between the wild-type and D97N and by an average 10-fold for the free receptor (KM values). D97 appeared to contribute approximately the same amount of binding energy for agonist to the G protein-coupled state as it does to the free receptor. The results indicate that the role of D97 is limited to providing slightly more than approximately 1 kcal/mole of binding energy on average to the binding of agonists and slightly less to the binding of antagonists (Table 4.2). Located at the extracellular end of the putative transmembrane ligand binding domain, D97 is well positioned to serve as a secondary anionic site in a 133 sequential amine ligand binding mechanism. Binding data support such a role for this residue.

Thermal inactivation

Results from thermal inactivation studies (Table 4.3) suggest that the D69, D97, and D103 are not critical for structural stability of the unliganded state. QNB stabilized the wild-type and mutant receptors that contained aspartate at position 103 to thermal inactivation; in D103N-containing mutants the stabilizing effect was lost. The simplest explanation is that D103 has a role in protein stability distinct from its role in ligand binding. Alternatively, QNB might bind the receptor in an additional or alternative manner. The possibility of an additional site was examined. Equilibrium binding experiments on the wild-type receptor membranes conducted at sufficiently high QNB concentrations to observe a low affinity site similar to the one observed in the

D69.103N and D97.103N mutants failed identify such a site (data not shown). This negative result does not exclude the possibility of an additional site because the site may only exist in D103N-containing mutants. The significance of the QNB-dependent thermal stability to agonist-bound receptor states in unclear. Far-UV CD spectra of detergent-solubilized purified m2 muscarinic receptor were indistinguishable in the unliganded versus the agonist-bound states; however, the QNB-bound state contained

4% less a-helix and 4% more a-sheet than the unliganded state (26). Negative antagonism observed in adenylyl cyclase assays was interpreted as the binding of QNB to give a receptor state that is different from the unliganded and the agonist-bound states (29).

Effects of double mutants

Results from the D69.97N double mutant indicate that the effects of D69N and

D97N on binding equilibria were approximately additive (Table 4.2) (62). The 134 interpretation of the double asparagine mutants between D69 and D103 and between

D97 and D103 is complicated by the lack of any more than an estimate of QNB affinity to the D103N single mutant. The data are consistent with additivity or superadditivity, where the effect of the double mutant is greater than the sum of the individual mutants, between D69N and D103N and/or with additivity or subadditivity, where the effect of the double mutant is less than the sum of the individual mutants, between D97N and

D103N. Complicating any interpretation are the effects that these mutants had on protein structure and stability. Thermal inactivation studies suggest that these mutational effects on protein stability were small, but even a small effect may have a large effect on ligand binding.

An interesting question is whether D97 and D103, positioned close to each other in helix 3, are capable of cooperative binding of ligand or have separate roles. If they cooperate in the binding of ligand the expected outcome of the double mutant is a synergistically deleterious (superadditive) effect on ligand binding. Since D97.103N binds ligands with higher affinity than D69.103N a lack of cooperativity or separate roles for D97 and D103 is the simplest explanation.

Another interaction between D97 and D103, unrelated to ligand binding equilibrium, was the effect of D97N and D103N on the expression of antagonist binding sites. As measured by antagonist binding, D97N was more poorly expressed than wild-type and D103N was very poorly expressed but the double mutant D97.103N was expressed approximately as well as D97N. It is not known if this reduced cellular expression was due to reduced protein translation, incorrect processing, or improper folding to a conformation capable of binding antagonist. Evidence that poor antagonist- detectable cellular expression of mutant muscarinic receptors was due at least partly to incorrect protein folding was demonstrated with helix 3 mutants of the ml muscarinic receptor. Immunocytochemistry identified cell surface expression that was in great 135 excess of the antagonist detectable mutant receptor; the small population of receptor that bound antagonist did so with wild-type affinity (63).

In conclusion, we find that the conserved aspartate in the middle of helix 3

(D103) plays a significant role in receptor activation in addition to and apart from its role in ligand binding, a role not generally shared among the amine-binding class of G protein-coupled receptors. In addition to its role in the formation of active receptor conformation(s) the conserved aspartate in helix 2 (D69) plays a related role of contributing to the specificity of functional activity. The effects of the asparagine mutations of residues D69 and D97 are approximately additive in the doubly mutated receptor. However, D103N is not additive with D69N and/or D97N. Finally, D97 appears to contribute to ligand binding by providing a secondary anionic site, a role that does not appear to be cooperative with the nearby D103.

References

1. Kubo, T., Fukuda, K., Mikami, A., Maeda, A., Takahashi, H., Mishina, M., Haga, T., Haga, K., Ichiymama, A., Kangawa, K., Kojima, M., Matsuo, H., Hirose, T., and Numa, S. (1986) Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetylcholine receptor. Nature 323, 411-416

2. Peralta, E. G., Winslow, J. W., Peterson, G. L., Smith, D. H., Ashkenazi, A., Ramachandran, J., Schimerlik, M. I., and Capon, D. J. (1987) Primary structure and biochemical properties of an M2 muscarinic receptor. Science 236, 600-605

3. Peralta, E. G., Ashkenazi, A., Winslow, J. W., Smith, D. H., Ramachandran, J., and Capon, D. J. (1987) Distinct primary structures, ligand-binding properties and tissue-specific expression of four human muscarinic acetylcholine receptors. EMBO J. 6, 3923-3929

4. Bonner, T. I., Young, A. C., Brann, M. R., and Buckley, N. J. (1988) Cloning and expression of the human and rat m5 muscarinic acetylcholine receptor genes. Neuron 1, 403-410

5. Wickman, K. D., and Clapham, D. E. (1995) G-protein regulation of ion channels. Curr. Opin. Neurobiol. 5, 278-285 136

6. Sealfon, S. C., Chi, L., Ebersole, B. J., Rodic, V., Zhang, D., Ballesteros, J. A., and Weinstein, H. (1995) Related contribution of specific helix 2 and 7 residues to conformational activation of the serotonin 5-HT2A receptor. J. Biol. Chem. 270,16683-16688

7. Zhou, W., Flanagan, C., Ballesteros, J. A., Konvicka, K., Davidson, J. S., Weinstein, H., Millar, R. P., and Sea lfon, S. C. (1994) A reciprocal mutation supports helix 2 and helix 7 proximity in the gonadotropin-releasing hormone receptor. Mol. Pharmacol. 45, 165-170

8. Zhukovsky, E. A., and Oprian, D. D. (1989) Effect of carboxylic acid side chains on the absorption maximum of visual pigments. Science 246, 928-930

9. Sakmar, T. P., Franke, R. R., and Khorana, H. G. (1989) Glutamic acid-113 serves as the retinylidene Schiff base counterion in bovine rhodopsin. Proc. Natl. Acad. Sci. U. S. A. 86, 8309-8313

10. Nathans, J. (1990) Determinants of visual pigment absorbance: identification of the retinylidene Schiff s base counterion in bovine rhodopsin. Biochemistry 29, 9746-9752

11. Nakayama, T. A., and Khorana, H. G. (1990) Orientation of retinal in bovine rhodopsin determined by cross-linking using a photoactivatable analog of 11­ cis- retinal. J. Biol. Chem. 265, 15762-15769

12. Farrens, D. L., Altenbach, C., Yang, K., Hubbell, W. L., and Khorana, H. G. (1996) Requirement of rigid-body motion of transmembrane helices for light activation of rhodopsin. Science 274, 768-770

13. Sheikh, S. P., Zvyaga, T. A., Lichtarge, 0., Sakmar, T. P., and Bourne, H. R. (1996) Rhodopsin activation blocked by metal-ion-binding sites linking transmembrane helices C and F. Nature 383, 347-350

14. Wess, J., Maggio, R., Palmer, J. R., and Vogel, Z. (1992) Role of conserved threonine and tyrosine residues in acetylcholine binding and muscarinic receptor activation. A study with m3 muscarinic receptor point mutants. J. Biol. Chem. 267, 19313-19319

15. Vogel, W. K., Sheehan, D. M., and Schimerlik, M. I. (1997) Site-directed mutagensis on the m2 muscarinic acetylcholine receptor. The significance of tyrosine 403 in the binding of agonists and functional coupling. Mol. Pharmacol. (submitted), Chapter 3 of this dissertation

16. Schertler, G. F. X., Villa, C., and Henderson, R. (1993) Projection structure of rhodopsin. Nature 362, 770-772

17. Schertler, G. F. X., and Hargrave, P. A. (1995) Projection structure of frog rhodopsin in two crystal forms. Proc. Natl. Acad. Sci. U. S. A. 92, 11578-11582 137

18. Jones, P. G., Curtis, C. A. M., and Hulme, E. C. (1995) The function of a highly-conserved arginine residue in activation of the muscarinic M1 receptor. Eur. J. PharmacoL 288, 251-257

19. Urlaub, G., and Chasin, L. A. (1980) Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc. Natl. Acad. Sci. U. S. A. 77, 4216-4220

20. Wig ler, M., Pellicer, A., Silverstein, S., Axel, R., Urlaub, G., and Chasin, L. (1979) DNA-mediated transfer of adenine phosphoribosyltransferase locus into mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 76, 1373-1376

21. Dorner, A. J., Was ley, L. C., and Kaufman, R. J. (1989) Increased synthesis of secreted proteins induces expression of glucose-regulated proteins in butyrate­ treated Chinese hamster ovary cells. J. Biol. Chem. 264, 20602-20607

22. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Rapid and efficient site- specific mutagensis without phenotypic selection. Methods EnzymoL 154, 367­ 382

23. Vandeyar, M. A., Weiner, M. P., Hutton, C. J., and Batt, C. A. (1988) A simple and rapid method for the selection of oligodeoxynucleotide-directed mutants. Gene 65, 129-133

24. Sanger, F., Nick len, S., and Coulson, A. R. (1977) DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467

25. Peterson, G. L., and Schimerlik, M. I. (1984) Large scale preparation and characterization of membranes-bound and detergent-solublized muscarinic acetylcholine receptor from pig atria. Prep. Biochem. 14, 33-74

26. Peterson, G. L., Toumadje, A., Jonhson, W. C., Jr., and Schimerlik, M. I. (1995) Purification of recombinant porcine m2 muscarinic acetylcholine receptor from Chinese hamster ovary cells. Circular dichrosim spectra and ligand binding properties. J. Biol. Chem. 270, 17808-17814

27. Lee, W., Nicklaus, K. J., Manning, D. R., and Wolfe, B. B. (1990) Ontogeny of cortical muscarinic receptor subtypes and muscarinic receptor-mediated responses in rat. J. Pharmacol. Exp. Ther. 252, 482-490

28. Salomon, Y. (1979) Adenylate Cyclase Assay. Adv. Cyclic Nucleotide Res. 10, 35-55

29. Vogel, W. K., Mosser, V. A., Bulseco, D. A., and Schimerlik, M. I. (1995) Porcine m2 muscarinic acetylcholine receptor-effector coupling in Chinese hamster ovary cells. J. Biol. Chem. 270, 15485-15493, Chapter 2 of this dissertation 138

30. Marquardt, D. W. (1963) An algorith for least-squares estimation of nonlinear parameters. J. Soc. Ind. AppL Math. 11, 431 411

31. Fersht, A. R. (1988) Relationships between apparent binding energies measured in site-directed mutagenesis experiments and energetics of binding and catalysis. Biochemistry 27, 1577-1580

32. Fraser, C. M., Wang, C. D., Robinson, D. A., Gocayne, J. D., and Venter, J. C. (1989) Site-directed mutagenesis of ml muscarinic acetylcholine receptors: conserved aspartic acids play important roles in receptor function. Mol. Pharmacol. 36, 840-847

33. Stockton, J. M., Birdsall, N. J. M., Burgen, A. S. V., and Hulme, E. C. (1983) Modification of the binding properties of muscarinic receptors by gallamine. Mol. Pharmacol. 23, 551-557

34. Strader, C. D., Sigal, I. S., Register, R. B., Candelore, M. R., Rands, E., and Dixon, R. A. F. (1987) Identification of residues required for ligand binding to the 13-adrenergic receptor. Proc. Natl. Acad. Sci. U. S. A. 84, 4384-4388

35. Strader, C. D., Sigal, I. S., Candelore, M. R., Rands, E., Hill, W. S., and Dixon, R. A. F. (1988) Conserved aspartic acid residues 79 and 113 of the 0-adrenergic receptor have different roles in receptor function. J. Biol. Chem. 263, 10267­ 10271

36. Wang, C.-D., Buck, M. A., and Fraser, C. M. (1991) Site-directed mutagenesis of a2A-adrenergic receptors: identification of amino acids involved in ligand binding and receptor activation by agonists. Mol. Pharmacol. 40, 168-179

37. Wang, C.-D., Gallaher, T. K., and Shih, J. C. (1993) Site-directed mutagenesis of the serotonin 5-hydroxytrypamine2 receptor: identification of amino acids necessary for ligand binding and receptor activation. Mol. Pharmacol. 43, 931­ 940

38. Schwarz, R. D., Spencer, C. J., Jaen, J. C., Mirzadegan, T., Moreland, D., Tec le, H., and Thomas, A. J. (1995) Mutations of aspartate 103 in the Hm2 receptor and alterations in receptor binding properties of muscarinic agonists. Life Sci. 56, 923-929

39. Page, K. M., Curtis, C. A. M., Jones, P. G., and Hulme, E. C. (1995) The functional role of the binding site aspartate in muscarinic acetylcholine receptors, probed by site-directed mutagenesis. Eur. J. Pharmacol. 289, 429­ 437

40. Ohta, K., Hayashi, H., Mizuguchi, H., Kagamiyama, H., Fujimoto, K., and Fukui, H. (1994) Site-directed mutagenesis of the histamine H1 receptor: roles of aspartic acid107, asparagine198 and threonine194. Biochem. Biophys. Res. Comm. 203, 1096-1101 139

41. Ho, B. Y., Karschin, A., Branchek, T., Davidson, N., and Lester, H. A. (1992) The role of conserved aspartate and serine residues in ligand binding and in function of the 5-HT receptor: a site-directed mutation study. FEBS Lett. 312, 259-262

42. Spalding, T. A., Birdsall, N. J. M., Curtis, C. A. M., and Hulme, E. C. (1994) Acetylcholine mustard labels the binding site aspartate in muscarinic acetylcholine receptors. J. Biol. Chem. 269, 4092-4097

43. Curtis, C. A. M., Wheatley, M., Bansal, S., Birdsall, N. J. M., Eveleigh, P., Pedder, E. K., Poyner, D., and Hulme, E. C. (1989) Propylbenzilylcholine mustard labels an acidic residue in transmembrane helix 3 of the muscarinic receptor. J. Biol. Chem. 264, 489-495

44. Kurtenbach, E., Curtis, C. A. M., Pedder, E. K., Aitken, A., Harris, A. C. M., and Hulme, E. C. (1990) Muscarinic acetylcholine receptors. Peptide sequencing identifies residues involved in antagonist binding and disulfide bond formation. J. Biol. Chem. 265, 13702-13708

45. Sussman, J. L., Harel, M., Fro low, F., Oefner, C., Goldman, A., Toker, L., and Silman, I. (1991) Atomic structure of acetylcholinesterase from Torpedo california: a prototypic acetylcholine-binding protein. Science 253, 872-879

46. Galzi, J.-L., Revah, F., Bessis, A., and Changeux, J.-P. (1991) Functional architecture of the nicotinic acetylcholine receptor: from electric organ to brain. Annu. Rev. Pharmacol. Toxicol. 31, 37-72

47. Galzi, J.-L., and Changeux, J.-P. (1994) Neurotransmitter-gated ion channels as unconventional allosteric proteins. Curr. Opin. Struct. Biol. 4, 554-565

48. Trumpp-Kallmeyer, S., Hoflack, J., Bruinvels, A., and Hibert, M. (1992) Modeling of G-protein-coupled receptors: application to dopamine, adrenaline, serotonin, acetylcholine, and mammalian opsin receptors. J. Med. Chem. 35, 3448-3462

49. Radic, Z., Gibney, G., Kawamoto, S., MacPhee-Quigley, K., Bongiorno, C., and Taylor, P. (1992) Expression of recombinant acetylcholinesterase in a baculovirus system: kinetic properties of glutamate 199 mutants. Biochemistry 31, 9760-9767

50. Ordentlich, A., Barak, D., Kronman, C., Ariel, N., Segall, Y., Velan, B., and Shafferman, A. (1995) Contribution of aromatic moieties of tyrosine 133 and of the anionic subsite tryptophan 86 to catalytic efficiency and allosteric modulation of acetylcholinesterase. J. Biol. Chem. 270, 2082-2091

51. Wess, J., Gdula, D., and Brann, M. R. (1991) Site-directed mutagenesis of the m3 muscarinic receptor: identification of a series of threonine and tyrosine residues involved in agonist but not antagonist binding. EMBO J. 10, 3729­ 3734 140

52. Gantz, I., Del Valle, J., Wang, L. D., Tashiro, T., Munzert, G., Guo, Y. J., Konda, Y., and Yamada, T. (1992) Molecular basis for the interaction of histamine with the histamine H2 receptor. J. Biol. Chem. 267, 20840-20843

53. Mansour, A., Meng, F., Meador-Woodruff, J. H., Taylor, L. P., Civelli, 0., and Akil, H. (1992) Site-directed mutagenesis of the human dopamine D2 receptor. Eur. J. Pharmacol. 227, 205-214

54. Exton, J. H. (1997) Cell signalling through guanine-nucleotide-binding regulatory proteins (G proteins) and phospholipases. Eur. J. Biochem. 243, 10­ 20

55. Chung, F.-Z., Wang, C.-D., Potter, P. C., Venter, J. C., and Fraser, C. M. (1988) Site-directed mutagenesis and continuous expression of human P-adrenergic receptors. J. Biol. Chem. 263, 4052-4055

56. Horstman, D. A., Brandon, S., Wilson, A. L., Guyer, C. A., Cragoe, E. J., Jr., and Limbird, L. E. (1990) An aspartate conserved among G-protein receptors confers allosteric regulation of a2-adrenergic receptors by sodium. J. Biol. Chem. 265, 21590-21595

57. Suprenant, A., Horstman, D. A., Akbarali, H., and Limbird, L. L. (1992) A point mutation of the a2-adrenoceptor that blocks coupling to potassium but not calcium currents. Science 257, 977-980

58. Neve, K. A., Cox, B. A., Henningsen, R. A., Spanoyannis, A., and Neve, R. L. (1991) Pivotal role for aspartate-80 in the regulation of dopamine D2 receptor affinity for drugs and inhibition of adenylyl cyclase. MoL Pharmacol. 39, 733­ 739

59. Bihoreau, C., Monnot, C., Davies, E., Teutsch, B., Bernstein, K. E., Corvol, P., and Clauser, E. (1993) Mutation of Asp74 of the rat angiotensin II receptor confers changes in antagonist affinities and abolishes G-protein coupling. Proc. Natl. Acad. Sci. U. S. A. 90, 5133-5137

60. Ceresa, B. P., and Limbird, L. E. (1994) Mutation of an aspartate residue highly conserved among G-protein-coupled receptors results in nonreciprocal disruption of afadrenergic receptor-G-protein interactions. A negative charge at amino acid residue 79 forecasts a2A-adrenergic receptor sensitivity to allosteric modulation by monovalent cations and fully effective receptor/G­ protein coupling. J. Biol. Chem. 269, 29557-29564

61. Jagerschmidt, A., Guillaume, N., Goudreau, N., Maigret, B., and Rogues, B.-P. (1995) Mutation of Aspl°° in the second transmembrane domain of the cholecystokinin B receptor increases antagonist binding and reduces signal transduction. MoL Pharmacol. 48, 783-789 141

62. LiCata, V. J., and Ackers, G. K. (1995) Long-range, small magnitude nonadditivity of mutational effects in proteins. Biochemistry 34, 3133-3139

63. Lu, Z.-L., Curtis, C. A., Jones, P. G., Pavia, J., and Hulme, E. C. (1997) The role of the aspartate-arginine-tyrosine triad in the ml muscarinic receptor: mutations of aspartate 122 and tyrosine 124 decrease receptor expression but do not abolish signaling. Mol. PharmacoL 51, 234-241 142 Chapter 5

Summary

When the m2 muscarinic receptor was exogenously expressed in Chinese hamster ovary cells assays of its functional activity were not reproducible. In assays of forskolin-stimulated adenylyl cyclase inhibition the concentration of agonist required to achieve a half-maximal effect (EC50) varied while the EC50 values from assays of phospholipase C stimulation were invariant. The source of this variability was the expression level of the receptor; the EC50 for adenylyl cyclase inhibition decreased with increasing receptor level. Further investigation led to additional observations. The maximal response of phospholipase C stimulation increased with receptor level while the maximal response of adenylyl cyclase inhibition assays did not, except for cells treated with pilocarpine. In adenylyl cyclase inhibition assays antagonist controls sometimes appeared to more than reverse the agonist effects. Further experiments showed that antagonists appeared to stimulate adenylyl cyclase where they should have had no effect.

At high agonist concentrations the adenylyl cyclase inhibition was reversed, apparently stimulated with an EC50 that decreased and a maximal effect that increased with receptor level. This G protein-mediated effect was unlike all other m2 muscarinic receptor effects in being insensitive to pertussis toxin, suggesting that the G protein involved was not Gi or Go. The best explanation for this effect is a 137 subunit from Gz, a member of the Gvo family of G proteins that is not sensitive to pertussis toxin. It should be noted that this effect requires both a very high concentration of agonist and high-level receptor expression; it is not likely to be physiologically relevant.

Before we could analyze the effects of site-directed mutants we needed to understand the effects that wild-type expression levels had on functional activity. The model that resulted not only provided an explanation for these observations but also 143 provided additional insight into the fundamental problem of the relationship between agonist binding and G protein-coupled receptor activity. The ternary complex model was expanded to include explicit activation and inactivation steps originating from the agonistreceptorG protein ternary and the receptorG protein binary complexes.

Functional activity was modeled to be proportional to the steady-state concentration of activated G protein. Muscarinic effects seen in phospholipase C stimulation and adenylyl cyclase inhibition assays were explained by muscarinic receptors coupling to these effects via different G proteins that bound the receptor with different affinities. The model explained the partial agonism observed with pilocarpine that disappeared at high receptor level as originating from the lower ratio of high to low agonist affinities compared with the other agonists and the lower absolute affinity of pilocarpine for the G protein-coupled receptor conformation. Negative antagonism was explained by the reduction in basal activity originating from the receptorG protein binary complex by the binding of antagonist to the inactive receptor conformation.

At the time of the preparation of Chapter 2 for publication the significance of fry effects in G protein signaling was uncertain. It is now throught to be a significant route of G protein signaling. Py was first reported to stimulate the cardiac inwardly-rectifying potassium channels in 1987 (1). Subsequent reports both confirmed (2) and contradicted

(3) that conclusion. Until it was resolved in 1994 (4, 5) in favor of 13y, it was not known if an au° or a Dy subunit or both were responsible. In adenylyl cyclases the role of Pry subunits appears to be secondary to the stimulatory effect of as and the inhibitory effect of a1. Of the nine adenylyl cyclase subtypes 13y inhibits only Type I while the 07 stimulation of Types II and IV occurs only synergistically with as (6). Phospholipase C stimulation was known to proceed via both pertussis toxin-sensitive and insensitive routes. The pertussis toxin-insensitive route was worked out first and found to proceed via the a subunits (7-9) of a new family of G proteins (later identified as the Gqin 144 family). Initial reports identified ao as the specific G protein subunit mediating the pertussis toxin-sensitive route of stimulation (10, 11). Reports of the involvement of [37 soon followed (12-16) but it was not clear at first whether its effects were secondary to an a subunit effect as was seen for adenylyl cyclase stimulation. The requirement for high concentration of 137 and pertussis toxin sensitivity led to the conclusion that the high-abundance Gvo family is the only physiologically relevant source of 137 subunits

(17).

In Chapter 2 we suggested that multiple G proteins interacting with the receptor with different affinities could explain the dissimilar effects observed in assays of adenylyl cyclase inhibition and phospholipase C stimulation. The more likely explanation for these effects now appears to be bifurcating signaling via a and 13y subunits. A single

G protein or a repertoire of G proteins with similar affinities could also produce the observed effects if the active subunits bind effectors with different affinities. Originally we modeled effector activity to be proportional to the steady-state concentration of activated G protein; the inclusion of explicit subunit affinities adds to the complexity of the model (Figure 5.1).

The model (Scheme 2.2 and the scheme in Figure 5.1) describes partial agonists as compounds with a relatively low ratio of binding affinities for the active and inactive receptor conformations compared to other compounds. Whether partial agonism is observed or not depends the ratio of agonist affinities to G protein affinities and the concentrations of receptor and G protein. The relatively low absolute and low ratio of high to low affinity explained the observation of pilocarpine partial agonism that disappeared at high receptor levels. This is the only possible explanation of partial agonism if different agonists bind receptor to promote the same active receptor conformation, and results with the wild-type receptor can be adequately explained by a single active receptor conformation. Results with the D69N mutant (Chapter 4) cannot 145

Figure 5.1. Ternary complex model with kinetic pathways toward G protein activation and inactivation. A is agonist, G is the GDP-bound G protein heterotrimer, R is the free receptor, AR is the agonist bound receptor, RG is the G protein bound receptor, and ARG is the agonistG proteinreceptor ternary complex. E1 and E2 are effectors that are bifurcately activated by oc-GTP and r3y subunits. GTP hydrolysis on the a subunit is shown to occur via two routes; the secondary effector-accelerated route has been observed in some systems. 146 be easily explained with fewer than three active receptor conformational states, at least two of which are agonist-specific, but there is no evidence that these two additional conformations are present and significant in the wild-type receptor. Multiple active receptor conformations that are differentially stabilized by agonists are the basis of an alternative explanation of partial agonism that is based on conformational selectivity.

A second argument for the model in Figure 5.1 is that it is capable of explaining the adenylyl cyclase stimulation observed at high agonist and receptor levels. In Chapter

2 we pointed out that this effect was inconsistent with the model as then presented.

Modeling activity as proportional to the steady-state concentration of activated G protein imposed a restriction that EC50 for an effect could not exceed the dissociation constant of agonist for the free receptor. A 137 effect, typically requiring a high concentration of this subunit, can have an EC50 greater than the agonist dissociation constant. The observation of adenylyl cyclase stimulation is consistent with the model in Figure 5.1. Also unexplained in Chapter 2 was the identity of the KL site observed in agonist binding assays. It was thought to be either modified or aggregated receptor but since its concentration did not change in the presence of guanine nucleotides, it did not appear to be receptor state involved in G protein signaling. Results from Chapter 4 indicate that guanine nucleotide sensitivity is not a requirement of functional activity, at least with some receptor conformational states. There no longer is any reason to conclude that the KL site is not capable of interacting with G proteins.

The ability of the model to relate changes in agonist affinities of the active and inactive receptor conformation to functional activity was exploited to explain the results of the site-directed mutant Y403F, a conserved residue in the sixth transmembrane helix, and resolved apparently conflicting results of the homologous mutation in the m3 muscarinic receptor. In the m3 subtype the mutation resulted in decreased agonist affinity and decreased functional activity and led to the conclusion that the residue was 147 involved in agonist binding and had a separate role in G protein activation (18). In the m2 subtype agonist affinities were more affected but functional activity was wild-type­ like except for pilocarpine where the functional activity was reduced in one assay and eliminated in another. The effects observed in both subtypes were explained by the decreased ratio of high affinity to low affinity agonist equilibrium constants for pilocarpine and an increased ratio for other agonists in the m2 subtype while the ratio decreased for comparable agonists in the m3 subtype.

Results from studies of muscarinic receptors and other rhodopsin-like family G protein-coupled receptors led to the identification of certain helices, conserved sites, and specific residues as being involved in receptor function, agonist binding, or both, but less is known about how these might interact. Helix 3 appears to have multiple roles. At the extracellular end it is involved in agonist binding; and its movement relative to helix 6, also a site of agonist binding, might be part of an activating conformational change. In muscarinic receptors there are two aspartates in the middle and extracellular end of helix 3 that affect agonist binding, one of these dramatically. Rhodopsin projection structures

(19, 20) suggest a close proximity of helices 2 and 3, and two highly conserved motifs that could conceivably interact are found at the intracellular ends. The conserved aspartate in helix 2, the most conserved residue in helix 2 and part of the motif, is critical to function and its relationship to agonist binding is most likely to be indirect. We produced site-directed asparagine mutants of the three conserved aspartates in helices 2 and 3 and produced double mutants of each of these for the purpose of identifying and characterizing potential nonadditive interactions between these sites.

The results indicate that between D69 ( in helix 2) and D97 (near the extracellular end of helix 3) both binding and functional activity were approximately additive.

However, results with the D103 site (in the middle of helix 3) indicated that this site was 148 nonadditive. The results are difficult to interpret because the single D103N mutation was not expressed well enough to be characterized.

A synergistic effect was observed between the D97N and D103N as the double mutant D97.103N was expressed as well as the D97N, while individually these mutants had a negative effect on the expression of antagonist binding sites. The conclusion from these results was that the absence of a carboxylate-bearing functional group at position

103 introduced a large bather to proper protein folding or processing. This barrier was significantly reduced in the absence of a second carboxylate at position 97 but the reasons for this are unclear. D97 and D103 positioned close to each other in the upper portion of helix 3 individually contribute to the binding of ligand. They could contribute synergistically to the same binding step or to separate binding steps in a sequential binding mechanism. If both residues contributed to the same binding step then their joint removal would be expected to have a synergistically deleterious effect on ligand binding. The D97.103N double mutant bound ligands better than the D69.103N double mutant. The conclusion most consistent with this result was that these residues contribute to separate binding steps.

Although the D103N mutation was not available for characterization, its effects could be evaluated by considering the results from the D97N single and the D97.103N double mutants. The D97N mutation reduced apparent agonist binding energies modestly and its effects in assays of functional activity were consistent with reduced agonist affinity. The D97.103N mutant reduced ligand affinities dramatically, eliminated high affinity guanine nucleotide-sensitive agonist binding, and eliminated functional activity completely at receptor expression levels at which wild-type-like functional activity was observed in D97N. The typical result from G protein-coupled receptors that conserve this residue is that ligand binding is dramatically reduced but functional activity 149 is preserved, at least partially, and consistent with the reduced agonist affinity. In muscarinic receptors this residue appears to have a role in receptor function that is additional to and distinct from the typical ligand-binding role of this conserved residue.

Results with D69N, the conserved helix 2 aspartate, were also atypical of results from other members of the rhodopsin-like family of G protein-coupled receptors.

Homologous mutations typically eliminate or significantly reduce high affinity guanine nucleotide-sensitive agonist binding and functional activity. This was also observed in

D69N but the activity that remained was agonist specific suggesting the existence of active conformations of the receptor that can be differentially stabilized by agonists.

There is little direct evidence that the additional two active conformations exist and are significant to wild-type receptor function. The simplest explanation is that the mutation resulted in the elimination of the predominant active receptor conformation that is stabilized all agonists. The two additional active conformations, one that is stabilized in the mutant only by oxotremorine M and the other that is stabilized by acetylcholine and carbachol but not oxotremorine M, exist in the wild-type but are not significant to overall function.

We gained insight into the roles of these conserved aspartates but were unable to discern from their combined effects a significant nonadditive effect between helices 2 and 3. The simplest explanation is that no significant nonadditive relationship exits between these helices. This conclusion would require more experiments than the few that have been completed. Asparagine mutagenesis may have been too large a change in residues 69 and 103. Glutamate mutations at these sites might be more productive.

Residue 103 is a particular problem because mutations at this site are not well tolerated.

D103E mutants have been reported transiently expressed in COS cells (21, 22); however 150 stable expression has been elusive.1 Since this mutation preserved, albeit dramatically altered, high affinity acetylcholine and carbachol binding (but interestingly oxotremorine

M and pilocarpine high affinity binding was eliminated) it might be more sensitive to an alteration in helix 2 (21). D69E has the potential to alter without eliminating guanine nucleotide-sensitive agonist binding but this has yet to be demonstrated. D69E or some other mutation near it that alters but does not eliminate guanine nucleotide-sensitive agonist binding might likewise be more sensitive to an alteration in helix 3.

Several diseases are associated with impaired G protein-coupled receptor signaling; for example, 0-adrenergic receptor in heart failure, dopamine receptors in

Parkinson's disease, and muscarinic receptors in Alzheimer's disease. Agonist-based therapeutic approaches are either the current art or are contemplated. The realization that receptor level has an effect on functional activity is not novel. How receptor levels might affect the nature of receptor function, specifically altering or not altering maximal effect and affecting or not affecting the EC50, was poorly understood. The ability to relate absolute and relative agonist affinities and G protein affinities quantitatively resulted in new insight into the mechanism of G protein-receptor-coupled effects. The development of subtype-specific pharmaceuticals is critical to effective treatments that have a minimum of side effects. The poor tolerance of muscarinic agonists is a major impediment to an effective treatment Alzheimer's disease. Recent clinical studies with m 1 (23) and m 1 and m4 (24) selective agonists suggest that this approach has promise.

The development of better treatments and a more sophisticated understanding of the disease may be aided by a more detailed understanding of the mechanism of receptor function.

1D103E and D103C were not expressed well in stably transfected CHO cells, D. J. Broderick and M. I. Schimerlik, unpublished data. 151 References

1. Logothetis, D. E., Kurachi, Y., Galper, J., Neer, E. J., and Clapham, D. E. (1987) The Py subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325, 321-326

2. Kurachi, Y., Ito, H., Sugimoto, T., Katada, T., and Ui, M. (1989) Activation of atrial muscarinic K+ channels by low concentrations of fry subunits of rat brain G protein. Pf lagers Arch. 413, 325-327

3. Yatani, A., Mattera, R., Codina, J., Graf, R., Okabe, K., Padrell, E., Iyengar, R., Brown, A. M., and Birnbaumer, L. (1988) The G protein-gated atrial K+ channel is stimulated by three distinct Gi a-subunits. Nature 336, 680-682

4. Reuveny, E., Slesinger, P. A., Inglese, J., Morales, J. M., Ifiiguez-Lluhi, J. A., Lefkowitz, R. J., Bourne, H. R., Jan, Y. N., and Jan, L. Y. (1994) Activation of the cloned muscarinic potassium channel by G protein fry subunits. Nature 370, 143-146

5. Wickman, K. D., Iniguez-Lluhl, J. A., Davenport, P. A., Taussig, R., Krapivinsky, G. B., Linder, M. E., Gilman, A. G., and Clapham, D. E. (1994) Recombinant G-protein (3y- subunits activate the muscarinic-gated atrial potassium channel. Nature 368, 255-257

6. Tang, W.-J., and Gilman, A. G. (1991) Type-specific regulation of adenylyl cyclase by G protein fry subunits. Science 254, 1500-1503

7. Taylor, S. J., Smith, J. A., and Exton, J. H. (1990) Purification from bovine liver membranes of a guanine nucleotide-dependent activator of phosphoinositide­ specific phospholipase C. Immunologic identification as a novel G-protein a subunit. J. Biol. Chem. 265, 17150-17156

8. Smrcka, A. V., Hepler, J. R., Brown, K. 0., and Sternweis, P. C. (1991) Regulation of polyphosphoinositide-specific phospholipase C activity by purified G9. Science 251, 804-807

9. Pang, I. H., and Sternweis, P. C. (1990) Purification of unique a subunits of GTP-binding regulatory proteins (G proteins) by affinity chromatography with immobilized 137 subunits. J. Biol. Chem. 265, 18707-18712

10. Moriarty, T. M., Padrell, E., Carty, D. J., Omri, G., Landau, E. M., and Iyengar, R. (1990) Go protein as signal transducer in the pertussis toxin-sensitive phosphatidylinositol pathway. Nature 343, 79-82

11. Padrell, E., Carty, D. J., Moriarty, T. M., Hildebrandt, J. D., Landau, E. M., and Iyengar, R. (1991) Two forms of the bovine brain Go that stimulate the inositol trisphosphate-mediated Cl- currents in Xenopus oocytes. Distinct guanine nucleotide binding properties. J. Biol. Chem. 266, 9771-9777 152

12. Camps, M., Hou, C., Sidiropoulos, D., Stock, J. B., Jakobs, K. H., and Gierschik, P. (1992) Stimulation of phospholipase C by guanine-nucleotide­ binding protein 137 subunits. Eur. J. Biochem. 206, 821-831

13. Camps, M., Carozzi, A., Schnabel, P., Scheer, A., Parker, P. J., and Gierschik, P. (1992) Isozyme-selective stimulation of phospholipase C-132 by G protein py subunits. Nature 360, 684-686

14. Blank, J. L., Brattain, K. A., and Exton, J. H. (1992) Activation of cytosolic phosphoinositide phospholipase C by G-protein fry subunits. J. Biol. Chem. 267, 23069-23075

15. Katz, A., Wu, D., and Simon, M. I. (1992) Subunits fry of heterotrimeric G protein activate 02 isoform of phospholipase C. Nature 360, 686-689

16. Park, D., Jhon, D.-Y., Lee, C.-W., Lee, K.-H., and Rhee, S. G. (1993) Activation of phospholipase C isozymes by G protein Py subunits. J. Biol. Chem. 268, 4573-4576

17. Exton, J. H. (1996) Regulation of phosphoinositide phospholipases by hormones, neurotransmitters, and other agonists linked to G proteins. Annu. Rev. Pharmacol. Toxicol. 36, 481-509

18. Wess, J., Maggio, R., Palmer, J. R., and Vogel, Z. (1992) Role of conserved threonine and tyrosine residues in acetylcholine binding and muscarinic receptor activation. A study with m3 muscarinic receptor point mutants. J. Biol. Chem. 267, 19313-19319

19. Schertler, G. F. X., Villa, C., and Henderson, R. (1993) Projection structure of rhodopsin. Nature 362, 770-772

20. Schertler, G. F. X., and Hargrave, P. A. (1995) Projection structure of frog rhodopsin in two crystal forms. Proc. Natl. Acad. Sci. U. S. A. 92, 11578-11582

21. Page, K. M., Curtis, C. A. M., Jones, P. G., and Hulme, E. C. (1995) The functional role of the binding site aspartate in muscarinic acetylcholine receptors, probed by site-directed mutagenesis. Eur. J. PharmacoL 289, 429-437

22. Schwarz, R. D., Spencer, C. J., Jaen, J. C., Mirzadegan, T., Moreland, D., Tecle, H., and Thomas, A. J. (1995) Mutations of aspartate 103 in the Hm2 receptor and alterations in receptor binding properties of muscarinic agonists. Life Sci. 56, 923-929

23. Fisher, A., Heldman, E., Gurwitz, D., Haring, R., Karton, Y., Meshulam, H., Pittel, Z., Marciano, D., Brandeis, R., Sadot, E., Barg, Y., Pinkas-Kramarski, R., Vogel, Z., Ginzburg, I., Treves, T. A., Verchovsky, R., Klimowsky, S., and Korczyn, A. D. (1996) M1 agonists for the treatment of Alzheimer's disease. Novel properties and clinical update. Ann. N. Y. Acad. Sci. 777, 189-196 153

24. Bodick, N. C., Offen, W. W., Levey, A. I., Cutler, N. R., Gauthier, S. G., Satlin, A., Shannon, H. E., Tollefson, G. D., Rasmussen, K., Bymaster, F. P., Hurley, D. J., Potter, W. Z., and Paul, S. M. (1997) Effects of xanomeline, a selective muscarinic receptor agonist, on cognitive function and behavioral symptoms in Alzheimer disease. Arch. Neurol. 54, 465-473 154 Bibliography

Akiba, I., Kubo, T., Maeda, A., Bujo, H., Nakai, J., Mishina, M., and Numa, S. (1988) Primary structure of porcine muscarinic acetylcholine receptor III and antagonist binding studies. FEBS Lett. 235, 257-261

Ashkenazi, A., Winslow, J. W., Peralta, E. G., Peterson, G. L., Schimerlik, M. I., Capon, D. J., and Ramachandran, J. (1987) An M2 muscarinic receptor subtype coupled to both adenylyl cyclase and phosphoinositide turnover. Science 238, 672-675

Baldwin, J. M. (1993) The probable arrangement of the helices in G protein-coupled receptors. EMBO J. 12, 1693-1703

Bihoreau, C., Monnot, C., Davies, E., Teutsch, B., Bernstein, K. E., Corvol, P., and Clauser, E. (1993) Mutation of Asp74 of the rat angiotensin II receptor confers changes in antagonist affinities and abolishes G-protein coupling. Proc. Natl. Acad. Sci. U. S. A. 90, 5133-5137

Birdsall, N. J. M., Burgen, A. S. V., and Hulme, E. C. (1978) The binding of agonists to brain muscarinic receptors. MoL Pharmacol. 14, 723-736

Birnbaumer, L., Pohl, S. L., Michiel, H., Krans, J., and Rodbell, M. (1970) The actions of hormones on the adenyl cyclase system. Adv. Biochem. Psychopharmacol. 3, 185-208

Birnbaumer, L., and Rodbell, M. (1969) Adenyl cyclase in fat cells II. Hormone receptors. J. Biol. Chem. 244, 3477-3482

Blank, J. L., Brattain, K. A., and Exton, J. H. (1992) Activation of cytosolic phosphoinositide phospholipase C by G-protein fry subunits. J. Biol. Chem. 267, 23069-23075

Bodick, N. C., Offen, W. W., Levey, A. I., Cutler, N. R., Gauthier, S. G., Satlin, A., Shannon, H. E., Tollefson, G. D., Rasmussen, K., Bymaster, F. P., Hurley, D. J., Potter, W. Z., and Paul, S. M. (1997) Effects of xanomeline, a selective muscarinic receptor agonist, on cognitive function and behavioral symptoms in Alzheimer disease. Arch. Neurol. 54, 465-473

Bohm, S. K., Grady, E. F., and Bunnett, N. W. (1997) Regulatory mechanism that modulate signalling by G-protein-coupled receptors. Biochem. J. 322, 1-18

Bokoch, G. M., Katada, T., Northup, J. K., Hewlett, E. L., and Gilman, A. G. (1983) Identification of the predominant substrate for ADP- ribsoylation by islet activating protein. J. Biol. Chem. 258, 2072-2075

Bond, R. A., Leff, P., Johnson, T. D., Milano, C. A., Rockman, H. A., McMinn, T. R., Apparsundaram, S., Hyek, M. F., Kenakin, T. P., Allen, L. F., and Lefkowitz, R. 155

J. (1995) Physiological effects of inverse agonists in mycocardial overexpression of the [3 2-adrenoceptor. Nature 374, 272-276 Bonner, T. I., Buckley, N. J., Young, A. C., and Brann, M. R. (1987) Identification of a family of muscarinic acetylcholine receptor genes. Science 237, 527-532,1628

Bonner, T. I., Young, A. C., Brann, M. R., and Buckley, N. J. (1988) Cloning and expression of the human and rat m5 muscarinic acetylcholine receptor genes. Neuron 1, 403-410

Bourne, H. R., Coffino, P., and Tompkins, G. M. (1975) Selection of a variant lymphoma cell line deficient in adenylate cyclase. Science 187, 750-752

Buckley, N. J., Bonner, T. I., and Brann, M. R. (1988) Localization of a family of muscarinic receptor mRNAs in rat brain. J. Neuosci. 8, 4646-4652

Burgen, A. S. V. (1995) The background of the muscarinic system. Life Sci. 56, 801­ 806

Burgen, A. S. V. (1989) in The Muscarinic Receptors (J. H. Brown, ed), Humana Press, Clifton, New Jersey

Camps, M., Carozzi, A., Schnabel, P., Scheer, A., Parker, P. J., and Gierschik, P. (1992) Isozyme-selective stimulation of phospholipase C-132 by G protein Py subunits. Nature 360, 684-686

Camps, M., Hou, C., Sidiropoulos, D., Stock, J. B., Jakobs, K. H., and Gierschik, P. (1992) Stimulation of phospholipase C by guanine-nucleotide-binding protein 13y subunits. Eur. J. Biochem. 206, 821-831

Cassel, D., and Selinger, Z. (1976) Catecholamine-stimulated GTPase activity in turkey erythrocyte membranes. Biochim. Biophys. Acta 252, 538-551

Ceresa, B. P., and Limbird, L. E. (1994) Mutation of an aspartate residue highly conserved among G-protein-coupled receptors results in nonreciprocal disruption of a2-adrenergic receptor-G-protein interactions. A negative charge at amino acid residue 79 forecasts a2A-adrenergic receptor sensitivity to allosteric modulation by monovalent cations and fully effective receptor/G-protein coupling. J. Biol. Chem. 269, 29557-29564

Cheung, A. H., Huang, R.-R. C., and Strader, C. D. (1992) Involvement of specific hydrophobic, but not hydrophilic, amino acids in the third intracellular loop of the 13-adrenergic receptor in the activation of Gs. MoL Pharmacol. 41, 1061-1065

Chidiac, P., Herbert, T. E., Valiquette, M., Dennis, M., and Bouvier, M. (1994) Inverse agonist activity of 13-arenergic antagonists. MoL Pharmacol. 45, 490-499 156

Choi, E.-J., Wong, S. T., Hinds, T. R., and Storm, D. R. (1992) Calcium and Muscarinic Agonist Stimulation of Type I Adenylylcyclase in Whole Cells. J. Biol. Chem. 267, 12440-12442

Chuang, T. T., Le Vine, H., III, and De Blasi, A. (1995) Phosphorylation and activation of p-adrenergic receptor kinase by protein kinase C. J. Biol. Chem. 270, 18660­ 18665

Chuang, T. T., Paolucci, L., and De Blasi, A. (1996) Inhibition of G protein-coupled receptor kinase subtypes by Ca2+/calmodulin. J. Biol. Chem. 271, 28691-28696

Chung, F.-Z., Wang, C.-D., Potter, P. C., Venter, J. C., and Fraser, C. M. (1988) Site- directed mutagenesis and continuous expression of human 0-adrenergic receptors. J. Biol. Chem. 263, 4052-4055

Clapham, D. E. (1996) The G-protein nanomachine. Nature 379, 297-299

Cooper, D. M. F., Schlegel, W., Lin, M. C., and Rodbell, M. (1979) The fat cell adenylate cyclase system. Characterization and manipulation of its bimodal regulation by GTP. J. Biol. Chem. 254, 8927-8931

Costa, T., Ogino, Y., Munson, P. J., Onaran, 0., and Rodbard, D. (1992) Drug efficacy at guanine nucleotide-binding regulatory protein-linked receptors: thermodynamic interpretation of negative antagonism and of receptor activity in the absence of ligand. MoL Pharmacol. 41, 549-560

Curtis, C. A. M., Wheatley, M., Bansal, S., Birdsall, N. J. M., Eveleigh, P., Pedder, E. K., Poyner, D., and Hulme, E. C. (1989) Propylbenzilylcholine mustard labels an acidic residue in transmembrane helix 3 of the muscarinic receptor. J. Biol. Chem. 264, 489-495

Daaka, Y., Pitcher, J. A., Richardson, M., Stoffel, R. H., Robishaw, J. D., and Lefkowitz, R. J. (1997) Receptor and Gr3y isoform-specific interactions with G protein- coupled receptor kinases. Proc. Natl. Acad. Sci. U. S. A. 94, 2180-2185

Dai, Y., and Baum, B. J. (1993) Relationship between muscarinic receptor occupancy and response in rat parotid acinar cells. Am. J. Physiol. 265, G1122G1127

Dale, H. H. (1914) The action of certain esters and ethers of choline, and their reaction to muscarine. J. Pharmacol. Exp. Ther. 6, 147-190

Dale, H. H., and Dudley, F. H. (1929) The presence of histamine and acetylcholine in the spleen of the ox and the horse. J. Physiol. 68, 97-123

De Lean, A., Stadel, J. M., and Lefkowitz, R. J. (1980) A ternary complex model explains the agonist-specific binding properties of the adenylate cyclase coupled 13-adrenergic receptor. J. Biol. Chem. 255, 7108-7117 157

De Waard, M., Liu, H., Walker, D., Scott, V. E. S., Gurnett, C. A., and Campbell, K. P. (1997) Direct binding of G-protein 12ry complex to voltage-dependent calcium channels. Nature 385, 446-450

De Bernardi, M. A., Seki, T., and Brooker, G. (1991) Inhibition of cAMP accumulation by intracellular calcium mobilization in C6-2B cells stably transfected with substance K receptor cDNA. Proc. Natl. Acad. Sci. U. S. A. 88, 9257-9261

Delhaye, M., De Smet, J. M., Taton, G., De Neff, P., Camus, J. C., Fontaine, J., Waelbroeck, M., Robberecht, P., and Christophe, J. (1984) A comparison between muscarinic receptor occupancy, adenylate cyclase inhibition, and inotropic response in human heart. Naunyn-Schmiedeberg's Arch. Pharmacol. 325, 170-175

Dell'Acqua, M. L., Carroll, R. C., and Peralta, E. G. (1993) Transfected m2 muscarinic acetylcholine receptors couple to Gai2 and Gai3 in Chinese hamster ovary cells. Activation and desensitization of the phospholipase C signaling pathway. J. Biol. Chem. 268, 5676-5685

Department of the Army. (1996) Handbook on the medical aspects of NBC defensive operations. Department of the Army Field Manual 8-9, Department of the Army, Washington, D. C.

Dittman, A. H., Weber, J. P., Hinds, T. R., Choi, E.-J., Migeon, J. C., Nathanson, N. M., and Storm, D. R. (1994) A novel mechanism for coupling of m4 muscarinic acetylcholine receptors to calmodulin-sensitive adenylyl cyclases: crossover from G protein-coupled inhibition to stimulation. Biochemistry 33, 943-951

Dixon, R. A. F., Kobilka, B. K., Strader, D. J., Benovic, J. L., Dohlman, H. G., Frielle, T., Bolanowski, M. A., Bennett, C. D., Rands, E., Diehl, R. E., Mumford, R. A., Skater, E. E., Sigal, I. S., Caron, M. G., Lefkowitz, R. J., and Strader, C. D. (1986) Cloning of the gene and cDNA for mammalian 0-adrenergic receptor and homology with rhodopsin. Nature 321, 75-79

Dixon, R. A. F., Sigal, I. S., and Strader, C. D. (1988) Structure-function analysis of the f3- adrenergic receptor. Cold Spring Harbor Symp. Quant. Biol. 53, 487-497

Dohlman, H. G., Caron, M. G., and Lefkowitz, R. J. (1987) A family of receptors coupled to guanine nucleotide regulatory proteins. Biochemistry 26, 2657-2664

Dorner, A. J., Wasley, L. C., and Kaufman, R. J. (1989) Increased synthesis of secreted proteins induces expression of glucose-regulated proteins in butyrate-treated Chinese hamster ovary cells. J. Biol. Chem. 264, 20602-20607

Dougherty, D. A. (1996) Cation-7T interactions in chemistry and biology: a new view of benzene, Phe, Tyr, and Trp. Science 271, 163-168

Ehlert, F. (1985) The relationship between muscarinic receptor occupancy and adenylate cyclase inhibition in the rabbit myocardium. MoL Pharmacol. 28, 410-421 158

Exton, J. H. (1997) Cell signalling through guanine-nucleotide-binding regulatory proteins (G proteins) and phospholipases. Eur. J. Biochem. 243, 10-20

Exton, J. H. (1996) Regulation of phosphoinositide phospholipases by hormones, neurotransmitters, and other agonists linked to G proteins. Annu. Rev. Pharmacol. Toxicol. 36, 481-509

Farrens, D. L., Altenbach, C., Yang, K., Hubbell, W. L., and Khorana, H. G. (1996) Requirement of rigid-body motion of transmembrane helices for light activation of rhodopsin. Science 274, 768-770

Fersht, A. R. (1988) Relationships between apparent binding energies measured in site- directed mutagenesis experiments and energetics of binding and catalysis. Biochemistry 27, 1577-1580

Fersht, A. R., Leatherbarrow, R. J., and Wells, T. N. C. (1987) Structureactivity relationships in engineered proteins: analysis of use of binding energy by linear free energy relationships. Biochemistry 26, 6030-6038

Fisher, A., Heldman, E., Gurwitz, D., Haring, R., Karton, Y., Meshulam, H., Pittel, Z., Marciano, D., Brandeis, R., Sadot, E., Barg, Y., Pinkas-Kramarski, R., Vogel, Z., Ginzburg, I., Treves, T. A., Verchovsky, R., Klimowsky, S., and Korczyn, A. D. (1996) M1 agonists for the treatment of Alzheimer's disease. Novel properties and clinical update. Ann. N. Y Acad. Sci. 777, 189-196

Fisher, S. K., Figueiredo, J. C., and Bartus, R. T. (1984) Differential stimulation of inositol phospholipid turnover in brain by analogs of oxotremorine. J. Neurochem. 43, 1171-1179

Fisher, S. K., Klinger, P. D., and Agranoff, B. W. (1983) Muscarinic agonist binding and phospholipid turnover in brain. J. Biol. Chem. 258, 7358-7363

Fraser, C. M., Arakawa, S., McCombie, W. R., and Venter, J. C. (1989) Cloning, sequence alalysis, and permanent expression of a2-adrenergic receptor in Chinese hamster ovary cells. J. Biol. Chem. 264, 11754-11761

Fraser, C. M., Wang, C. D., Robinson, D. A., Gocayne, J. D., and Venter, J. C. (1989) Site-directed mutagenesis of ml muscarinic acetylcholine receptors: conserved aspartic acids play important roles in receptor function. Mol. Pharmacol. 36, 840-847

Furchgott, R. F. (1964) Receptor mechanisms. Ann. Rev. Pharm. 4,21-50

Galzi, J.-L., and Changeux, J.-P. (1994) Neurotransmitter-gated ion channels as unconventional allosteric proteins. Curr. Opin. Struct. Biol. 4,554-565

Galzi, J.-L., Revah, F., Bessis, A., and Changeux, J.-P. (1991) Functional architecture of the nicotinic acetylcholine receptor: from electric organ to brain. Annu. Rev. Pharmacol. Toxicol. 31, 37-72 159

Gantz, I., Del Valle, J., Wang, L. D., Tashiro, T., Munzert, G., Guo, Y. J., Konda, Y., and Yamada, T. (1992) Molecular basis for the interaction of histamine with the histamine H2 receptor. J. Biol. Chem. 267, 20840-20843

Gao, B. N., and Gilman, A. G. (1991) Cloning and expression of a widely distributed (type IV) adenylyl cyclase. Proc. Natl. Acad. Sci. U. S. A. 88, 10178-10182

Gilman, A. G. (1987) G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56, 615-649

Gocayne, J., Robinson, D. A., Fitz Gerald, M. G., Chung, F.-Z., Kerlavage, A. R., Lentes, K.-U., Lai, J., Wang, C.-D., Fraser, C. M., and Venter, J. C. (1987) Primary structure of rat cardiac 13-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family. Proc. Natl. Acad. Sci. U. S. A. 84, 8296-8300

Goldsmith, P., Gierschik, P., Milligan, G., Unson, C. G., Vinitsky, R., Malech, H. L., and Spiegel, A. M. (1987) Antibodies directed against synthetic peptides distinguish between GTP-binding proteins in neutrophil and brain. J. Biol. Chem. 262, 14683-14688

Gutowski, S., Smrcka, A., Nowak, L., Wu, D., Simon, M., and Sternweis, P. C. (1991) Antibodies to the aq subfamily of guanine nucleotide-binding regulatory protein a subunits attenuate activation of phosphatidylinositol 4,5-bisphosphate hydrolysis by hormones. J. Biol. Chem. 266, 20519-20524

Haga, K., and Haga, T. (1992) Activation by G protein fry subunits of agonist- or light- dependent phosphorylation of muscarinic acetylcholine receptors and rhodopsin. J. Biol. Chem. 267, 2222-2227

Haga, K., and Haga, T. (1990) Dual regulation by G proteins of agonist-dependent phosphorylation of muscarinic acetylcholine receptors. FEBS Lett. 268, 43-47

Haga, K., Haga, T., and Ichiyama, A. (1990) Phosphorylation by protein kinase C of the muscarinic acetylcholine receptor. J. Neurochem. 54, 1639-1644

Haga, K., Kameyama, K., and Haga, T. (1994) Synergistic activation of a G protein- coupled receptor kinase by G protein fry subunits and mastoparan or related peptides. J. Biol. Chem. 269, 12594-12599

Haga, K., Kameyama, K., Haga, T., Kikkawa, U., Shiozaki, K., and Uchiyama, H. (1996) Phosphorylation of human ml muscarinic acetylcholine receptors by G protein-coupled receptor kinase 2 and protein kinase C. J. Biol. Chem. 271, 2776-2782

Haga, K., Tsuga, H., and Haga, T. (1997) Ca2+-dependent inhibition of G protein- coupled receptor kinase 2 by calmodulin. Biochemistry 36, 1315-1321 160

Haga, K., Uchiyama, H., Haga, T., Ichiyama, A., Kangawa, K., and Matsuo, H. (1989) Cerebral muscarinic acetylcholine receptors interact with three kinds of GTP- binding proteins in a reconstitution system of purified components. MoL Pharmacol. 35, 286-294

Haga, T., Haga, K., Kameyama, K., and Nakata, H. (1993) Phosphorylation of muscarinic receptors: regulation by G proteins. Life Sci. 52, 421-428

Hammer, R., Berrie, C. P., Birdsall, N. J. M., Burgen, A. S. V., and Hulme, E. C. (1980) Pirenzepine distinguishes between different subclasses of muscarinic receptors. Nature 283, 90-92

Hammer, R., Giraldo, E., Schiavi, G. B., Monferini, E., and Ladinsky, H. (1986) Binding profile of a novel cardioselective muscarine receptor antagonist, AF-DX 116, to membranes of peripheral tissues and brain in the rat. Life Sci. 38, 1653­ 1662

Hargrave, P. A., McDowell, J. H., Curtis, D. R., Wang, J. K., Juszczak, E., Fong, S.-L., Rao, J. K. M., and Argos, P. (1983) The structure of bovine rhodopsin. Biophys. Struct. Mech. 9, 235-244

Hargrave, P. A., McDowell, J. H., Feldmann, R. J., Atkinson, P. H., Rao, J. K., and Argos, P. (1984) Rhodopsin's protein and carbohydrate structure: selected aspects. Vision Res. 24, 1487-1499

Hayashi, M. K., and Haga, T. (1997) Palmitoylation of muscarinic acetylcholine receptor m2 subtypes: reduction in their ability to activate G proteins by mutation of a putative palmitoylation site, cysteine 457, in the carboxyl-terminal tail. Arch. Biochem. Biophys. 340, 376-382

Hepler, J. R., and Gilman, A. G. (1992) G proteins. Trends Biochem. Sci. 17, 383-387

Her litze, S., Garcia, D. E., Mackie, K., Hi lle, B., Scheuer, T., and Catterall, W. A. (1996) Modulation of Ca2+ channels by G-protein 13y subunits. Nature 380, 258-262

Hi lle, B. (1992) G protein-coupled mechanisms and nervous signaling. Neuron 9, 187­ 195

Hille, B. (1992) Ionic channels of excitable membranes, 2nd Ed., Sinauer, Sunderland, Massachusetts

Hirschberg, B. T., and Schimerlik, M. I. (1994) A kinetic model for oxotremorine M binding to recombinant porcine m2 muscarinic receptors in Chinese hamster ovary cells. J. Biol. Chem. 269, 26127-26135

Ho, B. Y., Karschin, A., Branchek, T., Davidson, N., and Lester, H. A. (1992) The role of conserved aspartate and serine residues in ligand binding and in function of the 5-HT1A receptor: a site-directed mutation study. FEBS Lett. 312, 259-262 161

Horstman, D. A., Brandon, S., Wilson, A. L., Guyer, C. A., Cragoe, E. J., Jr., and Limbird, L. E. (1990) An aspartate conserved among G-protein receptors confers allosteric regulation of a2-adrenergic receptors by sodium. J. Biol. Chem. 265, 21590-21595

Houslay, M., and Milligan, G. (1997) Tailoring cAMP-signalling responses through isoform multiplicity. Trends Biochem. Sci. 22, 217-224

Huang, C.-L., Slesinger, P. A., Casey, P. J., Jan, Y. N., and Jan, L. Y. (1995) Evidence that direct binding of Gfry to the GIRK1 G protein-gated inwardly rectifying K+ channel is important for channel activation. Neuron 15, 1133-1143

Huang, R.-R. C., Vicario, P. P., Strader, C. D., and Fong, T. M. (1995) Identification of residues involved in ligand binding to the neurokinin-2 receptor. Biochemistry 34, 10048-10055

Ikeda, S. R. (1996) Voltage-dependent modulation of N-type calcium channels by G- protein fry subunits. Nature 380, 255-258

Jagerschmidt, A., Guillaume, N., Goudreau, N., Maigret, B., and Rogues, B.-P. (1995) Mutation of Aspl°° in the second transmembrane domain of the cholecystokinin B receptor increases antagonist binding and reduces signal transduction. Mol. PharmacoL 48, 783-789

Jiang, H., Wu, D., and Simon, M. I. (1994) Activation of phospholipase C 134 by heterotrimeric GTP-binding proteins. J. Biol. Chem. 269, 7593-7596

Johnson, R. A., and Salomon, Y. (1991) Assay of Adenylyl Cyclase Catalytic Activity. Methods EnzymoL 195, 3-21

Jones, P. G., Curtis, C. A. M., and Hulme, E. C. (1995) The function of a highly- conserved arginine residue in activation of the muscarinic Ml receptor. Eur. J. Pharmacol. 288, 251-257

Kameyama, K., Haga, K., Haga, T., Kontani, K., Katada, T., and Fukada, Y. (1993) Activation by G protein fry subunits of (3-adrenergic and muscarinic receptor kinase. J. Biol. Chem. 268, 7753-7758

Katz, A., Wu, D., and Simon, M. I. (1992) Subunits fry of heterotrimeric G protein activate 132 isoform of phospholipase C. Nature 360, 686-689

Kohn, E. C., Alessandro, R., Probst, J., Jacobs, W., Brilley, E., and Felder, C. C. (1996) Identification and molecular characterization of a m5 muscarinic receptor in A2058 human melanoma cells. Coupling to inhibition of adenylyl Cyclase and stimulation of phospholipase A2. J. Biol. Chem. 271, 17476-17484

Kolakowski, L. F., Jr. (1994) GCRDb: a G-protein-coupled receptor database. Receptors Channels 2, 1-7 162

Kristiansen, K., Dahl, S. G., and Edvardsen, 0. (1996) A database of mutants and effects of site-directed mutagenesis experiments on G protein-coupled receptors. Protein-Struct. Funct. Genet. 26, 81-94

Kubo, T., Fukuda, K., Mikami, A., Maeda, A., Takahashi, H., Mishina, M., Haga, T., Haga, K., Ichiymama, A., Kangawa, K., Kojima, M., Matsuo, H., Hirose, T., and Numa, S. (1986) Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetylcholine receptor. Nature 323, 411-416

Kubo, T., Maeda, A., Sugimoto, K., Akiba, I., Mikami, A., Takahashi, H., Haga, T., Haga, K., Ichiyama, A., Kangawa, K., Matsuo, H., Hirose, T., and Numa, S. (1986) Primary structure of porcine cardiac muscarinic acetylcholine receptor deduced from the cDNA sequence. FEBS Lett. 209, 367-372

Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Rapid and efficient site-specific mutagensis without phenotypic selection. Methods Enzymol. 154, 367-382

Kurachi, Y., Ito, H., Sugimoto, T., Katada, T., and Ui, M. (1989) Activation of atrial muscarinic K+ channels by low concentrations of 13y subunits of rat brain G protein. Pfliigers Arch. 413, 325-327

Kurtenbach, E., Curtis, C. A. M., Pedder, E. K., Aitken, A., Harris, A. C. M., and Hulme, E. C. (1990) Muscarinic acetylcholine receptors. Peptide sequencing identifies residues involved in antagonist binding and disulfide bond formation. J. Biol. Chem. 265, 13702-13708

Kwatra, M. M., Benovic, J. L., Caron, M. G., Lefkowitz, R. J., and Hosey, M. M. (1989) Phosphorylation of chick heart muscarinic cholinergic receptors by the 13­ adrenergic receptor kinase. Biochemistry 28, 4543-4547

Lambrecht, G., Feifel, R., Forth, B., Strohmann, C., Tacke, R., and Mutschler, E. (1988) p-fluoro-hexahydro-sila-difenidol: the first M2 beta-selective muscarinic antagonist. Eur. J. Pharmacol. 152, 193-194

Lameh, J., Philip, M., Sharma, Y. K., Moro, 0., Ramachandran, J., and Sadee, W. (1992) Hml muscarinic cholinergic receptor internalization requires a domain in the third cytoplasmic loop. J. Biol. Chem. 267, 13406-13412

Langley, J. N. (1906) On nerve endings and on special excitable substances in cells. J. Physiol. 33, 170-194

Lee, W., Nicklaus, K. J., Manning, D. R., and Wolfe, B. B. (1990) Ontogeny of cortical muscarinic receptor subtypes and muscarinic receptor-mediated responses in rat. J. Pharmacol. Exp. Ther. 252, 482-490

Liao, C.-F., Themmen, A. P. N., Joho, R., Barberis, C., Birnbaumer, M., and Birnbaumer, L. (1989) Molecular cloning and expression of a fifth muscarinic acetylcholine receptor. J. Biol. Chem. 264, 7328-7337 163

LiCata, V. J., and Ackers, G. K. (1995) Long-range, small magnitude nonadditivity of mutational effects in proteins. Biochemistry 34, 3133-3139

Loewi, 0. (1921) Uber humorale Ubertragbarkeit der Herznervenwirkung (Mitteilung I). Arch. Ges. Physiol. 189, 239-242

Loewi, 0., and Navaratil, E. (1926) Uber humorale Ubertragbarkeit der Herznervenwirkung (Mitteilung IX). Arch. Ges. Physiol 214, 689-696

Loewi, 0., and Navaratil, E. (1926) Uber humorale Ubertragbarkeit der Herznervenwirkung (Mitteilung X). Arch. Ges. Physiol. 214, 678-688

Logothetis, D. E., Kurachi, Y., Galper, J., Neer, E. J., and Clapham, D. E. (1987) The 13'y subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325, 321-326

Lu, Z.-L., Curtis, C. A., Jones, P. G., Pavia, J., and Hulme, E. C. (1997) The role of the aspartate-arginine-tyrosine triad in the ml muscarinic receptor: mutations of aspartate 122 and tyrosine 124 decrease receptor expression but do not abolish signaling. Mol. Pharmacol. 51, 234-241

Maeda, A., Kubo, T., Mishina, M., and Numa, S. (1988) Tissue distribution of mRNAs encoding muscarinic acetylcholine receptor subtypes. FEBS Lett. 239, 339-342

Mann, J. (1992) Murder, Magic, and Medicine, Oxford University Press, New York

Mansour, A., Meng, F., Meador-Woodruff, J. H., Taylor, L. P., Civelli, 0., and Akil, H. (1992) Site-directed mutagenesis of the human dopamine D2 receptor. Eur. J. Pharmacol. 227, 205-214

Marquardt, D. W. (1963) An algorith for least-squares estimation of nonlinear parameters. J. Soc. Ind. AppL Math. 11, 431-441

McKinnon, L. A., and Nathanson, N. M. (1996) Tissue-specific regulation of muscarinic acetylcholine receptor expression during embryonic development. J. Biol. Chem. 270, 20636-20642

Moriarty, T. M., Padrell, E., Carty, D. J., Omri, G., Landau, E. M., and Iyengar, R. (1990) Go protein as signal transducer in the pertussis toxin-sensitive phosphatidylinositol pathway. Nature 343, 79-82

Mukai, H., Munekata, E., and Higashijima, T. (1992) G protein antagonists. A novel hydrophobic peptide competes with receptor for G protein binding. J. Biol. Chem. 267, 16237-16243

Murad, F., Chui, Y. M., Rall, R. W., and Sutherland, E. W. (1962) Adenylcyclase The effects of catecholamines and choline esters on the formation of 3',5'­ phosphate by preparations from cardic muscle and liver. J. BioL Chem. 237, 1233-1238 164

Nakayama, T. A., and Khorana, H. G. (1991) Mapping of the amino acids in membrane-embedded helices that interact with the retinal chromophore in bovine rhodopsin. J. Biol. Chem. 266, 4269-4275

Nakayama, T. A., and Khorana, H. G. (1990) Orientation of retinal in bovine rhodopsin determined by cross-linking using a photoactivatable analog of 11-cis-retinal. J. Biol. Chem. 265, 15762-15769

Nardone, J., and Hogan, P. G. (1994) Delineation of a region in the B2 bradykinin receptor that is essential for high-affinity agonist binding. Proc. Natl. Acad. Sci. U. S. A. 91, 4417-4421

Nathans, J. (1990) Determinants of visual pigment absorbance: identification of the retinylidene Schiff s base counterion in bovine rhodopsin. Biochemistry 29, 9746-9752

Nathans, J., and Hogness, D. S. (1984) Isolation and nucleotide sequence of the gene encoding human rhodopsin. Proc. Natl. Acad. Sci. U. S. A. 81, 4851-4855

Nathans, J., Thomas, D., and Hogness, D. S. (1986) Molecular genetics of human color vision: the genes encoding blue, green, and red pigments. Science 232, 193-202

Nathanson, N. M. (1987) Molecular proterties of the muscarinic acetylcholine receptor. Ann. Rev. Neurosci. 10, 195-236

Neer, E. J., Lok, J. M., and Wolf, L. G. (1984) Purification and properties of the inhibitory guanine nucleotide regulatory unit of brain adenylate cyclase. J. Biol. Chem. 259, 14222-14229

Neve, K. A., Cox, B. A., Henningsen, R. A., Spanoyannis, A., and Neve, R. L. (1991) Pivotal role for aspartate-80 in the regulation of dopamine D2 receptor affinity for drugs and inhibition of adenylyl cyclase. Mol. Pharmacol. 39, 733-739

Northup, J. K., Sternweis, P. C., Smigel, M. D., Schleifer, L. S., Ross, E. M., and Gilman, A. F. (1980) Purification of the regulatory component of adenylate cyclase. Proc. Natl. Acad. Sci. U. S. A. 77, 6516-6520

Ohta, K., Hayashi, H., Mizuguchi, H., Kagamiyama, H., Fujimoto, K., and Fukui, H. (1994) Site-directed mutagenesis of the histamine H1 receptor: roles of aspartic acid107, asparagine198 and threonine194. Biochem. Biophys. Res. Comm. 203, 1096-1101

Olvieira, L., Paiva, A. C. M., and Vriend, G. (1993) A common motif in G-protein­ coupled seven transmembrane helix receptors. J. Comp. Aid. Mol. Des. 7, 649­ 658

Onai, T., FitzGerald, M. G., Arakawa, S., Gocayne, J. D., Urquhart, D. A., Hall, L. M., Fraser, C. M., McCombie, W. R., and Venter, J. C. (1989) Cloning, sequence 165

analysis and chromosome localization of a Drosophila muscarinic acetylcholine receptor. FEBS Lett. 255, 219-225

Ordentlich, A., Barak, D., Kronman, C., Ariel, N., Segall, Y., Velan, B., and Shafferman, A. (1995) Contribution of aromatic moieties of tyrosine 133 and of the anionic subsite tryptophan 86 to catalytic efficiency and allosteric modulation of acetykholinesterase. J. Biol. Chem. 270, 2082-2091

Ovchinnikov, Y. A., Abdulaeh, N. G., Feigina, M. Y., Artamonov, I. D., Zolotereve, A. S., Kostina, M. B., Bogachuk, A. S., Miroshnikov, A. I., Martinov, V. I., and Kudelin, A. B. (1982) The complete amino acid sequence of visual rhodopsin. Bioorg. Khim. 8, 1011-1014

Padrell, E., Carty, D. J., Moriarty, T. M., Hildebrandt, J. D., Landau, E. M., and Iyengar, R. (1991) Two forms of the bovine brain Go that stimulate the inositol trisphosphate-mediated Cl- currents in Xenopus oocytes. Distinct guanine nucleotide binding properties. J. Biol. Chem. 266, 9771-9777

Page, K. M., Curtis, C. A. M., Jones, P. G., and Hulme, E. C. (1995) The functional role of the binding site aspartate in muscarinic acetylcholine receptors, probed by site-directed mutagenesis. Eur. J. Pharmacol. 289, 429-437

Pang, I. H., and Sternweis, P. C. (1990) Purification of unique a subunits of GTP- binding regulatory proteins (G proteins) by affinity chromatography with immobilized 13y subunits. J. Biol. Chem. 265, 18707-18712

Park, D., Jhon, D.-Y., Lee, C.-W., Lee, K.-H., and Rhee, S. G. (1993) Activation of phospholipase C isozymes by G protein 13y subunits. J. Biol. Chem. 268, 4573­ 4576

Peralta, E. G., Ashkenazi, A., Winslow, J. W., Ramachandran, J., and Capon, D. J. (1988) Differential regulation of PI hydrolysis and adenylyl cyclase by muscarinic receptor subtypes. Nature 334, 434-437

Peralta, E. G., Ashkenazi, A., Winslow, J. W., Smith, D. H., Ramachandran, J., and Capon, D. J. (1987) Distinct primary structures, ligand-binding properties and tissue-specific expression of four human muscarinic acetylcholine receptors. EMBO J. 6, 3923-3929

Peralta, E. G., Winslow, J. W., Peterson, G. L., Smith, D. H., Ashkenazi, A., Ramachandran, J., Schimerlik, M. I., and Capon, D. J. (1987) Primary structure and biochemical properties of an M2 muscarinic receptor. Science 236, 600-605

Peterson, G. L., and Schimerlik, M. I. (1984) Large scale preparation and characterization of membranes-bound and detergent-solublized muscarinic acetylcholine receptor from pig atria. Prep. Biochem. 14, 33-74

Peterson, G. L., Toumadje, A., Jonhson, W. C., Jr., and Schimerlik, M. I. (1995) Purification of recombinant porcine m2 muscarinic acetylcholine receptor from 166

Chinese hamster ovary cells. Circular dichrosim spectra and ligand binding properties. J. Biol. Chem,. 270, 17808-17814

Pfeuffer, T. (1977) GTP-binding proteins in membranes and the contol of adenylate cyclase activity. J. Biol. Chem. 252, 7224-7234

Pitcher, J. A., Inglese, J., Higgins, J. B., Arriza, J. L., Casey, P. J., Kim, C., Benovic, J. L., Kwatra, M. M., Caron, M. G., and Lefkowitz, R. J. (1992) Role of fry subunits of G proteins in targeting the 13-adrenergic receptor kinase to membrane-bound receptors. Science 257, 1264-1267

Probst, W. C., Snyder, L. A., Schuster, D. I., Brosius, J., and Sealfon, S. C. (1992) Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol. 11, 1-20

Radic, Z., Gibney, G., Kawamoto, S., MacPhee-Quigley, K., Bongiorno, C., and Taylor, P. (1992) Expression of recombinant acetylcholinesterase in a baculovirus system: kinetic properties of glutamate 199 mutants. Biochemistry 31, 9760-9767

Rall, T., Sutherland, E. W., and Berthet, J. (1957) The relationship of epinephrine and glucagon to liver phosphorylase. IV. Effect of epinephrine and glucagon on the reactivation of phosphorylase in liver homogenates. J. Biol. Chem. 224, 463-475

Ray, K., Kunsch, C., Bonner, L. M., and Robishaw, J. D. (1995) Isolation of cDNA clones encoding eight different human G protein 'y subunits, including three novel forms designated the 'Y 'Y Biol. Chem. 270, . 4' . 10' and 71.1 subunits. J. 21765-21771

Reuveny, E., Slesinger, P. A., Inglese, J., Morales, J. M., Iffiguez-Lluhi, J. A., Lefkowitz, R. J., Bourne, H. R., Jan, Y. N., and Jan, L. Y. (1994) Activation of the cloned muscarinic potassium channel by G protein fry subunits. Nature 370, 143-146

Riker, W. F., and Wescoe, W. C. (1951) The pharmacology of flaxedil with observations on certain analogs. Ann. N. 1'. Acad. Sci. 54, 373-394

Rodbell, M. (1980) The role of hormone receptors and GTP-regulatory proteins in membrane transduction. Nature 284, 17-22

Rodbell, M., Birnbaumer, L., Pohl, S. L., and Krans, H. M. J. (1971) The glucagon­ sensitive adenyl cyclase system in plasma membranes of rat liver. V. An obligatory role of guanyl nucleotides in glucagon action. J. Biol. Chem. 246, 1877-1882

Rodbell, M., Krans, H. M. J., Pohl, S. L., and Birnbaumer, L. (1971) The glucagon­ sensitive adenyl cyclase system in plasma membranes of rat liver. IV. Effects of guanyl nucleotides on binding of 125I-glucagon. J. Biol. Chem. 246, 1872-1876 167

Rosenbaum, L. C., Malencik, D. A., Anderson, S. R., Tota, M. R., and Schimerlik, M. I. (1987) Phosphorylation of the porcine atrial muscarinic acetylcholine receptor by cyclic AMP dependent protein kinase. Biochemistry 26, 8183-8188

Ross, E. M., and Gilman, A. G. (1977) Resolution of some components of adenylate cyclase necessary for catalytic activity. J. Biol. Chem. 252, 6966-6969

Sakmar, T. P., Franke, R. R., and Khorana, H. G. (1989) Glutamic acid-113 serves as the retinylidene Schiff base counterion in bovine rhodopsin. Proc. Natl. Acad. Sci. U. S. A. 86, 8309-8313

Salomon, Y. (1979) Adenylate Cyclase Assay. Adv. Cyclic Nucleotide Res. 10, 35-55

Samama, P., Cotecchia, S., Costa, T., and Lefkowitz, R. J. (1993) A mutation-induced activated state of the 132-adrenergic receptor. Extending the ternary complex model. J. Biol. Chem. 268, 4625-4636

Samama, P., Pei, G., Costa, T., Cotecchia, S., and Lefkowitz, R. J. (1994) Negative antagonist promote an inactive conformation of the f32-adrenergic receptor. MoL Pharmacol. 45, 390-394

Sanger, F., Nick len, S., and Coulson, A. R. (1977) DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467

Savarese, T. M., Wang, C.-D., and Fraser, C. M. (1992) Site-directed mutagenesis of the rat m1 muscarinic acetylcholine receptor. Role of conserved cysteines in receptor function. J. Biol. Chem. 267, 11439-11448

Scatchard, G. (1949) The attractions of proteins for small molecules and ions. Ann. N. Y. Acad. Sci. 51, 600-672

Schertler, G. F. X., and Hargrave, P. A. (1995) Projection structure of frog rhodopsin in two crystal forms. Proc. Natl. Acad. Sci. U. S. A. 92, 11578-11582

Schertler, G. F. X., Villa, C., and Henderson, R. (1993) Projection structure of rhodopsin. Nature 362, 770-772

Schimerlik, M. I., and Searles, R. P. (1980) Ligand interactions with membrane-bound porcine atrial mucarinic receptor(s). Biochemistry 19, 3407-3413

Schmiedeberg, 0., and Koope, R. (1869) Das Muscarin. Das giftige Alkaloid des Fliegenpilzes, Vogel, Leipzig

Schreibmayer, W., Dessauer, C. W., Vorobiov, D., Gilman, A. G., Lester, H. A., Davidson, N., and Dascal, N. (1996) Inhibition of an inwardly rectifying K+ channel by G-protein a-subunits. Nature 380, 624-627 168

Schwarz, R. D., Spencer, C. J., Jaen, J. C., Mirzadegan, T., Moreland, D., Tecle, H., and Thomas, A. J. (1995) Mutations of aspartate 103 in the Hm2 receptor and alterations in receptor binding properties of muscarinic agonists. Life Sci. 56, 923-929

Sealfon, S. C., Chi, L., Ebersole, B. J., Rodic, V., Zhang, D., Ballesteros, J. A., and Weinstein, H. (1995) Related contribution of specific helix 2 and 7 residues to conformational activation of the serotonin 5-HT2A receptor. J. Biol. Chem. 270, 16683-16688

Shapiro, R. A., Wakimoto, B. T., Subers, E. M., and Nathanson, N. M. (1989) Characterization and functional expression in mammalian cells of genomic and cDNA clones encoding a Drosophila muscarinic acetylcholine receptor. Proc. Natl. Acad. Sci. U. S. A. 86, 9039-9043

Sheikh, S. P., Zvyaga, T. A., Lichtarge, 0., Sakmar, T. P., and Bourne, H. R. (1996) Rhodopsin activation blocked by metal-ion-binding sites linking transmembrane helices C and F. Nature 383, 347-350

Smigel, M. D. (1986) Purification of the catalyst of adenylate cyclase. J. Biol. Chem. 261, 1976-1982

Smith, R. D., Kistler, M. K., Cohen Williams, M., and Coffin, V. L. (1996) Cholinergic improvement of a naturally-occurring memory deficit in the young rat. Brain Res. 707, 13-21

Smrcka, A. V., Hepler, J. R., Brown, K. 0., and Sternweis, P. C. (1991) Regulation of polyphosphoinositide-specific phospholipase C activity by purified Gq. Science 251, 804-807

Smrcka, A. V., and Sternweis, P. C. (1993) Regulation of purified subtypes of phosphatidylinositol-specific phospholipase co by G protein a and f3y subunits. J. Biol. Chem. 268, 9667-9674

Spalding, T. A., Birdsall, N. J. M., Curtis, C. A. M., and Hulme, E. C. (1994) Acetylcholine mustard labels the binding site aspartate in muscarinic acetylcholine receptors. J. Biol. Chem. 269, 4092-4097

Stein, R., Pinkas-Kramarski, R., and Sokolovsky, M. (1988) Cloned M1 muscarinic receptors mediate both adenylate cyclase inhibition and phosphoinositide turnover. EMBO J. 7, 3031-3005

Sternweis, P. C., and Robishaw, J. D. (1984) Isolation of two proteins with high affinity for guanine nucleotides from membranes of bovine brain. J. Biol. Chem. 259, 13806-13813

Stockton, J. M., Birdsall, N. J. M., Burgen, A. S. V., and Hulme, E. C. (1983) Modification of the binding properties of muscarinic receptors by gallamine. Mol. Pharmacol. 23, 551-557 169

Strader, C. D., Sigal, I. S., Candelore, M. R., Rands, E., Hill, W. S., and Dixon, R. A. F. (1988) Conserved aspartic acid residues 79 and 113 of the fr-adrenergic receptor have different roles in receptor function. J. Biol. Chem. 263, 10267­ 10271

Strader, C. D., Sigal, I. S., Register, R. B., Candelore, M. R., Rands, E., and Dixon, R. A. F. (1987) Identification of residues required for ligand binding to the fr­ adrenergic receptor. Proc. Natl. Acad. Sci. U. S. A. 84, 4384-4388

Suprenant, A., Horstman, D. A., Akbarali, H., and Limbird, L. L. (1992) A point mutation of the a2-adrenoceptor that blocks coupling to potassium but not calcium currents. Science 257, 977-980

Sussman, J. L., Harel, M., Fro low, F., Oefner, C., Goldman, A., Toker, L., and Silman, I. (1991) Atomic structure of acetylcholinesterase from Torpedo california: a prototypic acetylcholine-binding protein. Science 253, 872-879

Tang, W.-J., and Gilman, A. G. (1991) Type-specific regulation of adenylyl cyclase by G protein fry subunits. Science 254, 1500-1503

Taussig, R., and Gilman, A. G. (1995) Mammalian membrane-bound adenylyl cyclases. J. Biol. Chem. 270, 1-4

Taussig, R., Iiiiguez-Lluhi, J. A., and Gilman, A. G. (1993) Inhibition of adenylyl cyclase by Gi a. Science 261, 218-221

Taussig, R., Tang, W. J., Hepler, J. R., and Gilman, A. G. (1994) Distinct patterns of bidirectional regulation of mammalian adenylyl cyclases. J. Biol. Chem. 269, 6093-6100

Taylor, S. J., and Exton, J. H. (1991) Two a subunits of the Gq class of G proteins stimulate phosphoinositide phospholipase C-01 activity. FEBS Lett. 286, 214­ 216

Taylor, S. J., Smith, J. A., and Exton, J. H. (1990) Purification from bovine liver membranes of a guanine nucleotide-dependent activator of phosphoinositide­ specific phospholipase C. Immunologic identification as a novel G-protein subunit. J. Biol. Chem. 265, 17150-17156

Tietje, K. M., Goldman, P. S., and Nathanson, N. M. (1990) Cloning and functional analysis of a gene encoding a novel muscarinic acetylcholine receptor expressed in chick heart and brain. J. Biol. Chem. 265, 2828-2834

Tietje, K. M., and Nathanson, N. M. (1991) Embryonic chick heart expresses multiple muscarinic acetylcholine receptor subtypes. Isolation and characterization of a gene encoding a novel m2 muscarinic acetylcholine receptor with high affinity for pirenzepine. J. Biol. Chem. 266, 17382-17387 170

Tota, M. R., and Schimerlik, M. I. (1990) Partial agonist effects on the interaction between the atrial muscarinic receptor and the inhibitory guanine nucleotide- binding protein in a reconstituted system. MoL Pharmacol. 37, 996-1004

Trumpp-Kallmeyer, S., Hoflack, J., Bruinvels, A., and Hibert, M. (1992) Modeling of G-protein-coupled receptors: application to dopamine, adrenaline, serotonin, acetylcholine, and mammalian opsin receptors. J. Med. Chem. 35, 3448-3462

Urlaub, G., and Chasin, L. A. (1980) Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc. Natl. Acad. Sci. U. S. A. 77, 4216-4220 van Koppen, C. J., and Nathanson, N. M. (1990) Site-directed mutagenesis of the m2 muscarinic acetylcholine receptor. Analysis of the role of N-glycosylation in receptor expression and function. J. Biol. Chem. 265, 20887-20892

Vandeyar, M. A., Weiner, M. P., Hutton, C. J., and Batt, C. A. (1988) A simple and rapid method for the selection of oligodeoxynucleotide-directed mutants. Gene 65, 129-133

Velimirovic, B. M., Gordon, E. A., Lim, N. F., Navarro, B., and Clapham, D. E. (1996) The K+ channel inward rectifier subunits form a channel similar to neuronal G protein-gated K+ channel. FEBS Lett. 379, 31-37

Vilaro, M. T., Palacios, J. M., and Mengod, G. (1990) Localization of m5 muscarinic receptor mRNA in rat brain examined by in situ hybridization histochemistry. Neurosci. Lett. 114, 154-159

Vilaro, M. T., Wiederhold, K. H., Palacios, J. M., and Mengod, G. (1991) Muscarinic cholinergic receptors in the rat caudate-putamen and olfactory tubercle belong predominantly to the m4 class: in situ hybridization and receptor autoradiography evidence. Neuroscience 40, 159-167

Vilaro, M. T., Wiederhold, K. H., Palacios, J. M., and Mengod, G. (1992) Muscarinic M2 receptor mRNA expression and receptor binding in cholinergic and non­ cholinergic cells in the rat brain: a correlative study using in situ hybridization histochemistry and receptor autoradiography. Neuroscience 47, 367-393

Vogel, W. K., Mosser, V. A., Bulseco, D. A., and Schimerlik, M. I. (1995) Porcine m2 muscarinic acetylcholine receptor-effector coupling in Chinese hamster ovary cells. J. Biol. Chem. 270, 15485-15493, Chapter 2 of this dissertation

Vogel, W. K., Sheehan, D. M., and Schimerlik, M. I. (1997) Site-directed mutagensis on the m2 muscarinic acetylcholine receptor. The significance of tyrosine 403 in the binding of agonists and functional coupling. MoL PharmacoL (submitted), Chapter 3 of this dissertation 171

Wang, C.-D., Buck, M. A., and Fraser, C. M. (1991) Site-directed mutagenesis of a2A adrenergic receptors: identification of amino acids involved in ligand binding and receptor activation by agonists. Mol. Pharmacol. 40, 168-179

Wang, C.-D., Gallaher, T. K., and Shih, J. C. (1993) Site-directed mutagenesis of the serotonin 5-hydroxytrypamine2 receptor: identification of amino acids necessary for ligand binding and receptor activation. Mol. Pharmacol. 43, 931-940

Wasson, R. G. (1971) Soma: Divine Mushroom of Immortality, Harcourt, Brace, and Jovanovich, New York

Watson, A. J., Aragay, A. M., Slepak, V. Z., and Simon, M. I. (1996) A novel form of the G protein 13 subunit G135 is specifically expressed in the vertebrate retina. J. Biol. Chem. 271, 28154-28160

Wess, J., Gdula, D., and Brann, M. R. (1991) Site-directed mutagenesis of the m3 muscarinic receptor: identification of a series of threonine and tyrosine residues involved in agonist but not antagonist binding. EMBO J. 10, 3729-3734

Wess, J., Maggio, R., Palmer, J. R., and Vogel, Z. (1992) Role of conserved threonine and tyrosine residues in acetylcholine binding and muscarinic receptor activation. A study with m3 muscarinic receptor point mutants. J. Biol. Chem. 267, 19313­ 19319

Wess, J., Nanavati, S., Vogel, Z., and Maggio, R. (1993) Functional role of proline and tryptophan residues highly conserved among G protein-coupled receptors studied by mutational analysis of the m3 muscarinic receptor. EMBO J. 12, 331-338

Whaley, B. S., Yuan, N., Birnbaumer, L., Clark, R. B., and Barber, R. (1994) Differential expression of the 13-adrenergic receptor modifies agonist stimulation of adenylyl cyclase: a quantitative evaluation. Mol. Pharmacol. 45, 481-489

Whittaker, V. P. (1990) The contribution of drugs and toxins to understanding of cholinergic function. Trends Pharmacol. Sci. 11, 8-13

Wickman, K. D., and Clapham, D. E. (1995) G-protein regulation of ion channels. Curr. Opin. Neurobiol. 5, 278-285

Wickman, K. D., Ifiiguez-Lluhl, J. A., Davenport, P. A., Taussig, R., Krapivinsky, G. B., Linder, M. E., Gilman, A. G., and Clapham, D. E. (1994) Recombinant G- protein 13y-subunits activate the muscarinic-gated atrial potassium channel. Nature 368, 255-257

Wigler, M., Pellicer, A., Silverstein, S., Axel, R., Urlaub, G., and Chasin, L. (1979) DNA-mediated transfer of adenine phosphoribosyltransferase locus into mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 76, 1373-1376 172

Wong, H.-M. S., Sole, M. J., and Wells, J. A. (1986) Assessment of mechanistic proposals fot the binding of agonist to cardiac muscarinic receptor. Biochemistry 25, 6995-7008

Yatani, A., Mattera, R., Codina, J., Graf, R., Okabe, K., Padrell, E., Iyengar, R., Brown, A. M., and Birnbaumer, L. (1988) The G protein-gated atrial K+ channel is stimulated by three distinct Gi a-subunits. Nature 336,680-682

Yocca, F. D., 'ben, L., and Meller, E. (1992) Lack of apparent receptor reserve at postsynaptic 5-hydroxytryptamine1A receptors negatively coupled to adenylyl cyclase activity in rat hippocampal membranes. Mol. Pharmacol. 41, 1066-1072

Zamponi, G. W., Bourinet, E., Nelson, D., Nargeot, J., and Snutch, T. P. (1997) Crosstalk between G proteins and protein kinase C mediated by the calcium channel a subunit. Nature 385, 442-446 1

Zhang, D., and Weinstein, H. (1993) Signal transduction by a 5-HT2 receptor: a mechanistic hypothesis from molecular dynamics simulations of the three- dimensional model of the receptor complexed to ligands. J. Med. Chem. 36, 934-938

Zhou, W., Flanagan, C., Ballesteros, J. A., Konvicka, K., Davidson, J. S., Weinstein, H., Millar, R. P., and Sealfon, S. C. (1994) A reciprocal mutation supports helix 2 and helix 7 proximity in the gonadotropin-releasing hormone receptor. Mol. Pharmacol. 45, 165-170

Zhukovsky, E. A., and Oprian, D. D. (1989) Effect of carboxylic acid side chains on the absorption maximum of visual pigments. Science 246, 928-930 173

APPENDIX 174

Direct ligand binding

Scheme A.1 describes the equilibrium binding of radiolabeled ligand (L) to receptor (R) to form specifically bound receptor (RL). The dissociation constant (K) is described by Equation A.1. Nonspecifically bound ligand is modeled to be proportional to the free ligand concentration and the proportionality constant is N.

R + L RL

Scheme A.1

K _,[1?][L] [A.1] [RL]

The mass balance equations are,

[Ro] = [R] + [RL] [A.2]

[Lc] = [L] + [RL] + N[L] [A.3] where [Ro] and [Lo] are the total receptor and ligand concentrations and N[L] is the nonspecifically bound ligand.

A relationship for total bound ligand as a function of free ligand concentration is the sum of specific, [RL], and nonspecifically, N[L], bound ligand.

[RON N[L] [A.4] IC-F[L]

A relationship for total bound ligand as a function of total ligand concentration is likewise the sum of specific, [RL], and nonspecifically, N[L], bound ligand.

[R0([1-0] [RL]) [RL] ([Re] [A.5] K(N + 1)

Solving the quadratic in [RL] gives,

2[Ro ][4] [RL] [A.6] K(N + 1) + [Ro] + [L0] + V(K(N + 1) + [RO] +[L° D2 4[Ro][1,0] 175

Nonspecifically bound ligand as a function of total ligand concentration is found by rearranging Equation A.3,

N([4] [An) N[L] = [A.7] N +1

Competition Equilibrium Binding Scheme A.2 describes the equilibrium binding of unlabeled ligand (A) to n noninteracting classes of sites (R1) that bind labeled ligand (L) with the same affinity to form specifically bound receptor (RiL).

DRA -A +L KJ R i=1

Scheme A.2

K =[Ri][L] [A.8]

K [RIA] [A.9]

The mass balance equations are,

[Re] = +[R,L,]+[R,A]) [A.10]

[]i = [L] + N[L1+±jR,L1 [A.11]

[Ad= [A] +NA[A] +i[RA] [A.12] 1=1 where [R0], [Lo ], and [Ad are total receptor, labeled ligand, and unlabeled ligand, respectively, K is the dissociation constant of the L-bound complex, (RL), and K. is the dissociation constant of the A-bound complex, AA. Nonspecific binding of the labeled ligand is modeled to be proportional to its free ligand concentration, [L], and the 176 proportionality constant is N. In the general case nonspecific binding of the unlabeled ligand is modeled to be proportional to its free ligand concentration, [A], and the proportionality constant is NA. The concentration of specifically bound receptor, for A bound to a single site, is described by,

[RL]) = [Ro]([L0 [A.13] ,x(i+ [Lo][R -n [A0 where a=K(N+1) [A.14] and = K, (NA +1) [A.15]

Equation A.13 can be rearranged to a third-order polynomial,

a[RI]3 + b[RL]2 + c[RL] + d = 0 [A.161 where a = /3i a [A.17]

b = + 44] + [Ro] [Ad) 16,([Ro] + 2[4]) afli [A.18]

c = c0-0 X[Ao] + A AO ALL0141+ 2[Ro]) [A.19]

d = f3[Lo]2[Rol [A.20]

The specifically bound concentration of receptor is obtained efficiently by solving Equation A.16 via Newton's Method. An explicit solution can be obtained with the cubic equation but the solution is difficult to calculate reliably under certain conditions. Under typical conditions, [A0] --- [A] since no displacement occurs until

[A] > [Ro], a simplified solution can be derived. The specifically bound concentration for

A bound to n sites is described by,

[A.21] [RL] = [Ro ILO] [RLOL [41 177 where = K(N + 41+1 [A.22] K and F, is the fraction of total receptor that binds A with the dissociation constant Ki.

Equation A.21 has a quadratic solution for n = 1,

[RL] = 2[R0][4] [A.23] al +[L0] +[R0]+ V(cci + [4] + [Ro])2 4[Ro][4]

Equation A.21 has a solution in the root of a third-order polynomial for n = 2,

[RL]3 + a[RL]2 + b[RL] + c = 0 [A.24] where a = a2 2[4] -[R,3] [A.25]

b = ala2+[4](al+ a2 + [4] + 2[R,3])+[Rja2F, + a1F2) [A.26]

c = -[4][R4a2F1 +a,F2+[4]) [A.27]

Equation A.21 has a solution in the root of a fourth-order polynomial for n = 3,

[RL]4 + a[RL]3 + b[RL]2 + c[RL] + d = 0 [A.28] where a = a2 a3 3[4] -[R,3] [A.29]

b= ala2+a,a3 + a,a3+ [4](2(a, + a2+a,)+3([4]+[Ro])) [A.30] +[Ro](Fi(a2 + a3)+ F2(a, + a3)+ F3(al + a2))

c = -a,a2a3-[Ro](a2a3F, + oca3F2+a,a2F3) -[4](a,a2+ a,a3+ a2a3 + [4](ai+ a2 + a3 +[i [A.311

-2[4][Rd(F,(a2+ a3) + F2(a1 + a3) + F3 (a, + a2))

d = [4][Ro](a2a3F1 +a,a3F2+a,a2F3)+[4]3[Ro] [A.32] +[4]2[0F,(a2+a3)+ F2 (a, + a3) + F3(a,+ a2)) 178

The total bound ligand is the sum of specifically, UM, and nonspecifically, NG Lo] [RI]) , bound ligand. N +1