The Role of Pumilio 2 in Axonal Outgrowth by Dani Sarkis a Thesis

The Role of Pumilio 2 in Axonal Outgrowth

Dani Sarkis

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Physiology University of Toronto

The Role of Pumilio 2 in Axonal Outgrowth

Dani Sarkis

Master of Science

Graduate Department of Physiology

University of Toronto

2012

Pumilio 2 (PUM2) is a member of the Puf family of mRNA binding proteins and translational regulators which are involved in various processes including embryonic patterning and memory formation. Nevertheless, its functions in the outgrowth of neuronal axons have not been studied. This study shows endogenous expression of PUM2 in neurites of dorsal root ganglia (DRG) neurons and transport of PUM2 along retinal ganglion cell

(RGC) axons and their growth cones. Overexpression of PUM2 in DRG neurons resulted in shorter axons when compared to control neurons. Expression of either dominant negative mutation (dnPUM2) or PUM2W349G displayed a reduction in axonal length. PUM2 downregulation with microRNA (miRNA) also caused a reduction in neurite length compared to control neurons. Finally, PUM2 silencing did not alter eye size at E4, which allows investigation of axonal outgrowth in RGC in vivo. These results suggest a novel role for PUM2 in axonal outgrowth.

ii Dedication

To Ahed Khouri and Farid Sarkis, my mother and father. For everything you have done for me. For your unconditional love and support.

To Gabi Sarkis, my brother, my best friend, and idol.

iii Acknowledgements

First and foremost, I would like to thank my supervisor, Dr. Philippe Monnier, for giving me the chance to work on this project. I would also like to thank my advisory committee members, Dr. Zhong-Ping Feng and Dr. James Eubanks, for their insight and for ensuring I was on the right track towards obtaining my MSc.

I would also like to acknowledge the help and guidance of our research associate, Dr.

Nardos Tassew, PhD. Dr. Tassew taught me the skills that I needed to complete this project, and had very enlightening discussions with me to help me better understand my project, and I am grateful for her patience and help. Thank you Dr. Tassew and Dr.

Paromita Banerjee for your help with editing this thesis.

I must also thank my friends Gemma Higgs, MSc for help with editing this thesis,

Dr. Anne Wheeler, PhD for her helpful feedback and getting me into research in the ﬁrst place, and Elena Sidorova, MSc for her continuous support and encouragement.

This project was funded by two scholarships from the Vision Science Research Pro- gram (VSRP) at the Toronto Western Research Institute.

iv Contents

1 Introduction 1

1.1 mRNA Translation ...... 1

1.1.1 Overview of mRNA Translation in Eukaryotes ...... 1

1.1.2 Local Translation, RNA transport, and mRNA Binding Proteins . 2

1.2 Axonal Outgrowth ...... 4

1.3 The Embryonic Chicken Dorsal Root Ganglia as a Model for Axonal Out-

growth ...... 6

1.4 Pumilio - a Founding Member of the Puf Family ...... 7

1.5 Pumilio is Involved in Embryonic and Germline Development and Cell

Cycle Regulation ...... 9

1.6 Pumilio 1 and Pumilio 2: Vertebrate Homologues of the Drosophila Pumilio 10

1.7 Pumilio 2 and the Eukaryotic Initiation Factor 4E (eIF4E) ...... 12

1.8 Pumilio in the Nervous System ...... 13

1.9 Study Rationale ...... 14

1.10 Hypothesis and Aims ...... 17

2 Materials and Methods 18

2.1 Cloning ...... 18

2.1.1 Cloning of dominant negative PUM2 (dnPUM2) ...... 18

2.1.2 Cloning of PUM2W349G-EYFP in pEYFP-N1 ...... 19

v 2.1.3 Cloning of PUM2 microRNA (PUM2miRNA) ...... 20

2.1.4 Cloning of chicken PUM2 in pcDNA3.1 (-)/myc-His A ...... 21

2.1.5 Cloning of eIF4E-T2A-PUM2EYFP ...... 22

2.2 Cell Culture ...... 23

2.2.1 Transfection of Cell Lines ...... 24

2.3 Chicken Embryos ...... 24

2.4 Dorsal Root Ganglia (DRG) Neurons ...... 25

2.4.1 Dissection ...... 25

2.4.2 Nucleofection ...... 25

2.5 Retinal Flat Mounts ...... 26

2.6 Virus Preparation ...... 26

2.7 Fiber Tracing ...... 27

2.8 In Ovo Electroporation ...... 27

2.9 Immuno-cytochemistry ...... 29

2.10 Western Blots ...... 29

2.11 Microscopy ...... 30

2.12 Live Imaging ...... 31

2.13 Statistical Analysis ...... 31

3 Results 32

3.1 Construct Veriﬁcation ...... 32

3.2 PUM2 is transported along the axons in DRG neurons and RGCs . . . . 32

3.3 PUM2 overexpression results in shorter axons in dissociated DRG neurons 33

3.4 Expression of dnPUM2 or PUM2W349G results in shorter axons in disso-

ciated DRG neurons ...... 33

3.5 PUM2 silencing ...... 34

3.5.1 PUM2 silencing hinders axonal outgrowth in dissociated DRG neu-

rons ...... 34

vi 3.5.2 PUM2 silencing does not aﬀect eye size at E4 ...... 35

3.6 eIF4E fails to rescue the short axon phenotype ...... 35

4 Discussion 54

4.1 PUM2 localization in the growth cone and axons of RGCs and DRG neurons 55

4.2 Impaired axonal outgrowth in DRG neurons overexpressing PUM2 . . . . 56

4.3 Impaired axonal outgrowth in DRG neurons expressing PUM2 mutants . 58

4.4 PUM2 silencing interferes with axonal outgrowth in DRG neurons . . . . 60

4.5 eIF4E coexpression fails to rescue short axon phenotype ...... 61

4.6 Future Directions ...... 63

4.6.1 Are PUM2/Nos and PUM2/mRNA interactions necessary for nor-

mal axonal outgrowth? ...... 63

4.6.2 Can the short axon phenotype be rescued? ...... 63

4.6.3 What is the cause of the short axon phenotype? ...... 65

4.6.4 Testing the role of PUM2 in axonal outgrowth and guidance in vivo 66

4.7 Conclusion ...... 67

References 67

vii List of Figures

1.1 In Situ hybridization showing the expression of Pum2 transcript in E9 eye 15

1.2 PUM2 Expression in Axons and Growth Cones of Retinal Ganglion Cells 16

2.1 Schematic Representation of eIF4E-T2A-PUM2EYFP in pT2K ...... 23

2.2 In Ovo Electroporation of E1.5 Embryos ...... 28

3.1 Western blot verifying the provided and cloned constructs ...... 37

3.2 Western blot verifying PUM2W349G-EYFP ...... 38

3.3 PUM2 is transported along the axon of RGCs ...... 38

3.4 PUM2 is endogenously expressed in DRG neurons ...... 39

3.5 PUM2 Overexpression Results in Short Axons ...... 40

3.6 Quantiﬁcation of Axon Length in PUM2 Overexpression ...... 41

3.7 DRG neurons expressing dnPUM2 have shorter axons ...... 42

3.8 Quantiﬁcation of Axonal Length in dnPUM2 Overexpression ...... 43

3.9 DRG neurons expressing PUM2W349G have short axons ...... 44

3.10 Quantiﬁcation of Axonal Length in PUM2W349G Overexpression . . . . 45

3.11 PUM2 Silencing with miRNA constructs ...... 46

3.12 PUM2miRNA transfected neurons had shorter axons ...... 47

3.13 Quantiﬁcation of Axonal Length After PUM2 Silencing ...... 48

3.14 PUM2 Silencing and Eye Size ...... 49

3.15 Quantiﬁcation of the eﬀects of PUM2 silencing on eye size at E4 . . . . . 50

viii 3.16 Western Blot Conﬁrming Coexpression of eIF4E and PUM2EYFP . . . . 51

3.17 DRG neurons coexpressing eIF4E and PUM2 have short axons ...... 52

3.18 Quantiﬁcation of Axonal Length in eIF4E and PUM2 Coexpression . . . 53

4.1 Known interactions of PUM2 and possible involvement in axonal outgrowth 64

4.2 Time Lapse Imaging of DRG Neurons ...... 68

ix Chapter 1

Introduction

1.1 mRNA Translation

1.1.1 Overview of mRNA Translation in Eukaryotes

Messenger RNA (mRNA) translation is a stage of protein biosynthesis, where mRNA is used as a template for the assembly of amino acids to produce a polypeptide chain that undergoes modiﬁcations to form the protein. Translation is a complex and intricate process that involves many factors which are required to work in concert with one another. Brieﬂy, eukaryotic initiation factors (eIFs) activate the mRNA in preparation for ribosomal binding. eIFs bind to the m7G cap and the poly-A tail at the 5’ and 3’ ends of the mRNA, respectively. Next, the small ribosomal subunit (40S), loaded with the methionyl tRNA specialized for initiation (Met-tRNAi) and the initiation factors 1, 1A,

2, 3, and 5 must come together to form a pre-initiation complex (PIC). PIC interacts with the m7G binding eIF4E as well as eIF4G. The PIC then scans the 5’ untranslated region (UTR) of the mRNA for the start codon AUG (Sonenberg and Hinnebusch, 2009).

Furthermore, poly(A) binding protein (PABP) binds the poly(A) tail at the 3’ end of the mRNA and binds several factors, including the termination factor eRF-3. Direct interaction between PABP and eIF4G allows for the circularization of mRNA and the

1 Chapter 1. Introduction 2 formation of a closed loop complex (Sonenberg and Dever, 2003). The GTP (Guanosine

Triphosphate) on eIF2 is hydrolyzed to GDP (Guanosine Diphosphate), enabling the

40S ribosomal subunit to bind with a larger (60S) ribosomal subunit, forming an 80S ribosome necessary for translation of the mRNA (de Moor et al., 2005).

Other factors bind the 3’ UTR and contribute to the translation of mRNA. One such factor is the cytoplasmic polyadenylation element binding protein (CPEB). CPEB recognizes the cytoplasmic polyadenylation element (CPE) in the 3’ UTR of the mRNA and improves the recruitment of cleavage and polyadenylation speciﬁcity factor (CPSF), allowing for polyadenylation of the mRNA by poly(A) polymerase, thus increasing the stability of the mRNA (Radford et al., 2008). As one would expect, mRNA translation has the potential to be regulated in many ways and at diﬀerent steps as there are many factors that are involved. For example, phosphorylation of CPEB by Aurora A kinase on serine 174 is required in order for CPEB to recruit CPSF to the poly(A) signal. Another example is the suppression of cyclin B1 translation by Maskin, which can bind CPEB and eIF4E. This way, Maskin can exclude eIF4G and prevent the assembly of the proper translational machinery (de Moor et al., 2005).

1.1.2 Local Translation, RNA transport, and mRNA Binding

Proteins

Initially, biologists believed that translation of mRNA only occurred in the cytoplasm of the cell. However, it is was later proven that mRNA translation and protein production can occur where the protein is needed. Local translation was shown to be possible in cellular subcompartments and microdomains. For instance, protein production was shown to take place in the axons of goldﬁsh retinal explants, independent of the cell bodies (Koenig and Adams, 1982). In addition, mRNA of MAP2, CAMKIIα, and other proteins were shown to be selectively targeted to neuronal dendrites (Kuhl and Skehel,

1998). The question that arises from these observations is how mRNA molecules can ﬁnd Chapter 1. Introduction 3 their way to their destination.

Wilhelm and colleagues suggested a model to explain this phenomenon (Wilhelm and Vale, 1993). First, a ribonucleoprotein (RNP) complex is formed. This complex is comprised of the mRNA, RNA binding proteins (RBPs), and other cofactors. The

RNP complex uses the cytoskeleton to translocate to the destination subcellular domain, where the mRNA needs to be translated. Then, the RNP complex is anchored to the local cytoskeleton allowing the translation of mRNA in the target subdomains.

Another question that comes to mind is how the RNP complex moves along the cytoskeleton to reach its destination. It has been shown that RNP complexes also include motor proteins, allowing the RNP to associate with microﬁlaments and/or microtubules.

An example is Zipcode Binding Protein 1 (ZBP1), which binds the β-actin transcript forming a RNP complex. The RNP complex is then transported along microﬁlaments in

ﬁbroblasts and along microtubules in neurons (Kindler et al., 2005). Several RBPs have been shown to be associated with the motor protein kinesin 1, including staufen (Stau) and fragile X mental retardation protein (FMRP) (Kanai et al., 2004).

Several RBPs have been described and received considerable attention due to their clinical relevance. Mutations or impairment in the expression of FMRP, SMN (survival of motorneurons protein), and FUS (fused in sarcoma) are linked to fragile X syndrome, spinal muscular atrophy (SMA), and amyotrophic lateral sclerosis (ALS), respectively

(Liu-Yesucevitz et al., 2011). FMRP is involved in the transport and translational repression of its target mRNA. FMRP contains a RGG-box domain which allows the recognition of a G-quadruplex on the target mRNA, allowing the suppression of this mRNA at dendritic spines (Darnell et al., 2011). Lack of this translational suppression, either due to dephosphorylation by protein phosphatase-2A or mutations in the FMR1 gene, leads to overexpression of proteins that cause excess internalization of AMPA (2-amino-

3-(5-methyl-3-oxo-1,2- oxazol-4-yl)propanoic acid) receptors at the synapse (Bear et al.,

2004). Chapter 1. Introduction 4

Stau is another RBP that is involved in development. Stau was ﬁrst identiﬁed in Drosophila (Johnston et al., 1992) and has since been shown to interact with and transport several mRNAs, including oskar, bicoid, and prospero (Kiebler and DesGro- seillers, 2000). Stau has been implicated in several developmental processes varying from

Drosophila oocyte development (Johnston, 1995) to neuronal dendritic development in mammals (Tang et al., 2001). RBPs regulate other processes such as germline stem cell maintenance and eye development in the case of Musashi (Siddall et al., 2006; Raji et al.,

2007) and neuronal growth cone turning and local β-actin synthesis regulated by ZBP-1

(Sasaki et al., 2010).

1.2 Axonal Outgrowth

Santiago Ram´ony Cajal, considered by many to be the forefather of neuroscience, was the ﬁrst to identify the growth cone at the end of axons as a structure capable of amoe- boid movement, and speculated a role in axonal guidance and outgrowth (Cajal, 1890).

The growth cone is the leading tip of the growing axon and is responsible for sensing and responding to external cues. There are three phases of growth cone formation: 1) the initial protrusion is when lamellipodia and filopodia begin to extend, therefore initiating the formation of the growth cone, 2) engorgement is when microtubules and other organelles invade into the growth cone giving rise to its structural foundation, and 3) consolidation is when actin filaments cease to protrude and microtubules become bundled (Bouquet and Nothias, 2007). Also, the integrity of actin filaments is crucial for the function and structure of the growth cone. However, the axon requires proper microtubule assembly in order to elongate (Dent and Gertler, 2003).

Previously, newly synthesized proteins were thought to be produced in the soma of neurons and then traﬃcked to the axon where they were needed. However, it was later established that local translation can occur in the growing axons, even after axotomy Chapter 1. Introduction 5

(Tobias and Koenig, 1975; Koenig and Adams, 1982). These ﬁndings indicated a central role for local translation and de novo synthesized proteins in axonal outgrowth and elongation. Many proteins are synthesized in the axon itself, independent of the soma, including key cytoskeletal proteins required for axonal morphology and integrity such as actin, which makes up actin ﬁlaments, and tubulin, which makes up microtubules (Willis et al., 2005).

Axonal outgrowth depends on elongation of microtubules, which is thought to hap- pen by two mechanisms: 1) polymerization of tubulin subunits at the plus end of the axonal microtubule and 2) transport of pre-assembled tubulin polymers which are then added to the plus end of the microtubule, leading to elongation (Gallo and Letourneau,

1999). In addition, it has been shown that microtubule dynamics are required for growth cone motility and axonal outgrowth, and that inhibition of this dynamic pool of microtubules inhibits the assembly of microtubules, and thus axon elongation (Tanaka et al.,

1995). Furthermore, microtubule associated proteins (MAPs), such as Tau, interact with the microtubules to enhance their stability. Such interactions require post-translational modiﬁcations, such as phosphorylation by glycogen synthase kinase 3 (GSK3) (Bouquet and Nothias, 2007).

In mitotic cells, it was shown that phosphorylation of tubulin by cyclin-dependent kinase 1 (Cdk1) excludes tubulin from microtubules and causes failure of tubulin to in- corporate into growing microtubules (Fourest-Lieuvin et al., 2006). In agreement with these ﬁndings, phosphorylation of tubulin by a calmodulin-dependent protein kinase

(CaMK) at a 4K C-terminal domain can reversibly inhibit the ability of tubulin to as- semble into microtubules, therefore interfering with axonal outgrowth (Hargreaves et al.,

1986). Thus, the phosphorylation state of tubulin subunits is important for enhancing or reducing the stability of the microtubules, which directly aﬀects axonal outgrowth.

The regulation of axonal outgrowth involves many extra- and intra-cellular molecules and many pathways. For instance, neural cell adhesion molecules (NCAM) (Schmid and Chapter 1. Introduction 6

Maness, 2008) and integrins (Lilienbaum et al., 1995) are among some of the molecules that interact with the extracellular matrix that are required for axonal outgrowth. In- tracellular molecules involved in axonal outgrowth and guidance are continuously be- ing identiﬁed. One such molecule is Growth-Associated Protein-43 (GAP-43), which is required for proper neurite outgrowth and neuronal pathﬁnding (Meiri et al., 1998;

Strittmatter et al., 1995).

Another molecule that was found to be necessary for axonal outgrowth is P53. P53 was ﬁrst identiﬁed as a transcription factor and a tumor suppressor (Baker et al., 1989).

In addition, P53 displays pro-apoptotic eﬀects, therefore it was surprising to identify it as a factor necessary for axonal outgrowth (Tedeschi and Giovanni, 2009). Phosphorylation of P53 by ERK1 and 2 is necessary for its outgrowth promoting eﬀect (Giovanni and

Rathore, 2012), indicating the involvement of additional intracellular pathways in this process. Brain Derived Neurotropic Factor (BDNF), Nerve Growth Factor (NGF), ery- thropoeitin, and melanocortic were also found to enhance axonal outgrowth (Calabrese,

2008).

1.3 The Embryonic Chicken Dorsal Root Ganglia as

a Model for Axonal Outgrowth

The chicken embryo is a valuable model for developmental biology. The ease of access and manipulation, combined with a relatively short gestation period of 21 days, allows for the study of many developmental aspects, including cell-cell interactions, cell signaling, cell fate and differentiation, and cell migration (Davey and Tickle, 2007). The different stages of embryonic development have been described by Hamburger and Hamilton, who defined

46 stages from the blastoderm to a newly hatched chick (Hamburger and Hamilton, 1992).

Between HH (Hamburger-Hamilton) stages 12-16, neural crest cells migrate from the neural tube to reach their destination between the 8th somite to the end of the Chapter 1. Introduction 7 tube. Dorsal root ganglia (DRG), along with other types of tissue including autonomic ganglia, develop from migrating neural crest cells after they cease to migrate (de Bellard and Bronner-Fraser, 2005). DRG neurons have been widely used as a model to study neuronal axons and their properties, including axonal outgrowth (Strittmatter et al.,

1995; Fournier et al., 2003; Gallo and Letourneau, 1999), and protein traﬃcking (Willis et al., 2005). At embryonic day 8 (E8), DRG neurons have eccentric bipolar morphology.

By E14, 57% of those neurons will have undergone pseudo-unipolarization to display short- or long-stem unipolar morphology (Matsuda et al., 1996).

1.4 Pumilio - a Founding Member of the Puf Family

Pumilio and FBF (Fem-3 Binding Factor) are the founding members of the Puf family

of RNA binding proteins and translational regulators (Zhang et al., 1997). Although

some studies indicate Puf proteins to be translational repressors (Wharton et al., 1998;

Parisi and Lin, 2000; Walser et al., 2006), other studies have indicated a role for Puf

proteins in the activation of translation (Kaye et al., 2009). Puf proteins are classiﬁed

as trans-acting factors that recognize and bind to cis-elements in the 3’-UTR of mRNA

(Weidmann and Goldstrohm, 2011).

PUM was ﬁrst cloned and characterized in Drosophila, where its gene was shown

to span a region of over 160 kb. PUM (157 kDa) was found to contain regions rich in

single amino acid residues (glycine, alanine, glutamine, or serine/threonine) (Macdonald,

1992). PUM protein is highly conserved across species (Moore et al., 2003), and contains

a highly conserved RNA binding domain, called the Puf domain. The Puf domain is

made up of 8 α-helical repeats, where each repeat is approximately 36 amino acids in

length and makes contact with one nucleotide of a recognition sequence in the 3’ UTR

of the target mRNA (Jenkins et al., 2009). This domain was shown to be essential for

mRNA binding and translational repression (Wharton et al., 1998; Zamore et al., 1997). Chapter 1. Introduction 8

It is also conserved across eukaryotes including Saccharomyces cervisiae, Caenorhabditis elegans, Arabidopsis thaliana, and Homo sapiens (Zamore et al., 1997).

How do Puf proteins bind mRNA? Several groups of researchers have been try- ing to answer this question. PUM recognizes a consensus sequence in the 3’-UTR,

U1G2U3A4N5A6U7A8, where N is either A, U, or C (Gerber et al., 2006). The Puf domain forms a concave surface, and the single stranded RNA runs antiparallel to the

protein inside this pocket (Chen and Varani, 2011). This orientation means that the N

terminus of the Puf domain binds the 3’ end of the recognition sequence, whereas the C

terminus binds the 5’ end of this sequence.

Each repeat in the RNA binding domain recognizes one nucleotide on the mRNA by

means of three amino acids, where the amino acid side chain at position 13 in the repeats

forms stacking interactions with the aromatic ring of the nucleotide, while amino acids

12 and 16 recognize the Watson-Crick edge of the RNA base (Chen and Varani, 2011).

Adenine can therefore be recognized by cysteine and glutamine, uracil by asparagine and

glutamine, and guanine by serine and glutamate (Wang et al., 2002).

Naturally occurring Puf domains have not been observed to bind cytosine. Never-

theless, a “base-omission” recognition mode was described, where a cytosine in position

5 of the recognition sequence stacks directly on the adenine in position 4 and does not

make speciﬁc contact with the protein (Lu and Hall, 2011). Some groups successfully

demonstrated that cytosine recognition can be achieved by an argenine residue at posi-

tion 16, and an amino acid with a small or nucleophilic side chain at position 12 (glycine,

alanine, serine, threonine, or cysteine) (Dong et al., 2011). In fact, the Puf domain of

PUM can be engineered to target any mRNA of interest (Filipovska and Rackham, 2011;

Yoshimura et al., 2012), an aspect with enormous clinical potential.

PUM can recognize and bind to Nanos Response Element (NRE) (Wharton et al.,

1998) or PUM Binding Element (PBE) (Padmanabhan and Richter, 2006) in the 3’ UTR

of target mRNA. The mechanism of translational regulation can diﬀer greatly depending Chapter 1. Introduction 9 on the target mRNA. For example, in the Drosophila embryo, PUM recognizes and binds to NRE in the 3’-UTR of maternal hunchback (hb). This allows PUM to recruit

Nanos (Nos) and Brain Tumor (Brat) to form a repression complex and thus prevent the translation of hb (Sonoda and Wharton, 2001), the results of which are discussed in section 1.5. Additionally, PUM can recruit Nos or Brat individually, where it forms distinct repression complexes that target diﬀerent pools of mRNA (Harris et al., 2011).

Moreover, PUM proteins can bind the target mRNA and cause a conformational change which exposes a microRNA (miRNA) binding site, prompting mRNA degradation by

RNA-induced silencing complex (RISC) (Kedde et al., 2010). PUM can also associate directly with Argonaut (Ago), a RISC protein, and the elongation factor eEF1A to form a complex that attenuates translation elongation of target mRNA (Friend et al., 2012).

Together with Nos, PUM can promote the deadenylation of hb mRNA, thus sup- pressing its translation (Wreden et al., 1997). PUM can induce deadenylation of mRNA by recruiting CCR2-POP2-NOT deadenylation complex (Radford et al., 2008). Puf proteins can also enhance the translation of cGMP-dependent protein kinase EGL-4 (Kaye et al., 2009). These seemingly conflicting results can be explained, at least in part, by the number and relative positions of CPE and PBE, where different combinations of these two elements determine whether the outcome of CPEB/PUM regulation is activation or repression of translation (Piquéet al., 2008). PUM proteins need to be phosphorylated to be active, and the enzyme responsible for this phosphorylation is possibly Nemo-like

Kinase 1 (Ota et al., 2011).

1.5 Pumilio is Involved in Embryonic and Germline

Development and Cell Cycle Regulation

Early studies on PUM were performed on Drosophila embryos, where two morphogens,

Bicoid (bcd) and Hunchback (hb), were expressed in opposing gradients along the antero- Chapter 1. Introduction 10 posterior axis of the embryo (Micklem, 1995). It is was found that PUM could bind a

NRE in the 3’-UTR of hb mRNA and recruit Nos and Brat, enabling translational suppression, and therefore establishing the protein gradient that is essential for the proper posterior patterning and abdominal segmentation of the embryo (Murata and Whar- ton, 1995; Sonoda and Wharton, 2001). PUM was also shown to bind and induce the deadenylation of bcd mRNA, which causes translational suppression and ensures normal anterior patterning of the embryo (Gamberi et al., 2002).

PUM has also been implicated in germline development. PUM and Nos are required to promote the expression of zygotic vasa, one of the earliest genes expressed in pole cells in the Drosophila embryo, but not in the adult, suggesting a role for PUM and Nos in establishing the germ line, and not maintaining it (Sano et al., 2001). Conversely, it was also shown that PUM is required for germline stem cell maintenance. First,

PUM was shown to be required for the asymmetric cell division that is required for germline stem cell maintenance in Drosophila (Lin and Spradling, 1997). In addition, mutations in PUM caused defects in cell migration into the gonads, premature expression of germline markers, and premature mitosis (Asaoka-Taguchi et al., 1999). Furthermore, a study by Richter and Therukauf found that PUM, and Nos, were required to repress the translation of cyclin B mRNA, therefore ensuring cells remain in the G2 phase (Richter and Theurkauf, 2001).This may seem paradoxical at first, considering the role of PUM in germline development, but further insight into the molecular pathway clarified this process. Germline stem cells respond to Decapentaplegic (Dpp) signaling, which results in the suppression of Bag of Marbles (Bam) expression, thus allowing the translation of Nos. As a result, PUM and Nos form a repressor complex which targets a pool of pro-differentiation mRNAs, allowing the translation of self-renewal mRNA and the maintenance of stem cells. Upon loss of Dpp signaling, Bam is expressed, which leads to suppression of Nos. In this case, PUM forms a complex with Brat, and instead targets the self-renewal pool of mRNAs, allowing for the expression of pro-differentiation mRNAs Chapter 1. Introduction 11

(Chen and McKearin, 2003; Harris et al., 2011). A PUM/Nos complex was also detected in human germ cells, where human homologues of PUM and Nos (PUM 2 and Nanos 1, respectively) form a complex, suggesting a conserved role in germ cell development and maintenance (Jaruzelska et al., 2003).

Further evidence for the importance of PUM in germline development/maintenance was provided when Moore and colleagues demonstrated the ability of the human homo- logue of Drosophila PUM, PUM2, to interact with Deleted in AZoospermia (DAZ) and

DAZ-Like (DAZL) proteins, suggesting a highly conserved pathway in the reproductive system of organisms from Drosophila to humans (Moore et al., 2003).

1.6 Pumilio 1 and Pumilio 2: Vertebrate Homologues

of the Drosophila Pumilio

The Drosophila PUM has two homologues in vertebrates: PUM1 and PUM2. In humans,

Pum1 and Pum2 genes encode proteins that are 127 and 114 kDa, respectively, with 83% overall similarity and 91% Puf domain identity (Spassov and Jurecic, 2002). Studies have shown the expression of PUM2 in embryonic stem cells and germ cells in humans, where an interaction with DAZ and DAZL was described, as mentioned in section 1.5 (Moore et al., 2003).

PUM1 and PUM2 are also present in other vertebrates. In rainbow trout, zebrafish, and Japanese killifish, PUM1 and PUM2 are widely expressed with specific expression in the gonads and the brain (Kurisaki et al., 2007; Wang et al., 2011; Zhao et al., 2012).

It is worth noting that in rainbow trout, the PUM2 gene gives rise to 2 splice variants: a full length protein called PUM2A, and a truncated protein missing the Puf domain, called PUM2B (Kurisaki et al., 2007).

PUM1 and PUM2 are also expressed in chicken, where it was found that the highest expression of PUM1 was detected in hatched female gonads, whereas the highest expres- Chapter 1. Introduction 12 sion of PUM2 was detected in 12 day embryonic and hatched gonads, in addition to the heart, muscle tissue, and liver (Lee et al., 2008). PUM1 and PUM2 were also found in many cell types in the adult mouse and the mouse embryo, including hematopoietic stem cells (Spassov and Jurecic, 2003). Mouse PUM1 was observed in intestinal epithelial cells

(Islam et al., 2005), which indicates a potential role in the polarization of these cells in light of the documented role of Pumilio proteins in establishing gradients of the bcd and hb morphogen transcripts and controlling embryonic polarization (Micklem, 1995).

Many interactions have been described for both PUM1 and PUM2. For instance,

Xenopus PUM2 was shown to bind the 3’-UTR PBE of Ringo/Spy, an activator of cyclin- dependent kinases (cdks), and suppress its translation (Padmanabhan and Richter, 2006).

PUM1 also represses the translation of activators of the tumor suppressor P53, maintaining spermatogenesis (Chen et al., 2012). Conversely, PUM1 and PUM2 repress the translation of E2F3 oncogene, which has strong proliferative potential and is dysregulated in diﬀerent types of cancer (Miles et al., 2012).

PUM1 has the potential to bind the mRNA of p27, a tumor suppressor, and cause a conformational change which allows miRNA221/miRNA222 to bind its 3’-UTR and the subsequent recruitment of RISC (Kedde et al., 2010; Triboulet and Gregory, 2010).

A cooperative interaction between PUM1 and miRNA410 has also been documented, where the binding of PUM1 exposes the target sequence for miRRNA410, allowing for the suppression of the target mRNA (Leibovich et al., 2010). Additionally, PUM2 interacts with RNA DEAD-box helicase GEMIN3, a microRNA biogenesis factor, possibly to regulate mRNA translation (Ginter-Matuszewska et al., 2011).

In humans, PUM2 can promote proliferation in human adipose-derived stem cells

(Shigunov et al., 2011). Also, PUM2 interacts with mRNA encoding Cdc42 eﬀector 3

(CEP3), an eﬀector protein for the Rho GTPase Cdc42, in the human male gonads (Spik et al., 2006). The interaction of PUM2 with DAZ and DAZL in humans is important for germline development and was described in section 1.5. Chapter 1. Introduction 13

1.7 Pumilio 2 and the Eukaryotic Initiation Factor

4E (eIF4E)

As indicated in section 1.1.1, eIF4E is an important factor in the initiation of mRNA

translation. eIF4E binds to the 5’ m7G cap of the mRNA, and also binds eIF4G to

form eIF4F. eIF4F then interacts with PABP to form a circular complex allowing for the

assembly of the ribosome and the translation of the mRNA (Sonenberg and Hinnebusch,

2009).

eIF4E is made up of 8 antiparallel β strands which form a curved β sheet, giving rise to a concave surface that allows for the 5’ m7G cap interaction (Sonenberg and

Dever, 2003). Phosphorylation of eIF4E at a serine 209 by MNK1 and MNK2 appears to decrease the binding aﬃnity to 5’ m7G cap, thus allowing the initiation complex to scan for the start codon (Scheper et al., 2002).

Among the many mRNA targets of PUM2 is the eukaryotic initiation factor 4 E

(eIF4E). PUM2 has been shown to speciﬁcally bind to the 3’-UTR of the eIF4E mRNA in the Drosophila neuromuscular junction (Menon et al., 2004) and in the rat brain

(Vessey et al., 2010). These studies both show that PUM2 suppresses the translation of eIF4E, and that mutations in PUM2 lead to increased expression of eIF4E, therefore identifying PUM/PUM2 as a regulator of eIF4E.

This conserved interaction from invertebrates to mammals indicates an important developmental and functional role. Additionally, PUM2 has also been shown to compete with eIF4E for binding to the 5’ m7G cap of the RINGO/SPY mRNA, and that this binding required a single tryptophan residue (Cao et al., 2010). This dual regulation highlights an important pathway through which PUM2 can exert its actions, namely the control of eIF4E expression levels and activity. Chapter 1. Introduction 14

1.8 Pumilio in the Nervous System

PUM has been detected in the central and the peripheral nervous systems, and some

of its functions have been elucidated. PUM was found to be necessary for dendritic

morphogenesis in dendritic arborization (da) neurons in Drosophila, where overexpression

of PUM led to reduction of the high order dendritic branches of those neurons, but not

bipolar or chordotonal neurons (Ye et al., 2004).

The expression of PUM in Drosophila CNS was found to be activity dependent, where

neuronal excitation led to increased levels of PUM, and vice versa. In addition, PUM

was able to suppress the translation of paralytic (para), a voltage-gated Na+ channel in

Drosophila motorneurons, thus regulating neuronal excitability in an activity-dependent

manner (Mee et al., 2004). This regulation was achieved by forming a repressor complex

with Nos and Brat, which binds the 3’ UTR of the para mRNA (Muraro et al., 2008).

The mammalian Scn1a voltage-gated Na+ channel was also identiﬁed as a target for

PUM2 regulation (Vessey et al., 2010).

A role for PUM2 in dendritic formation and morphology has been described in mammals. In response to neuronal activity, the transcription factor myocyte enhancer factor-2

(MEF2) is activated, which leads to the expression of the miR379–410 cluster. A component of this cluster, miR-134, targets Pum2 mRNA and downregulates its translation,

alleviating the translational suppression PUM2 exerts on other targets. This allows for

the expression of positive regulators of dendritic outgrowth in primary rat neurons (Fiore

et al., 2009).

PUM2 is present in the dendrites and soma of rat hippocampal neurons. In addi-

tion, PUM2 is a component necessary for the formation of stress granules formed in

hippocampal neurons in response to metabolic stress (Vessey et al., 2006). Furthermore,

PUM2 is a negative regulator of dendritic morphogenesis in E17 rat hippocampal neu-

rons, where overexpression of PUM2 leads to formation of a less complex dendritic tree,

whereas PUM2 downregulation led to a more complex dendritic tree. In addition, PUM2 Chapter 1. Introduction 15 downregulation in hippocampal neurons caused an increase in the number of mEPSPs, increased neuronal excitability, and an increase in long thin dendritic spines (Vessey et al.,

2010). Regulation of neuronal excitability by PUM was also described in Drosophila, indicating an evolutionarily conserved role for the translational regulator in regulating neuronal function (Schweers et al., 2002).

In the Drosophila, PUM was found to bind and regulate the translation of synapse speciﬁc mRNAs, including discs large (dlg1), the Drosophila PSD95 ortholog, in the adult mushroom bodies - large dendritic spines that are the proposed ‘storage sites’ for memory (Chen et al., 2008). In fact, PUM has been indicated in long-term memory formation and olfactory conditioning in Drosophila, along with other proteins such as

Stau, moesin, and eIF-2G (Dubnau et al., 2003).

In addition, PUM2 was found to be localized to the dendrites of rat CA1 hippocampal neurons in a punctate fashion, which was consistent with the role of PUM in maintaining synaptic function and morphology (Zhong et al., 2006). In other studies, PUM2-deﬁcient mice were found to have abnormal behavioral strategies in spatial memory and object recognition tasks. PUM2-deﬁcient mice were also hyperactive and had lower seizure thresholds (Siemen et al., 2011). Together, these studies may suggest a crucial role for

PUM/PUM2 in learning and long-term memory.

1.9 Study Rationale

Local translation is critical for proper axonal outgrowth and axonal guidance, as it pro- vides growth cones and growing axons functional autonomy from the cell soma, and thus enables rapid responses to external cues. Studies have focused on the roles of PUM and its homologues in many aspects of embryonic development. These include, but are not restricted to, reproductive system development, stem cell maintenance, and determining the targets and co-factors of PUM. To date, no studies have looked at the role of PUM Chapter 1. Introduction 16 in axonal outgrowth. Previous studies from our laboratory using in situ hybridization

(performed in the lab by Jason P Charish, MSc of the University of Toronto) revealed the expression of pum2 transcript in the retina of E9 chicken embryos (Figure 1.1), and other parts of the nervous system. These results were consistent with the expression pattern described in previous studies (Lee et al., 2008; Vessey et al., 2006). In this study,

I wanted to investigate the role of PUM2 in axonal outgrowth in DRG neurons isolated from of 8-day old chicken embryos.

Figure 1.1: In Situ Hybridization showing the expression of Pum2 transcript in the retina of E9 chicken embryos. Pum2 mRNA is expressed in all layers of the

E9 retina, including the retinal ganglion cell layer, in addition to other parts of the brain.

Additional in situ hybridization performed on E7 retinae revealed the expression of

Pum2 mRNA in all layers (Figure 1.2, top left panels). Furthermore, E7 retinal explants labeled for tubulin or actin, and PUM2, showed expression of endogenous PUM2 in the axons and growth cones of retinal ganglion cells (Figure 1.2). As found in previous studies (Vessey et al., 2010), PUM2 displayed a punctate pattern of expression.

1.10 Hypothesis and Aims

Previous studies have indicated a role for PUM2 in dendritic morphogenesis and development. Additionally, work done previously in our laboratory indicated the presence of Chapter 1. Introduction 17

Figure 1.2: PUM2 Is Expressed in Axons of Retinal Ganglion Cells. PUM2 protein is expressed in the optic ﬁber layer of the retina (top right panel). In addition,

PUM2 protein expression can be visualized in the axons and in growth cones of retinal explants prepared from E7 chicken embryos. oﬂ: optic ﬁber layer, rgcl: retinal ganglion cell layer. Arrows indicate PUM2 punctae. Chapter 1. Introduction 18

PUM2 in axons. Therefore, I hypothesized that the translational regulator PUM2 played a major role in axonal outgrowth.

1. Aim 1: The role of Pum2 on axonal outgrowth in vitro.

(a) Examine endogenous expression of Pum2.

(b) Pum2 overexpression (Pum2-EYFP in pEYFP-N1).

tions 2.1.1 and 2.1.2).

(d) Pum2 silencing (Pum2miRNA1 and Pum2miRNA7 in pRFPRNAic).

2. Aim 2: Test rescue construct (eIF4E-T2A-Pum2EYFP, see section 2.1.5). Chapter 2

Materials and Methods

2.1 Cloning

To examine the role of PUM2 in axonal outgrowth, several constructs need to be engi-

neered and cloned. Mouse PUM2 overexpression constructs, PUM2-EYFP in pEYFP-N1

(PUM2-EYFP) and PUM2-RFP in pT2K (PUM2-pT2K) as well as PUM2 in pGEM R -

T Easy vector (Promega) were available and were used as starting material for further cloning. Cloning of two mutant constructs, dominant negative PUM2 (see 2.1.1) and

PUM2W349G (see 2.1.2), along with three silencing constructs (see 2.1.3) and a chicken

PUM2 construct (see 2.1.4) was required. In the cloning of all constructs, the vectors were pretreated with Calf Intestinal Phosphatase (CIP, New England Biolabs) to reduce self ligation prior to the ligation. Rapid ligation kit (Fermentas) was used for all ligation steps.

2.1.1 Cloning of dominant negative PUM2 (dnPUM2)

A dominant negative isoform of PUM2 was obtained by mutating a glycine residue at position 947 of PUM2 into an aspartic acid residue (G947D). dnPum2 (PUM2G947D) can still bind NRE, but is unable to recruit Brat, and therefore the repressor complex cannot

19 Chapter 2. Materials and Methods 20

be formed, causing the failure of translational regulation (Sonoda and Wharton, 2001).

dnPum2 can compete with the endogenous PUM2 because of its non-productive binding

to the NRE (Wharton et al., 1998). This was done through site directed mutagenesis

using Pfu DNA polymerase (Fermentas) using the primer sequences are below:

Forward primer:

5’ caaattgtttccgaaatcagagacaaggtcttagccctgagtcaacac 3’

Reverse primer:

5’ gtgttgactcagggctaagaccttgtctctgatttcggaaacaattttg 3’

I designed the primers to contain the required single amino acid mutation (bold letters in primer sequences) and a unique restriction site, PﬂF I (New England Biolabs)

which was used in the restriction analysis and screening of this clone. dnPUM2-EYFP

in pEYFP-N1 was obtained by using PUM2-EYFP as a template for the PCR.

To obtain dnPUM2-RFP in pT2K, PUM2 cloned into pGEM R -T Easy vector (Promega)

was used as a template for a site directed mutagenesis PCR using the aforementioned

primers. The resulting dnPUM2 was digested out using the restriction enzymes PmeI

and Xho I (New England Biolabs) and ligated into pT2K digested with the same enzymes

using T4 DNA ligase (Fermentas).

2.1.2 Cloning of PUM2W349G-EYFP in pEYFP-N1

PUM2W349G was obtained by mutating a tryptophan residue at position 349 of PUM2

into a glycine residue (W349G). The mutation interferes with the ability of PUM2 to

bind the m7G cap of the mRNA, therefore eliminating competition with eIF4E for cap

binding. The mutation was introduced through site-directed mutagenesis using Pfu DNA

polymerase (Fermentas). The primers used have the following sequence:

Forward primer:

5’ ccacctcagtattacggtgttccgggggagtgtatccagcc 3’

Reverse primer: Chapter 2. Materials and Methods 21

5’ ggctggatacactcccccgggaacaccgtaatactgaggtgg 3’

The letters in bold indicate the mutated nucleotides. This mutation also introduces a unique restriction site, SmaI (New England Biolabs), which was used in screening this clone. The end result is a PUM2 mutant, PUM2W349G-EYFP in a pEYFP-N1 expression vector (PUM2W349G).

2.1.3 Cloning of PUM2 microRNA (PUM2miRNA)

Four PUM2 microRNA constructs (PUM2miRNA 1, 2, 3, 4) were cloned by Diane M.

Cockburn, MSc of the University of Toronto. I cloned three additional PUM2-miRNA

(PUM2miRNA 5, 6, 7) hairpin sequences using a Pfu polymerase-based PCR. The primer sequences are below:

PUM2miRNA5 Forward:

5’ gagaggtgctgctgagcgcaggagatgatgaggatgttactagtgaagccacagatgta 3’

PUM2miRNA5 Reverse:

5’ attcaccaccactaggcaaaggtgatgatgaggatgttactacatctgtggcttcact 3’

PUM2miRNA6 Forward:

5’ gagaggtgctgctgagcgcagtacatctcttggctttggatagtgaagccacagatgta 3’

PUM2miRNA6 Reverse:

5’ attcaccaccactaggcaaagtacatctcttggctttggatacatctgtggcttcact 3’

PUM2miRNA7 Forward:

5’ gagaggtgctgctgagcgcagatcagcatggttctagatttagtgaagccacagatgta 3’

PUM2miRNA7 Reverse:

5’ attcaccaccactaggcaaagatcagcatggttctagatttacatctgtggcttcact 3’

The common sequences in the primers comprise part of the miRNA ﬂanking sequences and common loop and terminal stem sequences which are derived from the human miRNA30. Also, the 5’ base of the sense strand was changed in order to mismatch the antisense sequence, therefore replicating a natural mismatch in miRNA30 at Chapter 2. Materials and Methods 22

this position. The primers introduced the restriction sites NheI and MluI (New England

Biolabs), which were used to clone microRNA into the pRFPRNAic vector (Das et al.,

2006). The microRNA sequences were designed to target chicken PUM2 as they will be

used in the chicken system to target the endogenous protein. Once the sequences were

ligated into the pRFPRNAic vector, the microRNA cassette was digested out of this

vector using NotI and ClaI (New England Biolabs) and ligated into the RCAS-A viral

vector (Das et al., 2006) in order to infect the optic vesicle at E2.

2.1.4 Cloning of chicken PUM2 in pcDNA3.1 (-)/myc-His A

To clone chicken PUM2 (cPUM2), reverse transcription PCR was performed on total

RNA puriﬁed from E11 chick brain lysate. Total RNA is isolated using RNeasy Mini

Kit (Qiagen), where the brain was lysed and homogenized, and total RNA was extracted

using the binding columns provided in the aforementioned kit. Reverse transcription PCR

allowed for the addition of PmeI and XhoI sites at the 5’ and 3’ ends of the sequence,

respectively. Subsequently, cPum2 was cloned into pRFPRNAic vector using the same

restriction enzyme sites.

PCR was performed on the cPum2 template (cPum2 in pRFPRNAic) to introduce

XhoI and HindIII to the 5’ and 3’ ends, respectively, replacing the PmeI and XhoI restriction sites. cPUM2 was subsequently cloned into pGEM R -T Easy vector (Promega).

Introduction of an A overhang was necessary for this step and was achieved by incubating cPUM2 PCR product with Taq DNA polymerase (New England Biolabs) and dATP for

30 minutes at 70◦C. Finally, cPum2-pGEM was digested to excise cPum2 using XhoI

and HindIII (New England Biolabs) and ligated in to pcDNA3.1TM (-)/myc-His A (In-

vitrogen) using the same restriction enzymes, cPUM2 was digested out of pGEM R -T

Easy vector (Promega) and ligated into pcDNA3.1TM (-)/myc-His A (Invitrogen) with

the same enzymes. Chapter 2. Materials and Methods 23

2.1.5 Cloning of eIF4E-T2A-PUM2EYFP

A pGBKT7 vector that expresses Homo sapien eIF4E was obtained from Dr. Joel

Richter’s laboratory at the University of Massachusetts Medical School (Worcester, MA,

USA). Through PCR, a PmeI restriction site was inserted at the 5’ end, and a T2A

sequence was inserted at the 3’ end of the coding sequence of eIF4E. The T2A sequence

allows for the 1:1 expression of both proteins through a 2A-based ribosomal skip mech-

anism (Szymczak et al., 2004). The primers used in this reaction have the following

sequences:

primer 1: eIF4E-PmeI-Fwd

5’ gggggtttaaacatggcgactgtcgaaccgg 3’

primer 2: eIF4E-T2A-Rev

5’ ctcgacgtcaccgcatgttagcagacttcctctgccctcaacaacaaacctatttttagtggtgg 3’

A PCR was performed in parallel on PUM2EYFP where T2A was introduced to the

5’ end and PacI was introduced to the 3’ end of the coding sequence. The primers used

in this reaction have the sequences below:

primer 3: T2A-PUM2-Fwd

5’ ctgctaacatgcggtgacgtcgaggagaatcctggcccaatgaatcatgattttcaagctcttg 3’

primer 4: EYFP-PacI-Rev

5’ ggggttaattaattacttgtacagctcgtccatgcc 3’

Each PCR product was incubated with dATP and Taq polymerase for 30 minutes at

70◦C, to add an A overhang, enabling them to be cloned into pGEM R -T Easy vector

(Promega) as an intermediate step. The underlined letters in primers 2 and 3 indicate the unique restriction site AatII (New England Biolabs) found in the T2A sequence that was added to eIF4E and PUM2EYFP. AatII was used for subsequent cloning steps.

Next, pGEM R -T Easy vector (Promega) containing eIF4E-T2A was digested using PmeI

and AatII restriction enzymes (New England Biolabs), and pGEM R -T Easy vector

(Promega) containing T2A-Pum2 was digested using AatII and PacI restriction enzymes Chapter 2. Materials and Methods 24

(New England Biolabs), for a three-way ligation with the pT2K expression vector. The

ﬁnal construct was full-length eIF4E-T2A-PUM2EYFP in pT2K. The expression of this product was driven by a β-actin promoter, while ampicillin resistance gene was expressed under control of a chicken U6 promoter. Figure 2.1 shows a schematic representation of the construct.

Figure 2.1: Schematic representation of the eIF4E-T2A-PUM2EYFP in pT2K construct. The blue region represents the CMV enhancer and β-actin promoter region of the vector.

2.2 Cell Culture

Immortalized chicken ﬁbroblast (DF-1) and Human Embryonic Kidney (HEK293T) cell lines were cultured and maintained in Dulbecco’s Modiﬁed Eagle Medium (Sigma-Aldrich) containing 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin antibiotic so-

◦ lution (Gibco) at 37 C and 5% CO2. A tray of water was kept in the incubator to maintain a humid environment. For cell passaging, a 5 minute trypsinization step (0.25% Chapter 2. Materials and Methods 25

Trypsin-EDTA, Gibco) was required for DF-1 cells, however, this step is not required for

HEK293T cells as these cells readily dissociate from the plate.

2.2.1 Transfection of Cell Lines

Transfection of DF-1 cells was performed using LipofectamineTM 2000 (Invitrogen).

DF-1 cells passaged in preparation for transfection were cultured in DMEM with 10%

Fetal Bovine Serum (FBS), and no antibiotics. To transfect a 10cm culture dish with the plasmid of interest, 16µg of DNA and 40µl of LipofectamineTM2000 were diluted separately in 1.5 ml of dilution medium (Opti-MEM, Gibco). The separate aliquots were incubated for 10 minutes at room temperature and then combined and and allowed to incubate for 20 minutes. The solution was added to the DF-1 cells in a drop-wise fashion and placed back in the incubator at 37◦C. It is worth noting that 80-85% conﬂuency of cells is necessary for optimal transfection eﬃciency.

Conversely, HEK293T cells did not require incubation in antibiotic-free media, and were transfected using Polyethylenimine (PEI). 9µg of DNA and 24µl of PEI were diluted separately in 500µl of 0.1 M phosphate buﬀered saline (PBS, pH 7.4) and incubated for 5 minutes at room temperature. The solutions were combined and incubated for a further

10 minutes at room temperature. The solution was then added to the HEK293T cells and incubated at 37◦C.

2.3 Chicken Embryos

Fertilized chicken eggs were purchased from Frey’s Hatchery (St. Jacob’s, Ontario) and stored at 4◦C for no longer than 2 weeks. Eggs were incubated at 38◦C, and humidity was maintained at 60% until the desired developmental stage was reached. Chapter 2. Materials and Methods 26

2.4 Dorsal Root Ganglia (DRG) Neurons

2.4.1 Dissection

At embryonic day 8 (E8) or HH stage 34 (Hamburger and Hamilton, 1992), DRG neurons

were cultured as follows. Embryos were removed from the egg and decapitated. The

anterior abdominal wall was cut open using ﬁne scissors, and the viscera were pushed

back to expose the vertebral column. The caudal end of the vertebral column was cut

perpendicularly using micro-scissors, followed by two cuts, one on each side, parallel to

the long axis of the column. The ventral part of the column (comprising the bodies of

vertebrae) was removed, exposing the spinal cord and DRG. DRG were then harvested

by cutting the aﬀerent and eﬀerent nerves and stored in Hank’s Balanced Salt Solution

(HBSS with phenol red, Gibco). This process was repeated until 100-120 DRG were

collected. Excess tissue was removed from harvested DRG using ﬁne-tip forceps.

DRG were then transfered to a trypsin solution (0.25% Trypisin-EDTA, Gibco) and

incubated at 37◦C for 15 minutes, and centrifuged at 1500rpm for 5 minutes at room

temperature. The supernatant was discarded and the pellet was resuspended in HBSS.

A 10µl sample was collected for counting, and the remaining suspension was centrifuged

at 1500rpm for 5 minutes. The supernatant was removed and cells were resuspended in

transfection solution (see section 2.4.2).

2.4.2 Nucleofection

The Amaxa R Chicken Neuron Nucleofector R kit (Cat. No. VPG-1002, Lonza) was used to transfect the DRG neurons. The cell pellet comprising the dissociated DRG was resuspended in Nucleofector R solution and divided into 100µl aliquots. As per the manual, 6-10µg of the plasmid of interest was then added to the 100µl aliquot, and the

mixture was transfered to the specialized cuvettes provided with the kit. The program

used to transfect the neurons was “G-013”. The cells were then plated on to poly-L- Chapter 2. Materials and Methods 27

lysine/laminin coated 18mm coverslips and incubated at 37◦C for 18 hours. pMaxGFP

(Lonza), provided with the Nucleofector R kit, was used as a GFP control vector for

overexpression of PUM2-EYFP, dnPUM2-EYFP, and PUM2W349G-EYFP.

2.5 Retinal Flat Mounts

The eyes of E5 embryos were excised using ﬁne tip splinter forceps (Long-Points, 4-3/8”,

Almedic). Using ﬁne tip forceps, the retinal pigmented epithelium was removed, followed

by the lens and vitreous humor, such that the remaining structure was a pure and intact

retina. The retina was then placed onto a cell culture insert (Millicell R , 0.4µm, 30mm diameter. Millipore, Ireland). Four incisions were made to ﬂatten the retina, and the inner surface of the retina (i.e. the retinal ganglion cell layer) was exposed.

The insert containing the retina, was placed on an electrode that was connected to the cathode, and a cube of 5% agarose was used to achieve direct contact between the electrode and the membrane immediately below the retina. The anode was then positioned in close proximity, but not in direct contact with, the retina. A single drop of plasmid DNA of interest was placed between the anode and the retina. The retina was then electroporated (60V, 50ms, 3 pulses). The insert containing the retina was placed into a 6-well plate containing chick retinal media comprising of Dulbecco’s Modiﬁed

Eagle Medium: Nutrient Mixture F-12 (DMEM/F12, Gibco), 10% FBS (Gibco), 10% chick serum, and 1% penecillin/streptomycin (Gibco). 18 hours later, the retinal tissue was ﬁxed in 4% paraformaldehyde (PFA), and mounted onto a slide for microscopic analysis.

2.6 Virus Preparation

PUM2miRNA1- and PUM2miRNA7-RCAS-A vectors, along with a control RCAS-A vector, were transfected into DF-1 cells as described above (see section 2.2.1). After 48 Chapter 2. Materials and Methods 28 hours, the cells were split and allowed to proliferate undisturbed for 7 days. Next, the culture medium was replaced with DMEM containing 1% FBS, and harvested 24 hours later. The medium was centrifuged at 1000 rpm for 5 minutes and pushed through a

0.45µm syringe ﬁlter (Pall Life Sciences) to ﬁlter out cell debris, and stored at -80◦C.

Media was harvested for 2 consecutive days, where fresh media replaced the collected media containing the virus particles to allow continued production of the virus. After the harvesting was complete, the media was spun down at 25,000 rpm for 2 hours at

4◦C using a Beckman L-80 ultracentrifuge. The supernatant was discarded and the virus particles were resuspended in DMEM containing 1% FBS and stored at -80◦C.

2.7 Fiber Tracing

PUM2 silencing viruses, or control viruses, were injected into the right optic vesicle of

E1.5 chicken embryos using glass micropipettes connected to a Hamilton syringe. To allow visualization of the injected solution and ensure accurate targeting of the injection,

0.2µl Fast Green Dye was added to the viral aliquote. The eggs were taped closed, and placed in the incubator to resume development. At E15, a DiI crystal was implanted into the right eye of the embryo, and placed back in the incubator. At E17, the embryos were sacriﬁced and the optic tecta were harvested and ﬁxed in 4% PFA at 4◦C overnight.

2.8 In Ovo Electroporation

Fertilized eggs were incubated horizontally for 1.5 days at 37◦C. Next, 2ml of yolk were removed from the egg using a 5ml syringe and a 18G needle and scotch tape was placed on the shell to prevent it from cracking. Using a pair of ﬁne-tip scissors, a circular window was cut in the shell to allow access to the embryo. Using ﬁne tip splinter forceps

(Long-Points, 4-3/8”, Almedic), the vitelline membrane was partially removed to allow injection into the embryo. Chapter 2. Materials and Methods 29

Afterwards, the positive electrode was placed next to the right optic vesicle as shown in ﬁgure 2.2. Once the electrode was stabilized in position, the embryo was the injected with 2µg/µl of either PUM2miRNA1-pRFPRNAic, PUM2miRNA7-pRFPRNAic, or Lu- ciferase miRNA-pRFPRNAic. The injection was targeted to the right optic vesicle of the embryo, and Fast Green Dye was added to the DNA to enable visualization. The negative electrode was then placed within the neural pore, thus ﬂanking the optic vesicle injected with DNA of interest. Three pulses (each 6V and 25ms), were applied through a

Napagene square wave electroporator (Genetronics, San Diego, CA). The eggs were taped closed and placed back in the incubator and allowed to develop to E4, at which point the embryos were sacrificed and fixed in 4% PFA for 3 hours at room temperature. Embryos were then examined under a Olympus BX61 confocal microscope at 4X magnification to detect fluorescence (Cockburn et al., 2012).

Figure 2.2: In Ovo Electroporation of E1.5 Embryos. DNA with Fast Green Dye

was injected into the optic vesicle (OV) and three pulses (each 6V and 25ms) were applied

to allow vector entry into the cells. Image adopted from

http://www.riken.jp/lab-www/nakagawa/in%20ovo%20electroporation.html Chapter 2. Materials and Methods 30

2.9 Immuno-cytochemistry

DRG cultures were ﬁxed with 4% PFA for 10 minutes at 4◦C and then washed with a 0.1M PBS containing 0.1% Triton X-100 (PBS-Triton) 3 times for 5 minutes each.

The cells were then incubated in a blocking solution (0.1M PBS, 0.1% Triton X-100, 5%

FBS) for 1 hour at room temperature. To stain for endogenous PUM2, PUM2 antibody

(Rabit anti-Human, Cat. No. A300-202A, Bethyl Laboratories, INC) was used at 1:1000 dilution. To stain for tubulin, cells were incubated for 1.5 hours at room temperature with mouse monoclonal tubulin antibody (1:1000, Neuronal Class III β-Tubulin, Cat.

No. MMS-435P, Covance) in blocking solution. Following washes in PBS-Triton (3 x 5 minutes), cells were incubated with goat anti-mouse Alexa Fluor R 555-labeled secondary antibody (1:2000, Invitrogen) in blocking solution. Finally, and after washing with PBS-

Triton (3 x 5 minutes), the cover slips were mounted on microscope slides and Mowiol was used as the mounting medium. The cells were then examined under a microscope

(see 2.11).

2.10 Western Blots

Western blots were used to verify the constructs used in this study. Samples were prepared from cells, as required, by harvesting the cells in ice chilled 0.1M PBS and cen- trifuging at 4◦C at 1000 rpm for 5 minutes. PBS was aspirated and the cells were lysed in ice chilled radioimmunoprecipitation assay (RIPA) buﬀer containing 1% protease in- hibitor cocktail. The cells were passed through a 30G needle 5-10 times to ensure eﬃcient lysis. The lysate was centrifuged at 4◦C, 4000 rpm for 10 minutes, and the supernatant was stored at -20◦C.

8% SDS protein gels were prepared and the samples were loaded into the wells. Next, the electroporesis apparatus (PowerPacTM Basic Power Supply, Bio-Rad) applies a 240V potential diﬀerence for 25 minutes. After that, the protein samples were transferred Chapter 2. Materials and Methods 31 onto a nitrocellulose membrane (Biotrace NT Nitrocellulose Transfer Membranes, Pall) using 100V voltage for 1.5 hours. The membranes were then blocked using 5% milk solution prepared in 0.1M PBS for a minimum of 1 hour at room temperature. Then, primary antibodies were diluted in 5% milk solution prepared in 0.1M PBS with 0.1%

Tween-20 (PBS-Tween-20) overnight at 4◦C. When a PUM2 antibody was used (Rabit anti-Human, Cat. No. A300-202A, Bethyl Laboratories, INC) it was prepared at a

1:10,000 dilution. When a His-tag antibody was used (Mouse anti-His tag, Cat. No.

G020, Applied Biological Material, INC) it was prepared at a 1:1000 dilution. After washing with 0.1% PBS-Tween-20 (3 x 5 minutes), the blots were incubated in secondary antibody (IRDye 800CW Goat anti-Rabbit IgG, Cat. No. 926-32211 or IRDye 680 Goat anti-Mouse IgG, Cat. No. 926-32220, LI-COR) for 1 hour at room temperature. The dilution of the secondary antibody solution was 1:4000 prepared in 0.1% PBS-Tween-20.

The blots were then scanned using an Odyssey Infrared Imaging System (LI-COR).

To verify PUM2-EYFP, PUM2-RFP, dnPUM2-EYFP, dnPUM2-RFP, PUM2W349G, and eIF4E-T2A-PUM2EYFP constructs, HEK293T cells were transfected and lysed 24 hours later. The remainder of the procedure is described above. The eﬃciency of the silencing constructs was assessed by co-transcfecting pRFPRNAic vectors expressing

PUM2 miRNA with cPUM2 in to HEK293T cells. Three days later, the cells were harvested and lysed and a Western blot was performed as described above. To ensure that similar amounts of protein were loaded in each sample, a Coomassie stain was performed on the SDS gel.

2.11 Microscopy

All images of DRG neurons, except for those of the live imaging experiment, were obtained using a BX61 confocal microscope (Olympus) with a 20X objective. CellSens R software was used for acquisition and quantiﬁcation the neurite length. The neurons selected Chapter 2. Materials and Methods 32 for analysis had to be positive for β-III tubulin and enhanced yellow ﬂuorescence protein

(EYFP) in the overexpression experiments, and β-III tubulin and RFP in the PUM2 silencing experiment. EYFP in the transfected constructs was used to visualize the expressed proteins.

2.12 Live Imaging

Compartmentalized 35mm culture dishes with glass bottom (CellViewTM, Cat. No.

627 871, Greiner Bio-One) were coated with poly-L-lysine and laminin prior to plat- ing the cells. DRG neurons were then prepared and transfected with PUM2miRNA1- pRFPRNAic, PUM2miRNA7-pRFPRNAic, or Luciferase miRNA-pRFPRNAic (see section 2.4.2) and were plated in separate compartments of the cultures plates. The plates

◦ were placed in the incubator for 15 hours at 37 C, 5% CO2 and 30% humidity. The

◦ cells were then placed in the controlled environment chamber (37 C, 5% CO2, 30% humidity) of an Axiovery 200M microscope (Zeiss) for 12 hours. These conditions were maintained by LiveCell3 system. IPLab4 software (Scanalytics, Inc. Fairfax, VA) was used for multi-position and time-lapse acquisition. The microscope was programmed to obtain images from multiple coordinates at 10 minute intervals over the incubation period. Once acquisition was completed, image analysis was performed using Image J.

2.13 Statistical Analysis

All extensions from a neuron were measured based on β-III tubulin staining, and the longest was considered the axon of that neuron. The start of the neurite was considered the point where the branch emerged from the soma. Statistical signiﬁcance was assessed using an unpaired two-tail Student’s t-test in Microsoft R Excel or one-way ANOVA with

Tukey HSD post hoc in SPSS (IBM). Chapter 3

Results

3.1 Construct Veriﬁcation

The cloned constructs were veriﬁed by restriction analysis, DNA sequencing (TCAG

DNA Sequencing Facility. Toronto, ON), and Western blot analysis. Brieﬂy, HEK293T cells were transfected with either Pum2-EYFP, dnPUM2-EYFP, or PUM2W349G-EYFP constructs, and cell lysate was prepared from transfected and untransfected HEK293T cells. Anti-PUM2 primary antibody and anti-rabbit secondary antibody were used to develop those blots. Bands corresponding to the molecular size of PUM2 were detected at 125KDa (represented in ﬁgures 3.1 and 3.2).

3.2 PUM2 is transported along the axons in DRG

neurons and RGCs

Our laboratory previously showed the presence of endogenous PUM2 in the axons emerg- ing from chick retinal explants (Figure 1.2). To verify these ﬁndings, PUM2-EYFP was electroporated into the chick retina as described in section 2.5. EYFP expression was detected in the soma, along the axon, and in the growth cone of retinal ganglion cells

33 Chapter 3. Results 34

Figure 3.1: Western Blot Analysis veriﬁed overexpression constructs Pum2, dnPum2. HEK293T cells were tranfected with PUM2-RFP in pT2K (PUM2-RFP), dnPUM2-RFP in pT2K (dnPUM2-RFP), PUM2-EYFP in pEYFPN1 (PUM2-EYFP), and dnPUM2-EYFP in pEYFPN1 (dnPUM2-EYFP). The lane labeled ‘-ve’ is the negative control where lysate from untransfected cells was blotted.

(Figure 3.3). This further supports the results shown in ﬁgure 1.2 and indicates a role of

PUM2 in the growing axons of RGCs.

In addition, DRG neurons were cultured from E8 chick embryos and ﬁxed 18 hours after seeding. DRG neurons were labeled using an antibody for Pum2, and revealed punctate expression of PUM2 along the neurites. PUM2 expression overlapped with

β-III tubulin (Figure 3.4), indicating a role for PUM2 in the growing axons.

3.3 PUM2 overexpression results in shorter axons in

dissociated DRG neurons

The role of Pum2 in axonal growth was examined by transfecting DRG neurons from E8 chicken embryos with either Pum2-EYFP or a GFP control as described in sections 2.4.1 and 2.4.2. DRG neurons with Pum2-EYFP construct had signiﬁcantly shorter axons than the GFP transfected neurons (Figure 3.5). After quantiﬁcation, the neurites were shown to be 84.7±2.7% (n = 14 neurons, p < 0.0001) shorter than the GFP transfected Chapter 3. Results 35

Figure 3.2: Western Blot Analysis veriﬁed overexpression construct

PUM2W349G. HEK293T cells were tranfected with PUM2W349G-EYFP in pEYFPN1 (PUM2W349G-EYFP), and a Western blot was performed using anti-PUM2 antibody. The lane labeled ‘-ve control’ represents lysate from untransfected cells. neurons (Figure 3.6). This suggests PUM2 regulates axonal outgrowth.

3.4 Expression of dnPUM2 or PUM2W349G results

in shorter axons in dissociated DRG neurons

In order to determine a possible mechanism through which PUM2 aﬀects axonal outgrowth, two mutants were cloned. First, a dominant negative form of PUM2, in which glycine 947 is mutated to aspartic acid (G947D) was generated. This mutant retains the ability to bind mRNA, but fails to regulate translation (Wharton et al., 1998).

The second mutation (Pum2W349G), in which tryptophan 349 is mutated to glycine

(W349G), disrupts binding of Pum2W349G to the m7G 5’ cap of the target mRNA.

Mutated Pum2 cannot compete with eIF4E for the cap, and consequently, its ability to

regulate translation of the target mRNA is disrupted (Cao et al., 2010).

DRG neurons transfected with dnPUM2-EYFP had signiﬁcantly shorter axons (56.29±6.1%,

n = 14 neurons, p = 0.001) than the GFP transfected neurons (Figures 3.7 and 3.8).

The binding capability of Pum2 to the 5’ cap of target mRNA and the eﬀect on

axonal outgrowth was examined by transfecting Pum2W349G-EYFP construct into DRG

neurons and measuring axonal length. Pum2W349G-EYFP transfected neurons revealed Chapter 3. Results 36

signiﬁcantly shorter axons compared to neurons transfected with GFP (n = 9 neurons,

p < 0.0001) (Figures 3.9 and 3.10).

3.5 PUM2 silencing

Seven Pum2miRNA constructs were cloned. PUM2miRNA1, 2, 3, and 4 were cloned

by Diane Cockburn and were designed to target diﬀerent regions of the coding sequence

of the Pum2 mRNA in the chicken. I cloned Pum2miRNA5, 6, and 7 such that each miRNA targets a 22 nucleotide region in the coding sequence of Pum2 mRNA starting at nucleotides 463, 1655, and 2221, respectively. Each construct was co-trasnfected with cPum2 (see section 2.1.4) into HEK cells. Western Blot analysis examined the eﬃciency of each construct to silence Pum2. Two constructs knocked down cPUM2 eﬃciently. Those constructs were PUM2miRNA1 and PUM2miRNA7 and were used in further silencing experiments (Figure 3.11).

3.5.1 PUM2 silencing hinders axonal outgrowth in dissociated

DRG neurons

Neurons with Pum2-EYFP had shorter axons compared to control GFP neurons, therefore I wanted to examine the eﬀect on axonal outgrowth when Pum2 was silenced.

PUM2miRNA1 and PUM2miRNA7 were used to assess the eﬀects of PUM2 silencing on axonal outgrowth.

DRG neurons transfected with Pum2miRNA1 had 60.3±7.5% shorter axons (n =

21 neurons, p <0.001) compared to control DRG neurons transfected with Luciferase miRNA. A similar effect was observed in DRG neurons transfected with PUM2miRNA7 as these neurons had 61.26±5.4% shorter axons compared to control neurons transfected with Luciferase miRNA (n = 21 neurons, p <0.001). No statistically significant difference between axon length in DRG neurons transfected with PUM2miRNA1 and Chapter 3. Results 37

PUM2miRNA7 was detected (p = 0.996). Results are shown in ﬁgures 3.12 and 3.13.

One-way ANOVA with Tukey HSD post hoc was used to assess statistical signiﬁcance.

3.5.2 PUM2 silencing does not aﬀect eye size at E4

It was important to consider any eﬀects of PUM2 silencing on eye development if we were to assess the role of PUM2 in axonal outgrowth and axonal guidance in RGCs in vivo. To test the eﬀect of PUM2 silencing on eye size, PUM2miRNA, or Luciferase miRNA constructs were electroporated into the right eye of E1.5 embryos (see section

2.8) and eye size was measured at E4. Quantification revealed no statistically significant differences in eye size between control group and the PUM2miRNA1 group (p = 0.971) or the PUM2miRNA7 group (p = 0.557). Additionally, there was no statistically significant difference between PUM2miRNA1 and PUM2miRNA7 groups (p = 0.506) (Figures 3.14 and 3.15). One-way ANOVA with Tukey HSD post hoc was used to assess statistical significance.

3.6 eIF4E fails to rescue the short axon phenotype

Previous studies have described the translational suppression of eIF4E mRNA by PUM2

(Menon et al., 2004; Vessey et al., 2010) in addition to competition for 5’ m7G cap binding (Cao et al., 2010). Therefore, I engineered and cloned a construct that expresses both eIF4E and PUM2-EYFP using a 2A-based ribosomal skip mechanism (see section

2.1.5) to test whether coexpression of eIF4E could rescue the short axon phenotype observed after overexpression of PUM2. To validate the eIF4E-T2A-PUM2EYFP construct,

HEK293T cells were transfected with eIF4E-T2A-PUM2EYFP in pT2K and a Western blot was performed. Cell lysate from transfected and untransfected HEK293T cells was blotted with anti-Pum2 antibody and a band was observed at 125 kDa. Cell lysate from transfected and untransfected HEK293T was blotted with anti-2A antibody and a band Chapter 3. Results 38

was observed at 25 kDa (Figure 3.16).

Next, the eIF4E-T2A-PUM2EYFP vector was transfected into the DRG neurons as

described in section 2.4. DRG neurons transfected with the eIF4E-T2A-PUM2EYFP

construct had signiﬁcantly shorter axons (70.72±7.29%, n = 5 neurons, p = 0.006) than the GFP transfected neurons (Figures 3.17 and 3.18). This indicated that coexpression of eIF4E failed to rescue the short axon phenotype caused by PUM2 overexpression. Chapter 3. Results 39

Figure 3.3: Pum2-EYFP was detected in the axons and growth cones of RCGs

After electroporation of PUM2-EYFP into retinal ﬂat mounts, PUM2-EYFP was detected along the axon and in the growth cone of RGCs. Arrows indicate PUM2-EYFP punctae. Chapter 3. Results 40

Figure 3.4: PUM2 is endogenously expressed in DRG neurons. DRG neurons were cultured at E8 and ﬁxed 18 hours after seeding. (A) Top left panel shows PUM2 expression. Top right panel shows β-III tubulin. Bottom left panel is DAPI staining.

Bottom right panel is a merged image. (B) Area indicated by the box was enlarged to show the axon of a DRG neuron. Arrow heads indicate PUM2 expression along the axon. Chapter 3. Results 41

Figure 3.5: E8 DRG neurons transfected with PUM2-EYFP have shorter axons compared to neurons transfected with GFP. Scale bars = 50 µm

Figure 3.6: Axon length is signiﬁcantly shorter in DRG neurons overexpressing

PUM2 compared to control GFP neurons. Axons were 84.7±2.7% shorter in DRG neurons with Pum2-EYFP (n = 14 neurons, p < 0.0001). Chapter 3. Results 42

Figure 3.7: E8 DRG neurons transfected with dnPUM2-EYFP have shorter axons compared to control DRG neurons transfected with GFP. Scale bars = 50 µm

Figure 3.8: Axon length is signiﬁcantly shorter in DRG neurons overexpressing dnPUM2 compared to control GFP neurons. The resulting axons were 56.29±6.1%

(n = 14 neurons, p = 0.001) shorter than the control GFP transfected neurons. Chapter 3. Results 43

Figure 3.9: E8 DRG neurons transfected with PUM2W349G-EYFP have shorter axons

compared to control DRG neurons transfected with GFP. Scale bars = 50 µm

Figure 3.10: Axon length is signiﬁcantly shorter in DRG neurons expressing

PUM2W349G compared to control GFP neurons. The resulting axons were

85±1.7% (n = 9 neurons, p < 0.0001) shorter compared to GFP transfected control

neurons. Chapter 3. Results 44

Figure 3.11: PUM2 silencing with PUM2miRNA1 or PUM2miRNA7. Top panel: a Western blot showing the eﬃcient silencing of cPUM2 in HEK293T cells. Bottom panel: a Commassie stain of the SDS gel conﬁrms similar amounts of protein were loaded in each lane. Chapter 3. Results 45

Figure 3.12: PUM2miRNA transfected neurons had shorter neurite length compared to control neurons transfected with Luciferase miRNA. Scale bars = 50 µm Chapter 3. Results 46

Figure 3.13: Axon length is signiﬁcantly shorter in DRG neurons expressing

PUM2miRNA1 and PUM2miRNA7 compared to control GFP neurons. Ax-

ons of PUM2miRNA1 transfected neurons were 60.3±7.5% (n = 21 neurons, p <0.001)

shorter axons compared to Luciferase miRNA transfected control neurons. Axons of

PUM2miRNA7 transfected neurons were 61.26±5.4% (n = 21 neurons, p <0.001) shorter

compared to Luciferase miRNA control transfections. One-way ANOVA with Tukey HSD

post hoc was used to assess statistical signiﬁcance. Chapter 3. Results 47

Brighfield RFP Merge

miRNA

Luciferase

Pum2miRNA1 Pum2miRNA2221

Figure 3.14: PUM2 silencing with PUM2miRNA1 or PUM2miRNA7 at E1.5 did not alter eye size at E4. Images were obtained using a 4X objective. Chapter 3. Results 48

Figure 3.15: PUM2 silencing did not affect eye size at E4. The diameter of the electroporated eye was measured and quantification revealed no statistically significant differences between the control group and PUM2miRNA1 (p = 0.971) or PUM2miRNA7

(0.557), nor between the PUM2miRNA1 and PUM2miRNA7 groups (p = 0.506). One- way ANOVA with Tukey HSD post hoc was used to assess statistical signiﬁcance. Chapter 3. Results 49

Figure 3.16: A Western Blot Validating the eIF4E-T2A-PUM2EYFP (eTPY) in pT2K construct. (A) Cell lysate from transfected and untransfected HEK293T cells was blotted with anti-PUM2 antibody and a band was observed at 125 kDa. (B) Cell lysate from transfected and untransfected HEK293T was blotted with anti-2A antibody and a band was observed at 25 kDa.

Figure 3.17: E8 DRG neurons transfected with eIF4E-T2A-PUM2EYFP have shorter axons compared to control DRG neurons transfected with GFP. Scale bars = 50 µm Chapter 3. Results 50

Figure 3.18: Axon length is signiﬁcantly shorter in DRG neurons coexpressing eIF4E and PUM2 compared to control GFP neurons. The resulting axons were

70.72±7.29% (n = 5 neurons, p = 0.006) shorter axons compared to GFP transfected control neurons. Chapter 4

Discussion

PUM is a founding member of the Puf family of mRNA binding proteins and translational regulators (Zhang et al., 1997). It can bind recognition sequences in the 3’ UTR of target mRNA through the RNA binding domain. This domain, termed the Puf domain, can establish direct contact with either the Watson-Crick or the Hoogsteen edges of the ribonucleic bases, depending on the identity and the location of the base within the recognition sequence (Chen and Varani, 2011).

Pum2 has been well characterized in the translational suppression of hb mRNA in

Drosophila, whereby PUM binds the NRE in the 3’-UTR of the hb transcript, and recruits both Nos and Brat to form a repressor complex that induces the deadenylation of hb mRNA (Wreden et al., 1997; Sonoda and Wharton, 2001). PUM and the vertebrate homologues, PUM1 and PUM2, appear to repress translation via several mechanisms including recruiting Nos without Brat to repress cyclin b mRNA (Asaoka-Taguchi et al.,

1999; Sonoda and Wharton, 2001; Nakahata et al., 2001), Brat without Nos to repress the translation of self-renewal mRNAs including Mad and dMyc (Harris et al., 2011), activation of miRNA (Leibovich et al., 2010; Ginter-Matuszewska et al., 2011), and by competing with eIF4E for the 5’ m7G cap (Cao et al., 2010). However, studies have also found that the invertebrate Puf protein, FBF-1, is involved in enhancing translation, as

51 Chapter 4. Discussion 52 in the case of EGL-4 (Kaye et al., 2009).

To date, the majority of research on PUM (or its homolgues) has examined its role in cell proliferation. For example, PUM was found to important be in germ line stem cell maintenance and differentiation through its differential interaction with either Nos or Brat in response to differences in Dpp signaling (Harris et al., 2011). Furthermore,

PUM2 was found to interact with DAZ and DAZL in the human germ cells, indicating an important role in germ cell development (Moore et al., 2003).

A few studies have looked at the role of PUM and its homologues in the nervous system. In one study, PUM2 expression exhibited somato-dendritic localization in rat hippocampal neurons, and was further indicated to be important in dendritic morphogenesis of these neurons (Vessey et al., 2006, 2010). However, there are no studies to date that examine the role of PUM2 in axonal outgrowth during development. Previous studies from our lab found that PUM2 was expressed in axons and growth cones of E7 retinal explants. The purpose of this study was to investigate the involvement of PUM2 in axonal outgrowth during development. PUM2 was found to be transported along the axons in retinal ganglion cells and in dorsal root ganglia neurons. Furthermore, overexpression of either wild type or mutant forms of PUM2 (dnPUM2 or PUM2W349G) hindered axonal outgrowth in DRG neurons. Moreover, PUM2 silencing in DRG neurons using miRNA constructs (PUM2miRNA1 and PUM2miRNA7) also led to axonal outgrowth hindrance. These results suggest that a sensitive balance in PUM2 activity is necessary to achieve normal axonal outgrowth.

4.1 PUM2 localization in the growth cone and axons

of RGCs and DRG neurons

To date, studies have addressed the presence and role of PUM2 in dendrites and dendritic spines (Vessey et al., 2006; Mee et al., 2004). Furthermore, it has been suggested that Chapter 4. Discussion 53

PUM2 collaborates with other RNA binding proteins, such as FMRP, to suppress the

translation of target mRNAs and ensure transport to dendritic spines (Liu-Yesucevitz

et al., 2011). However, no studies have reported endogenous PUM2 expression in axons,

and subsequently the role of PUM2 in axonal development. Previous studies from our

lab suggested the presence of PUM2 in the axons of RGCs, where PUM2 was detected

by immunohistochemical staining of sections of retinae prepared from E7 embryos and

retinal explants prepared from E7 embryos (Figure 1.2). Indeed, when PUM2-EYFP

was electroporated into retinal ﬂat mounts, PUM2 was detected in the soma, the axon,

and the growth cone of RGC (Figure 3.3), indicating a functional role of PUM2 in these

compartments.

In addition, endogenous PUM2 was detected in the neurites of DRG neurons, and

colocalized with β-III tubulin (Figure 3.4). This is consistent with previous literature which described the transport of PUM2 along microtubules in cultured hippocampal neurons (Vessey et al., 2006). Taken together, these results indicate a previously undescribed role for PUM2 in mRNA transport along growing axons, in addition to regulating local translation in these growing axons, thus orchestrating processes such as axonal outgrowth and path-ﬁnding.

4.2 Impaired axonal outgrowth in DRG neurons over-

expressing PUM2

A previous study observed a reduction in the voltage-gated Na+ current mediated by the protein Para when PUM was overexpressed in Drosophila neurons (Mee et al., 2004).

Studies that have looked at mammalian neurons reported a decrease in dendritic complexity in addition to a reduction in dendritic spine numbers following PUM2 overexpression (Vessey et al., 2010). Another study has shown that overexpression of PUM2 in hippocampal neurons induced the formation of stress granules and the recruitment of Chapter 4. Discussion 54 other RNA binding proteins, such as Stau1, in response to stressful stimuli (Vessey et al.,

2006). These studies suggest that PUM2 is involved in regulating neuronal function and morphology.

Therefore, I proposed that overexpressing Pum2 in DRG neurons would suppress the growth of axons. In order to determine the role of PUM2 in axonal outgrowth, it was necessary to overexpress it in neurons. Pum2-EYFP was transfected into cultured DRG neurons, and axon length was measured at 18 hours after transfection (see section 2.4.2).

The axons of PUM2-EYFP transfected DRG neurons were shorter when compared to axons of GFP transfected DRG neurons. This result indicates a role for PUM2 in axonal outgrowth, and is consistent with the reduction in dendritic branching and complexity mentioned above (Vessey et al., 2010).

There are several possible reasons for this phenotype. For instance, it is possible that overexpressing PUM2 could repress translation of eIF4E (Menon et al., 2004; Vessey et al., 2010), which is required for the translation of other mRNAs that may be necessary for axonal outgrowth. eIF4E plays a central role in mRNA translation because of its interaction with eIF4G to form eIF4F, which can simultaneously bind the 5’ cap and the PABP on the poly-A tail of the mRNA, allowing mRNA translation to ensue

(Sonenberg and Dever, 2003; Sonenberg and Hinnebusch, 2009). Therefore, PUM2 can lead to reduced production of proteins that act as building blocks for the growing axon.

Moreover, PUM2 represses the translation of the mitogen-activated protein kinase

(MAPK) ERK2 (Lee et al., 2007; Lu and Hall, 2011), which can phosphorylate and subsequently activate eIF4E (Bramham and Wells, 2007). This would lead to reduced activation of eIF4E and therefore reduced translation of the downstream mRNAs. By interfering with eIF4E function, either by dowregulating its expression (Vessey et al.,

2010; Menon et al., 2004) or by competing with it for binding the 5’ m7G cap, PUM2 overexpression may cause the observed short neurite phenotype.

On the other hand, one must also consider the possibility that the eﬀects of axonal Chapter 4. Discussion 55

outgrowth regulation by PUM2 are independent of eIF4E. For example, studies have

shown that normal MAPK activity is required for normal microtubule dynamics, and

and disrupting MAPK activity aﬀects microtubule assembly through direct association

with microtubules or microtubule-associated proteins (Olsen et al., 1998). PUM2 has

been shown to bind the 3’ UTR of the mRNA encoding the MAPK erk2 and suppress

its translation (Lee et al., 2007; Lu and Hall, 2011) in addition to downregulating other

components of the EGFR/MAPK signaling pathway (Kim et al., 2012). Therefore, it is

possible that by controlling the MAPK pathway, PUM2 can disrupt microtubule dynam-

ics, which are necessary for normal axonal outgrowth (Tanaka et al., 1995).

Another pathway that may be involved is the phosphorylation of microtubule associ-

ated proteins by c-Jun N-Terminal Kinase (JNK) and Erk2 MAPKs (Bj¨orkblomet al.,

2005). PUM2 can downregulate the translation of diﬀerent MAPKs, including JNK and

ERK2 (Lee et al., 2007), therefore PUM2 may interfere with the activation of microtubule

associated proteins and therefore inhibit their binding to the assembled microtubule.

4.3 Impaired axonal outgrowth in DRG neurons ex-

pressing PUM2 mutants

PumG1330D, a dominant negative mutation (Wharton et al., 1998), fails to recruit Brat

to the 3’-UTR of hb mRNA, but retains the ability to bind the NRE and recruit Nos in Drosophila (Sonoda and Wharton, 2001). This is consistent with the model that suggests a direct interaction between the Puf domain of PUM and the NHL domain of

Brat (Edwards et al., 2003). This may explain the sustained ability of PUM to bind hb mRNA, but failure to regulate its translation.

Contrary to my initial hypothesis, overexpression of dnPUM2 in DRG neurons resulted in a similar phenotype to DRG neurons overexpressing wild-type Pum2. Consis- tent with my ﬁndings, other studies have observed a reduction in dendritic complexity Chapter 4. Discussion 56 and high order dendritic branches in Drosophila class IV dendritic arborization (da) neurons when either PUM or PUMG1330D mutant was overexpressed (Ye et al., 2004).

Since PUM has been indicated to have multiple mechanisms of action, one explanation for the observed phenotype could be that the translational regulation mechanism in axonal outgrowth is independent of Brat, where abolishing the ability of PUM2 to recruit Brat would not aﬀect the translational repression of target mRNA. Therefore, the dnPum2 mutant would maintain normal translational suppression activity.

Alternatively, recruitment of Brat by PUM2 may indeed be required to regulate axonal outgrowth. In this case, it is possible that failure to recruit Brat to the repressor complex did indeed interfere with normal PUM2 function, leading to failure of translational repression. This may lead to the translation of a distinct pool of mRNAs, such as kinases or phosphatases, that may interfere with the production or assembly of microtubules and microﬁlaments. An example of such a protein is Cdk1 whose activity is regulated by PUM via regulation of Ringo/Spy (Padmanabhan and Richter, 2006). This would decrease the activity of Cdk1, which normally phosphorylates microtubules and decreases their stability (Fourest-Lieuvin et al., 2006). In this case, a sensitive balance between outgrowth promoting and outgrowth inhibiting mRNA must be maintained in order to ensure normal neurite elongation. The outgrowth promoting pool may include mRNAs which require eIF4E for their translation, and which encode proteins that are considered “building blocks” for axonal outgrowth, such as microtubules, microtubule associated proteins, and/or their activators. The outgrowth inhibiting pool of mRNAs would include transcripts that encode proteins that would interfere with the assembly of microtubules, such as Cdk1. This balance could be maintained by PUM2 and interfering with normal PUM2 function disrupts this balance.

DRG neurons with Pum2W349G exhibited a similar phenotype to neurons with the dnPum2 mutant, in that axons were shorter than in the control group. Pum2W349G has an impaired ability to bind the 5’ m7G cap of the target mRNA, thus eliminating Chapter 4. Discussion 57 the competition with eIF4E for the cap analogue (Cao et al., 2010). This leads to failure of translational repression in a 5’ cap dependent manner. It is interesting that the same phenotype was observed when PUM2W349G was overexpressed in DRG neurons.

Therefore, despite having distinct mechanisms of action, a similar phenotype was observed with the mutant PUM2 constructs. There are two possible explanations for the phenotype observed in DRG neurons expressing Pum2W349G. First, it is possible that the binding of PUM2 to the 5’ m7G cap is not necessary for axonal outgrowth regulation. In this case, the activity of PUM2 would be sustained despite the mutation, and the level of translational suppression would be similar to that seen in the wild type PUM2 overexpression.

On the other hand, it is also possible that PUM2 binding to 5’ m7G is required for the translational regulation of mRNA involved in axonal outgrowth. Therefore, disrup- tion of PUM2 binding to 5’ m7G will aﬀect the regulation of outgrowth. This would would further support the idea that a tightly regulated level of PUM2 activity must be maintained for normal neurite outgrowth.

4.4 PUM2 silencing interferes with axonal outgrowth

in DRG neurons

PUM2 was downregulated using two diﬀerent miRNA constructs, PUM2miRNA1 and

PUM2miRNA7, that target different regions of the open reading frame of Pum2 mRNA, and axon length was significantly shorter compared to control cells. Previous studies have examined the effects of PUM/PUM2 silencing or downregulation. In Drosophila motorneurons, PUM was found to be responsible for regulation of neuronal excitability.

Loss of PUM from these neurons resulted in an increase in the persistent Na+ current through increased levels of the voltage-gated Na+ channel Para, thus increasing neuronal excitability (Mee et al., 2004), whereas the opposite eﬀect was observed when PUM was Chapter 4. Discussion 58 overexpressed in those neurons.

Using RNA interference, PUM2 downregulation in cultured hippocampal neurons caused a reduction in stress granule formation in response to metabolic stress, whereas an increase in stress granule formation was observed when PUM2 was overexpressed

(Vessey et al., 2006). Additionally, PUM2 downregulation was shown to increase the number of primary dendrites, primary branching points, and immature thin dendritic spines in cultured embryonic rat hippocampal neurons, whereas overexpression of PUM2 had the reverse eﬀect (Vessey et al., 2010).

PUM2 downregulation in DRG neurons in this study did not display opposite eﬀects to PUM2 overexpression. This result was contrary to what I initially expected, which was an enhancement of neurite outgrowth. This suggests that PUM2 is necessary for normal axonal outgrowth in DRG neurons.

It is worth noting that DRG neurons transfected with PUM2 or PUM2W349G constructs had similar phenotypes in that axons were approximately 85% shorter than control cells, whereas DRG neurons with dnPUM2 or miRNA constructs had a similar but less severe phenotype (approximately 60% shorter axons compared to control cells). It is diﬃcult to explain this observation without pin-pointing the molecular mechanism un- derlying axonal outgrowth regulation by PUM2. However, one can speculate that PUM2 and PUM2W349G result in a similar phenotype because axonal outgrowth regulation by

PUM2 is cap independent. In this case, the ability of PUM2 to suppress the translation of target mRNAs remains intact even after the mutation, and thus can exert the same eﬀect on axonal outgrowth.

Moreover, DRG neurons with dnPUM2 or PUM2 silencing constructs may have a similar phenotype due to loss of function of PUM2. I am confident that the endogenous PUM2 in DRG neurons was silenced effectively and efficiently using the miRNA constructs PUM2miRNA1 and PUM2miRNA7 in pRFPRNAic (Figure 3.11). Based on this, it can be argued that the dnPUM2 protein used in this study is non-functional and Chapter 4. Discussion 59 that it indeed acts as a dominant negative, and is therefore an effective loss of function tool. Thus, it could be deduced that the recruitment of Brat into the repressor complex at the 3’ UTR of the the target mRNA (Sonoda and Wharton, 2001) by PUM2 is imperative to axonal outgrowth regulation.

4.5 eIF4E coexpression fails to rescue short axon

phenotype

In order to determine the molecules/proteins involved in the regulation of axonal outgrowth via PUM2, we would need to test whether the co-expression of eIF4E along with

PUM2 would rescue the short axon phenotype observed (described in section 3.3). eIF4E is directly regulated by PUM2 at the expression level (Menon et al., 2004; Vessey et al.,

2010) and at the functional level (Cao et al., 2010), therefore I predicted that overexpressing eIF4E would restore the translation of the downstream mRNAs aﬀected by the overexpression of PUM2, and therefore restore normal axonal outgrowth.

To test this hypothesis, I engineered and cloned the eIF4E-T2A-PUM2EYFP in pT2K construct (see sections 2.1.5 and 3.1). This construct allows the coexpression of eIF4E and PUM2-EYFP using a 2A-peptide sequence that allows for a ribosomal skip mechanism, which ensures a 1:1 expression ratio of both proteins. This is especially important because eIF4E and PUM2 have been shown to compete for the 5’ m7G cap binding (Cao et al., 2010). If overexpression of PUM2 caused the short axon phenotype by favoring

PUM2 in the competition for the cap binding, then it is possible that co-expressing eIF4E at a 1:1 ratio may restore the balance between eIF4E and PUM2, and therefore rescue the short axon phenotype. In addition, a 2A tag would be added to the C-terminus of the eIF4E, which would enable the specific staining and detection of the expressed protein, as opposed to the endogenous protein (Szymczak et al., 2004). DRG neurons transfected with this construct had significantly shorter axons than DRG neurons transfected with Chapter 4. Discussion 60 a control GFP construct, indicating that eIF4E co-expression is not sufficient to rescue the short axon phenotype caused by PUM2 overexpression. It is possible that despite the expression of eIF4E, PUM2 can still compete with eIF4E for the 5’ m7G cap, thus preventing eIF4E from forming the closed loop complex necessary for the translation of mRNA (see section 1.1.1).

Figure 4.1 summarizes the known interactions of PUM2 and their possible involvement in axonal outgrowth regulation. Several of those interactions were tested in this study. The necessity of PUM2 for normal axonal outgrowth in indicated by the short axon phenotype observed following the overexpression or downregulation of PUM2 in

DRG neurons. Furthermore, the necessity of Brat recruitment by PUM2 is suggested by the short axon phenotype observed following dnPUM2 expression in DRG neurons.

Additionally, expression of the PUM2W349G mutant in DRG neurons also suggests that the 5’ m7G cap binding capability of PUM2 is necessary for normal axonal outgrowth in those neurons. Finally, the co-expression of eIF4E with PUM2 was not suﬃcient to rescue the short axon phenotype caused by PUM2 overexpression, despite the 1:1 expression ratio ensured by the 2A-based ribosomal skip mechanism.

4.6 Future Directions

4.6.1 Are PUM2/Nos and PUM2/mRNA interactions neces-

sary for normal axonal outgrowth?

To dissect out the functions of PUM2 in axonal outgrowth, it is important to determine which interactions of PUM2 are necessary for regulation of this process. After examining the role of several of those interactions (Figure 4.1B), it is important to examine the role of PUM2/Nos interactions in axonal outgrowth. Previous studies have shown that amino acid residues in the 8th repeat of the Puf domain are necessary for the recruitment of Chapter 4. Discussion 61

Figure 4.1: Known interactions of PUM2 and possible involvement in axonal

outgrowth. (A) Under normal conditions, PUM2 regulates the translation of mRNA

through documented interactions with mRNA, Nos, Brat, 5’ m7G cap, and eIF4E. Such

regulation results in normal axonal outgrowth. (B) PUM2 interactions that were tested

in this study. Overexpression and silencing of PUM2, ablating the recruitment of Brat,

ablating PUM2’s ability to bind 5’ m7G cap, and co-expressing eIF4E with PUM2 all

resulted in DRG neurons with short axons. (C) Known interactions of PUM2 that were not tested in this study that are possibly involved in axonal outgrowth. Chapter 4. Discussion 62

Nos by PUM to form a translational complex (Sonoda and Wharton, 1999). Thus, by mutating those amino acids, a PUM2 mutant that fails to recruit Nos can be generated and used to assess the necessity of this interaction. In addition, it is important to determine whether RNA binding capability of PUM2 is necessary for axonal outgrowth regulation. This can be achieved by introducing mutations to the Puf domain of PUM2 to preventing PUM2 binding to NRE (Wharton et al., 1998) and/or PBE (Padmanabhan and Richter, 2006).

4.6.2 Can the short axon phenotype be rescued?

A construct coexpressing PUM2 and Stau2 has also been engineered to determine a possible mechanism of axonal outgrowth regulation by PUM2. Interaction of these two proteins has previously been reported where Stau2 acts upstream of PUM2 (Dubnau et al., 2003; Vessey et al., 2006). Thus, it is possible that Stau2 is involved in regulating the PUM2 pathway and is therefore likely that coexpressing Stau2 can attenuate the eﬀects that overexpression of PUM2 can exert on axonal outgrowth. I have generated a construct that co-expresses both Stau2 and PUM2 using the 2A-based ribosomal skip mechanism described for the eIF4E-T2A-PUM2EYFP construct (see sections 2.1.5 and

4.5).

4.6.3 What is the cause of the short axon phenotype?

A live imaging experiment was performed in which DRG neurons transfected with a

Luciferase miRNA construct, PUM2miRNA1, or PUM2miRNA7 were imaged every 10 minutes for 12 hours following an 18 hour incubation period (see section 2.12). Unfortu- nately, all neurites collapsed when they contacted another cell or cell debris (Figure 4.2), which prevented us from determining the cause of the observed phenotype.

As an alternative approach, a time point experiment could be performed to further examine the mechanism by which the short neurite phenotype is caused. DRG cells would Chapter 4. Discussion 63

Figure 4.2: Time lapse imaging of DRG neurons. Pictures taken at 1 hour intervals reveal

the outgrowth of neurites (red arrow heads) from the soma (black arrow head) and the

collapse of these neurites when in contact with cell debris.

be trasnfected as described section 2.4 with silencing constructs PUM2miRNA1 and

PUM2miRNA7 and would be ﬁxed at 24 and 30 hours. After ﬁxing with 4% PFA, cells

will be stained for β-III tubulin and F-actin (Alexa Fluor R 350 phalloidin, Invitrogen).

The length of axons, along with the integrity of growth cones will be assessed. This will allow us to measure the rate of axonal outgrowth, and will therefore allow us to determine the mechanism by which the observed phenotype is caused. There are two possible reasons why the neurite outgrowth was impaired. First, the observed phenotype may be caused by a delay in the onset of axonal outgrowth. Alternatively, the short axon phenotype may be caused by a reduction in the rate of axonal outgrowth. We hypothesize that the rate of neurite outgrowth would be reduced following PUM2 silencing. Chapter 4. Discussion 64

4.6.4 Testing the role of PUM2 in axonal outgrowth and guid-

ance in vivo

Despite strong evidence for a role for PUM2 in axonal outgrowth, performing in vivo

experiments is still indispensable to thoroughly understand the role of PUM2 in this

process. An in vivo model has been well established in our laboratory, where the primary

optic vesicle of E1.5 chicken embryos will be infected with the viral vector RCAS-A, and

axonal outgrowth and targeting to the optic tectum will be assessed at E17 (Tassew

et al., 2008) (also see section 2.7).

To silence PUM2 for in vivo analysis, a RCAS vector expressing Pum2miRNA would

be utilized. We have cloned constructs that express either PUM2miRNA1 or PUM2miRNA7

along with GFP to allow the visualization of infected cells. Unfortunately, the same vec-

tor cannot be used to test the role of PUM2 overexpression on axonal guidance due

to restrictions on the size of the insert cloned into the vector (Das et al., 2006). This

experiment was attempted for this study. However, the survival rate of the embryos

was extremely low, and therefore repeating the experiment is necessary. Based on the

phenotype observed in DRG neurons in response to PUM2 silencing, we expect to see a

reduction in the arborization of axons in the optic tectum. We have shown that PUM2

silencing in the eye at E1.5 does not aﬀect eye size at E4, which indicates that eye de-

velopment can still proceed normally in the absence of PUM2. On the other hand, this

could be due to the lack of PUM2 expression at early developmental stages. There are

no studies which describe the expression proﬁle of PUM2 in the developing eye of the

chicken embryo. Therefore, in situ hybridization of E1.5 embryos is required to determine

whether PUM2 mRNA is present at that stage. Chapter 4. Discussion 65

4.7 Conclusion

PUM2 has been studied in a variety of systems, including the nervous system of several organisms. However, there is no literature on the role of PUM2 in axonal outgrowth. In this study, I provide evidence for a previously undescribed role for PUM2 in the regulation of axonal outgrowth. First, I found that PUM2 was present in the axons of retinal ganglion cells and dorsal root ganglia neurons. Furthermore, overexpression of PUM2 in DRG neurons caused a severe reduction in axonal length, as did the overexpression of the PUM2W349G mutant, which has an impaired ability to bind the 5’ m7G cap of mRNA. Interestingly, I observed a reduction in axonal length when Pum2 was silenced with miRNA, and when dnPum2 was overexpressed, albeit not as severe the reduction caused by PUM2 and PUM2W349G, which may be because PUM2 requires Brat to exert its eﬀects on axonal outgrowth.

Future experiments will focus on several aspects of the involvement of PUM2 in axonal outgrowth. First, the involvement of PUM2/Nos and PUM2/mRNA interactions in axonal outgrowth regulation will be assessed. Second, the time point experiment will allow us to determine whether PUM2 in necessary for regulating the rate or onset of axonal outgrowth. Finally, the ﬁber tracing experiment will allow us to assess axonal outgrowth in vivo when PUM2 function is manipulated in vivo. References

Asaoka-Taguchi, M., Yamada, M., Nakamura, A., Hanyu, K., and Kobayashi, S. (1999).

Maternal pumilio acts together with nanos in germline development in drosophila em-

bryos. Nat Cell Biol, 1(7):431–437.

Baker, S. J., Fearon, E. R., Nigro, J. M., Hamilton, S. R., Preisinger, A. C., Jessup,

J. M., vanTuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., White, R., and

Vogelstein, B. (1989). Chromosome 17 deletions and p53 gene mutations in colorectal

carcinomas. Science, 244(4901):217–221.

Bear, M. F., Huber, K. M., and Warren, S. T. (2004). The mglur theory of fragile x

mental retardation. Trends Neurosci, 27(7):370–377.

Bj¨orkblom,B., Ostman, N., Hongisto, V., Komarovski, V., Fil´en,J.-J., Nyman, T. A.,

Kallunki, T., Courtney, M. J., and Coﬀey, E. T. (2005). Constitutively active cytoplas-

mic c-jun n-terminal kinase 1 is a dominant regulator of dendritic architecture: role of

microtubule-associated protein 2 as an eﬀector. J Neurosci, 25(27):6350–6361.

Bouquet, C. and Nothias, F. (2007). Molecular mechanisms of axonal growth. Adv Exp

Med Biol, 621:1–16.

Bramham, C. R. and Wells, D. G. (2007). Dendritic mrna: transport, translation and

function. Nat Rev Neurosci, 8(10):776–789.

66 REFERENCES 67

Cajal, S. R. y. (1890). A` quelle ´epoque apparaissent les expansions des cellules nerveuses

de la moëlleépinièredu poulet? Anatomomischer Anzeiger, 21-22:609–639.

Calabrese, E. J. (2008). Enhancing and regulating neurite outgrowth. Crit Rev Toxicol,

38(4):391–418.

Cao, Q., Padmanabhan, K., and Richter, J. D. (2010). Pumilio 2 controls translation by

competing with eif4e for 7-methyl guanosine cap recognition. RNA, 16(1):221–227.

Chen, D. and McKearin, D. M. (2003). A discrete transcriptional silencer in the bam

gene determines asymmetric division of the drosophila germline stem cell. Development,

130(6):1159–1170.

Chen, D., Zheng, W., Lin, A., Uyhazi, K., Zhao, H., and Lin, H. (2012). Pumilio 1 sup-

presses multiple activators of p53 to safeguard spermatogenesis. Curr Biol, 22(5):420–

425.

Chen, G., Li, W., Zhang, Q.-S., Regulski, M., Sinha, N., Barditch, J., Tully, T., Krainer,

A. R., Zhang, M. Q., and Dubnau, J. (2008). Identiﬁcation of synaptic targets of

drosophila pumilio. PLoS Comput Biol, 4(2):e1000026.

Chen, Y. and Varani, G. (2011). Finding the missing code of rna recognition by puf

proteins. Chem Biol, 18(7):821–823.

Cockburn, D. M., Charish, J., Tassew, N. G., Eubanks, J., Bremner, R., Macchi, P., and

Monnier, P. P. (2012). The double-stranded rna-binding protein staufen 2 regulates

eye size. Mol Cell Neurosci.

Darnell, J. C., Driesche, S. J. V., Zhang, C., Hung, K. Y. S., Mele, A., Fraser, C. E.,

Stone, E. F., Chen, C., Fak, J. J., Chi, S. W., Licatalosi, D. D., Richter, J. D., and

Darnell, R. B. (2011). Fmrp stalls ribosomal translocation on mrnas linked to synaptic

function and autism. Cell, 146(2):247–261. REFERENCES 68

Das, R. M., Hateren, N. J. V., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous,

V. C., Manning, E. M., McGrew, M. J., Ohyama, K., Sacco, M. A., Halley, P. A.,

Sang, H. M., Storey, K. G., Placzek, M., Tickle, C., Nair, V. K., and Wilson, S. A.

(2006). A robust system for rna interference in the chicken using a modiﬁed microrna

operon. Dev Biol, 294(2):554–563.

Davey, M. G. and Tickle, C. (2007). The chicken as a model for embryonic development.

Cytogenet Genome Res, 117(1-4):231–239.

de Bellard, M. E. and Bronner-Fraser, M. (2005). Neural crest migration methods in the

chicken embryo. Methods Mol Biol, 294:247–267. de Moor, C. H., Meijer, H., and Lissenden, S. (2005). Mechanisms of translational control

by the 3’ utr in development and diﬀerentiation. Semin Cell Dev Biol, 16(1):49–58.

Dent, E. W. and Gertler, F. B. (2003). Cytoskeletal dynamics and transport in growth

cone motility and axon guidance. Neuron, 40(2):209–227.

Dong, S., Wang, Y., Cassidy-Amstutz, C., Lu, G., Bigler, R., Jezyk, M. R., Li, C.,

Hall, T. M. T., and Wang, Z. (2011). Speciﬁc and modular binding code for cytosine

recognition in pumilio/fbf (puf) rna-binding domains. J Biol Chem, 286(30):26732–

26742.

Dubnau, J., Chiang, A.-S., Grady, L., Barditch, J., Gossweiler, S., McNeil, J., Smith, P.,

Buldoc, F., Scott, R., Certa, U., Broger, C., and Tully, T. (2003). The staufen/pumilio

pathway is involved in drosophila long-term memory. Curr Biol, 13(4):286–296.

Edwards, T. A., Wilkinson, B. D., Wharton, R. P., and Aggarwal, A. K. (2003). Model of

the brain tumor-pumilio translation repressor complex. Genes Dev, 17(20):2508–2513.

Filipovska, A. and Rackham, O. (2011). Designer rna-binding proteins: New tools for

manipulating the transcriptome. RNA Biol, 8(6). REFERENCES 69

Fiore, R., Khudayberdiev, S., Christensen, M., Siegel, G., Flavell, S. W., Kim, T.-K.,

Greenberg, M. E., and Schratt, G. (2009). Mef2-mediated transcription of the mir379-

410 cluster regulates activity-dependent dendritogenesis by ﬁne-tuning pumilio2 pro-

tein levels. EMBO J, 28(6):697–710.

Fourest-Lieuvin, A., Peris, L., Gache, V., Garcia-Saez, I., Juillan-Binard, C., Lantez, V.,

and Job, D. (2006). Microtubule regulation in mitosis: tubulin phosphorylation by the

cyclin-dependent kinase cdk1. Mol Biol Cell, 17(3):1041–1050.

Fournier, A. E., Takizawa, B. T., and Strittmatter, S. M. (2003). Rho kinase inhibition

enhances axonal regeneration in the injured cns. J Neurosci, 23(4):1416–1423.

Friend, K., Campbell, Z. T., Cooke, A., Kroll-Conner, P., Wickens, M. P., and Kimble,

J. (2012). A conserved puf-ago-eef1a complex attenuates translation elongation. Nat

Struct Mol Biol, 19(2):176–183.

Gallo, G. and Letourneau, P. C. (1999). Diﬀerent contributions of microtubule dynamics

and transport to the growth of axons and collateral sprouts. J Neurosci, 19(10):3860–

3873.

Gamberi, C., Peterson, D. S., He, L., and Gottlieb, E. (2002). An anterior function for

the drosophila posterior determinant pumilio. Development, 129(11):2699–2710.

Gerber, A. P., Luschnig, S., Krasnow, M. A., Brown, P. O., and Herschlag, D.

(2006). Genome-wide identiﬁcation of mrnas associated with the translational regula-

tor pumilio in drosophila melanogaster. Proc Natl Acad Sci U S A, 103(12):4487–4492.

Ginter-Matuszewska, B., Kusz, K., Spik, A., Grzeszkowiak, D., Rembiszewska, A.,

Kupryjanczyk, J., and Jaruzelska, J. (2011). Nanos1 and pumilio2 bind microrna

biogenesis factor gemin3, within chromatoid body in human germ cells. Histochem

Cell Biol, 136(3):279–287. REFERENCES 70

Giovanni, S. D. and Rathore, K. (2012). p53-dependent pathways in neurite outgrowth

and axonal regeneration. Cell Tissue Res, 349(1):87–95.

Hamburger, V. and Hamilton, H. L. (1992). A series of normal stages in the development

of the chick embryo. 1951. Dev Dyn, 195(4):231–272.

Hargreaves, A. J., Wandosell, F., and Avila, J. (1986). Phosphorylation of tubulin

enhances its interaction with membranes. Nature, 323(6091):827–828.

Harris, R. E., Pargett, M., Sutcliﬀe, C., Umulis, D., and Ashe, H. L. (2011). Brat

promotes stem cell diﬀerentiation via control of a bistable switch that restricts bmp

signaling. Dev Cell, 20(1):72–83.

Islam, S., Montgomery, R. K., Fialkovich, J. J., and Grand, R. J. (2005). Developmental

and regional expression and localization of mrnas encoding proteins involved in rna

translocation. J Histochem Cytochem, 53(12):1501–1509.

Jaruzelska, J., Kotecki, M., Kusz, K., Spik, A., Firpo, M., and Pera, R. A. R. (2003).

Conservation of a pumilio-nanos complex from drosophila germ plasm to human germ

cells. Dev Genes Evol, 213(3):120–126.

Jenkins, H. T., Baker-Wilding, R., and Edwards, T. A. (2009). Structure and rna binding

of the mouse pumilio-2 puf domain. J Struct Biol, 167(3):271–276.

Johnston, D. S. (1995). The intracellular localization of messenger rnas. Cell, 81(2):161–

170.

Johnston, D. S., Brown, N. H., Gall, J. G., and Jantsch, M. (1992). A conserved double-

stranded rna-binding domain. Proc Natl Acad Sci U S A, 89(22):10979–10983.

Kanai, Y., Dohmae, N., and Hirokawa, N. (2004). Kinesin transports rna: isolation and

characterization of an rna-transporting granule. Neuron, 43(4):513–525. REFERENCES 71

Kaye, J. A., Rose, N. C., Goldsworthy, B., Goga, A., and L’Etoile, N. D. (2009). A 3’utr

pumilio-binding element directs translational activation in olfactory sensory neurons.

Neuron, 61(1):57–70.

Kedde, M., van Kouwenhove, M., Zwart, W., Vrielink, J. A. F. O., Elkon, R., and Agami,

R. (2010). A pumilio-induced rna structure switch in p27-3’ utr controls mir-221 and

mir-222 accessibility. Nat Cell Biol, 12(10):1014–1020.

Kiebler, M. A. and DesGroseillers, L. (2000). Molecular insights into mrna transport and

local translation in the mammalian nervous system. Neuron, 25:19–28.

Kim, S. Y., Kim, J. Y., Malik, S., Son, W., Kwon, K.-S., and Kim, C. (2012). Negative

regulation of egfr/mapk pathway by pumilio in drosophila melanogaster. PLoS One,

7(4):e34016.

Kindler, S., Wang, H., Richter, D., and Tiedge, H. (2005). Rna transport and local

control of translation. Annu Rev Cell Dev Biol, 21:223–245.

Koenig and Adams (1982). Local protein synthesizing activity in axonal ﬁelds regener-

ating In Vitro. Journal of Neurochemistry, 39:386–400.

Kuhl, D. and Skehel, P. (1998). Dendritic localization of mrnas. Curr Opin Neurobiol,

8(5):600–606.

Kurisaki, I., Iwai, T., Yamashita, M., Kobayashi, M., Ito, E., and Matsuoka, I. (2007).

Identiﬁcation and expression analysis of rainbow trout pumilio-1 and pumilio-2. Cell

Tissue Res, 327(1):33–42.

Lee, J. Y., Lim, J. M., Kim, D. K., Zheng, Y. H., Moon, S., Han, B. K., Song, K. D., Kim,

H., and Han, J. Y. (2008). Identiﬁcation and gene expression proﬁling of the pum1 and

pum2 members of the pumilio family in the chicken. Mol Reprod Dev, 75(1):184–190. REFERENCES 72

Lee, M.-H., Hook, B., Pan, G., Kershner, A. M., Merritt, C., Seydoux, G., Thomson,

J. A., Wickens, M., and Kimble, J. (2007). Conserved regulation of map kinase ex-

pression by puf rna-binding proteins. PLoS Genet, 3(12):e233.

Leibovich, L., Mandel-Gutfreund, Y., and Yakhini, Z. (2010). A structural-based sta-

tistical approach suggests a cooperative activity of pum1 and mir-410 in human 3’-

untranslated regions. Silence, 1(1):17.

Lilienbaum, A., Reszka, A. A., Horwitz, A. F., and Holt, C. E. (1995). Chimeric integrins

expressed in retinal ganglion cells impair process outgrowth in vivo. Mol Cell Neurosci,

6(2):139–152.

Lin, H. and Spradling, A. C. (1997). A novel group of pumilio mutations aﬀects the

asymmetric division of germline stem cells in the drosophila ovary. Development,

124(12):2463–2476.

Liu-Yesucevitz, L., Bassell, G. J., Gitler, A. D., Hart, A. C., Klann, E., Richter, J. D.,

Warren, S. T., and Wolozin, B. (2011). Local rna translation at the synapse and in

disease. J Neurosci, 31(45):16086–16093.

Lu, G. and Hall, T. M. T. (2011). Alternate modes of cognate rna recognition by human

pumilio proteins. Structure, 19(3):361–367.

Macdonald, P. M. (1992). The drosophila pumilio gene: an unusually long transcription

unit and an unusual protein. Development, 114(1):221–232.

Matsuda, S., Baluk, P., Shimizu, D., and Fujiwara, T. (1996). Dorsal root ganglion

neuron development in chick and rat. Anat Embryol (Berl), 193(5):475–480.

Mee, C. J., Pym, E. C. G., Moﬀat, K. G., and Baines, R. A. (2004). Regulation of

neuronal excitability through pumilio-dependent control of a sodium channel gene. J

Neurosci, 24(40):8695–8703. REFERENCES 73

Meiri, K. F., Saﬀell, J. L., Walsh, F. S., and Doherty, P. (1998). Neurite outgrowth stimu-

lated by neural cell adhesion molecules requires growth-associated protein-43 (gap-43)

function and is associated with gap-43 phosphorylation in growth cones. J Neurosci,

18(24):10429–10437.

Menon, K. P., Sanyal, S., Habara, Y., Sanchez, R., Wharton, R. P., Ramaswami, M., and

Zinn, K. (2004). The translational repressor pumilio regulates presynaptic morphology

and controls postsynaptic accumulation of translation factor eif-4e. Neuron, 44(4):663–

676.

Micklem, D. R. (1995). mrna localisation during development. Dev Biol, 172(2):377–395.

Miles, W. O., Tschp, K., Herr, A., Ji, J.-Y., and Dyson, N. J. (2012). Pumilio facilitates

mirna regulation of the e2f3 oncogene. Genes Dev, 26(4):356–368.

Moore, F. L., Jaruzelska, J., Fox, M. S., Urano, J., Firpo, M. T., Turek, P. J., Dorfman,

D. M., and Pera, R. A. R. (2003). Human pumilio-2 is expressed in embryonic stem cells

and germ cells and interacts with daz (deleted in azoospermia) and daz-like proteins.

Proc Natl Acad Sci U S A, 100(2):538–543.

Muraro, N. I., Weston, A. J., Gerber, A. P., Luschnig, S., Moﬀat, K. G., and Baines,

R. A. (2008). Pumilio binds para mrna and requires nanos and brat to regulate sodium

current in drosophila motoneurons. J Neurosci, 28(9):2099–2109.

Murata, Y. and Wharton, R. P. (1995). Binding of pumilio to maternal hunchback mrna

is required for posterior patterning in drosophila embryos. Cell, 80(5):747–756.

Nakahata, S., Katsu, Y., Mita, K., Inoue, K., Nagahama, Y., and Yamashita, M. (2001).

Biochemical identiﬁcation of xenopus pumilio as a sequence-speciﬁc cyclin b1 mrna-

binding protein that physically interacts with a nanos homolog, xcat-2, and a cyto-

plasmic polyadenylation element-binding protein. J Biol Chem, 276(24):20945–20953. REFERENCES 74

Olsen, M. K., Reszka, A. A., and Abraham, I. (1998). Kt5720 and u-98017 inhibit mapk

and alter the cytoskeleton and cell morphology. J Cell Physiol, 176(3):525–536.

Ota, R., Kotani, T., and Yamashita, M. (2011). Possible involvement of nemo-like kinase

1 in xenopus oocyte maturation as a kinase responsible for pumilio1, pumilio2, and

cpeb phosphorylation. Biochemistry, 50(25):5648–5659.

Padmanabhan, K. and Richter, J. D. (2006). Regulated pumilio-2 binding controls

ringo/spy mrna translation and cpeb activation. Genes Dev, 20(2):199–209.

Parisi, M. and Lin, H. (2000). Translational repression: a duet of nanos and pumilio.

Curr Biol, 10(2):R81–R83.

Piqué,M., López, J. M., Foissac, S., Guigó,R., and Méndez,R. (2008). A combinatorial

code for cpe-mediated translational control. Cell, 132(3):434–448.

Radford, H. E., Meijer, H. A., and de Moor, C. H. (2008). Translational control by

cytoplasmic polyadenylation in xenopus oocytes. Biochim Biophys Acta, 1779(4):217–

229.

Raji, B., Dansault, A., Leemput, J., de la Houssaye, G., Vieira, V., Kobetz, A., Arbogast,

L., Masson, C., Menasche, M., and Abitbol, M. (2007). The rna-binding protein

musashi-1 is produced in the developing and adult mouse eye. Mol Vis, 13:1412–1427.

Richter, J. D. and Theurkauf, W. E. (2001). Development. the message is in the trans-

lation. Science, 293(5527):60–62.

Sano, H., Mukai, M., and Kobayashi, S. (2001). Maternal nanos and pumilio regu-

late zygotic vasa expression autonomously in the germ-line progenitors of drosophila

melanogaster embryos. Dev Growth Diﬀer, 43(5):545–552.

Sasaki, Y., Welshhans, K., Wen, Z., Yao, J., Xu, M., Goshima, Y., Zheng, J. Q., and

Bassell, G. J. (2010). Phosphorylation of zipcode binding protein 1 is required for REFERENCES 75

brain-derived neurotrophic factor signaling of local beta-actin synthesis and growth

cone turning. J Neurosci, 30(28):9349–9358.

Scheper, G. C., van Kollenburg, B., Hu, J., Luo, Y., Goss, D. J., and Proud, C. G.

(2002). Phosphorylation of eukaryotic initiation factor 4e markedly reduces its aﬃnity

for capped mrna. J Biol Chem, 277(5):3303–3309.

Schmid, R. S. and Maness, P. F. (2008). L1 and ncam adhesion molecules as signal-

ing coreceptors in neuronal migration and process outgrowth. Curr Opin Neurobiol,

18(3):245–250.

Schweers, B. A., Walters, K. J., and Stern, M. (2002). The drosophila melanogaster

translational repressor pumilio regulates neuronal excitability. Genetics, 161(3):1177–

1185.

Shigunov, P., Sotelo-Silveira, J., Kuligovski, C., de Aguiar, A. M., Rebelatto, C. K.,

Moutinho, J. A., Brofman, P. S., Krieger, M. A., Goldenberg, S., Munroe, D., Correa,

A., and Dallagiovanna, B. (2011). Pumilio-2 is involved in the positive regulation of

cellular proliferation in human adipose-derived stem cells. Stem Cells Dev.

Siddall, N. A., McLaughlin, E. A., Marriner, N. L., and Hime, G. R. (2006). The rna-

binding protein musashi is required intrinsically to maintain stem cell identity. Proc

Natl Acad Sci U S A, 103(22):8402–8407.

Siemen, H., Colas, D., Heller, H. C., Brstle, O., and Pera, R. A. R. (2011). Pumilio-2

function in the mouse nervous system. PLoS One, 6(10):e25932.

Sonenberg, N. and Dever, T. E. (2003). Eukaryotic translation initiation factors and

regulators. Curr Opin Struct Biol, 13(1):56–63.

Sonenberg, N. and Hinnebusch, A. G. (2009). Regulation of translation initiation in

eukaryotes: mechanisms and biological targets. Cell, 136(4):731–745. REFERENCES 76

Sonoda, J. and Wharton, R. P. (1999). Recruitment of nanos to hunchback mrna by

pumilio. Genes Dev, 13(20):2704–2712.

Sonoda, J. and Wharton, R. P. (2001). Drosophila brain tumor is a translational repres-

sor. Genes Dev, 15(6):762–773.

Spassov, D. S. and Jurecic, R. (2002). Cloning and comparative sequence analysis of

pum1 and pum2 genes, human members of the pumilio family of rna-binding proteins.

Gene, 299(1-2):195–204.

Spassov, D. S. and Jurecic, R. (2003). Mouse pum1 and pum2 genes, members of the

pumilio family of rna-binding proteins, show diﬀerential expression in fetal and adult

hematopoietic stem cells and progenitors. Blood Cells Mol Dis, 30(1):55–69.

Spik, A., Oczkowski, S., Olszak, A., Formanowicz, P., Bazewicz, J., and Jaruzelska, J.

(2006). Human fertility protein pumilio2 interacts in vitro with testis mrna encoding

cdc42 eﬀector 3 (cep3). Reprod Biol, 6(2):103–113.

Strittmatter, S. M., Fankhauser, C., Huang, P. L., Mashimo, H., and Fishman, M. C.

(1995). Neuronal pathﬁnding is abnormal in mice lacking the neuronal growth cone

protein gap-43. Cell, 80(3):445–452.

Szymczak, A. L., Workman, C. J., Wang, Y., Vignali, K. M., Dilioglou, S., Vanin, E. F.,

and Vignali, D. A. A. (2004). Correction of multi-gene deﬁciency in vivo using a single

’self-cleaving’ 2a peptide-based retroviral vector. Nat Biotechnol, 22(5):589–594.

Tanaka, E., Ho, T., and Kirschner, M. W. (1995). The role of microtubule dynamics in

growth cone motility and axonal growth. J Cell Biol, 128(1-2):139–155.

Tang, S. J., Meulemans, D., Vazquez, L., Colaco, N., and Schuman, E. (2001). A role

for a rat homolog of staufen in the transport of rna to neuronal dendrites. Neuron,

32(3):463–475. REFERENCES 77

Tassew, N. G., Chestopolava, L., Beecroft, R., Matsunaga, E., Teng, H., Chedotal, A.,

and Monnier, P. P. (2008). Intraretinal rgma is involved in retino-tectal mapping. Mol

Cell Neurosci, 37(4):761–769.

Tedeschi, A. and Giovanni, S. D. (2009). The non-apoptotic role of p53 in neuronal

biology: enlightening the dark side of the moon. EMBO Rep, 10(6):576–583.

Tobias, G. S. and Koenig, E. (1975). Axonal protein synthesizing activity during the

early outgrowth period following neurotomy. Exp Neurol, 49(1 Pt 1):221–234.

Triboulet, R. and Gregory, R. I. (2010). Pumilio turns on microrna function. Nat Cell

Biol, 12(10):928–929.

Vessey, J. P., Schoderboeck, L., Gingl, E., Luzi, E., Rieﬂer, J., Leva, F. D., Karra, D.,

Thomas, S., Kiebler, M. A., and Macchi, P. (2010). Mammalian pumilio 2 regulates

dendrite morphogenesis and synaptic function. Proc Natl Acad Sci U S A, 107(7):3222–

3227.

Vessey, J. P., Vaccani, A., Xie, Y., Dahm, R., Karra, D., Kiebler, M. A., and Mac-

chi, P. (2006). Dendritic localization of the translational repressor pumilio 2 and its

contribution to dendritic stress granules. J Neurosci, 26(24):6496–6508.

Walser, C. B., Battu, G., Hoier, E. F., and Hajnal, A. (2006). Distinct roles of the pumilio

and fbf translational repressors during c. elegans vulval development. Development,

133(17):3461–3471.

Wang, H. N., Xu, Y., Tao, L. J., Zhou, J., Qiu, M. X., Teng, Y. H., and Deng, F. J. (2011).

Identiﬁcation and characterization of the pumilio-2 expressed in zebraﬁsh embryos and

adult tissues. Mol Biol Rep.

Wang, X., McLachlan, J., Zamore, P. D., and Hall, T. M. T. (2002). Modular recognition

of rna by a human pumilio-homology domain. Cell, 110(4):501–512. REFERENCES 78

Weidmann, C. and Goldstrohm, A. C. (2011). Drosophila pumilio protein contains mul-

tiple autonomous repression domains that regulate mrnas independently of nanos and

brain tumor. Mol Cell Biol.

Wharton, R. P., Sonoda, J., Lee, T., Patterson, M., and Murata, Y. (1998). The pumilio

rna-binding domain is also a translational regulator. Mol Cell, 1(6):863–872.

Wilhelm, J. E. and Vale, R. D. (1993). Rna on the move: the mrna localization pathway.

J Cell Biol, 123(2):269–274.

Willis, D., Li, K. W., Zheng, J.-Q., Chang, J. H., Smit, A. B., Smit, A., Kelly, T.,

Merianda, T. T., Sylvester, J., van Minnen, J., and Twiss, J. L. (2005). Diﬀerential

transport and local translation of cytoskeletal, injury-response, and neurodegeneration

protein mrnas in axons. J Neurosci, 25(4):778–791.

Wreden, C., Verrotti, A. C., Schisa, J. A., Lieberfarb, M. E., and Strickland, S. (1997).

Nanos and pumilio establish embryonic polarity in drosophila by promoting posterior

deadenylation of hunchback mrna. Development, 124(15):3015–3023.

Ye, B., Petritsch, C., Clark, I. E., Gavis, E. R., Jan, L. Y., and Jan, Y. N. (2004). Nanos

and pumilio are essential for dendrite morphogenesis in drosophila peripheral neurons.

Curr Biol, 14(4):314–321.

Yoshimura, H., Inaguma, A., Yamada, T., and Ozawa, T. (2012). Fluorescent probes

for imaging endogenous -actin mrna in living cells using ﬂuorescent protein-tagged

pumilio. ACS Chem Biol.

Zamore, P. D., Williamson, J. R., and Lehmann, R. (1997). The pumilio protein binds

rna through a conserved domain that deﬁnes a new class of rna-binding proteins. RNA,

3(12):1421–1433. REFERENCES 79

Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J., and Wickens, M. P.

(1997). A conserved rna-binding protein that regulates sexual fates in the c. elegans

hermaphrodite germ line. Nature, 390(6659):477–484.

Zhao, H., Cui, J., Wang, Y., Liu, X., Zhao, D., and Duan, J. (2012). Spatial-temporal

expression of pum1 and pum2 in medaka oryzias latipes. J Fish Biol, 80(1):100–109.

Zhong, J., Zhang, T., and Bloch, L. M. (2006). Dendritic mrnas encode diversiﬁed

functionalities in hippocampal pyramidal neurons. BMC Neurosci, 7:17.