Profiling Data
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin-Dependent Kinase 2 and AKT Inhibition
Published OnlineFirst September 23, 2016; DOI: 10.1158/1078-0432.CCR-16-0620 Biology of Human Tumors Clinical Cancer Research Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin- Dependent Kinase 2 and AKT Inhibition George Au-Yeung1,2, Franziska Lang1, Walid J. Azar1, Chris Mitchell1, Kate E. Jarman3, Kurt Lackovic3,4, Diar Aziz5, Carleen Cullinane1,6, Richard B. Pearson1,2,7, Linda Mileshkin2,8, Danny Rischin2,8, Alison M. Karst9, Ronny Drapkin10, Dariush Etemadmoghadam1,2,5, and David D.L. Bowtell1,2,7,11 Abstract Purpose: Cyclin E1 (CCNE1) amplification is associated with Results: We validate CDK2 as a therapeutic target by demon- primary treatment resistance and poor outcome in high-grade strating selective sensitivity to gene suppression. However, we found serous ovarian cancer (HGSC). Here, we explore approaches to that dinaciclib did not trigger amplicon-dependent sensitivity in a target CCNE1-amplified cancers and potential strategies to over- panel of HGSC cell lines. A high-throughput compound screen come resistance to targeted agents. identified synergistic combinations in CCNE1-amplified HGSC, Experimental Design: To examine dependency on CDK2 in including dinaciclib and AKT inhibitors. Analysis of genomic data CCNE1-amplified HGSC, we utilized siRNA and conditional from TCGA demonstrated coamplification of CCNE1 and AKT2. shRNA gene suppression, and chemical inhibition using dina- Overexpression of Cyclin E1 and AKT isoforms, in addition to ciclib, a small-molecule CDK2 inhibitor. High-throughput mutant TP53, imparted malignant characteristics in untransformed compound screening was used to identify selective synergistic fallopian tube secretory cells, the dominant site of origin of HGSC. -
Evolution, Expression and Meiotic Behavior of Genes Involved in Chromosome Segregation of Monotremes
G C A T T A C G G C A T genes Article Evolution, Expression and Meiotic Behavior of Genes Involved in Chromosome Segregation of Monotremes Filip Pajpach , Linda Shearwin-Whyatt and Frank Grützner * School of Biological Sciences, The University of Adelaide, Adelaide, SA 5005, Australia; fi[email protected] (F.P.); [email protected] (L.S.-W.) * Correspondence: [email protected] Abstract: Chromosome segregation at mitosis and meiosis is a highly dynamic and tightly regulated process that involves a large number of components. Due to the fundamental nature of chromosome segregation, many genes involved in this process are evolutionarily highly conserved, but duplica- tions and functional diversification has occurred in various lineages. In order to better understand the evolution of genes involved in chromosome segregation in mammals, we analyzed some of the key components in the basal mammalian lineage of egg-laying mammals. The chromosome passenger complex is a multiprotein complex central to chromosome segregation during both mitosis and meio- sis. It consists of survivin, borealin, inner centromere protein, and Aurora kinase B or C. We confirm the absence of Aurora kinase C in marsupials and show its absence in both platypus and echidna, which supports the current model of the evolution of Aurora kinases. High expression of AURKBC, an ancestor of AURKB and AURKC present in monotremes, suggests that this gene is performing all necessary meiotic functions in monotremes. Other genes of the chromosome passenger complex complex are present and conserved in monotremes, suggesting that their function has been preserved Citation: Pajpach, F.; in mammals. -
Funkce CDK12 a CDK13 V Regulaci Transkripce Hana Paculová
MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV BIOCHEMIE Funkce CDK12 a CDK13 v regulaci transkripce Disertační práce Hana Paculová Školitel: Mgr. Jiří Kohoutek, Ph.D Brno 2018 Bibliogra cký záznam Autorka: Mgr. Hana Paculová Prrodovedecáá aaául,a鏈 Maaarkáova unvverv,a Úa,av bvochemve Název práce: Funáce CDK12 a CDK13 v regulacv ,ranaárvpce Studijní program: Bvochemve Studijní obor: Bvochemve Školitel: Mgr. Jvr Kohou,eá鏈 Ph.D Akademický rok: 2017/2018 Po et stran: 89 Klí ová slova: Ckálvn-dependen,n ávnaaa鏈 CDK12鏈 ,ranaárvpce鏈 RNA polkmeraaa II鏈 raáovvna vaječnáů鏈 CHK1 Bibliographic entry Author: Mgr. Hana Paculová Facul,k oa acvence鏈 Maaarká unvverav,k Department of Biochemistry Title oF dissertation: CDK12 and CDK13 aunc,von vn ,ranacrvp,von regula,von Degree programme: Bvochemva,rk Field oF study: Bvochemva,rk Supervisor: Mgr. Jvr Kohou,eá鏈 Ph.D Academic year: 2017/2018 Number oF pages: 89 Keywords: Ckclvn-dependen ávnaae鏈 CDK12鏈 ,ranacrvp,von鏈 RNA polkmeraae II鏈 ovarvan cancer鏈 CHK1 Abstrakt Ckálvn-dependen,n ávnaaa 12 (CDK12) je ,ranaárvpčn ávnaaa鏈 á,erá rd expreav avých clových genů ,m鏈 že aoaaorkluje RNA polkmeraau II v průbehu elongačn aáe ,ranaárvpce. CDK12 je apojena do neáolváa bunečných preceaů鏈 což ahrnuje odpoveď na pošáoen DNA鏈 vývoj a bunečnou dvaerencvacv a aea,rvh mRNA. CDK12 bkla popaána jaáo jeden genů鏈 á,eré jaou čaa,o mu,ovánk v hvgh-grade aerónm ovarválnm áarcvnomu鏈 nvcméne vlvv ,ech,o mu,ac na aunácv CDK12 a jejvch role v áarcvnogenev dopoaud nebkla a,anovena. Zjva,vlv jame鏈 že ve,švna mu,ac CDK12鏈 á,eré bklk naleenk v nádorech鏈 brán vk,voren áomplexu CDK12 a Ckálvnem K a vnhvbuj ávnaaovou aá,vvv,u CDK12. -
Supplementary Information Material and Methods
MCT-11-0474 BKM120: a potent and specific pan-PI3K inhibitor Supplementary Information Material and methods Chemicals The EGFR inhibitor NVP-AEE788 (Novartis), the Jak inhibitor I (Merck Calbiochem, #420099) and anisomycin (Alomone labs, # A-520) were prepared as 50 mM stock solutions in 100% DMSO. Doxorubicin (Adriablastin, Pfizer), EGF (Sigma Ref: E9644), PDGF (Sigma, Ref: P4306) and IL-4 (Sigma, Ref: I-4269) stock solutions were prepared as recommended by the manufacturer. For in vivo administration: Temodal (20 mg Temozolomide capsules, Essex Chemie AG, Luzern) was dissolved in 4 mL KZI/glucose (20/80, vol/vol); Taxotere was bought as 40 mg/mL solution (Sanofi Aventis, France), and prepared in KZI/glucose. Antibodies The primary antibodies used were as follows: anti-S473P-Akt (#9271), anti-T308P-Akt (#9276,), anti-S9P-GSK3β (#9336), anti-T389P-p70S6K (#9205), anti-YP/TP-Erk1/2 (#9101), anti-YP/TP-p38 (#9215), anti-YP/TP-JNK1/2 (#9101), anti-Y751P-PDGFR (#3161), anti- p21Cip1/Waf1 (#2946), anti-p27Kip1 (#2552) and anti-Ser15-p53 (#9284) antibodies were from Cell Signaling Technologies; anti-Akt (#05-591), anti-T32P-FKHRL1 (#06-952) and anti- PDGFR (#06-495) antibodies were from Upstate; anti-IGF-1R (#SC-713) and anti-EGFR (#SC-03) antibodies were from Santa Cruz; anti-GSK3α/β (#44610), anti-Y641P-Stat6 (#611566), anti-S1981P-ATM (#200-301), anti-T2609 DNA-PKcs (#GTX24194) and anti- 1 MCT-11-0474 BKM120: a potent and specific pan-PI3K inhibitor Y1316P-IGF-1R were from Bio-Source International, Becton-Dickinson, Rockland, GenTex and internal production, respectively. The 4G10 antibody was from Millipore (#05-321MG). -
Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer
Advancing a clinically relevant perspective of the clonal nature of cancer Christian Ruiza,b, Elizabeth Lenkiewicza, Lisa Eversa, Tara Holleya, Alex Robesona, Jeffrey Kieferc, Michael J. Demeurea,d, Michael A. Hollingsworthe, Michael Shenf, Donna Prunkardf, Peter S. Rabinovitchf, Tobias Zellwegerg, Spyro Moussesc, Jeffrey M. Trenta,h, John D. Carpteni, Lukas Bubendorfb, Daniel Von Hoffa,d, and Michael T. Barretta,1 aClinical Translational Research Division, Translational Genomics Research Institute, Scottsdale, AZ 85259; bInstitute for Pathology, University Hospital Basel, University of Basel, 4031 Basel, Switzerland; cGenetic Basis of Human Disease, Translational Genomics Research Institute, Phoenix, AZ 85004; dVirginia G. Piper Cancer Center, Scottsdale Healthcare, Scottsdale, AZ 85258; eEppley Institute for Research in Cancer and Allied Diseases, Nebraska Medical Center, Omaha, NE 68198; fDepartment of Pathology, University of Washington, Seattle, WA 98105; gDivision of Urology, St. Claraspital and University of Basel, 4058 Basel, Switzerland; hVan Andel Research Institute, Grand Rapids, MI 49503; and iIntegrated Cancer Genomics Division, Translational Genomics Research Institute, Phoenix, AZ 85004 Edited* by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved June 10, 2011 (received for review March 11, 2011) Cancers frequently arise as a result of an acquired genomic insta- on the basis of morphology alone (8). Thus, the application of bility and the subsequent clonal evolution of neoplastic cells with purification methods such as laser capture microdissection does variable patterns of genetic aberrations. Thus, the presence and not resolve the complexities of many samples. A second approach behaviors of distinct clonal populations in each patient’s tumor is to passage tumor biopsies in tissue culture or in xenografts (4, 9– may underlie multiple clinical phenotypes in cancers. -
Human Kinome Profiling Identifies a Requirement for AMP-Activated
Human kinome profiling identifies a requirement for AMP-activated protein kinase during human cytomegalovirus infection Laura J. Terrya, Livia Vastagb,1, Joshua D. Rabinowitzb, and Thomas Shenka,2 aDepartment of Molecular Biology and bDepartment of Chemistry and the Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544 Contributed by Thomas Shenk, January 11, 2012 (sent for review December 29, 2011) Human cytomegalovirus (HCMV) modulates numerous cellular (7). Thus, the connections between AMPK activity and metabolic signaling pathways. Alterations in signaling are evident from the changes during HCMV infection have remained unclear. broad changes in cellular phosphorylation that occur during HCMV We confirmed the requirement for AMPK during infection, infection and from the altered activity of multiple kinases. Here we and we show that an AMPK antagonist, compound C, blocks report a comprehensive RNAi screen, which predicts that 106 cellular HCMV-induced changes to glycolysis and inhibits viral gene kinases influence growth of the virus, most of which were not expression. These studies argue that AMPK or a related, com- previously linked to HCMV replication. Multiple elements of the pound C-sensitive kinase is an essential contributor to metabolic AMP-activated protein kinase (AMPK) pathway scored in the screen. changes initiated by HCMV and provide unique insight into As a regulator of carbon and nucleotide metabolism, AMPK is poised potential antiviral strategies. to activate many of the metabolic pathways induced by HCMV infection. An AMPK inhibitor, compound C, blocked a substantial Results portion of HCMV-induced metabolic changes, inhibited the accumu- HumanKinomeScreenIdentifies Putative Effectors of HCMV Replication. lation of all HCMV proteins tested, and markedly reduced the We conducted an siRNA screen of the human kinome to perform an production of infectious progeny. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
Kinase Profiling Book
Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28