US0094.87764B2
(12) United States Patent (10) Patent No.: US 9.487,764 B2 Fab et al. (45) Date of Patent: Nov. 8, 2016
(54) BACTERIA ENGINEERED TO TREAT (56) References Cited DISEASES ASSOCATED WITH HYPERAMMONEMA U.S. PATENT DOCUMENTS 5,589,168 A 12/1996 Allen et al. (71) Applicant: Synlogic, Inc., Cambridge, MA (US) 5,989,463 A 11/1999 Tracy et al. 6,203,797 B1 3/2001 Perry 6,835,376 B1 12/2004 Neeser et al. (72) Inventors: Dean Falb, Sherborn, MA (US); 7,731,976 B2 6, 2010 Cobb et al. Vincent M. Isabella, Cambridge, MA 2003. O166191 A1 9, 2003 Gardner et al. (US); Jonathan W. Kotula, Somerville, 2016,0177274 A1* 6, 2016 Fab ...... C12R 1/19 MA (US); Paul F. Miller, Salem, CT 424.93.2 (US) OTHER PUBLICATIONS Assignee: Synlogic, Inc., Cambridge, MA (US) (73) Alifano et al. Histidine biosynthetic pathway and genes: structure, regulation, and evolution. Microbiol Rev. Mar. 1996:60(1):44-69. (*) Notice: Subject to any disclaimer, the term of this Altenhoefer et al. The probiotic Escherichia coli strain Nissle 1917 patent is extended or adjusted under 35 interferes with invasion of human intestinal epithelial cells by U.S.C. 154(b) by 0 days. different enteroinvasive bacterial pathogens. FEMS Immunol Med Microbiol. Apr. 9, 2004:40(3):223-9. (21) Appl. No.: 14/960,333 Andersen et al. Uracil uptake in Escherichia coli K-12: isolation of uraA mutants and cloning of the gene. J Bacteriol. Apr. (22) Filed: Dec. 4, 2015 1995; 177(8): 2008-13. Arthur et al. Intestinal inflammation targets cancer-inducing activity of the microbiota. Science. Oct. 5, 2012:338(6103): 120-3. NIH (65) Prior Publication Data Public Access Author Manuscript; available in PMC May 6, 2013 US 2016/O177274 A1 Jun. 23, 2016 (11 pages). Aoyagi et al. Gastrointestinal urease in man. Activity of mucosal urease. Gut. Dec. 1966;7(6):631-5. Arai et al. Expression of the nir and nor genes for denitrification of Related U.S. Application Data Pseudomonas aeruginosa requires a novel CRPFNR-related tran (60) Provisional application No. 62/087,854, filed on Dec. scriptional regulator, DNR, in addition to ANR. FEBS Lett. Aug. 28, 5, 2014, provisional application No. 62/173,706, filed 1995:371(1): 73-6. Caldara et al. The arginine regulon of Escherichia coli: whole on Jun. 10, 2015, provisional application No. system transcriptome analysis discovers new genes and provides an 62/256,041, filed on Nov. 16, 2015, provisional integrated view of arginine regulation. Microbiology. Nov. application No. 62/103.513, filed on Jan. 14, 2015, 2006;152(Pt. 11):3343-54. provisional application No. 62/150,508, filed on Apr. Caldara et al. Arginine biosynthesis in Escherichia coli: experimen 21, 2015, provisional application No. 62/173,710, tal perturbation and mathematical modeling. J Biol Chem. Mar. 7, filed on Jun. 10, 2015, provisional application No. 2008:283(10):6347-58. 62/256,039, filed on Nov. 16, 2015, provisional Caldovic et al. N-acetylglutamate synthase: structure, function and application No. 62/184.811, filed on Jun. 25, 2015, defects. Mol Genet Metab. 2010; 100 Suppl 1:S13-9. NIH Public provisional application No. 62/183,935, filed on Jun. Access Author Manuscript; available in PMC Feb. 26, 2011 (16 pages). 24, 2015, provisional application No. 62/263.329, Callura et al. Tracking, tuning, and terminating microbial physiol filed on Dec. 4, 2015. ogy using synthetic riboregulators. Proc Natl AcadSci U S A. Sep. 7, 2010; 107(36): 15898-903. (51) Int. C. Castiglione et al. The transcription factor DNR from Pseudomonas AOIN 63/00 (2006.01) aeruginosa specifically requires nitric oxide and haem for the CI2N L/20 (2006.01) activation of a target promoter in Escherichia coli. Microbiology. CI2N 9/10 (2006.01) Sep. 2009; 155(Pt 9): 2838-44. CI2R L/19 (2006.01) (Continued) CI2N 15/52 (2006.01) CI2N 15/70 (2006.01) CI2P I3/10 (2006.01) Primary Examiner — Michael Burkhart CI2R I/OI (2006.01) (74) Attorney, Agent, or Firm — Finnegan, Henderson, A6 IK 35/74 (2015.01) Farabow, Garrett & Dunner, LLP (52) U.S. C. CPC ...... CI2N 9/1029 (2013.01); A61K 35/741 (2013.01); C12N 9/1025 (2013.01); CI2N (57) ABSTRACT 15/52 (2013.01); C12N 15/70 (2013.01); C12P Genetically engineered bacteria, pharmaceutical composi 13/10 (2013.01): CI2R I/01 (2013.01); CI2R tions thereof, and methods of modulating and treating dis 1/19 (2013.01); C12Y 203/01001 (2013.01) orders associated with hyperammonemia are disclosed. (58) Field of Classification Search None See application file for complete search history. 18 Claims, 75 Drawing Sheets US 9.487,764 B2 Page 2
(56) References Cited Hasegawa et al. Activation of a consensus FNR-dependent promoter by DNR of Pseudomonas aeruginosa in response to nitrite. FEMS Microbiol Lett. Sep. 15, 1998; 166(2):213-7. OTHER PUBLICATIONS Hodges et al. The sp?' mouse: A missense mutation in the ornithine transcarbamylase gene also causes aberrant mRNA splicing. Proc Charlier et al. Arginine regulon of Escherichia coli K-12. A study Natl AcadSci U S A. Jun. 1989;86(11):4142-6. of repressor-operator interactions and of in vitro binding affinities Hoeren et al. Sequence and expression of the gene encoding the versus in vivo repression. J Mol Biol. Jul. 20, 1992:226(2):367-86. respiratory nitrous-oxide reductase from Paracoccus denitrificans. Clarkson et al. Diaminopimelic Acid and Lysine Auxotrophs of Eur, J Biochem. Nov. 15, 1993:218(1):49-57. Pseudomonas aeruginosa 8602. J. Gen. Microbiol. 1971:66:161-9. Hoffmann and Kölker. Defects in amino acid catabolism and the urea cycle. Handbk Clin Neurol. 2013; 113:1755-73. Crabeel et al. Characterization of the Saccharomyces cerevisiae Hosseini et al. Propionate as a health-promoting microbial metabo ARG7 gene encoding ornithine acetyltransferase, an enzyme also lite in the human gut. Nutr Rev. May 2011;69(5):245-58. endowed with acetylglutamate synthase activity. Eur J Biochem. Isabella et al. Deep sequencing-based analysis of the anaerobic Dec. 1, 1997:250(2): 232-41. stimulon in Neisseria gonorrhoeae. BMC Genomics. Jan. 20, Cuevas-Ramos et al. Escherichia coli induces DNA damage in vivo 2011:12:51 (24 pages). and triggers genomic instability in mammalian cells. Proc Natl Acad Konieczna et al. Bacterial urease and its role in long-lasting human Sci U S A. Jun. 22, 2010; 107(25): 11537-42. diseases. Curr Protein Pept Sci. Dec. 2012:13(8):789-806. Cunin et al. Molecular basis for modulated regulation of gene Lazier et al. Hyperammonemic encephalopathy in an expression in the arginine regulon of Escherichia coli K-12. Nucleic adenocarcinoma patient managed with carglumic acid. Curr Oncol. Acids Res. Aug. 11, 1983; 11(15):5007-19. Oct. 2014:21(5):e736-9. Cunin et al. Biosynthesis and metabolism of arginine in bacteria. Leonard. Disorders of the urea cycle and related enzymes. Inborn Microbiol Rev. Sep. 1986:50(3):314-52. Erratum in: Microbiol Rev. Metabolic Diseases, 4th ed Heidelberg: Springer Medizin Verlag, Mar. 1987:51(1):178. 2006; pp. 263-72. Deignan et al. Contrasting features of urea cycle disorders in human Lim et al. Nucleotide sequence of the argR gene of Escherichia coli patients. Mol Genet Metab. Jan. 2008:93(1): 7-14. NIH Public K-12 and isolation of its product, the arginine repressor. Proc Natl Access Author Manuscript; available in PMC Jun. 8, 2009 (13 AcadSci U S A. Oct. 1987:84(19):6697-701. pages). Liu et al. Methanococci use the diaminopimelate aminotransferase Deutscher. The mechanisms of carbon catabolite repression in (DapL) pathway for lysine biosynthesis. J Bacteriol. Jul. 2010; 192(13):3304-10. bacteria. Curr Opin Microbiol. Apr. 2008; 11(2): 87-93. Lodeiro et al. Robustness in Escherichia coli glutamate and gluta Diaz et al. Ammonia control and neurocognitive outcome among mine synthesis studied by a kinetic model. J Biol Phys. Apr. 2008; urea cycle disorder patients treated with glycerol phenylbutyrate. 34(1-2):91-106. Hepatology. Jun. 2013:57(6):217 1-9. Lopez and Anderson. Synthetic Auxotrophs with Ligand-Dependent Dinleyici et al. Saccharomyces boulardii CNCM 1-745 in different Essential Genes for a BL21 (DE3) Biosafety Strain. ACS Synthetic clinical conditions. Expert Opin Biol Ther. Nov. 2014;14(11): 1593 Biology. Dec. 2015;4(12): 1279-86. 609. Makarova et al. Conservation of the binding site for the arginine Dogovski et al. Enzymology of Bacterial Lysine Biosynthesis. repressor in all bacterial lineages. Genome Biol. Chapter 9 in Biochemistry. Prof. Deniz Ekinci (Ed.), InTech, Mar. 2001:2(4):research00 13.1-0013.8. 2012: pp. 225-262. ISBN: 978-953-51-0076-8. online Retrieved Maas et al. Studies on the mechanism of repression of arginine from: http://www.intechopen.com/books/biochemistry/enzymol biosynthesis in Escherichia coli. II. Dominance of repressibility in ogy-of-bacterial-lysine-biosynthesis (39 pages). diploids. J Mol Biol. Mar. 1964;8:365-70. Doolittle et al. A new allele of the sparse fur gene in the mouse. J Maas, W.K. The arginine repressor of Escherichia coli. Microbiol Hered. May-Jun. 1974:65(3):194-5. Rev. Dec. 1994:58(4):631-40. Eckhardt and Leisinger. Isolation and characterization of mutants Meadow et al. Interrelationships between lysine and alpha epsilon with a feedback resistant N-acetylglutamate synthase in Escherichia diaminopimelic acid and their derivatives and analogues in mutants coli K12. Mol Gen Genet. Jun. 19, 1975; 138(3):225-32. of Escherichia coli. Biochem J. Jun. 1957;66(2):270-82. Eiglmeier et al. Molecular genetic analysis of FNR-dependent Meng et al. Nucleotide sequence of the Escherichia coli cad operon: promoters. Mol Microbiol. Jul. 1989:3(7):869-78. a system for neutralization of low extracellular pH.J Bacteriol. Apr. Feng et al. Role of phosphorylated metabolic intermediates in the 1992; 174(8): 2659-69. regulation of glutamine synthetase synthesis in Escherichia coli. J Moore et al. Regulation of FNR dimerization by subunit charge Bacteriol. Oct. 1992; 174(19):6061-70. repulsion. J Biol Chem. Nov. 3, 2006:281 (44):33268-75. Fraga et al. Real-Time PCR. Current Protocols Essential Labora Mountain et al. Cloning of a Bacillus subtilis restriction fragment tory Techniques. John Wiley & Sons, Inc., 2008; Unit 10.3, pp. 1-33. complementing auxotrophic mutants of eight Escherichia coli genes Galimand et al. Positive FNR-like control of anaerobic arginine of arginine biosynthesis. Mol Gen Genet. 1984; 197(1):82-9. degradation and nitrate respiration in Pseudomonas aeruginosa. J Nagamani et al. Optimizing therapy for argininosuccinic aciduria. Bacteriol. Mar. 1991; 173(5):1598-606. Mol Genet Metab. Sep. 2012; 107(1-2):10-14. NIH Public Access Gamper et al. Anaerobic regulation of transcription initiation in the Author Manuscript; available in PMC Sep. 1, 2013 (12 pages). arcDABC operon of Pseudomonas aeruginosa. J Bacteriol. Aug. Nicaise et al. Control of acute, chronic, and constitutive hyperam 1991; 173(15):4742-50. monemia by wild-type and genetically engineered Lactobacillus Gardner et al. Construction of a genetic toggle Switch in Escherichia plantarum in rodents. Hepatology. Oct. 2008:48(4): 1184-92. coli. Nature. 2000:403:339-42. Nicoloff et al. Two arginine repressors regulate arginine biosynthe Gerdes et al. Essential genes on metabolic maps. Curr. Opin. sis in Lactobacillus plantarum. J Bacteriol. Sep. Biotechnol., Oct. 2006:17(5):448-56. 2004; 186(18):6059-69. Görke and Stilke. Carbon catabolite repression in bacteria: many Nougayrede et al. Escherichia coli induces DNA double-strand ways to make the most out of nutrients. Nat Rey Microbiol. Aug. breaks in eukaryotic cells. Science. Aug. 11, 2006:313(5788):848 2008;6(8):613-24. 51. Haberle et al. Suggested guidelines for the diagnosis and manage Olier et al. Genotoxicity of Escherichia coli Nissle 1917 strain ment of urea cycle disorders. Orphanet J Rare Dis. May 29, cannot be dissociated from its probiotic activity. Gut Microbes. 2012:7:32 (30 pages). Nov.-Dec. 2012:3(6):501-9. Haberle, J. Clinical and biochemical aspects of primary and Sec Pham et al. Multiple myeloma-induced hyperammonemic encepha ondary hyperammonemic disorders. Arch Biochem Biophys. Aug. lopathy: An entity associated with high in-patient mortality. Leuk 15, 2013:536(2):101-8. Res. Oct. 2013:37(10): 1229-32. US 9.487,764 B2 Page 3
(56) References Cited Szwajkajzer et al. Quantitative analysis of DNA binding by the Escherichia coli arginine repressor, J Mol Biol. Oct. 5, OTHER PUBLICATIONS 2001:312(5):949-62. Tian et al. Binding of the arginine repressor of Escherichia coli K12 Purcell et al. Rule-Based Design of Synthetic Transcription Factors to its operator sites. J Mol Biol. Jul. 20, 1992:226(2):387-97. in Eukaryotes. ACS Synthetic Biology. 2014:3(10):737-744; online Tian et al. Explanation for different types of regulation of arginine publication date Dec. 12, 2013. Rajagopal et al. Use of inducible feedback-resistant biosynthesis in Escherichia coli B and Escherichia coli K12 caused N-acetylglutamate synthetase (argA) genes for enhanced arginine by a difference between their arginine repressors. J Mol Biol. Jan. biosynthesis by genetically engineered Escherichia coli K-12 7, 1994;235(1):221-30. strains. Appl Environ Microbiol. May 1998:64(5): 1805-11. Torres-Vega et al. Delivery of glutamine synthetase gene by Ray et al. The effects of mutation of the anr gene on the aerobic baculovirus vectors: a proof of concept for the treatment of acute respiratory chain of Pseudomonas aeruginosa. FEMS Microbiol hyperammonemia. Gene Ther. Oct. 23, 2014:22(1):58-64. Lett. Nov. 15, 1997; 156(2):227-32. Trunk et al. Anaerobic adaptation in Pseudomonas aeruginosa: Reboul et al. Structural and dynamic requirements for optimal definition of the Anr and Dnr regulons. Environ Microbiol. Jun. activity of the essential bacterial enzyme dihydrodipicolinate 2010; 12(6):1719-33. synthase. PLoS Comput Biol. 2012;8(6):e 1002537 online DOI: Tuchman et al. Enhanced production of arginine and urea by 10.1371/journal.pcbi. 1002537 (11 pages). genetically engineered Escherichia coli K-12 strains. Appl Environ Reister et al. Complete genome sequence of the Gram-negative Microbiol. Jan. 1997:63(1):33-8. probiotic Escherichia coli strain Nissle 1917. J Biotechnol. Oct. 10, Ukena et al. Probiotic Escherichia coli Nissle 1917 inhibits leaky 2014; 187: 106-7. gut by enhancing mucosal integrity. PLoS One. Dec. 12. Rembacken et al. Non-pathogenic Escherichia coli versus 2007:2(12):e 1308, online DOI: 10.1371/journal.pone.000 1308 mesalazine for the treatment of ulcerative colitis: a randomised trial. (11 pages). Lancet. Aug. 21, 1999:354(9179):635-9. Unden et al. Alternative respiratory pathways of Escherichia coli: Saint-Girons et al. Structure and autoregulation of the met J regu energetics and transcriptional regulation in response to electron latory gene in Escherichia coli. J Biol Chem. Nov. 25, acceptors. Biochim Biophy's Acta. Jul. 4, 1997:1320(3):217-34. 1984:259(22): 14282-5. Van Heeswijk et al. Nitrogen assimilation in Escherichia coli: Salmon et al. Global gene expression profiling in Escherichia coli putting molecular data into a systems perspective. Microbiol Mol K12. The effects of oxygen availability and FNR.J. Biol Chem. Aug. Biol Rev. Dec. 2013;77(4):628-95. 8, 2003:278(32):29837-55. Vander Wauven et al. Pseudomonas aeruginosa mutants affected in Sat et al. The Escherichia coli mazEF suicide module mediates anaerobic growth on arginine: evidence for a four-gene cluster thymineless death. J Bacteriol. Mar. 2003; 185(6): 1803-7. encoding the arginine deiminase pathway, J Bacteriol. Dec. Sawers. Identification and molecular characterization of a transcrip 1984; 160(3):928-34. tional regulator from Pseudomonas aeruginosa PAO1 exhibiting Walker, Severe hyperammonaemia in adults not explained by liver structural and functional similarity to the FNR protein of disease. Ann Clin Biochem. May 2012:49(Pt3):214-28. Escherichia coli. Mol Microbiol. Jun. 1991:5(6): 1469-81. Winteler et al. The homologous regulators ANR of Pseudomonas Schneider et al. Arginine catabolism and the arginine suc aeruginosa and FNR of Escherichia coli have overlapping but cinyltransferase pathway in Escherichia coli. J Bacteriol. Aug. distinct specificities for anaerobically inducible promoters. Micro 1998; 180(16): 4278-86. biology. Mar. 1996; 142 (Pt3):685-93. Schultz. Clinical use of E. coli Nissle 1917 in inflammatory bowel Wright et al. GeneGuard: A modular plasmid system designed for disease. Inflamm Bowel Dis. Jul. 2008;14(7): 1012-8. biosafety. ACS Synth Biol. Mar. 20, 2015;4(3):307-16. Shoeman et al. Regulation of methionine synthesis in Escherichia Wu et al. Direct regulation of the natural competence regulator gene coli: Effect of metJ gene product and S-adenosylmethionine on the tfoXby cyclic AMP (cAMP) and cAMP receptor protein in Vibrios. expression of the metH gene. Proc Natl Acad Sci U S A. Jun. Sci Rep. Oct. 7, 2015:5:14921 (15 pages). 1985;82(11):3601-5. Zhang and Lin. DEG 5.0, a database of essential genes in both Sonnenborn and Schulze. The non-pathogenic Escherichia coli prokaryotes and eukaryotes. Nucl. Acids Res. 2009:37(suppl. strain Nissle 1917 features of a versatile probiotic. Microbial 1):D455-8. Ecology in Health and Disease. 2009:21:122-58. Zimmermann et al. Anaerobic growth and cyanide synthesis of Suiter et al. Fitness consequences of a regulatory polymorphism in Pseudomonas aeruginosa depend on anr, a regulatory gene a seasonal environment. Proc Natl Acad Sci U S A. Oct. 28, homologous with finr of Escherichia coli. Mol Microbiol. Jun. 2003: 100(22): 12782-6. 1991;5(6): 1483-90. Summerskill. On the origin and transfer of ammonia in the human gastrointestinal tract. Medicine. Nov. 1996:45(6):491-6. * cited by examiner U.S. Patent Nov. 8, 2016 Sheet 1 of 75 US 9.487,764 B2
FG. A
iš8::::::::
U.S. Patent Nov. 8, 2016 Sheet 2 of 75 US 9.487,764 B2
FG. 1B
&:388:
U.S. Patent Nov. 8, 2016 Sheet 3 Of 75 US 9.487,764 B2
FG. 2A
Airaef{ic
FG, 2B U.S. Patent Nov. 8, 2016 Sheet 4 of 75 US 9.487,764 B2
F.G. 3
U.S. Patent Nov. 8, 2016 Sheet 5 Of 75 US 9.487,764 B2
FG 4
Mutagenesis 5-5 U.S. Patent Nov. 8, 2016 Sheet 6 of 75 US 9.487,764 B2
F.G. 5
AuX Selection Enforce high Arg U.S. Patent Nov. 8, 2016 Sheet 7 Of 75 US 9.487,764 B2
F.G. 6 Regulatory region 234567890.234567890.234567890 argA WT GCAAAAAAACACAATAAAAAT CAATAATT (SEQ ID NO : ) TCEAATAATCAT CAAAGAGGTGTACCGTG argA mutant gCaaaaaaaCaCtttaaaaa Cittaataatt (SEO ID NO: 2) tCCttta at CaCtta aa gaggtgta CCgtg arg I W AGACTTGCAAATGAATAAICATCATATAG (SEQ ID NO : 3) ATTAATTTTAATTEATTAAGGCGTTAGCC ACAGGAGGGATCTATG
argl mutant agaCtt gCaaaCttata Cittat C Catata.g (SEC) ID NO : 4) attttgttittaatttgttaagg Cottag Co a Caggagg Cat Ct. at C
argCBH WT (SEQ ID NO : 5)
CACCAGCCGTAAGGTGAATGTTTTACGTTT AACCTGGCAACCAGACATAAGAAGGTGAAT AGCCCCGATG
arg CBH mutant tCattgttgaCaCaCCtctggtCatCatag (SEQ ID NO : 6) tat caaact tcatgggatatttatctittaa. aaata Citt CaaCCtt Gag CG taataaaa CC CaCCag CCG talaggtoaatgttttacgttt aa CCtgg CaaCCaga Catalaga aggtgaat agCCCC gatg U.S. Patent Nov. 8, 2016 Sheet 8 Of 75 US 9.487,764 B2
Regulatory region | 123456789012345678901234567890 argE WT CATCGGGGCTATTCACCTTCTATCTCTCC (SEQ ID NO : 7) TTGCCAGGTTAAA CGTAAAACATTCACCT ACGGCTGGTGGGTTTTATTACGCTCAACGT TAGI(TATTTTTATTATAAATACT TG AAATTGATACTATCATGACCAGAGGGTG TCA ACAATGA
argE multant CatC gggg Ctatt CaCCttct tatgtctgg (SEQ ID NO: 8) ttgcCaggittaaacgtaaaa Catt CaCCtt a CGGC to Ct. GGC titt tatta CCCt Caa COt tCaag tatttittaaagataa at at C C CatC aagtttgatactatoatgacca gaggtgttg tCaacaatga
Car A3 WT AGCAGATTTGCATTGATTTACGTCATCATT (SEQ ID NO: 9) GTSAATTAATATEAAATAAAGTAGTGAA CTGGAGGGTGTTTTG CarAB mutant agcag atttgcattgatttacgt.cat Catt (SEQ ID NO : 10) Ct Cttittaat at Cittaataa. CtggagtgaC gtttctic to gagggtottttg argD WT TTTCTGATTGCCATTCAGTATTTTTTAT& (SEC ID NO: 1) (ATATTTTGT, TTATAATTT (ATATTTAT TATCCGTAACAGGGTGATCATGAGATG
arg D mutant. tittctgattocCatt cagtCttttitt tact. (SEC ID NO: 12) tatattittgttctittataatct tatattitat titat gCgta a Cagg gtgat Cat gagatg
FIG. 6 (Continued) U.S. Patent Nov. 8, 2016 Sheet 9 Of 75 US 9.487,764 B2
Regulatory region | 123456789012345678901234567890 argG WT CTAATCACGT&AATGAATATEC (SEO ID NO : 13) TTCATTTGTTGAATACTT ACCTTCTCCT CCTTTCCCTTAAGCGCATIATTTTACAAAA AACACACA AACCCCGTCCCGABAA AAGATGATTAAATGAAAAC TTA TTT (CATAAAAATTCAGTGAAAGCAGAAATCCA GGCTCATCATCAGTTAATTAAGCAGGGTGT TATTTTATG
arg G mutant Ctaatca CCttaatgaat Ctt Cagttcact (SEO ID NO : 14) tt catttgttgaatact tttacct tctic ct gCttt CCCttaag CGCattattitta Caaaa aa.ca cactaaactict tcct gttct cogataa aagatgat Cittatcaaaac Cittitt tattt C ttataaaaat Cttgttgaaag CagaaatcCa gg CtCat Cat Cagittaattaag Cagg gtgt tattt tatg arg G mutant CCtgaaacgtgg Caaatt Ctact Cottttg (SEO ID NO: 15) gg taaaaaat gCaaata Citgctgggatttg gtgta CC gaga CC gga C gtaaaat CtgCag GCattatadtgat coacgc.ca cattt totc aacgtt tattgctaatcattgacggctag c toagtCC tagg tacagtgctago ACCCGTT TTTTTGGGCTAGAAATAATTTTGTTTAACT TTAAGAAGGAGATATACA ACCC
FIG. 6 (Continued) U.S. Patent Nov. 8, 2016 Sheet 10 Of 75 US 9.487,764 B2
FG, 7
NR ''''regulatory | 12345678901234567890123456789012345678901234567890 region ATCCCCATCACTCTTGATGGAGACAATTCCCCAAGCTGCTAGAGCGTTA. SEO ED NO : 16 CCTTGCCCTTAAACATTAGCAATGTCGATTACAGAGGGCCGACAGGCT CCCACAGGAGAAAACCG
CCTTGACGTACAATTCCCACGCTGICAGAGCCACCTGCCCT SEC ID NO: 1F | TAAACATTAGCAATGTCGATTATCAGAGGGCCGACAGGCTCCCACAGGA GAAAACCG
GCAGCAAACACCCIGACCCICATAATGICAGCCGGGCGGCACT ATCGTCGTCCGGCCTTTTCCTCTCTTACTCTCCTACGTACATCTATTTCT nir B1 AAAATCCGT CAATTGTCG Trn TTTCCACAAACATGAAAATCAGAC SEC ID NO : T8 AATCCGTGACTTAAGAAAATTTATACAAATCAGCAATATACCCCTTAAG GAGTATAAAAGGGAATTGATTACACAATAAGCGGGGTTCCTGAAT CGTTAAGGl'AGGCGGTAAT AGAAAAGAAATCGAGGCAAAA
CGGCCCGATCGTTGAACATAGCGGTCCGCAGGCGGCACTGCTTACAGCAA ACGGCTGTACGCTGTCGTCTTGIGAGTGCCCGIAGGTTTCGIC AGCCGT CACCGTCAGCAAACACCCTGACCCCAAAIGCTCAGCC nir E32 GGACGGCACTATCGTCGTCCGGCCITTTCCTCTCT, TCCCCCGCTACGTCC SEC ID NC: 1.9 ATCTATTTCTATAAACCCGCTCATTTTGTCTATTTTTTGCACAAACATGA AAATCAGACAATTCCGIGACTTAAGAAAATTTATACAAATCAGCAATAT ACCCAITAAGGAGATAAAAGGGAATTGATTACACAATAAGCGGG GTTGCTGAATCGTTAAGGTAGGCGGTAATAGAAAAGAAATCGAGGCAAAA atgtttgtttalactittaagaaggagatata Cat
GECAGCAEAACACCCTGACCTCTCAIAAGCCAGCCGGACGGCACI ATCGTCGTCCGGCCTTTTCCTCTCTTCCCCCGCTACGTGCATCTATT ICT nir E33 An AAACCCGC CATTTT GTCATTTTTT GCACAAACATGAA, ATACAGAC SEC ID NO: 20 AATTCCGIGACTTAAGAAAATTTATACAAATCAGCAATATACCCATTAAG GAGTATAAAAGGGAATTGATTACACAATAAGCGGGGTTGCIGAAT CGITA AGGTAGGCGGTAATAGAAAAGAAATCGAGGCAAAA
AICCCICATCCCACCGGGGGAGAGCTCCCCCGACIATGGC ydf7; TCATGCAGCATEAAAAAAGATGGAGCTTGATCAAAAACAAAAAATATT SEO TD NO: 21 | "CACTCGACAGGAGTATTTATATTGCGCCCGT TACGTGGGCTTCGACTG AAATCAGAAAGGAGAAAACACCT U.S. Patent Nov. 8, 2016 Sheet 11 Of 75 US 9.487,764 B2
GTCAGCATAACACCCT(GACCTCTCATAATGTTCACGCCGGGCGGCACT ACGTCGTCCGGCCTTTCCTCTCTACTCTGCTACGTACATCATCT ATAAATCCGTTCAATTGTCTGTTTTTT GCACAAACATGAAATATCAGAC nir E3-i-RBS AATTCCGTGACTTAAGAAAAITTATACAAATCAGCAATAACCCCTAAG SEO TD NO; 22 CAGTATATAAACGTCAATTCATTTACAT CAATAAGCCGGGTTCCT CAAT CGTTAAGGACCCTCTAGAAATAATTTGTTTAACTTAAGAAGGAGATA ACAT
CATTTCCTCTCAICCCATCCCCCGTCACAGICTTTTCCCCCCACITATCC ydf2+RBS CCAT, GCATGCATCAAAAAAGATGTGAGCTTGATCAAAAACAAAAAATAT SEQ ID NO: 23 TTCACTCCACAGGAGTATTTATATTGCGCCCGGAFCCCTCTAGAAATAAT TTTGTTTAACTTTAAGAAGGAGATATACA.T
AGTTTTCITATGGTGGGTTGCTTATGGTIGCASCGTAGTAAAGGT frS1 TGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAAACGCCGTAAAG SEO TD NO: 24 TTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCA ATATCTCTCTT GGAECCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATA CAT
AGITGTTCTTATTGGGGGTTCCTTTATGGTTGCACGTAGTAAATCGT TGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAAACGCCGCAA AG firs2 Trn TGAGCGAACTCA An AAACTCTCTACCCATTCACGGCAATAT, CTCTCT SEO TD NO: 25 GGATCCAAAGTGAACCACAAATAATGT. AACTAAGAAGGAGA IATACA
TCTCTTT GTCATCTCCTTCCT. CTTAGGTTTCCT CACCCGT CACCC, TCAG CATA ACACCCT CACCTCTCATTAATTCCT CATCCCCCACCCCACTATCCT CGTCCGGCCTTTCCT. CTCTCCCCCGCTACGTCCATCTATTTCTATAAA nir B+crp CCCGCTCATTTGTCATTTTTT GCACAAACATGAAATATCAGACAATTC SEO ID NO; 26 CGTGACTTAAGAAAATTTATACAAATCAGCAATATACCCATTAAGGAGTA TATAAAGGGAATTTGATTACATCAATAAGCGGGGTTGCTGAATCGTTA AGGTAGaaatgttgatc. tagttca cattt GCGGTAATAGAAAAGAAATCGA GGCAAAA atgtttgttta actittaagaaggagatata cat
AGTTGTTCTTATTGGGGGTTGCTTATGGTTGCACGTAGTAAATGGT fnrS+crp TGTAACAAAAGCAATTTTTCCGGCTGTCTGTATACAAAAACGCCGCA AAG SEO ID NO; 27 | TTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCAATATCTCTCaa atgttgat Ctagttca Cattittittgttta actittaagaaggagatata cat
FIG. 7 (Continued)
U.S. Patent Nov. 8, 2016 Sheet 14 Of 75 US 9.487,764 B2
AGACTTAACATGTCCAGATATATTATGAATTTTTAACGGAAAAGAAAGGCAAA TCTCTTCACAAAAACTAATTCTAATTTTTCGCTTGAGAACTTGGCATAGTTTCTCCACTGG AAAATCCAAAGCCTTTA ACCAAAGGATCCGATTTCCACAGICCGT CATCAGCTCTC GGTTGCTTAGCTAATACACCATAAGCATTTTCCCTACTGATGTTCATCAICTGAGCGTATT GGTTATAAGTGAACC AT ACCGTCCGTTCTTTCCTTGTAGGGTTTTCAATCGTCCCCTTGAGT AGGCCACACAGCATAAAATTAGCTTGGTTTCATGCTCCGTTAAGTCATAGCGACTAATCGC TAGTTCATTTGCTTTGAAAACAACTAATTCAGACATACATCT CAATTGGTCTAGGTGATTTT AACACIATAC CAATTGACAGGGCIA GTCAAGAAAACTAGTCCITTTCCTTGAGTI G (GGATCIGT AAATTCGCTAGACCTTGCGGAAAACTTGAAATCGCTAGACCCTC TGAAAICCGCAGACCGTCCIT' (TAACAAGGGAAAAA GAATAAAGAAAGAATAAAAAAAGATAAAAAGAAT AGATCCCAGCCCTGTGTATAACT CACTA CTTTAGTCAGTTCCCCACTATACAAAACCATGTCCCAAA CGCTGTTTCCTCCTCTACAAAA CAGACCTTAAAACCCTAAAGGCTTA AG TAGCACCCTCGCA AGCTCGGGCAAATCGCTGAATA TTCCTTTTGTCTCCGACCATCAGGCACCTGAGTCGCTGTCTTTTTCGTGACATTCAGTTCGC IGCGCTCACGGCTCTCGCAGTAAGGGCGIAAAIGGCACTACAGGCGCCITIATGGAITC ATGCAAGGAAACTACCCATAAACAAGAAAAGCCCGTCACGGGCTCTCAGGGCGTTTTATG GCGGGCIGCT.A.GIGGGCAICGACIGCGICAGCAGCCGCCCCIGAI TCCACTCTGACCACTTCCGATTATCCCGTGACACGTCATTCAGACTGGCTAATGCACCCAGT AACCCAGCCGTATCATCAACAGGCTTACCCGT CTTACT G TCTTTTCTACGGGCTCTCACGCT CAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCAC CTAGATCCTTTTAAATTAAAAATGAAGTTTTAAACAATCTAAAGTATATATGAGTAAACTT GGCTGACAGTTACCAATCGCTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTCGT TCATCCATAGTTGCCT CACTCCCCGTCG T G TAGATAACTACGATACGGGAGGGCTTACCATC TGGCCCCAGTGCGCAATGAACCGCGAGACCCACGCT CACCGGCTCCAGATTTAICAGCAA TAA ACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGGGTCCTGCAACTTATCC GCCTCCATC CAGTCTATAATTTTGCCGGGAAGCT AGAGTAAG TAGTTCGCCAGITAATAGTTTGCGCAA CGTGT, GCCATIGCTACAGGCACGTGGT, GCACGCTCGTCGTGGTAGGCTCATICA GCTCCGGTTCCCAA CGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTT AGCTCCTTCGGTCCTCCCATCGTTGTCAGAAGTAAGTTGGCCCCAGICTTATCACTCATGGT TATGGCAGCACTGCATAATTCTCTTACTGTCAGCCATCCGTAAGATGCTTTTCTGTGACTG GGAGTACCAACCAAGICATICTGAGAATAGTGTATGCGGCGACCGAGTTGCCTTGCCCG GCGT CAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAA ACCTTCTCCCCCCGAAAAC CTCAAC CATCTACCGCTCTTGAGAICCAGTTCCAGTAAC CCACICGTGCACCCA ACIGACTICAGCATC'''I'''TACTTCACCAGCGICTGGGIGAGCA. AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACT CATAC CTTCCTTTTT CAATATTATTGAACCATTTATCAGGGTTATTGTCTCATGAGCGGAT A.C.A.TATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA GTGCCACCTGACGTCTAAGAAACCATTAITATCATGACATTA ACCTATAAAAATAGGCGTA CACGAGCCCCTTTCCTCTCGCGCGTTTCCGIGATGACG GIGAAAACCTCTGACACAIGCAGC TCCCGGAGACGGT CACAGCGTCGTAAGCGGAGCCGGGAGCAGACAAGCCCGTCAGGGC GCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGT ACTGAGAGGCAC CATATGCGGTGGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA TCACCCGCCATTCGCCATTCACGCTCCCCAA CTCTTGGGAACGGCGATCCGTCCCCCCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCC AGGGTTTTCCCAGTCACGACGTT FIG. 8B (Continued) U.S. Patent Nov. 8, 2016 Sheet 15 Of 75 US 9.487,764 B2
FIG 9 Nucleotide sequence of exemplary FNR promoter-driven argA' Sequence (SEOD NO:30)
AGGCAGGGGGGCAGGGCACGAGAAAGGGAACAA AAGCAATCCGGCEGCGAACAAAAACGCCGCAAAGGAGCGAAGCAA AAACTCTCTACCCATTCAGGGCAATATCTCTCTTggat.ccaaagttgaactictagaaat aattittgttta actitt.aagaaggagatata Cat ATGGTAAAGGAACGTAAAACCGAG TTGGTCGAGGGATTCCGCCATTCGGTTCCCTGTATCAATACCCACCGGGGAAAAACG TTTGTCATCATGC (CGGCGGGAAGCCATTGAGCATGAGAATTTCTCCAGTATCGTT AATGATATCGGGTTGTTGCACAGCCTCGGCATCCGTCTGGTGGTGGTCTATGGCGCA CGTCCGCAGATCGACGCAAACTGGCTGCGCACACCACGA, ACCGCTGTATCACAAG AATAACGGTGACCGACGCCAAAACACTGGAACTGGGAA (CAGGCGCGGGAACA TTGCAACTGGATA TACTGCTCGCCTGTCGATGAGTCT CAATAACACGCCGCTGCAG GCCGCGCAATCAA CGICGTCAGTCCCAATITIATIATTCCCCAGCCGCTGGGCCIC GATGACGGCGTGGATTACTGCCAAGCGGGCGTATCCGGCGGATTGAGAAGACGCG ATCCATCGCAAC GGACAGCGGTGCAATAGTGCTAATGGGGCCGGTCGCTGTTTCA GTCACGGCGAGAGC TTAACCTGACCTCGGAAGAGATIGCCACCAACGGCCATC AAACTGAAAGCIGAAAAGA CGATTGGTTTTIGCTCTCCCAGGGCGTCACTAATGAC GACGCIGAATTCTC CCGAACTICCCTAACGAAGCGCAAGCGCGGGTAGAAGCC CAGGAAGAGAAAGGCGATTACAA CTCCGGTACGGTGCGCTTTTTGCGTGGCGCAGTG AAAGCCTGCCGCAGCGGCG GCGICGCT(TCATTTAATCAGTATCAGGA, AGATGGC GCGCTGTTGCA AGAGTTGTTCTCACGCGACGGTATCGGTACGCAGATTGTGATGGAA AGCGCCGAGCAGATICGTCGCGCAACAATCA ACGATATTGGCC GTATCGGAGITG AITCGCCCACTGGAGCAGCAAGGTATICTGGTACGCCGTTCTCGCGAGCAGCTGGAG ATGGAAATCGACAAATTCACCATTATTCACCGCCATA ACACGACTATTGCCTGCGCC GCGCTCTACCGTCCC (GAAGAGA AGATTGGGGAAAGGCCTGTGGGCAGTTCAC CCGGATTACCGCAGT CATCAAGGGGTGAAGTTCTGCTGGA ACGCATIGCCGCTCAG GCTAAG CAGAGCGGCT AAG CAAA CIGITT CIGCT CACCACCCGCAGTATTCACGG ICCAGGAACGGGATTACCCCAGGGATATTGATTACTGCCCGAGAGCAAAAAG CAGTGACAACTACCAGCGAAA CCCAAAGTGTTGAGGCGGATTAGGGAA U.S. Patent Nov. 8, 2016 Sheet 16 Of 75 US 9.487,764 B2
F.G. 10
FR:xxswins 8::ging Sites (R&S;
8: 8:riging $88 U.S. Patent Nov. 8, 2016 Sheet 17 of 75 US 9.487,764 B2
FIG 11
$3th:8; registory &:8:888 that say RSS 3:38:8: 338g
in 8irsig Sites U.S. Patent Nov. 8, 2016 Sheet 18 Of 75 US 9.487,764 B2
FG. 12
yeak 83
in 8incing Site
U.S. Patent Nov. 8, 2016 Sheet 20 Of 75 US 9.487,764 B2
F.G. 14A
3. cr: 8xing Sit:
s 8; 8:8ing Site
FG. 4B
U.S. Patent Nov. 8, 2016 Sheet 22 Of 75 US 9.487,764 B2
C t C t iCa Cotatto Citat coctittitt CocoC C -1 C C a CCaC to CCC CaCtgct Citgoat CCCaCaaaagg gag Co, Ctt CCttato Cata tactgcaaac Ctggg CCag coagaC C al al aggattatgatgcg at CCC tict C, tC Cat Calata CCCCCCC Catala CCC a CC, tC tgat Coactg.ccgcaaacaactogtog Cogalagg tattgcco C tatt Cagtgtgg.cgcattt CataaCaCCaCtggtggaCtgaCC tattt Caa Cacga CCC.gctggg CCC gcc.gtgaCC gg CaCCa
atgtctgtcGaaaaag Cttact. CCaCogact. Coala Cato Cttg gtgcaacg Catgaag.cgaaggatctggaatacct CaactCcag c
FIG. 15 (Continued)
U.S. Patent Nov. 8, 2016 Sheet 24 Of 75 US 9.487,764 B2
F.G. 17 Wild-type arg&
Constitutive arg
U.S. Patent Nov. 8, 2016 Sheet 26 Of 75 US 9.487,764 B2
GGAAGAGATTGCCACTCAACTGGCCATCAA ACTGAAAGCTGAAAAGAFGATTGGTTTTT CCCCCAGGGCGCACAAGACGACGGGATAGTCTCCGAACTTCCCAAC GAAGCGCAAGCGCGGGTAGAAGCCCAGGAAGAGAAAGGCGATTACAAcircCGGTACGGr GCGCTTTTTGCGTGGCGCAGTGAAAGCCGCCGCAGCGGCCTGCGTCGCTCTCATTTAA TCAGTTAFCAGGAAGATGGCGCGCTGT, GCA AGAGTFGTTCTCACGCSACGGTATCGG5 ACGCAGATGTGATGGAAAGCGCCGAGCAGATTCGCGCGCA ACAATCAA CGATATTGG CGGTAircrgGAGTrgArcGCCCAcrgeAccAGCAAGGTATTCTGGTAcGccGTrcirc GCGAGCAGCTGGAGATGGAAATCGACAAATTCACCATFATTCAGCGCGATAACACGACT ATFGCCTGCGCCGCGCTCAFCCGTTCCCGGAAGASA AGATTGGGGAAATGGCCTGTG.; gccAgricAccocGATAccGCAGTrcatcAAGGGFGAAcircrgcreeAAccoatre CGCTCAGGCTAAGCAGAGCGGCTTAAG CAAATGTTTGTGCTGACCACGCGCAGTATE CACTGGTTCCAGGAACGTGGATTTACCCCAGTGGATATTGATTTACTGCCCGAGAGCAA a AAGCASrror ACAACTACCAGCGTAAAircCAA AgrgrgATGGCGGATTTAGGGTAAT GGGAATTAGCCATGGPCCATA"FGAAPATCCFCCPIAGTTCCTATCC gaagttcctatt CCgaagttcc tattotctagaaagtataggaactitc GAAGCAGCTCCAGCCTACACAAT
CGCCAAGACGCTAATGCGCAA CGCAGCAAGCGGCACGGCCACGC GCAAIEEGAGCC G3CAGAGGCGGGCGIC CCCCCCCCACCCTCCGGGCCGTCCCCCAACCCAAATCCCCCCCGGCG
ATGCCTGGCAGTFCCCTACTCTCGCATGcticgagic catgggacgt.ccagg tattagaagccaacctggcgctgccaaaacacaacctggtcacg
ccggtgaagtggttgaaggtacgaaaaag.ccctectc.cgacacgc.caactcaccggctg ctetatcaggcattcc.cgtCtattgg.cggcattgtgcacacacactc.gc.gc.cacgc.cac catctggg.cgcaggagggc.cagtegattccagcagc.cggcaccacccacgc.cgactatt tetacggcaccattcc.ctgcaccc.gcaaaatgaccgacgcagaaatcaacggtgaatat
gcaaatgcceggcgtgctggtocattetcacggcccatttgcatggggaaaaaacgc.cg F.G. 18 (Continued) U.S. Patent Nov. 8, 2016 Sheet 27 Of 75 US 9.487,764 B2
aagatgcggtgcataacgc.ca tcgtgctggaagaagttcgcttatatggggatattotgc. cgtcagttagcgcc.gcagttaccggatatgcagoaaacgctgctggataaacactatot gcgtaageatggcgcgaaggcatattacgggcagtaa
FIG. 18 (Continued) U.S. Patent Nov. 8, 2016 Sheet 28 Of 75 US 9.487,764 B2
FG. 9
&rriaix's
U.S. Patent Nov. 8, 2016 Sheet 30 Of 75 US 9.487,764 B2
FIG 21A pSC101 plasmid (SEQ ID NO. 34) Ann AAGTCGGTAACGCCAGGGTTmrCCCAGTCACGACGTATCCGrm GCGCinCACIGCCCGC TTTCCAGTCGGGAAACCGTCGTCCCAGCTGCA ITAATGAATCGGCCAA CGCGCGGGGAGAGCC GGTTTGCGTATTGGGCGCTCTCCGCTTCCTCGCT CACTGACCGCTGCGCTCGGTCGTTCGGC TGCGGCGAGCGGTATCAGCT CACT CAAAGGCGGTAGTACGGGTTTTGCTGCCCGCAAACGGGCT GTTCTGGTGTTGCTAGTTTGTTATCACAATCGCAGATCCGGCTTCAGGTTTCCCCCCTGAAAGC GCTATTCTCCAGAATTGCCATGATTTTTTCCCCACGGGAGGCGTCACTGGCCCCGTGITGT CGGCAGCTTTGATTCGATAAGCAGCATCGCCTGTTTCAGGCTGTCATGTGIGACTGTTGAGCT GTAACAAGTTGTCTCAGGGTTCAATTTCATGT, TCTAGTTGCTTGTTTT ACTGGTTTCACCTG TTCATAGGTGTTACAIGCTGTTCACGTACATTGTCGATCGTICAGGGA ACAGCTTT AAAIGCACCAAAAACTCGTAAAAGCTCGATGTATCTATCTTTTTTACACCGTTTTCATCTGTG CATAGGACAGLITICCCTTGATATCAACGGIGA ACAGTTGTTCTACTGIGITAGIC IIGAIGCTTCACTGATAGATACAAGAGCCAAAGAACCTCAGAICCIICCGIATAGCCAGTA TGTTCCTAGTGTGGTTCGTTGTTTTTGCGTGAGCCATGAGA ACGAACCATTGAGATCAT, GCIT ACTTTGCATGTCACTCAAAAATTTTGCCT CAAAACTGGTGAGCTGAATTTTGCAGTAAAGCA TCGGTAGGTTTTTCTTAGTCCGTTACGTAGGTAGGAATCGATGTAATGGTTGGGTATTT TGT CACCACAITIETATCTGGTTGTCCAAGITCGGTTACGAGATCCAGICAICTAG TTCA ACTTGGAAAATCAAC GTATCAGTCGGGCGGCCTCGCTTATCA ACCACCAATTTCATATTG CTGTAAGTGITAAATCTACTTATTGGTTTCAAAACCCATGGTTAAGCCAAACT CAT GGTAGTATTTTCAAGCATIAA-CATGAACTAAATTCATCAAGGCAATCCTATATTGCCTT CTGACITICTTTTCCTTAGTTCTTTTAATAACCACTCATAAATCCTCATAGACIATTC, IT TCAAAAG ACTTAACATGTTCCAGATTATATTTTATGAATTTTTTTAACTGGAAAAGAAAGGCA ATACTCTTCACTAAAAACTAATTCTA ATTTTTCGCTTGAGAACGGCAAGTTTGTCCACTG CAAAATCT CAAACCCTTTAACCAAACCATICCICATTTCCACAGTTCTCC, TCAT CACCTCTCTG CIICCITAC CTAATACACCAAACCACCCTACTGATGICAICAICTGAGCCTATTGGT marazGin GAA CGATACCGICCGTTCnrn CCTGAGGGTTTCAA CGrGGGGming AG TAGTGC CACACAGCATAAAAT AGCTTGGTTTCATGCTCCGT TAAGTCATAGCCACAATCGCTAGTTCA TTTCCTTTGAAAACAACTAATTCACACATACATCT CAATTCCTCTAGCTGATTTTAATCACTAT ACCAATTGACATGGGCTAGTCAATGATAATTACTAGTCCTTTTCCTTTGACTTGTGGGTATCTG TAAATTCTGCTAGACCTTTCCTGGAAAACTTGTAAATTCTGCTAG ACCCTCTGTAAATTCCGCT AGACCnning GTGTTTTTTTGTT mATArrCAAGTGGTTATAAT. TrArr; GAAAAAGAAAGAAir AAAAAAAGATAAAAAGAAT AGATCCCAGCCCTGTGTATAACT CACIACTTAGCAGTTCCGCA GTATTACAAAAGGAT G TCGCA AACCCTGTTTCCTCCTCTACAAAACAGACCAAAACCCTAAA CGCTAAG TAGCACCCTCGCAAGCTCGGGCAAATCGCTGAATATTCCTTTTGTCTCCGACCATC AGGCACCTGAGTCGCT(TCTTTTTCGTGACATTCAGTTCGCT(CGCTCACGGCTCTGGCAGTCA, ATGGGGGTAAATGGCACTACAGGCGCCTTAGGATTCATCCAAGGAAACACCCAAATACA AGAAAAGCCCGTCACGGGCICICAGGGCGTTTTATGGCGGGTCGCIAIGGGGCTATCTGA CTTTTIGCTGTTCAGCAGTCCTGCCCCIGATTTCCAGTCGACCACTCGGATATCCCGT GACAGGTCATTCAGACTGGCTAATGCACCCAGTAAGGCAGCGGTATCATCAACAGGCTTACCCG CIFACGTCTTTTCACGGGGICTGACGCCAGTGGAACGAAAACICACGTAAGGGATTTG GTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCITTTAAATAAAAAIGAAGI ITTAAAI CAACTAAAGTATATAlGAGAAACTIGGICTGACAGTTACCAAGCIIAAICAGTGAGGCACC TATCCAGCGAICIGICATICGTICACCAAGILGCCTGACCCCCGCGGAGAAAC ACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCT CAC
U.S. Patent Nov. 8, 2016 Sheet 33 Of 75 US 9.487,764 B2
GTTCAACTTGGAAAATCAACGTATCAGTCGGGCGGCCTCGC ACA ACCACCAATTTCATATT CCTGTAACTCTTTAAATCTTT ACTTATTGGTTTCAAAACCCATTCCTTAAGCCTTTTAAACT CA TGGTAGTTATTTTCAAGCATTAACATGAACTTAAATTCATCAAGGCTAATCTCTATATTTGCCT TCTGAGTTTTCTTTTGGTTAGIC III AATAACCACTCATAAATCCTCATAGAGTATTTGTT TT CAAAAG ACTTAACAT (TTCCAGATTA Ann TTATGAAT Trrrrrrrrrr AACTGGAAAAGATAAGGC AATA.ICICIECACTAAAAACAATTCTAATTTTTCGCGAGAACGGCAAGILIGICCACI GGAAAATCT CAAAGCCIITAACCAAAGGATTCCTGATTTCCACAGTTCTCCT CATCAGCTCTCT GGIGCITAGC'AAACACCAAAGCA TTTCCCTACGAGCACACIGAGCGIALIGG TTATAAGTGAACGATACCGTCCC, TICTT TCCTTC, TACCCTTTT CAATCGTCCCCTTGA (TAGTG CCACACGCATAAAAAGCTGGTTTCAIGCTCCGTAAGTCATAGCGACTAATCGCTAGTTC ATTTCCTTGAAAACAACTAATTCAGACATACATCT CAATTCGTCACGTGATTAAICACTA. naCCAAnnGAGArGGGCiAGTCAATGATAATTACTAGCCT. TTCCTTGACnr GTGGGran Cir GTAAATTCTGCTAGACCTTGCTGGAAAACTTGTAAATTCTGCTAGACCCTCTGTAAATTCCGC TAGACCTTTGTGTGTTTTTTT TOTT TATAT, TCAAG GGTTATAATAAGAAAAAGAAAGAA TAAAAAAAGATAAAAAGAAT AGATCCCAGCCCTG GTATAACT CACACTTAGTCAGTTCCGC AGTATTACAAAAGGAGCGCAA ACGCTGTTTGCTCCTCTACAAAACAGACCTTAAAACCCTAA ACCCTTAAG TAGCACCCCGCAAGCTCGGGCAAATCGCGAATA TTCCTTTTCTCTCCGACCAT CAGGCACCGAGCGCGICITICGIGACAI CAGECGCTGCGCTCACGGCTCTGGCAGTG AATCGGGGTAAATGGCACTACAGGCGCCTTTTATGGATTCAIGCAAGGAAACTACCCAT. AATAC AAGAAAAGCCCGTCACGGGCTTCTCAGGGCGTTTTATGGCGGGTCGCTATGTGGTGCTATCTG ACTTTTTCCTGTTCACCACTTCCTCCCCTCTCATTTTCCAGTCTGACCACTTCGGATTATCCCC TGACAGGCATTCAGACTGGCTAATGCACCCAGTAAGGCAGCGGTATCATCA ACAGGCTTACCC GICTTACGC'll TCACGGGGCIGACGCICAG 'GGAA CGAAAACTCACGTAAGGGATTTT GGCATGA, GATTACAAAAAGGAICTTCACC TAGA CCn TrAAAAAAAAGAAGTAAA TCAATCTA AAGTATATATGAGTAAACTTGGTCTGACAGITACCA AGC'IAATCAGIGAGGCAC CTATCT CACCCATCTCTCTATTTCCTTCATCCATAGTTCCCTGACTCCCCGTCCTGTAGATAAC TACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCA CCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTG CAACTTTATCCGCCTCCATCCACTCTATTAATTGTTGCCGGGAAGCTACA GTAAG TAGTTCGCC AGITA AIA GTTTGCGCAA.CGTTGGCCATIGC ACAGGCACGGGIGICACGCICGICGITI GGnarCGCmncArnOAGCTCCGGini CCCAA CGA CAAGGCGAGTACAT CACCCCCAT GmTOT GCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT ATCACTCATGGTTATCCCACCACTCCATAATTCTCTTACTGTCATCCCATCCCTAAG ATCCTTT TCTGTGACTGGTGAGACT CAACCAAGTCATTCTGAGAATAGTGTAGCGGCGACCGAGTTGCT CTTGCCCGGCGTCAAACGGGATAATACCGCGCCACATAGCAGA AC TAAAAGIGCT CATCAT TGGAAAACGTTCTTCGGGGCGAAAA CTCTCAAGGA CTTACCGCTGT GAGATCCAGTTCGATG TAACCCACTCGTGCACCCAACTGATCTTCAGCA CTTTTACTTTCACCAGCGTTTCTGGGTGAG CAAAAACAGGAAGGCAAAATGCCGAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACT CATACTCTTCCTTTTT CAATATATTGAAGCATTTATCAGGGTTATGTCTCATGAGCGGATAC ATATTGAAGATTAGAAAAAAAACAAATAGGGGCCGCGCACATTTCCCCGAAAAGGC CACCTGACGTCTAAGAAAs CCATTATTATCATGACAT. AACCTATAAAAATAGGCGTATCACGAG GCCCTTTCGCCGCGCGCGGGAIGACGG 'GAAAACCCTGACACAIGCAGCTCCCGGAG ACGCTCACAGCTTGTCGTAAGCGGATGCCGGGAGCAGACAAGCCCG CAGGGCGCGTCAGCOC GTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGA TGTACTGAGA GTGCA CCATATGCGGTGTGAAAACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCG CCATTCACGCTGCGCA ACTGTGG GAAGGGCGATCGGGCGGGCCCT CGCATTACGCCAGC TGGCGAAAGGGGGATGTGCTGCAAGGCG FIG. 21 B (Continued)
U.S. Patent Nov. 8, 2016 Sheet 35 of 75 US 9.487,764 B2
FG. 23
Brightness of constitutive RFP integrated in tee ocations: Arai 2, via Efik 3. MetYiArg& 4. Nissie (non-fluorescent)
U.S. Patent Nov. 8, 2016 Sheet 37 Of 75 US 9.487,764 B2
SY33333 SY-334 SY33832 SY-3C:38 U.S. Patent Nov. 8, 2016 Sheet 38 of 75 US 9.487,764 B2
FG. 26
U.S. Patent Nov. 8, 2016 Sheet 39 Of 75 US 9.487,764 B2
S. 8: & s : S. U.S. Patent Nov. 8, 2016 Sheet 40 of 75 US 9.487,764 B2
FIG. 28A
8:w w s:
F.G. 28B FG, 28C U.S. Patent Nov. 8, 2016 Sheet 41 of 75 US 9.487,764 B2
F.G. 29 Normal chow?H2O 380 fas reif-2C im 70% roteifi sys-scies S{
as xk}{} SP 350 c 3.
U.S. Patent Nov. 8, 2016 Sheet 44 of 75 US 9.487,764 B2
| U.S. Patent Nov. 8, 2016 Sheet 45 of 75 US 9.487,764 B2
FG 33
ilvD dapD leuB dapE lysA dapF serA metA glyA hisBhis B ilvAiVA pheapheA proA thrthrd trpCtrpc tyra U.S. Patent Nov. 8, 2016 Sheet 46 of 75 US 9.487,764 B2
\fejn
wSÁI
GA!!!
woud yaqd
Sunou,8iz U.S. Patent US 9.487,764 B2
d U.S. Patent US 9.487,764 B2
d U.S. Patent Nov. 8, 2016 Sheet 49 of 75 US 9.487,764 B2
U.S. Patent US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 52 of 75 US 9.487,764 B2
U.S. Patent US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 54 Of 75 US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet SS Of 75 US 9.487,764 B2
U.S. Patent US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 57 Of 75 US 9.487,764 B2
?? \ U.S. Patent Nov. 8, 2016 Sheet 58 Of 75 US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 59 of 75 US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 60 of 75 US 9.487,764 B2
U.S. Patent NOV. 8, 2016 Sheet 62 of 75 US 9.487,764 B2
F.G. 50
U.S. Patent Nov. 8, 2016 Sheet 63 of 75 US 9.487,764 B2
xx -3. 88.3:
U.S. Patent Nov. 8, 2016 Sheet 64 of 75 US 9.487,764 B2
isel?ju!
U.S. Patent Nov. 8, 2016 Sheet 66 of 75 US 9.487,764 B2
@Lºl@@@G)
^
U.S. Patent Nov. 8, 2016 Sheet 68 of 75 US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 69 of 75 US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 71 Of 75 US 9.487,764 B2
F.G. 59 Time-Delay Shut-off Switch (Toxin Producer)
Pconstant ...... Asiaero8& Efreshire, 80S, &c., U.S. Patent Nov. 8, 2016 Sheet 72 Of 75 US 9.487,764 B2
U.S. Patent US 9.487,764 B2
U.S. Patent Nov. 8, 2016 Sheet 74 of 75 US 9.487,764 B2
| U.S. Patent Nov. 8, 2016 Sheet 75 of 75 US 9.487,764 B2
.*¿¿.* |(sudonoxne ?(s|se?quÁs||enwlleo)w/dep•?p?oeou?uue)w?eupuevues• -Á?egespeubau?6u?"II (s|sæ?quÁsVNG)VÁ?•
Á?dou?oxný) :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
.:::&º." queue6eue.IN.3].se/W Á?eges?ueue?ul"I .::::::::::::*******************************************************************************************************************...;...; US 9.487,764 B2 1. 2 BACTERIA ENGINEERED TO TREAT mia. Likewise, histidine biosynthesis, methionine biosyn DISEASES ASSOCATED WITH thesis, lysine biosynthesis, asparagine biosynthesis, gluta HYPERAMMONEMA mine biosynthesis, and tryptophan biosynthesis are also capable of incorporating excess nitrogen, and enhancement This application claims the benefit of U.S. Provisional of those pathways may be used to modulate or treat condi Application No. 62/087,854, filed Dec. 5, 2014: U.S. Pro tions associated with hyperammonemia. visional Application No. 62/173,706, filed Jun. 10, 2015: Current therapies for hyperammonemia and UCDs aim to U.S. Provisional Application No. 62/256,041, filed Nov. 16, reduce ammonia excess, but are widely regarded as Subop 2015; U.S. Provisional Application No. 62/103.513, filed timal (Nagamani et al., 2012; Hoffmann et al., 2013: Torres Jan. 14, 2015; U.S. Provisional Application No. 62/150,508, 10 Vega et al., 2014). Most UCD patients require substantially filed Apr. 21, 2015; U.S. Provisional Application No. modified diets consisting of protein restriction. However, a 62/173,710, filed Jun. 10, 2015; U.S. Provisional Applica low-protein diet must be carefully monitored; when protein tion No. 62/256,039, filed Nov. 16, 2015; U.S. Provisional intake is too restrictive, the body breaks down muscle and Application No. 62/184,811, filed Jun. 25, 2015; U.S. Pro consequently produces ammonia. In addition, many patients visional Application No. 62/183,935, filed Jun. 24, 2015: 15 require Supplementation with ammonia Scavenging drugs, and U.S. Provisional Application No. 62/263.329, filed Dec. Such as Sodium phenylbutyrate, sodium benzoate, and glyc 4, 2015, which are incorporated herein by reference in their erol phenylbutyrate, and one or more of these drugs must be entirety to provide continuity of disclosure. administered three to four times per day (Leonard, 2006; Diaz et al., 2013). Side effects of these drugs include nausea, SEQUENCE LISTING Vomiting, irritability, anorexia, and menstrual disturbance in females (Leonard, 2006). In children, the delivery of food The instant application contains a Sequence Listing which and medication may require a gastrostomy tube Surgically has been submitted electronically in ASCII format and is implanted in the stomach or a nasogastric tube manually hereby incorporated by reference in its entirety. Said ASCII inserted through the nose into the stomach. When these copy, created on Mar. 9, 2016, is named 12671.0006 25 treatment options fail, a liver transplant may be required 00000 SL.txt and is 46,692 bytes in size. (National Urea Cycle Disorders Foundation). Thus, there is This disclosure relates to compositions and therapeutic significant unmet need for effective, reliable, and/or long methods for reducing excess ammonia and converting term treatment for disorders associated with hyperammone ammonia and/or nitrogen into alternate byproducts. In cer mia, including urea cycle disorders. tain aspects, the disclosure relates to genetically engineered 30 The invention provides genetically engineered bacteria bacteria that are capable of reducing excess ammonia, that are capable of reducing excess ammonia and converting particularly in low-oxygen conditions, such as in the mam ammonia and/or nitrogen into alternate byproducts. In cer malian gut. In certain aspects, the compositions and methods tain embodiments, the genetically engineered bacteria disclosed herein may be used for modulating or treating reduce excess ammonia and convert ammonia and/or nitro disorders associated with hyperammonemia, e.g., urea cycle 35 gen into alternate byproducts selectively in low-oxygen disorders and hepatic encephalopathy. environments, e.g., the gut. In certain embodiments, the Ammonia is highly toxic and generated during metabo genetically engineered bacteria are non-pathogenic and may lism in all organs (Walker, 2012). Hyperammonemia is be introduced into the gut in order to reduce toxic ammonia. caused by the decreased detoxification and/or increased As much as 70% of excess ammonia in a hyperammonemic production of ammonia. In mammals, the urea cycle detoxi 40 patient accumulates in the gastrointestinal tract. Another fies ammonia by enzymatically converting ammonia into aspect of the invention provides methods for selecting or urea, which is then removed in the urine. Decreased ammo targeting genetically engineered bacteria based on increased nia detoxification may be caused by urea cycle disorders levels of ammonia and/or nitrogen consumption, or produc (UCDs) in which urea cycle enzymes are defective, such as tion of a non-toxic byproduct, e.g., arginine or citrulline. The argininosuccinic aciduria, arginase deficiency, carbamoyl 45 invention also provides pharmaceutical compositions com phosphate synthetase deficiency, citrullinemia, N-acetylglu prising the genetically engineered bacteria, and methods of tamate synthetase deficiency, and ornithine transcarbamy modulating and treating disorders associated with hyperam lase deficiency (Häberle et al., 2012). The National Urea monemia, e.g., urea cycle disorders and hepatic encepha Cycle Disorders Foundation estimates that the prevalence of lopathy. UCDs is 1 in 8,500 births. In addition, several non-UCD 50 disorders, such as hepatic encephalopathy, portosystemic BRIEF DESCRIPTION OF THE FIGURES shunting, and organic acid disorders, can also cause hyper ammonemia. Hyperammonemia can produce neurological FIGS. 1A and 1B depict the state of the arginine regulon manifestations, e.g., seizures, ataxia, stroke-like lesions, in one embodiment of an ArgR deletion bacterium of the coma, psychosis, vision loss, acute encephalopathy, cerebral 55 invention under non-inducing (FIG. 1A) and inducing (FIG. edema, as well as vomiting, respiratory alkalosis, hypother 1B) conditions. FIG. 1A depicts relatively low arginine mia, or death (Häberle et al., 2012: Häberle et al., 2013). production under aerobic conditions due to arginine ("Arg Ammonia is also a source of nitrogen for amino acids, in oval) interacting with ArgA (squiggle ) to inhibit which are synthesized by various biosynthesis pathways. (indicated by “X”) ArgA activity, while oxygen (O) pre For example, arginine biosynthesis converts glutamate, 60 vents (indicated by “X”) FNR (dotted boxed FNR) from which comprises one nitrogen atom, to arginine, which dimerizing and activating the FNR promoter (grey FNR comprises four nitrogen atoms. Intermediate metabolites box) and the argA' gene under its control. FIG. 1B depicts formed in the arginine biosynthesis pathway, such as citrul up-regulated arginine production under anaerobic conditions line, also incorporate nitrogen. Thus, enhancement of argi due to FNR dimerizing (two dotted boxed FNRs) and nine biosynthesis may be used to incorporate excess nitro 65 inducing FNR promoter (grey FNR box)-mediated expres gen in the body into non-toxic molecules in order to sion of ArgA' (squiggle above argA), which is resis modulate or treat conditions associated with hyperammone tant to inhibition by arginine. This overcomes (curved US 9.487,764 B2 3 4 arrow) the inhibition of the wild-type ArgA caused by FIG. 5 depicts another embodiment of the invention. In arginine ("Arg’ in oval) interacting with ArgA (Squiggle this embodiment, a construct comprising an ArgR binding above box depicting argA). Each gene in the arginine site (black bar bound by the ArgR-Arg complex) in a regulon is depicted by a rectangle containing the name of the promoter driving expression of the Tet repressor (not shown) gene. Each arrow adjacent to one or a cluster of rectangles 5 from the tetR gene is linked to a second promoter compris depict the promoter responsible for driving transcription, in ing a TetR binding site (black bar) that drives expression of the direction of the arrow, of such gene(s). Heavier lines an auxotrophic protein necessary for host survival (“AUX). adjacent one or a series of rectangles depict ArgR binding Under high arginine concentrations, the ArgR-arginine com sites, which are not utilized because of the ArgR deletion in plex binds to the ArgR binding site, thereby inhibiting this bacterium. Arrows above each rectangle depict the 10 expression of TetR from the tetR gene. This, in turn, allows expression product of each gene. expression of AUX, allowing the host to survive. Under low FIGS. 2A and 2B depict an alternate exemplary embodi arginine concentrations, TetR is expressed from the tetR ment of the present invention. FIG. 2A depicts the embodi gene and inhibits the expression of AUX, thus killing the ment under aerobic conditions where, in the presence of host. The construct in FIG. 5 enforces high arginine (“Arg') oxygen, the FNR proteins (FNR boxes) remain as monomers 15 production by making it necessary for host cell Survival and are unable to bind to and activate the FNR promoter through its control of AUX expression. (“FNR) which drives expression of the arginine feedback FIG. 6 depicts the wild-type genomic sequences compris resistant argA' gene. The wild-type ArgA protein is func ing ArgR binding sites and mutants thereof for each arginine tional, but is susceptible to negative feedback inhibition by biosynthesis operon in E. coli Nissle. For each wild-type binding to arginine, thus keeping arginine levels at or below sequence, the ARG boxes are indicated in italics, and the normal. All of the arginine repressor (ArgR) binding sites in start codon of each gene is boxed. The RNA polymerase the promoter regions of each arginine biosynthesis gene binding sites are underlined (Cunin, 1983; Maas, 1994). (argA, argE, argC. argB, argH, arg), argl, argG, carA, and Bases that are protected from DNA methylation during ArgR carB) have been mutated (black bars; black “X”) to reduce binding are highlighted, and bases that are protected from or eliminate binding to ArgR. FIG. 2B depicts the same 25 hydroxyl radical attack during ArgR binding are bolded embodiment under anaerobic conditions where, in the (Charlier et al., 1992). The highlighted and bolded bases are absence of oxygen the FNR protein (FNR boxes) dimerizes the primary targets for mutations to disrupt ArgR binding. and binds to and activates the FNR promoter (“FNR). This FIG. 7 depicts the nucleic acid sequences of exemplary drives expression of the arginine feedback resistant argA' regulatory region sequences comprising a FNR-responsive gene (black squiggle ( )–argA' gene expression prod 30 promoter sequence. Underlined sequences are predicted uct), which is resistant to feedback inhibition by arginine ribosome binding sites, and bolded sequences are restriction ('Arg’ in ovals). All of the arginine repressor (ArgR) sites used for cloning. Exemplary sequences comprising a binding sites in the promoter regions of each arginine FNR promoter include, but are not limited to, SEQID NO: biosynthetic gene (argA, argE, argC. argB, argH, arg), argl, 16, SEQ ID NO: 17, nirB1 promoter (SEQ ID NO: 18), argG, carA, and carB) have been mutated (black bars) to 35 nirB2 promoter (SEQ ID NO: 19), nirB3 promoter (SEQ ID reduce or eliminate binding to ArgR (black “X”), thus NO: 20), ydf7 promoter(SEQ ID NO: 21) nirB promoter preventing inhibition by an arginine-ArgR complex. This fused to a strong ribosome binding site (SEQ ID NO: 22), allows high level production of arginine. The organization of ydf7 promoter fused to a strong ribosome binding site (SEQ the arginine biosynthetic genes in FIGS. 1A and 1B is ID NO. 23), an anaerobically induced small RNA gene finrS representative of that found in E. coli strain Nissle. 40 promoter selected from finrS1 (SEQ ID NO: 24) and finrS2 FIG. 3 depicts another embodiment of the invention. In (SEQID NO:25), nirB promoter fused to a CRP binding site this embodiment, a construct comprising an ArgR binding (SEQID NO: 26), and finrS promoter fused to a CRP binding site (black bar) in a promoter driving expression of the Tet site (SEQ ID NO: 27). repressor (TetR) from the tetR gene is linked to a second FIG. 8A depicts the nucleic acid sequence of an exem promoter comprising a TetR binding site (black bar between 45 plary argA sequence. FIG. 8B depicts the nucleic acid TetR and X) that drives expression of gene X. Under low sequence of an exemplary FNR promoter-driven argA' arginine concentrations, TetR is expressed and inhibits the plasmid. The FNR promoter sequence is bolded and the expression of gene X. At high arginine concentrations, ArgR argA' sequence is boxed associates with arginine and binds to the ArgR binding site, FIG.9 depicts the nucleic acid sequence of an exemplary thereby inhibiting expression of TetR from the tetR gene. 50 FNR promoter-driven argA' sequence. The FNR promoter This, in turn, removes the inhibition by TetR allowing gene sequence is bolded, the ribosome binding site is highlighted, X expression (black squiggle ( )). and the argA” sequence is boxed. FIG. 4 depicts another embodiment of the invention. In FIG. 10 depicts a schematic diagram of the argA' gene this embodiment, a construct comprising an ArgR binding under the control of an exemplary FNR promoter (fnrS) site (black bar) in a promoter driving expression of the Tet 55 fused to a strong ribosome binding site. repressor (TetR) from the tetR gene is linked to a second FIG. 11 depicts another schematic diagram of the argA' promoter comprising a TetR binding site (black bar bound to gene under the control of an exemplary FNR promoter TetR oval) that drives expression of green fluorescent pro (nirB) fused to a strong ribosome binding site. Other regu tein (“GFP). Under low arginine concentrations, TetR is latory elements may also be present. expressed and inhibits the expression of GFP. At high 60 FIG. 12 depicts a schematic diagram of the argA' gene arginine concentrations, ArgR associates with arginine and under the control of an exemplary FNR promoter (nirB) binds to the ArgR binding site, thereby inhibiting expression fused to a weak ribosome binding site. of TetR from the tetR gene. This, in turn, removes the FIGS. 13A and 13B depict exemplary embodiments of a inhibition by TetR allowing GFP expression. By mutating a FNR-responsive promoter fused to a CRP binding site. FIG. host containing this construct, high arginine producers can 65 13A depicts a map of the FNR-CRP promoter region, with be selected on the basis of GFP expression using fluores restriction sites shown in bold. FIG. 13B depicts a schematic cence-activated cell sorting (“FACS”). diagram of the argA” gene under the control of an exem US 9.487,764 B2 5 6 plary FNR promoter (nirB promoter), fused to both a CRP bacterial chromosome, and results in varying degrees of binding site and a ribosome binding site. Other regulatory brightness under fluorescent light. Unmodified E. coli Nissle elements may also be present. (strain 4) is non-fluorescent. FIGS. 14A and 14B depict alternate exemplary embodi FIG. 24 depicts a bar graph of in vitro arginine levels ments of a FNR-responsive promoter fused to a CRP binding produced by streptomycin-resistant control Nissle (SYN site. FIG. 14A depicts a map of the FNR-CRP promoter UCD103), SYN-UCD201, SYN-UCD202, and SYN region, with restriction shown in bold. FIG. 14B depicts a UCD203 under inducing (+ATC) and non-inducing (-ATC) schematic diagram of the argA' gene under the control of conditions. SYN-UCD201 comprises AArgR and no an exemplary FNR promoter (fnrS promoter), fused to both argA'. SYN-UCD202 comprises AArgR and tetracycline 10 inducible argA' on a high-copy plasmid. SYN-UCD203 a CRP binding site and a ribosome binding site. comprises AArgR and tetracycline-driven argA' on a low FIG. 15 depicts the wild-type genomic sequence of the copy plasmid. regulatory region and 5' portion of the argG gene in E. coli FIG. 25 depicts a bar graph of in vitro levels of arginine Nissle, and a constitutive mutant thereof. The promoter and citrulline produced by Streptomycin-resistant control region of each sequence is underlined, and a 5" portion of the 15 Nissle (SYN-UCD103), SYN-UCD104, SYN-UCD204, and argG gene is boxed . In the wild-type sequence, ArgR SYN-UCD105 under inducing conditions. SYN-UCD104 binding sites are in uppercase and underlined. In the mutant comprises wild-type ArgR, tetracycline-inducible argA' on sequence, the 5' untranslated region is in uppercase and a low-copy plasmid, tetracycline-inducible argG, and muta underlined. Bacteria expressing argG under the control of tions in each ARG box for eacharginine biosynthesis operon the constitutive promoter are capable of producing arginine. except for argG. SYN-UCD204 comprises AArgR and Bacteria expressing argG under the control of the wild-type, argA' expressed under the control of a tetracycline-induc ArgR-repressible promoter are capable of producing citrul ible promoter on a low-copy plasmid. SYN-UCD105 com line. prises wild-type ArgR, tetracycline-inducible argA' on a FIG. 16 depicts an exemplary embodiment of a constitu low-copy plasmid, constitutively expressed argG tively expressed argG construct in E. coli Nissle. The 25 (BBa J23100 constitutive promoter), and mutations in each constitutive promoter is BBa J23100, boxed in gray. ARG box for each arginine biosynthesis operon except for Restriction sites for use in cloning are in bold. argG. FIG. 17 depicts a map of the wild-type argG operon E. FIG. 26 depicts a bar graph of in vitro arginine levels coli Nissle, and a constitutively expressing mutant thereof. produced by streptomycin-resistant Nissle (SYN-UCD103), 30 SYN-UCD205, and SYN-UCD204 under inducing (+ATC) ARG boxes are present in the wild-type operon, but absent and non-inducing (-ATC) conditions, in the presence (+O) from the mutant. ArgC is constitutively expressed under the or absence (-O.) of oxygen. SYN-UCD103 is a control control of the BBa J23100 promoter. Nissle construct. SYN-UCD205 comprises AArgR and FIG. 18 depicts the nucleic acid sequence of an exemplary argA' expressed under the control of a FNR-inducible BAD promoter-driven argA' construct. All bolded 35 promoter (fnrS2) on a low-copy plasmid. SYN204 com sequences are Nissle genomic DNA. A portion of the araC prises AArgR and argA' expressed under the control of a gene is bolded and underlined, the argA' gene is boxed, and tetracycline-inducible promoter on a low-copy plasmid. the bolded sequence in between is the promoter that is FIG. 27 depicts a graph of Nissle residence in vivo. activated by the presence of arabinose. The ribosome bind Streptomycin-resistant Nissle was administered to mice via ing site is in italics, the terminator sequences are high 40 oral gavage without antibiotic pre-treatment. Fecal pellets lighted, and the FRT site is boxed. A portion of the ara) from six total mice were monitored post-administration to gene is boxed in dashes. determine the amount of administered Nissle still residing FIG. 19 depicts a schematic diagram of an exemplary within the mouse gastrointestinal tract. The bars represent BAD promoter-driven argA' construct. In this embodi the number of bacteria administered to the mice. The line ment, the argA' gene is inserted between the araCandaralD 45 represents the number of Nissle recovered from the fecal genes. ArgA' is flanked by a ribosome binding site, a FRT samples each day for 10 consecutive days. site, and one or more transcription terminator sequences. FIGS. 28A, 28B, and 28C depict bar graphs of ammonia FIG. 20 depicts a map of the pSC101 plasmid. Restriction levels in hyperammonemic TAA mice. FIG. 28A depicts a sites are shown in bold. bar graph of ammonia levels in hyperammonemic mice FIG. 21A depicts the nucleic acid sequence of a pSC101 50 treated with unmodified control Nissle or SYN-UCD202, a plasmid. FIG. 21B depicts the nucleotide sequence of a finrS genetically engineered strain in which the Arg repressor promoter-driven argA pSC101 plasmid. The argA' gene is deleted and the argA' gene is under the control of sequence is boxed, the ribosome binding site is highlighted, a tetracycline-inducible promoter on a high-copy plasmid. A and the finrS promoter is capitalized and bolded. total of 96 mice were tested, and the error bars represent FIG. 22 depicts a map of exemplary integration sites 55 standard error. Ammonia levels in mice treated with SYN within the E. coli 1917 Nissle chromosome. These sites UCD202 are lower than ammonia levels in mice treated with indicate regions where circuit components may be inserted unmodified control Nissle at day 4 and day 5. FIG. 28B into the chromosome without interfering with essential gene depicts a bar graph showing in vivo efficacy (ammonia expression. Backslashes (/) are used to show that the inser consumption) of SYN-UCD204 in the TAA mouse model of tion will occur between divergently or convergently 60 hepatic encephalopathy, relative to streptomycin-resistant expressed genes. Insertions within biosynthetic genes, such control Nissle (SYN-UCD103) and vehicle-only controls. as thy A, can be useful for creating nutrient auxotrophies. In FIG. 28C depicts a bar graph of the percent change in blood Some embodiments, an individual circuit component is ammonia concentration between 24–48 hours post-TAA inserted into more than one of the indicated sites. treatment. FIG. 23 depicts three bacterial strains which constitu 65 FIG. 29 depicts a bar graph of ammonia levels in hyper tively express red fluorescent protein (RFP). In strains 1-3, ammonemic spf' mice. Fifty-six spf' mice were sepa the rfp gene has been inserted into different sites within the rated into four groups. Group 1 was fed normal chow, and US 9.487,764 B2 7 8 groups 2-4 were fed 70% protein chow following an initial and excision genes cause a time delay, the kinetics of which blood draw. Groups were gavaged twice daily, with water, can be altered and optimized depending on the number and streptomycin-resistant Nissle control (SYN-UCD103), or choice of essential genes to be excised, allowing cell death SYN-UCD204, and blood was drawn 4 hours following the to occur within a matter of hours or days. The presence of first gavage. SYN-UCD204, comprising AArgR and argA' 5 multiple nested recombinases (as shown in FIG. 59) can be expressed under the control of a tetracycline-inducible pro used to further control the timing of cell death. moter on a low-copy plasmid, significantly reduced blood FIG. 38 depicts a non-limiting embodiment of the disclo ammonia to levels below the hyperammonemia threshold. Sure, where an anti-toxin is expressed from a constitutive FIG. 30 depicts a chart of ammonia consumption kinetics promoter, and expression of a heterologous gene is activated and dosing. This information may be used to determine the 10 by an exogenous environmental signal. In the absence of amount of arginine that needs to be produced in order to arabinose, the AraC transcription factor adopts a conforma absorb a therapeutically relevant amount of ammonia in tion that represses transcription. In the presence of arab UCD patients. Similar calculations may be performed for inose, the AraC transcription factor undergoes a conforma citrulline production. tional change that allows it to bind to and activate the FIG. 31 depicts an exemplary schematic of synthetic 15 AraBAD promoter, which induces expression of TetR, thus genetic circuits for treating UCDS and disorders character preventing expression of a toxin. However, when arabinose ized by hyperammonemia, via the conversion of ammonia to is not present, TetR is not expressed, and the toxin is desired products, such as citrulline or arginine. expressed, eventually overcoming the antitoxin and killing FIGS. 32A and 32B depict diagrams of exemplary con the cell. The constitutive promoter regulating expression of structs which may be used to produce a positive feedback the anti-toxin should be a weaker promoter than the pro auxotroph and select for high arginine production. FIG. 32A moter driving expression of the toxin. The AraC is under the depicts a map of the astC promoter driving expression of control of a constitutive promoter in this circuit. thy A. FIG. 32B depicts a schematic diagram of the thy A FIG. 39 depicts another non-limiting embodiment of the gene under the control of an astC promoter. The regulatory disclosure, wherein the expression of a heterologous gene is region comprises binding sites for CRP, ArgR, and RNA 25 activated by an exogenous environmental signal. In the polymerase (RNAP), and may also comprise additional absence of arabinose, the AraC transcription factor adopts a regulatory elements. conformation that represses transcription. In the presence of FIG. 33 depicts a table of exemplary bacterial genes arabinose, the AraC transcription factor undergoes a con which may be disrupted or deleted to produce an auxo formational change that allows it to bind to and activate the trophic strain. These include, but are not limited to, genes 30 AraBAD promoter, which induces expression of TetR (tet required for oligonucleotide synthesis, amino acid synthesis, repressor) and an antitoxin. The antitoxin builds up in the and cell wall synthesis. recombinant bacterial cell, while TetR prevents expression FIG. 34 depicts a table illustrating the survival of various of a toxin (which is under the control of a promoter having amino acid auxotrophs in the mouse gut, as detected 24 a TetR binding site). However, when arabinose is not pres hours and 48 hours post-gavage. These auxotrophs were 35 ent, both the antitoxin and TetR are not expressed. Since generated using BW25113, a non-Nissle strain of E. coli. TetR is not present to repress expression of the toxin, the FIG. 35 depicts one non-limiting embodiment of the toxin is expressed and kills the cell. The AraC is under the disclosure, where an exogenous environmental condition or control of a constitutive promoter in this circuit. one or more environmental signals activates expression of a FIG. 40 depicts an exemplary embodiment of an engi heterologous gene and at least one recombinase from an 40 neered bacterial strain deleted for the argR gene and express inducible promoter or inducible promoters. The recombi ing the feedback-resistant argA' gene. This strain is useful nase then flips a toxin gene into an activated conformation, for the consumption of ammonia and the production of and the natural kinetics of the recombinase create a time arginine. delay in expression of the toxin, allowing the heterologous FIG. 41 depicts an exemplary embodiment of an engi gene to be fully expressed. Once the toxin is expressed, it 45 neered bacterial strain deleted for the argR gene and express kills the cell. ing the feedback-resistant argA' gene. This strain further FIG. 36 depicts another non-limiting embodiment of the comprises one or more auxotrophic modifications on the disclosure, where an exogenous environmental condition or chromosome. This strain is useful for the consumption of one or more environmental signals activates expression of a ammonia and the production of arginine. heterologous gene, an anti-toxin, and at least one recombi 50 FIG. 42 depicts an exemplary embodiment of an engi nase from an inducible promoter or inducible promoters. neered bacterial Strain deleted for the argR and argG genes, The recombinase then flips a toxin gene into an activated and expressing the feedback-resistant argA' gene. This conformation, but the presence of the accumulated anti strain is useful for the consumption of ammonia and the toxin Suppresses the activity of the toxin. Once the exog production of citrulline. enous environmental condition or cue(s) is no longer pres 55 FIG. 43 depicts an exemplary embodiment of an engi ent, expression of the anti-toxin is turned off. The toxin is neered bacterial Strain deleted for the argR and argG genes, constitutively expressed, continues to accumulate, and kills and expressing the feedback-resistant argA' gene. This the bacterial cell. strain further comprises one or more auxotrophic modifica FIG. 37 depicts another non-limiting embodiment of the tions on the chromosome. This strain is useful for the disclosure, where an exogenous environmental condition or 60 consumption of ammonia and the production of citrulline. one or more environmental signals activates expression of a FIG. 44 depicts an exemplary embodiment of an engi heterologous gene and at least one recombinase from an neered bacterial strain which lacks ArgR binding sites and inducible promoter or inducible promoters. The recombi expresses the feedback-resistant argA' gene. This strain is nase then flips at least one excision enzyme into an activated useful for the consumption of ammonia and the production conformation. The at least one excision enzyme then excises 65 of arginine. one or more essential genes, leading to senescence, and FIG. 45 depicts an exemplary embodiment of an engi eventual cell death. The natural kinetics of the recombinase neered bacterial strain which lacks ArgR binding sites and US 9.487,764 B2 10 expresses the feedback-resistant argA' gene. This strain binant bacterial cell for treating UCD. The recombinant further comprises one or more auxotrophic modifications on bacterial cell is engineered to consume excess ammonia to the chromosome. This strain is useful for the consumption of produce beneficial byproducts to improve patient outcomes. ammonia and the production of arginine. The recombinant bacterial cell also comprises a highly FIG. 46 depicts an exemplary embodiment of an engi controllable kill switch to ensure safety. In response to a low neered bacterial strain which lacks ArgR binding sites in all oxygen environment (e.g., such as that found in the gut), the of the arginine biosynthesis operons except for argG, and FNR promoter induces expression of the Int recombinase expresses the feedback-resistant argA' gene. This strain is and also induces expression of the Kis anti-toxin. The Int useful for the consumption of ammonia and the production recombinase causes the Kid toxin gene to flip into an of citrulline. 10 activated conformation, but the presence of the accumulated FIG. 47 depicts an exemplary embodiment of an engi Kis anti-toxin Suppresses the activity of the expressed Kid neered bacterial strain which lacks ArgR binding sites in all toxin. In the presence of oxygen (e.g., outside the gut), of the arginine biosynthesis operons except for argG, and expression of the anti-toxin is turned off. Since the toxin is expresses the feedback-resistant argA' gene. This strain constitutively expressed, it continues to accumulate and kills further comprises one or more auxotrophic modifications on 15 the bacterial cell. the chromosome. This strain is useful for the consumption of FIG. 61 depicts another non-limiting embodiment of the ammonia and the production of citrulline. disclosure, wherein the expression of a heterologous gene is FIG. 48A depicts a schematic diagram of a wild-type clbA activated by an exogenous environmental signal. In the construct. FIG. 48B depicts a schematic diagram of a clbA absence of arabinose, the AraC transcription factor adopts a knockout construct. conformation that represses transcription. In the presence of FIG. 49 depicts exemplary sequences of a wild-type clbA arabinose, the AraC transcription factor undergoes a con construct and a clbA knockout construct. formational change that allows it to bind to and activate the FIG. 50 depicts a bar graph of in vitro ammonia levels in AraBAD promoter, which induces expression of TetR (tet culture media from SYN-UCD101, SYN-UCD102, and repressor) and an antitoxin. The antitoxin builds up in the blank controls at baseline, two hours, and four hours. Both 25 recombinant bacterial cell, while TetR prevents expression SYN-UCD101 and SYN-UCD102 are capable of consum of a toxin (which is under the control of a promoter having ing ammonia in vitro. a TetR binding site). However, when arabinose is not pres FIG. 51 depicts a bar graph of in vitro ammonia levels in ent, both the antitoxin and TetR are not expressed. Since culture media from SYN-UCD201, SYN-UCD203, and TetR is not present to repress expression of the toxin, the blank controls at baseline, two hours, and four hours. Both 30 toxin is expressed and kills the cell. FIG. 61 also depicts SYN-UCD201 and SYN-UCD203 are capable of consum another non-limiting embodiment of the disclosure, wherein ing ammonia in vitro. the expression of an essential gene not found in the recom FIG. 52 depicts the use of GeneGuards as an engineered binant bacteria is activated by an exogenous environmental safety component. All engineered DNA is present on a signal. In the absence of arabinose, the AraC transcription plasmid which can be conditionally destroyed. See, e.g., 35 factor adopts a conformation that represses transcription of Wright et al., “GeneGuard: A Modular Plasmid System the essential gene under the control of the araBAD promoter Designed for Biosafety.” ACS Synthetic Biology (2015) 4: and the bacterial cell cannot survive. In the presence of 307-316. arabinose, the AraC transcription factor undergoes a con FIG. 53 depicts an exemplary L-homoserine and L-me formational change that allows it to bind to and activate the thionine biosynthesis pathway. Circles indicate genes 40 AraBAD promoter, which induces expression of the essen repressed by MetJ, and deletion of metJ leads to constitutive tial gene and maintains viability of the bacterial cell. expression of these genes and activation of the pathway. FIG. 62 depicts a non-limiting embodiment of the disclo FIG. 54 depicts an exemplary histidine biosynthesis path Sure, where an anti-toxin is expressed from a constitutive way. promoter, and expression of a heterologous gene is activated FIG. 55 depicts an exemplary lysine biosynthesis path 45 by an exogenous environmental signal. In the absence of way. arabinose, the AraC transcription factor adopts a conforma FIG. 56 depicts an exemplary asparagine biosynthesis tion that represses transcription. In the presence of arab pathway. inose, the AraC transcription factor undergoes a conforma FIG. 57 depicts an exemplary glutamine biosynthesis tional change that allows it to bind to and activate the pathway. 50 AraBAD promoter, which induces expression of TetR, thus FIG. 58 depicts an exemplary tryptophan biosynthesis preventing expression of a toxin. However, when arabinose pathway. is not present, TetR is not expressed, and the toxin is FIG. 59 depicts one non-limiting embodiment of the expressed, eventually overcoming the antitoxin and killing disclosure, where an exogenous environmental condition or the cell. The constitutive promoter regulating expression of one or more environmental signals activates expression of a 55 the anti-toxin should be a weaker promoter than the pro heterologous gene and a first recombinase from an inducible moter driving expression of the toxin. promoter or inducible promoters. The recombinase then flips FIG. 63 depicts a summary of the safety design of the a second recombinase from an inverted orientation to an recombinant bacteria of the disclosure, including the inher active conformation. The activated second recombinase flips ent safety of the recombinant bacteria, as well as the the toxin gene into an activated conformation, and the 60 engineered safety-waste management (including kill natural kinetics of the recombinase create a time delay in Switches and/or auxotrophy). expression of the toxin, allowing the heterologous gene to be fully expressed. Once the toxin is expressed, it kills the cell. DESCRIPTION OF EMBODIMENTS FIG. 60 depicts a synthetic biotic engineered to target urea cycle disorder (UCD) having the kill-switch embodiment 65 The invention includes genetically engineered bacteria, described in FIG. 59. In this example, the Int recombinanse pharmaceutical compositions thereof, and methods of modu and the Kid-Kis toxin-antitoxin system are used in a recom lating or treating disorders associated with hyperammone US 9.487,764 B2 11 12 mia, e.g., urea cycle disorders and hepatic encephalopathy. non-toxic molecules, including but not limited to: arginine, The genetically engineered bacteria are capable of reducing citrulline, methionine, histidine, lysine, asparagine, gluta excess ammonia, particularly in low-oxygen conditions, mine, tryptophan, or urea. The urea cycle, for example, Such as in the mammalian gut. In certain embodiments, the enzymatically converts ammonia into urea for removal from genetically engineered bacteria reduce excess ammonia by 5 the body in the urine. Because ammonia is a source of incorporating excess nitrogen in the body into non-toxic nitrogen for many amino acids, which are synthesized via molecules, e.g., arginine, citrulline, methionine, histidine, numerous biochemical pathways, enhancement of one or lysine, asparagine, glutamine, or tryptophan. more of those amino acid biosynthesis pathways may be In order that the disclosure may be more readily under used to incorporate excess nitrogen into non-toxic mol stood, certain terms are first defined. These definitions 10 ecules. For example, arginine biosynthesis converts gluta should be read in light of the remainder of the disclosure and mate, which comprises one nitrogen atom, to arginine, as understood by a person of ordinary skill in the art. Unless which comprises four nitrogen atoms, thereby incorporating defined otherwise, all technical and scientific terms used excess nitrogen into non-toxic molecules. In humans, argi herein have the same meaning as commonly understood by nine is not reabsorbed from the large intestine, and as a a person of ordinary skill in the art. Additional definitions 15 result, excess arginine in the large intestine is not considered are set forth throughout the detailed description. to be harmful. Likewise, citrulline is not reabsorbed from the “Hyperammonemia,” “hyperammonemic,” or “excess large intestine, and as a result, excess citrulline in the large ammonia' is used to refer to increased concentrations of intestine is not considered to be harmful. Arginine biosyn ammonia in the body. Hyperammonemia is caused by thesis may also be modified to produce citrulline as an end decreased detoxification and/or increased production of product; citrulline comprises three nitrogen atoms and thus ammonia. Decreased detoxification may result from urea the modified pathway is also capable of incorporating excess cycle disorders (UCDs), such as argininosuccinic aciduria, nitrogen into non-toxic molecules. arginase deficiency, carbamoylphosphate synthetase defi "Arginine regulon,” “arginine biosynthesis regulon,' and ciency, citrullinemia, N-acetylglutamate synthetase defi “arg regulon' are used interchangeably to refer to the ciency, and ornithine transcarbamylase deficiency, or from 25 collection of operons in a given bacterial species that bypass of the liver, e.g., open ductus hepaticus; and/or comprise the genes encoding the enzymes responsible for deficiencies in glutamine synthetase (Hoffman et al., 2013; converting glutamate to arginine and/or intermediate Häberle et al., 2013). Increased production of ammonia may metabolites, e.g., citrulline, in the arginine biosynthesis result from infections, drugs, neurogenic bladder, and intes pathway. The arginine regulon also comprises operators, tinal bacterial overgrowth (Häberle et al., 2013). Other 30 promoters, ARG boxes, and/or regulatory regions associated disorders and conditions associated with hyperammonemia with those operons. The arginine regulon includes, but is not include, but are not limited to, liver disorders such as hepatic limited to, the operons encoding the arginine biosynthesis encephalopathy, acute liver failure, or chronic liver failure; enzymes N-acetylglutamate synthetase, N-acetylglutamate organic acid disorders; isovaleric aciduria; 3-methylcroto kinase, N-acetylglutamylphosphate reductase, acetylornith nylglycinuria; methylmalonic acidemia; propionic aciduria; 35 ine am inotransferase, N-acetylornithinase, ornithine trans fatty acid oxidation defects; carnitine cycle defects; carnitine carbamylase, argininosuccinate synthase, argininosuccinate deficiency; B-oxidation deficiency; lysinuric protein intoler lyase, carbamoylphosphate synthase, operators thereof, pro ance; pyrroline-5-carboxylate synthetase deficiency; pyru moters thereof, ARG boxes thereof, and/or regulatory vate carboxylase deficiency; ornithine aminotransferase regions thereof. In some embodiments, the arginine regulon deficiency; carbonic anhydrase deficiency; hyperinsulinism 40 comprises an operon encoding ornithine acetyltransferase hyperammonemia syndrome; mitochondrial disorders; Val and associated operators, promoters, ARG boxes, and/or proate therapy; asparaginase therapy; total parenteral nutri regulatory regions, either in addition to or in lieu of tion; cystoscopy with glycine-containing Solutions; post N-acetylglutamate synthetase and/or N-acetylornithinase. In lung/bone marrow transplantation; portosystemic shunting: Some embodiments, one or more operons or genes of the urinary tract infections; ureter dilation; multiple myeloma; 45 arginine regulon may be present on a plasmid in the bacte and chemotherapy (Hoffman et al., 2013; Häberle et al., rium. In some embodiments, a bacterium may comprise 2013: Pham et al., 2013: Lazier et al., 2014). In healthy multiple copies of any gene or operon in the arginine Subjects, plasma ammonia concentrations are typically less regulon, wherein one or more copies may be mutated or than about 50 umol/L (Leonard, 2006). In some embodi otherwise altered as described herein. ments, a diagnostic signal of hyperammonemia is a plasma 50 One gene may encode one enzyme, e.g., N-acetylgluta ammonia concentration of at least about 50 Limol/L, at least mate synthetase (argA). Two or more genes may encode about 80 Limol/L, at least about 150 umol/L, at least about distinct subunits of one enzyme, e.g., Subunit A and Subunit 180 umol/L, or at least about 200 umol/L (Leonard, 2006; B of carbamoylphosphate synthase (carA and carB). In some Hoffman et al., 2013; Haberle et al., 2013). bacteria, two or more genes may each independently encode “Ammonia' is used to refer to gaseous ammonia (NH), 55 the same enzyme, e.g., ornithine transcarbamylase (argF and ionic ammonia (NH), or a mixture thereof. In bodily argl). In some bacteria, the arginine regulon includes, but is fluids, gaseous ammonia and ionic ammonium exist in not limited to, argA, encoding N-acetylglutamate Syn equilibrium: thetase; argB, encoding N-acetylglutamate kinase; argC. encoding N-acetylglutamylphosphate reductase; arg), 60 encoding acetylornithine aminotransferase; argE, encoding Some clinical laboratory tests analyze total ammonia N-acetylornithinase; argG, encoding argininosuccinate Syn (NH+NH) (Walker, 2012). In any embodiment of the thase; argH, encoding argininosuccinate lyase; one or both invention, unless otherwise indicated, "ammonia' may refer of argF and argl, each of which independently encodes to gaseous ammonia, ionic ammonia, and/or total ammonia. ornithine transcarbamylase; carA, encoding the Small Sub “Detoxification' of ammonia is used to refer to the 65 unit of carbamoylphosphate synthase; carB, encoding the process or processes, natural or synthetic, by which toxic large subunit of carbamoylphosphate synthase; operons ammonia is removed and/or converted into one or more thereof; operators thereof; promoters thereof; ARG boxes US 9.487,764 B2 13 14 thereof, and/or regulatory regions thereof. In some embodi arginine biosynthesis pathway, Such that the mutant arginine ments, the arginine regulon comprises arg.J., encoding orni regulon produces more arginine and/or intermediate byprod thine acetyltransferase (either in addition to or in lieu of uct than an unmodified regulon from the same bacterial N-acetylglutamate synthetase and/or N-acetylornithinase), Subtype under the same conditions. In some embodiments, operons thereof, operators thereof, promoters thereof, ARG 5 the genetically engineered bacteria comprise an arginine boxes thereof, and/or regulatory regions thereof. feedback resistant N-acetylglutamate synthase mutant, e.g., "Arginine operon,” “arginine biosynthesis operon, and argA', and a mutant arginine regulon comprising one or “arg operon” are used interchangeably to refer to a cluster of more nucleic acid mutations in at least one ARG box for one one or more of the genes encoding arginine biosynthesis or more of the operons that encode the arginine biosynthesis enzymes under the control of a shared regulatory region 10 enzymes N-acetylglutamate kinase, N-acetylglutamylphos comprising at least one promoter and at least one ARG box. phate reductase, acetylornithine aminotransferase, N-acety In some embodiments, the one or more genes are co lornithinase, ornithine transcarbamylase, argininosuccinate transcribed and/or co-translated. Any combination of the synthase, argininosuccinate lyase, and carbamoylphosphate genes encoding the enzymes responsible for arginine bio synthase, thereby derepressing the regulon and enhancing synthesis may be organized, naturally or synthetically, into 15 arginine and/or intermediate byproduct biosynthesis. In an operon. For example, in B. subtilis, the genes encoding Some embodiments, the genetically engineered bacteria N-acetylglutamylphosphate reductase, N-acetylglutamate comprise a mutant arginine repressor comprising one or kinase, N-acetylornithinase, N-acetylglutamate kinase, more nucleic acid mutations such that arginine repressor acetylornithine aminotransferase, carbamoylphosphate Syn function is decreased or inactive, or the genetically engi thase, and ornithine transcarbamylase are organized in a neered bacteria do not have an arginine repressor (e.g., the single operon, argCAEBD-carAB-argF (see, e.g., Table 2), arginine repressor gene has been deleted), resulting in dere under the control of a shared regulatory region comprising pression of the regulon and enhancement of arginine and/or a promoter and ARG boxes. In E. coli K12 and Nissle, the intermediate byproduct biosynthesis. In some embodiments, genes encoding N-acetylornithinase, N-acetylglutamylphos the genetically engineered bacteria comprise an arginine phate reductase, N-acetylglutamate kinase, and argininosuc 25 feedback resistant N-acetylglutamate synthase mutant, e.g., cinate lyase are organized in two bipolar operons, argECBH. argA', a mutant arginine regulon comprising one or more The operons encoding the enzymes responsible for arginine nucleic acid mutations in at least one ARG box for each of biosynthesis may be distributed at different loci across the the operons that encode the arginine biosynthesis enzymes, chromosome. In unmodified bacteria, each operon may be and/or a mutant or deleted arginine repressor. In some repressed by arginine via ArgR. In some embodiments, 30 embodiments, the genetically engineered bacteria comprise arginine and/or intermediate byproduct production may be an arginine feedback resistant N-acetylglutamate synthase altered in the genetically engineered bacteria of the inven mutant, e.g., argA' and a mutant arginine regulon compris tion by modifying the expression of the enzymes encoded by ing one or more nucleic acid mutations in at least one ARG the arginine biosynthesis operons as provided herein. Each box for each of the operons that encode the arginine bio arginine operon may be present on a plasmid or bacterial 35 synthesis enzymes. In some embodiments, the genetically chromosome. In addition, multiple copies of any arginine engineered bacteria comprise an arginine feedback resistant operon, or a gene or regulatory region within an arginine N-acetylglutamate synthase mutant, e.g., argA' and a operon, may be present in the bacterium, wherein one or mutant or deleted arginine repressor. In some embodiments, more copies of the operon or gene or regulatory region may the mutant arginine regulon comprises an operon encoding be mutated or otherwise altered as described herein. In some 40 wild-type N-acetylglutamate synthetase and one or more embodiments, the genetically engineered bacteria are engi nucleic acid mutations in at least one ARG box for said neered to comprise multiple copies of the same product (e.g., operon. In some embodiments, the mutant arginine regulon operon or gene or regulatory region) to enhance copy comprises an operon encoding wild-type N-acetylglutamate number or to comprise multiple different components of an synthetase and mutant or deleted arginine repressor. In some operon performing multiple different functions. 45 embodiments, the mutant arginine regulon comprises an “ARG box consensus sequence” refers to an ARG box operon encoding ornithine acetyltransferase (either in addi nucleic acid sequence, the nucleic acids of which are known tion to or in lieu of N-acetylglutamate synthetase and/or to occur with high frequency in one or more of the regula N-acetylornithinase) and one or more nucleic acid mutations tory regions of argR, argA, argB, argC, arg), argE, argF. in at least one ARG box for said operon. argG, argH, argl, arg.J. carA, and/or carB. As described 50 The ARG boxes overlap with the promoter in the regu above, each arg operon comprises a regulatory region com latory region of each arginine biosynthesis operon. In the prising at least one 18-nucleotide imperfect palindromic mutant arginine regulon, the regulatory region of one or sequence, called an ARG box, that overlaps with the pro more arginine biosynthesis operons is Sufficiently mutated to moter and to which the repressor protein binds (Tian et al., disrupt the palindromic ARG box sequence and reduce ArgR 1992). The nucleotide sequences of the ARG boxes may 55 binding, but still comprises sufficiently high homology to the vary for each operon, and the consensus ARG box sequence promoter of the non-mutant regulatory region to be recog is A/T nTGAAT A/T A/TT/AT/AATTCAn T/A (Maas, nized as the native operon-specific promoter. The operon 1994). The arginine repressor binds to one or more ARG comprises at least one nucleic acid mutation in at least one boxes to actively inhibit the transcription of the arginine ARG box such that ArgR binding to the ARG box and to the biosynthesis enzyme(s) that are operably linked to that one 60 regulatory region of the operon is reduced or eliminated. In or more ARG boxes. some embodiments, bases that are protected from DNA "Mutant arginine regulon' or “mutated arginine regulon' methylation and bases that are protected from hydroxyl is used to refer to an arginine regulon comprising one or radical attack during ArgR binding are the primary targets more nucleic acid mutations that reduce or eliminate argi for mutations to disrupt ArgR binding (see, e.g., FIG. 6). The nine-mediated repression of each of the operons that encode 65 promoter of the mutated regulatory region retains Sufi the enzymes responsible for converting glutamate to argi ciently high homology to the promoter of the non-mutant nine and/or an intermediate byproduct, e.g., citrulline, in the regulatory region such that RNA polymerase binds to it with US 9.487,764 B2 15 16 sufficient affinity to promote transcription of the operably An “inducible promoter refers to a regulatory region that linked arginine biosynthesis enzyme(s). In some embodi is operably linked to one or more genes, wherein expression ments, the G/C:A/T ratio of the promoter of the mutant of the gene(s) is increased in the presence of an inducer of differs by no more than 10% from the G/C:A/T ratio of the said regulatory region. wild-type promoter. “Exogenous environmental condition(s) refer to In some embodiments, more than one ARG box may be setting(s) or circumstance(s) under which the promoter present in a single operon. In one aspect of these embodi described above is induced. In some embodiments, the ments, at least one of the ARG boxes in an operon is altered exogenous environmental conditions are specific to the gut to produce the requisite reduced ArgR binding to the regu of a mammal. In some embodiments, the exogenous envi latory region of the operon. In an alternate aspect of these 10 ronmental conditions are specific to the upper gastrointes embodiments, each of the ARG boxes in an operon is altered tinal tract of a mammal. In some embodiments, the exog to produce the requisite reduced ArgR binding to the regu enous environmental conditions are specific to the lower latory region of the operon. gastrointestinal tract of a mammal. In some embodiments, “Reduced ArgR binding is used to refer to a reduction in 15 the exogenous environmental conditions are specific to the repressor binding to an ARG box in an operon or a reduction Small intestine of a mammal. In some embodiments, the in the total repressor binding to the regulatory region of said exogenous environmental conditions are low-oxygen, operon, as compared to repressor binding to an unmodified microaerobic, or anaerobic conditions, such as the environ ARG box and regulatory region in bacteria of the same ment of the mammalian gut. In some embodiments, exog Subtype under the same conditions. In some embodiments, enous environmental conditions are molecules or metabo ArgR binding to a mutant ARG box and regulatory region of lites that are specific to the mammalian gut, e.g., propionate. an operon is at least about 50% lower, at least about 60% In some embodiments, the genetically engineered bacteria of lower, at least about 70% lower, at least about 80% lower, the invention comprise an oxygen level-dependent promoter. at least about 90% lower, or at least about 95% lower than Bacteria have evolved transcription factors that are capable ArgR binding to an unmodified ARG box and regulatory 25 of sensing oxygen levels. Different signaling pathways may region in bacteria of the same Subtype under the same be triggered by different oxygen levels and occur with conditions. In some embodiments, reduced ArgR binding to different kinetics. An "oxygen level-dependent promoter” or a mutant ARG box and regulatory region results in at least "oxygen level-dependent regulatory region” refers to a about 1.5-fold, at least about 2-fold, at least about 10-fold, nucleic acid sequence to which one or more oxygen level 30 sensing transcription factors is capable of binding, wherein at least about 15-fold, at least about 20-fold, at least about the binding and/or activation of the corresponding transcrip 30-fold, at least about 50-fold, at least about 100-fold, at tion factor activates downstream gene expression. least about 200-fold, at least about 300-fold, at least about Examples of oxygen level-dependent transcription factors 400-fold, at least about 500-fold, at least about 600-fold, at include, but are not limited to, FNR, ANR, and DNR. least about 700-fold, at least about 800-fold, at least about 35 Corresponding FNR-responsive promoters, ANR-respon 900-fold, at least about 1,000-fold, or at least about 1,500 sive promoters, and DNR-responsive promoters are known fold increased mRNA expression of the one or more genes in the art (see, e.g., Castiglione et al., 2009; Eiglmeier et al., in the operon. 1989; Galimand et al., 1991; Hasegawa et al., 1998: Hoeren “ArgR' or “arginine repressor is used to refer to a protein et al., 1993; Salmon et al., 2003), and non-limiting examples that is capable of Suppressing arginine biosynthesis by 40 are shown in Table 1. regulating the transcription of arginine biosynthesis genes in the arginine regulon. When expression of the gene that TABLE 1. encodes for the arginine repressor protein ("argR') is Examples of transcription factors and increased in a wild-type bacterium, arginine biosynthesis is responsive genes and regulatory regions decreased. When expression of argR is decreased in a 45 wild-type bacterium, or if argR is deleted or mutated to Transcription Examples of responsive genes, inactivate arginine repressor function, arginine biosynthesis Factor promoters, and/or regulatory regions: is increased. FNR nirB, yolfz, pdhR, focA, ndH, hlyE, Bacteria that “lack any functional ArgR'' and “ArgR narK, narX, narG, yfiD, tdcD deletion bacteria' are used to refer to bacteria in which each 50 ANR arcDABC arginine repressor has significantly reduced or eliminated DNR norb, norC activity as compared to unmodified arginine repressor from bacteria of the same Subtype under the same conditions. As used herein, a “non-native' nucleic acid sequence Reduced or eliminated arginine repressor activity can result refers to a nucleic acid sequence not normally present in a in, for example, increased transcription of the arginine 55 bacterium, e.g., an extra copy of an endogenous sequence, or biosynthesis genes and/or increased concentrations of argi a heterologous sequence such as a sequence from a different nine and/or intermediate byproducts, e.g., citrulline. Bacte species, strain, or Substrain of bacteria, or a sequence that is ria in which arginine repressor activity is reduced or elimi modified and/or mutated as compared to the unmodified nated can be generated by modifying the bacterial argR gene sequence from bacteria of the same Subtype. In some or by modifying the transcription of the argR gene. For 60 embodiments, the non-native nucleic acid sequence is a example, the chromosomal argR gene can be deleted, can be synthetic, non-naturally occurring sequence (see, e.g., Pur mutated, or the argR gene can be replaced with an argR gene cell et al., 2013). The non-native nucleic acid sequence may that does not exhibit wild-type repressor activity. be a regulatory region, a promoter, a gene, and/or one or "Operably linked’ refers a nucleic acid sequence, e.g., a more genes in gene cassette. In some embodiments, “non gene encoding feedback resistant ArgA, that is joined to a 65 native' refers to two or more nucleic acid sequences that are regulatory region sequence in a manner which allows not found in the same relationship to each other in nature. expression of the nucleic acid sequence, e.g., acts in cis. The non-native nucleic acid sequence may be present on a US 9.487,764 B2 17 18 plasmid or chromosome. In some embodiments, the geneti engineered bacteria produce at least about 1.5-fold, at least cally engineered bacteria of the invention comprise a gene about 2-fold, at least about 10-fold, at least about 15-fold, at cassette that is operably linked to a directly or indirectly least about 20-fold, at least about 30-fold, at least about inducible promoter that is not associated with said gene 50-fold, at least about 100-fold, at least about 200-fold, at cassette in nature, e.g., a FNR-responsive promoter operably least about 300-fold, at least about 400-fold, at least about linked to a butyrogenic gene cassette. 500-fold, at least about 600-fold, at least about 700-fold, at “Constitutive promoter” refers to a promoter that is least about 800-fold, at least about 900-fold, at least about capable of facilitating continuous transcription of a coding 1,000-fold, or at least about 1,500-fold more citrulline or sequence or gene under its control and/or to which it is other intermediate byproduct than unmodified bacteria of the operably linked. Constitutive promoters and variants are 10 same Subtype under the same conditions. In some embodi well known in the art and include, but are not limited to, ments, the mRNA transcript levels of one or more of the BBa J23100, a constitutive Escherichia coli o' promoter arginine biosynthesis genes in the genetically engineered (e.g., an osmy promoter (International Genetically Engi bacteria are at least about 1.5-fold, at least about 2-fold, at neered Machine (iGEM) Registry of Standard Biological least about 10-fold, at least about 15-fold, at least about Parts Name BBa J45992; BBa J45993)), a constitutive 15 20-fold, at least about 30-fold, at least about 50-fold, at least Escherichia coli of promoter (e.g. htpG heat shock pro about 100-fold, at least about 200-fold, at least about 300 moter (BBa J45504)), a constitutive Escherichia coli o' fold, at least about 400-fold, at least about 500-fold, at least promoter (e.g., lacq promoter (BBa J54200; BBa J56015), about 600-fold, at least about 700-fold, at least about 800 E. coli CreABCD phosphate sensing operon promoter fold, at least about 900-fold, at least about 1,000-fold, or at (BBa J64951), GInRS promoter (BBa K088007), lacZ pro least about 1,500-fold higher than the mRNA transcript moter (BBa K1 19000; BBa K119001); M13K07 gene I levels in unmodified bacteria of the same subtype under the promoter (BBa M13101); M13K07 gene II promoter same conditions. In certain embodiments, the unmodified (BBa M13102), M13KO7 gene III promoter bacteria will not have detectable levels of arginine, inter (BBa M13103), M13KO7 gene IV promoter mediate byproduct, and/or transcription of the gene(s) in (BBa M13104), M13KO7 gene V promoter 25 Such operons. However, protein and/or transcription levels (BBa M13105), M13KO7 gene VI promoter of arginine and/or intermediate byproduct will be detectable (BBa M13106), M13K07 gene VIII promoter in the corresponding genetically engineered bacterium hav (BBa M13108), M13110 (BBa M13110)), a constitutive ing the mutant arginine regulon. Transcription levels may be Bacillus subtilis O' promoter (e.g., promoter veg detected by directly measuring mRNA levels of the genes. (BBa K143013), promoter 43 (BBa K143013), P. 30 Methods of measuring arginine and/or intermediate byprod (BBa K823000), Prep 4 (BBa K823.002), Pveg uct levels, as well as the levels of transcript expressed from (BBa K823003)), a constitutive Bacillus subtilis o' pro the arginine biosynthesis genes, are known in the art. Argi moter (e.g., promoter ctic (BBa K143010), promoter gsiB nine and citrulline, for example, may be measured by mass (BBa K143011)), a Salmonella promoter (e.g., PspV2 from spectrometry. Salmonella (BBa K112706), Pspv from Salmonella 35 “Gut” refers to the organs, glands, tracts, and systems that (BBa K112707)), a bacteriophage T7 promoter (e.g., T7 are responsible for the transfer and digestion of food, promoter (BBa 712074; BBa 719005; BBa J34814; absorption of nutrients, and excretion of waste. In humans, BBa J64997: BBa K113010; BBa K113011; the gut comprises the gastrointestinal tract, which starts at BBa K113012; BBa R0085; BBa RO180; BBa RO181; the mouth and ends at the anus, and additionally comprises BBa RO182: BBa RO183; BBa ZO251; BBa Z0252: 40 the esophagus, stomach, Small intestine, and large intestine. BBa Z0253)), and a bacteriophage SP6 promoter (e.g., SP6 The gut also comprises accessory organs and glands, such as promoter (BBa J64998)). the spleen, liver, gallbladder, and pancreas. The upper gas As used herein, genetically engineered bacteria that trointestinal tract comprises the esophagus, stomach, and “overproduce’ arginine or an intermediate byproduct, e.g., duodenum of the small intestine. The lower gastrointestinal citrulline, refer to bacteria that comprise a mutant arginine 45 tract comprises the remainder of the Small intestine, i.e., the regulon. For example, the engineered bacteria may comprise jejunum and ileum, and all of the large intestine, i.e., the a feedback resistant form of ArgA, and when the arginine cecum, colon, rectum, and anal canal. Bacteria can be found feedback resistant ArgA is expressed, are capable of pro throughout the gut, e.g., in the gastrointestinal tract, and ducing more arginine and/or intermediate byproduct than particularly in the intestines. unmodified bacteria of the same subtype under the same 50 “Non-pathogenic bacteria' refer to bacteria that are not conditions. The genetically engineered bacteria may alter capable of causing disease or harmful responses in a host. In natively or further comprise a mutant arginine regulon Some embodiments, non-pathogenic bacteria are commensal comprising one or more nucleic acid mutations in at least bacteria. Examples of non-pathogenic bacteria include, but one ARG box for each of the operons that encode the are not limited to Bacillus, Bacteroides, Bifidobacterium, arginine biosynthesis enzymes. The genetically engineered 55 Brevibacteria, Clostridium, Enterococcus, Escherichia coli, bacteria may alternatively or further comprise a mutant or Lactobacillus, Lactococcus, Saccharomyces, and Staphyllo deleted arginine repressor. In some embodiments, the geneti coccus, e.g., Bacillus coagulans, Bacillus subtilis, Bacte cally engineered bacteria produce at least about 1.5-fold, at roides fragilis, Bacteroides subtilis, Bacteroides thetaiotao least about 2-fold, at least about 10-fold, at least about micron, Bifidobacterium bifidum, Bifidobacterium infantis, 15-fold, at least about 20-fold, at least about 30-fold, at least 60 Bifidobacterium lactis, Bifidobacterium longum, about 50-fold, at least about 100-fold, at least about 200 Clostridium butyricum, Enterococcus faecium, Lactobacil fold, at least about 300-fold, at least about 400-fold, at least lus acidophilus, Lactobacillus bulgaricus, Lactobacillus about 500-fold, at least about 600-fold, at least about 700 casei, Lactobacillus johnsonii, Lactobacillus paracasei, fold, at least about 800-fold, at least about 900-fold, at least Lactobacillus plantarum, Lactobacillus reuteri, Lactobacil about 1,000-fold, or at least about 1,500-fold more arginine 65 lus rhamnosus, Lactococcus lactis, and Saccharomyces bou than unmodified bacteria of the same subtype under the lardii (Sonnenborn et al., 2009; Dinleyici et al., 2014: U.S. same conditions. In some embodiments, the genetically Pat. Nos. 6,835,376; 6,203.797; 5,589,168; 7,731,976). US 9.487,764 B2 19 20 Naturally pathogenic bacteria may be genetically engineered may encompass reducing or eliminating excess ammonia to provide reduce or eliminate pathogenicity. and/or associated symptoms, and does not necessarily “Probiotic' is used to refer to live, non-pathogenic micro encompass the elimination of the underlying hyperammo organisms, e.g., bacteria, which can confer health benefits to nemia-associated disorder. a host organism that contains an appropriate amount of the As used herein a “pharmaceutical composition” refers to microorganism. In some embodiments, the host organism is a preparation of genetically engineered bacteria of the a mammal. In some embodiments, the host organism is a invention with other components such as a physiologically human. Some species, strains, and/or subtypes of non Suitable carrier and/or excipient. pathogenic bacteria are currently recognized as probiotic The phrases “physiologically acceptable carrier and bacteria. Examples of probiotic bacteria include, but are not 10 “pharmaceutically acceptable carrier' which may be used limited to, Bifidobacteria, Escherichia coli, Lactobacillus, interchangeably refer to a carrier or a diluent that does not and Saccharomyces, e.g., Bifidobacterium bifidum, Entero cause significant irritation to an organism and does not coccus faecium, Escherichia coli strain Nissle, Lactobacil abrogate the biological activity and properties of the admin lus acidophilus, Lactobacillus bulgaricus, Lactobacillus istered bacterial compound. An adjuvant is included under paracasei, Lactobacillus plantarum, and Saccharomyces 15 these phrases. boulardii (Dinleyici et al., 2014: U.S. Pat. Nos. 5,589,168: The term “excipient” refers to an inert substance added to 6,203,797; 6,835,376). The probiotic may be a variant or a a pharmaceutical composition to further facilitate adminis mutant strain of bacterium (Arthur et al., 2012; Cuevas tration of an active ingredient. Examples include, but are not Ramos et al., 2010; Olier et al., 2012: Nougayrede et al., limited to, calcium bicarbonate, calcium phosphate, various 2006). Non-pathogenic bacteria may be genetically engi Sugars and types of starch, cellulose derivatives, gelatin, neered to enhance or improve desired biological properties, vegetable oils, polyethylene glycols, and Surfactants, includ e.g., Survivability. Non-pathogenic bacteria may be geneti ing, for example, polysorbate 20. cally engineered to provide probiotic properties. Probiotic The terms “therapeutically effective dose” and “therapeu bacteria may be genetically engineered to enhance or tically effective amount” are used to refer to an amount of a improve probiotic properties. 25 compound that results in prevention, delay of onset of As used herein, “stably maintained' or “stable' bacterium symptoms, or amelioration of symptoms of a condition, e.g., is used to refer to a bacterial host cell carrying non-native hyperammonemia. A therapeutically effective amount may, genetic material, e.g., a feedback resistant argA gene, mutant for example, be sufficient to treat, prevent, reduce the arginine repressor, and/or other mutant arginine regulon that severity, delay the onset, and/or reduce the risk of occur is incorporated into the host genome or propagated on a 30 rence of one or more symptoms of a disorder associated with self-replicating extra-chromosomal plasmid, Such that the elevated ammonia concentrations. A therapeutically effec non-native genetic material is retained, expressed, and tive amount, as well as a therapeutically effective frequency propagated. The stable bacterium is capable of survival of administration, can be determined by methods known in and/or growth in vitro, e.g., in medium, and/or in Vivo, e.g., the art and discussed below. in the gut. For example, the stable bacterium may be a 35 The articles “a” and “an,” as used herein, should be genetically engineered bacterium comprising an argA' understood to mean 'at least one.” unless clearly indicated gene, in which the plasmid or chromosome carrying the to the contrary. argA' gene is stably maintained in the bacterium, such that The phrase “and/or, when used between elements in a argA' can be expressed in the bacterium, and the bacterium list, is intended to mean either (1) that only a single listed is capable of survival and/or growth in vitro and/or in vivo. 40 element is present, or (2) that more than one element of the As used herein, the term “treat' and its cognates refer to list is present. For example, “A, B, and/or C indicates that an amelioration of a disease or disorder, or at least one the selection may be A alone; B alone; C alone; A and B: A discernible symptom thereof. In another embodiment, and C: B and C: or A, B, and C. The phrase “and/or may “treat” refers to an amelioration of at least one measurable be used interchangeably with “at least one of or “one or physical parameter, not necessarily discernible by the 45 more of the elements in a list. patient. In another embodiment, “treat” refers to inhibiting Bacteria the progression of a disease or disorder, either physically The genetically engineered bacteria of the invention are (e.g., stabilization of a discernible symptom), physiologi capable of reducing excess ammonia and converting ammo cally (e.g., stabilization of a physical parameter), or both. In nia and/or nitrogen into alternate byproducts. In some another embodiment, “treat” refers to slowing the progres 50 embodiments, the genetically engineered bacteria are non sion or reversing the progression of a disease or disorder. As pathogenic bacteria. In some embodiments, the genetically used herein, prevent' and its cognates refer to delaying the engineered bacteria are commensal bacteria. In some onset or reducing the risk of acquiring a given disease or embodiments, the genetically engineered bacteria are pro disorder. biotic bacteria. In some embodiments, the genetically engi Those in need of treatment may include individuals 55 neered bacteria are naturally pathogenic bacteria that are already having a particular medical disorder, as well as those modified or mutated to reduce or eliminate pathogenicity. at risk of having, or who may ultimately acquire the disorder. Exemplary bacteria include, but are not limited to Bacillus, The need for treatment is assessed, for example, by the Bacteroides, Bifidobacterium, Brevibacteria, Clostridium, presence of one or more risk factors associated with the Enterococcus, Escherichia coli, Lactobacillus, Lactococcus, development of a disorder, the presence or progression of a 60 Saccharomyces, and Staphylococcus, e.g., Bacillus coagul disorder, or likely receptiveness to treatment of a subject lans, Bacillus subtilis, Bacteroides fragilis, Bacteroides sub having the disorder. Primary hyperammonemia is caused by tilis, Bacteroides thetaiotaomicron, Bifidobacterium bifi UCDs, which are autosomal recessive or X-linked inborn dum, Bifidobacterium infantis, Bifidobacterium lactis, errors of metabolism for which there are no known cures. Bifidobacterium longum, Clostridium butyricum, Enterococ Hyperammonemia can also be secondary to other disrup 65 cus faecium, Lactobacillus acidophilus, Lactobacillus bul tions of the urea cycle, e.g., toxic metabolites, infections, garicus, Lactobacillus casei, Lactobacillus johnsonii, Lac and/or Substrate deficiencies. Treating hyperammonemia tobacillus paracasei, Lactobacillus plantarum, US 9.487,764 B2 21 22 Lactobacillus reuteri, Lactobacillus rhamnosus, Lactococ al., 1986). The first five steps involve N-acetylation to cus lactis, and Saccharomyces boulardii. In certain embodi generate an ornithine precursor. In the sixth step, ornithine ments, the genetically engineered bacteria are selected from transcarbamylase (also known as ornithine carbamoyltrans the group consisting of Bacteroides fragilis, Bacteroides ferase) catalyzes the formation of citrulline. The final two thetaiotaomicron, Bacteroides subtilis, Bifidobacterium bifi steps involve carbamoylphosphate utilization to generate dum, Bifidobacterium infantis, Bifidobacterium lactis, arginine from citrulline. Clostridium butyricum, Escherichia coli Nissle, Lactobacil In some bacteria, e.g., Bacillus Stearothermophilus and lus acidophilus, Lactobacillus plantarum, Lactobacillus Neisseria gonorrhoeae, the first and fifth steps in arginine reuteri, and Lactococcus lactis. biosynthesis may be catalyzed by the bifunctional enzyme In some embodiments, the genetically engineered bacteria 10 ornithine acetyltransferase. This bifunctionality was initially are Escherichia coli strain Nissle 1917 (E. coli Nissle), a identified when ornithine acetyltransferase (arg.J) was shown Gram-negative bacterium of the Enterobacteriaceae family to complement both N-acetylglutamate synthetase (argA) that “has evolved into one of the best characterized probi and N-acetylornithinase (argE) auxotrophic gene mutations otics’ (Ukena et al., 2007). The strain is characterized by its in E. coli (Mountain et al., 1984; Crabeel et al., 1997). complete harmlessness (Schultz, 2008), and has GRAS 15 ArgA encodes N-acetylglutamate synthetase, argB (generally recognized as safe) status (Reister et al., 2014, encodes N-acetylglutamate kinase, argC encodes N-acetyl emphasis added). Genomic sequencing confirmed that E. glutamylphosphate reductase, arg) encodes acetylornithine coli Nissle lacks prominent virulence factors (e.g., E. coli aminotransferase, argE encodes N-acetylornithinase, argF C.-hemolysin, P-fimbrial adhesins) (Schultz, 2008). In addi encodes ornithine transcarbamylase, argl also encodes orni tion, it has been shown that E. coli Nissle does not carry thine transcarbamylase, argG encodes argininosuccinate pathogenic adhesion factors, does not produce any entero synthase, argH encodes argininosuccinate lyase, and arg.J toxins or cytotoxins, is not invasive, and not uropathogenic encodes ornithine acetyltransferase. CarA encodes the Small (Sonnenbornet al., 2009). As early as in 1917, E. coli Nissle A subunit of carbamoylphosphate synthase having glutami was packaged into medicinal capsules, called Mutaflor, for nase activity, and carB encodes the large B subunit of therapeutic use. E. coli Nissle has since been used to treat 25 carbamoylphosphate synthase that catalyzes carbamoyl ulcerative colitis in humans in vivo (Rembacken et al., phosphate synthesis from ammonia. Different combinations 1999), to treat inflammatory bowel disease, Crohn's disease, of one or more of these arginine biosynthesis genes (i.e., and pouchitis in humans in vivo (Schultz, 2008), and to argA, argB, argC, arg), argE, argF, argG, argH, argl, arg.J. inhibit enteroinvasive Salmonella, Legionella, Yersinia, and carA, and carB) may be organized, naturally or synthetically, Shigella in vitro (Altenhoefer et al., 2004). It is commonly 30 into one or more operons, and Such organization may vary accepted that E. coli Nissle's therapeutic efficacy and safety between bacterial species, strains, and Subtypes (see, e.g., have convincingly been proven (Ukena et al., 2007). Table 2). The regulatory region of each operon contains at One of ordinary skill in the art would appreciate that the least one ARG box, and the number of ARG boxes per genetic modifications disclosed herein may be modified and regulatory region may vary between operons and bacteria. adapted for other species, strains, and Subtypes of bacteria. 35 All of the genes encoding these enzymes are subject to It is known, for example, that arginine-mediated regulation repression by arginine via its interaction with ArgR to form is remarkably well conserved in very divergent bacteria, i.e., a complex that binds to the regulatory region of each gene gram-negative bacteria, Such as E. coli, Salmonella enterica and inhibits transcription. N-acetylglutamate synthetase is serovar Typhimurium, Thermotoga, and Moritella profilinda, also subject to allosteric feedback inhibition at the protein and gram-positive bacteris, such as B. subtilis, Geobacillus 40 level by arginine alone (Tuchman et al., 1997: Caldara et al., Stearothermophilus, and Streptomyces clavuligerus, as well 2006; Caldara et al., 2008; Caldovic et al., 2010). as other bacteria (Nicoloff et al., 2004). Furthermore, the The genes that regulate arginine biosynthesis in bacteria arginine repressor is universally conserved in bacterial are scattered across the chromosome and organized into genomes and that its recognition signal (the ARG box), a multiple operons that are controlled by a single repressor, weak palindrome, is also conserved between genomes (Ma 45 which Maas and Clark (1964) termed a “regulon. Each karova et al., 2001). operon is regulated by a regulatory region comprising at Unmodified E. coli Nissle and the genetically engineered least one 18-nucleotide imperfect palindromic sequence, bacteria of the invention may be destroyed, e.g., by defense called an ARG box, that overlaps with the promoter and to factors in the gut or blood serum (Sonnenborn et al., 2009). which the repressor protein binds (Tian et al., 1992; Tian et The residence time of bacteria in vivo can be determined 50 al., 1994). The argR gene encodes the repressor protein, using the methods described in Example 19. In some which binds to one or more ARG boxes (Lim et al., 1987). embodiments, the residence time is calculated for a human Arginine functions as a corepressor that activates the argi Subject. A non-limiting example using a streptomycin-resis nine repressor. The ARG boxes that regulate each operon tant E. coli Nissle comprising a wild-type ArgR and a may be non-identical, and the consensus ARG box sequence wild-type arginine regulon is provided (see FIG. 27). In 55 is A/T nTGAAT A/T A/TT/AT/AATTCAn T/A (Maas, Some embodiments, residence time in vivo is calculated for 1994). In addition, the regulatory region of argR contains the genetically engineered bacteria of the invention. two promoters, one of which overlaps with two ARG boxes Reduction of Excess Ammonia and is autoregulated. Arginine Biosynthesis Pathway In some embodiments, the genetically engineered bacteria In bacteria Such as Escherichia coli (E. coli), the arginine 60 comprise a mutant arginine regulon and produce more biosynthesis pathway is capable of converting glutamate to arginine and/or an intermediate byproduct, e.g., citrulline, arginine in an eight-step enzymatic process involving the than unmodified bacteria of the same subtype under the enzymes N-acetylglutamate synthetase, N-acetylglutamate same conditions. The mutant arginine regulon comprises one kinase, N-acetylglutamate phosphate reductase, acetylorni or more nucleic acid mutations that reduce or prevent thine aminotransferase, N-acetylornithinase, carbamoyl 65 arginine-mediated repression—via ArgR binding to ARG phosphate synthase, ornithine transcarbamylase, arginino boxes and/or arginine binding to N-acetylglutamate Syn Succinate synthase, and argininosuccinate lyase (Cunin et thetase—of one or more of the operons that encode the US 9.487,764 B2 23 24 enzymes responsible for converting glutamate to arginine in suitable modification(s) to the lysine biosynthesis pathway the arginine biosynthesis pathway, thereby enhancing argi may be used to increase ammonia consumption. nine and/or intermediate byproduct biosynthesis. Asparagine Biosynthesis Pathway In alternate embodiments, the bacteria are genetically Asparagine is synthesized directly from oxaloacetate and engineered to consume excess ammonia via another meta aspartic acid via the oxaloacetate transaminase and aspara bolic pathway, e.g., a histidine biosynthesis pathway, a gine synthetase enzymes, respectively. In the second step of methionine biosynthesis pathway, a lysine biosynthesis this pathway, either L-glutamine or ammonia serves as the pathway, an asparagine biosynthesis pathway, a glutamine amino group donor. In some embodiments, the genetically biosynthesis pathway, and a tryptophan biosynthesis path engineered bacteria of the invention overproduce asparagine way. 10 as compared to unmodified bacteria of the same Subtype Histidine Biosynthesis Pathway under the same conditions, thereby consuming excess Histidine biosynthesis, for example, is carried out by eight ammonia and reducing hyperammonemia. Alternatively, genes located within a single operon in E. coli. Three of the asparagine synthesis may be optimized by placing one or eight genes of the operon (hisD, hisB, and hisl) encode 15 both of these genes under the control of an inducible bifunctional enzymes, and two (hisH and hisF) encode promoter, such as a FNR-inducible promoter. Any other polypeptide chains which together form one enzyme to Suitable modification(s) to the asparagine biosynthesis path catalyze a single step, for a total of 10 enzymatic reactions way may be used to increase ammonia consumption. (Alifano et al., 1996). The product of the hisG gene, ATP Glutamine Biosynthesis Pathway phosphoribosyltransferase, is inhibited at the protein level The synthesis of glutamine and glutamate from ammonia by histidine. In some embodiments, the genetically engi and oxoglutarate is tightly regulated by three enzymes. neered bacteria of the invention comprise a feedback-resis Glutamate dehydrogenase catalyzes the reductive amination tant hisG. Bacteria may be mutagenized and/or screened for of oxoglutarate to yield glutamate in a single step. Gluta feedback-resistant hisG mutants using techniques known in mine synthetase catalyzes the ATP-dependent condensation the art. Bacteria engineered to comprise a feedback-resistant 25 of glutamate and ammonia to form glutamine (Lodeiro et al., hisG would have elevated levels of histidine production, 2008). Glutamine synthetase also acts with glutamine— thus increasing ammonia consumption and reducing hyper oxoglutarate amino transferase (also known as glutamate ammonemia. Alternatively, one or more genes required for synthase) in a cyclic reaction to produce glutamate from histidine biosynthesis could be placed under the control of glutamine and oxoglutarate. In some embodiments, the an inducible promoter, such as a FNR-inducible promoter, 30 and allow for increased production of rate-limiting enzymes. genetically engineered bacteria of the invention express Any other suitable modification(s) to the histidine biosyn glutamine synthetase at elevated levels as compared to thesis pathway may be used to increase ammonia consump unmodified bacteria of the same subtype under the same tion. conditions. Bacteria engineered to have increased expres Methionine Biosynthesis Pathway 35 sion of glutamine synthetase would have elevated levels of The bacterial methionine regulon controls the three-step glutamine production, thus increasing ammonia consump synthesis of methionine from homoserine (i.e., acylation, tion and reducing hyperammonemia. Alternatively, expres Sulfurylation, and methylation). The metJ gene encodes a sion of glutamate dehydrogenase and/or glutamine-oxoglu regulatory protein that, when combined with methionine or tarate amino transferase could be modified to favor the a derivative thereof, causes repression of genes within the 40 consumption of ammonia. Since the production of glutamine methionine regulon at the transcriptional level (Saint-Girons synthetase is regulated at the transcriptional level by nitro et al., 1984; Shoeman et al., 1985). In some embodiments, gen (Feng et al., 1992; Van Heeswijk et al., 2013), placing the genetically engineered bacteria of the invention com the glutamine synthetase gene under the control of different prise deleted, disrupted, or mutated metJ. Bacteria engi inducible promoter, such as a FNR-inducible promoter, may neered to delete, disrupt, or mutate metJ would have 45 also be used to improve glutamine production. Any other elevated levels of methionine production, thus increasing Suitable modification(s) to the glutamine and glutamate ammonia consumption and reducing hyperammonemia. Any biosynthesis pathway may be used to increase ammonia other suitable modification(s) to the methionine biosynthesis consumption. pathway may be used to increase ammonia consumption. Tryptophan Biosynthesis Pathway Lysine Biosynthesis Pathway 50 In most bacteria, the genes required for the synthesis of Microorganisms synthesize lysine by one of two path tryptophan from a chorismate precursor are organized as a ways. The diaminopimelate (DAP) pathway is used to single transcriptional unit, the trp operon. The trp operon is synthesize lysine from aspartate and pyruvate (Dogovski et under the control of a single promoter that is inhibited by the al., 2012), and the aminoadipic acid pathway is used to tryptophan repressor (TrpR) when high levels of tryptophan synthesize lysine from alpha-ketoglutarate and acetyl coen 55 are present. Transcription of the trp operon may also be Zyme A. The dihydrodipicolinate synthase (DHDPS) terminated in the presence of high levels of charged tryp enzyme catalyzes the first step of the DAP pathway, and is tophan tRNA. In some embodiments, the genetically engi subject to feedback inhibition by lysine (Liu et al., 2010; neered bacteria of the invention comprise a deleted, dis Reboulet al., 2012). In some embodiments, the genetically rupted, or mutated trpR gene. The deletion, disruption, or engineered bacteria of the invention comprise a feedback 60 mutation of the trpR gene, and consequent inactivation of resistant DHDPS. Bacteria engineered to comprise a feed TrpR function, would result in elevated levels of both back-resistant DHDPS would have elevated levels of histi tryptophan production and ammonia consumption. Alterna dine production, thus increasing ammonia consumption and tively, one or more enzymes required for tryptophan bio reducing hyperammonemia. Alternatively, lysine production synthesis could be placed under the control of an inducible could be optimized by placing one or more genes required 65 promoter, such as a FNR-inducible promoter. Any other for lysine biosynthesis under the control of an inducible Suitable modification(s) to the tryptophan biosynthesis path promoter, such as a FNR-inducible promoter. Any other way may be used to increase ammonia consumption. US 9.487,764 B2 25 26 Engineered Bacteria Comprising a Mutant Arginine that encode the enzymes responsible for converting gluta Regulon mate to arginine and/or an intermediate byproduct in the In some embodiments, the genetically engineered bacteria arginine biosynthesis pathway. Reducing or eliminating comprise an arginine biosynthesis pathway and are capable arginine-mediated repression may be achieved by reducing of reducing excess ammonia. In a more specific aspect, the or eliminating ArgR repressor binding (e.g., by mutating or genetically engineered bacteria comprise a mutant arginine deleting the arginine repressor or by mutating at least one regulon in which one or more operons encoding arginine ARG box for each of the operons that encode the arginine biosynthesis enzyme(s) is derepressed to produce more biosynthesis enzymes) and/or arginine binding to N-acetyl arginine or an intermediate byproduct, e.g., citrulline, than glutamate synthetase (e.g., by mutating the N-acetylgluta unmodified bacteria of the same subtype under the same 10 mate synthetase to produce an arginine feedback resistant conditions. In some embodiments, the genetically engi N-acetylglutamate synthase mutant, e.g., argA'). neered bacteria overproduce arginine. In some embodi ARG BOX ments, the genetically engineered bacteria overproduce cit In some embodiments, the genetically engineered bacteria rulline; this may be additionally beneficial, because comprise a mutant arginine regulon comprising one or more citrulline is currently used as a therapeutic for particular urea 15 nucleic acid mutations in at least one ARG box for one or cycle disorders (National Urea Cycle Disorders Founda more of the operons that encode the arginine biosynthesis tion). In some embodiments, the genetically engineered enzymes N-acetylglutamate kinase, N-acetylglutamylphos bacteria overproduce an alternate intermediate byproduct in phate reductase, acetylornithine aminotransferase, N-acety the arginine biosynthesis pathway, such as any of the inter lornithinase, ornithine transcarbamylase, argininosuccinate mediates described herein. In some embodiments, the synthase, argininosuccinate lyase, and carbamoylphosphate genetically engineered bacterium consumes excess ammo synthase, thereby derepressing the regulon and enhancing nia by producing more arginine, citrulline, and/or other arginine and/or intermediate byproduct biosynthesis. In intermediate byproduct than an unmodified bacterium of the Some embodiments, the genetically engineered bacteria same bacterial Subtype under the same conditions. Enhance comprise a mutant arginine repressor comprising one or ment of arginine and/or intermediate byproduct biosynthesis 25 more nucleic acid mutations such that arginine repressor may be used to incorporate excess nitrogen in the body into function is decreased or inactive, or the genetically engi non-toxic molecules in order to treat conditions associated neered bacteria do not have an arginine repressor (e.g., the with hyperammonemia, including urea cycle disorders and arginine repressor gene has been deleted), resulting in dere hepatic encephalopathy. pression of the regulon and enhancement of arginine and/or One of skill in the art would appreciate that the organi 30 intermediate byproduct biosynthesis. In either of these Zation of arginine biosynthesis genes within an operon embodiments, the genetically engineered bacteria may fur varies across species, strains, and Subtypes of bacteria, e.g., ther comprise an arginine feedback resistant N-acetylgluta bipolar argECBH in E. coli K12, argCAEBD-carAB-argF in mate synthase mutant, e.g., argA'. Thus, in some embodi B. subtilis, and bipolar carAB-argCJBDF in L. plantarum. ments, the genetically engineered bacteria comprise a Non-limiting examples of operon organization from differ 35 mutant arginine regulon comprising one or more nucleic ent bacteria are shown in Table 2 (in some instances, the acid mutations in at least one ARG box for one or more of genes are putative and/or identified by sequence homology the operons that encode the arginine biosynthesis enzymes to known sequences in Escherichia coli: in some instances, and an arginine feedback resistant N-acetylglutamate Syn not all of the genes in the arginine regulon are known and/or thase mutant, e.g., argA'. In some embodiments, the shown below). In certain instances, the arginine biosynthesis 40 genetically engineered bacteria comprise a mutant or deleted enzymes vary across species, strains, and Subtypes of bac arginine repressor and an arginine feedback resistant teria. N-acetylglutamate synthase mutant, e.g., argA'. In some embodiments, the genetically engineered bacteria comprise TABLE 2 an arginine feedback resistant N-acetylglutamate synthase 45 mutant, e.g., argA', a mutant arginine regulon comprising Examples of arg Operon organization one or more nucleic acid mutations in at least one ARG box Bacteria Operon organization for each of the operons that encode the arginine biosynthesis enzymes, and/or a mutant or deleted arginine repressor. Escherichia argA bipolar arg) arg argG carAB coi Nissle argECBH In some embodiments, the genetically engineered bacteria Bacteroides argRGCD argF argB argE carAB 50 encode an arginine feedback resistant N-acetylglutamate Clostridium argR argGH arg synthase and further comprise a mutant arginine regulon Bacilius argGH argCAEBD-carAB-argF comprising one or more nucleic acid mutations in each ARG subtiis Bacilius argGH argCJBD-carAB-argF box for one or more of the operons that encode N-acetyl subtiis glutamate kinase, N-acetylglutamylphosphate reductase, Lacto- argGH bipolar carAB-argCJBDF 55 acetylornithine aminotransferase, N-acetylornithinase, orni bacilius thine transcarbamylase, argininosuccinate synthase, argini pianiartin noSuccinate lyase, carbamoylphosphate synthase, and wild Lactococci is argE carA carB argGH argFBDJC type N-acetylglutamate synthetase, such that ArgR binding is reduced or eliminated, thereby derepressing the regulon Each operon is regulated by a regulatory region compris 60 and enhancing arginine and/or intermediate byproduct bio ing at least one promoter and at least one ARG box, which synthesis. control repression and expression of the arginine biosynthe In some embodiments, the ARG boxes for the operon sis genes in said operon. encoding argininosuccinate synthase (argG) maintain the In some embodiments, the genetically engineered bacteria ability to bind to ArgR, thereby driving citrulline biosyn of the invention comprise an arginine regulon comprising 65 thesis. For example, the regulatory region of the operon one or more nucleic acid mutations that reduce or eliminate encoding argininosuccinate synthase (argG) may be a con arginine-mediated repression of one or more of the operons stitutive, thereby driving arginine biosynthesis. In alternate US 9.487,764 B2 27 28 embodiments, the regulatory region of one or more alternate ferase, N-acetylornithinase, ornithine transcarbamylase, operons may be constitutive. In certain bacteria, however, argininosuccinate synthase, argininosuccinate lyase, and genes encoding multiple enzymes may be organized in carbamoylphosphate synthase, such that the arginine regu bipolar operons or under the control of a shared regulatory lon is derepressed and biosynthesis of arginine and/or an region; in these instances, the regulatory regions may need intermediate byproduct, e.g., citrulline, is enhanced. to be deconvoluted in order to engineer constitutively active In some embodiments, the mutant arginine regulon com regulatory regions. For example, in E. coli K12 and Nissle, prises an operon encoding ornithine acetyltransferase and argE and argCBH are organized in two bipolar operons, one or more nucleic acid mutations in at least one ARG box argECBH, and those regulatory regions may be deconvo for said operon. The one or more nucleic acid mutations luted in order to generate constitutive versions of argE 10 results in the disruption of the palindromic ARG box and/or argCBH. sequence, such that ArgRbinding to that ARG box and to the In some embodiments, all ARG boxes in one or more regulatory region of the operon is reduced or eliminated, as operons that comprise an arginine biosynthesis gene are compared to ArgR binding to an unmodified ARG box and mutated to reduce or eliminate ArgR binding. In some regulatory region in bacteria of the same Subtype under the embodiments, all ARG boxes in one or more operons that 15 same conditions. In some embodiments, nucleic acids that encode an arginine biosynthesis enzyme are mutated to are protected from DNA methylation and hydroxyl radical reduce or eliminate ArgR binding. In some embodiments, all attack during ArgR binding are the primary targets for ARG boxes in each operon that comprises an arginine mutations to disrupt ArgR binding. In some embodiments, biosynthesis gene are mutated to reduce or eliminate ArgR the mutant arginine regulon comprises at least three nucleic binding. In some embodiments, all ARG boxes in each acid mutations in one or more ARG boxes for each of the operon that encodes an arginine biosynthesis enzyme are operons that encode the arginine biosynthesis enzymes mutated to reduce or eliminate ArgR binding. described above. The ARG box overlaps with the promoter, In some embodiments, the genetically engineered bacteria and in the mutant arginine regulon, the G/C:A/T ratio of the encode an arginine feedback resistant N-acetylglutamate mutant promoter region differs by no more than 10% from synthase, argininosuccinate synthase driven by a ArgR 25 the G/C:A/T ratio of the wild-type promoter region (FIG. 6). repressible regulatory region, and further comprise a mutant The promoter retains Sufficiently high homology to the arginine regulon comprising one or more nucleic acid muta non-mutant promoter such that RNA polymerase binds with tions in each ARG box for each of the operons that encode Sufficient affinity to promote transcription. N-acetylglutamate kinase, N-acetylglutamylphosphate The wild-type genomic sequences comprising ARG boxes reductase, acetylornithine am inotransferase, N-acetylorni 30 and mutants thereof for eacharginine biosynthesis operon in thinase, ornithine transcarbamylase, argininosuccinate Syn E. coli Nissle are shown in FIG. 6. For exemplary wild-type thase, argininosuccinate lyase, carbamoylphosphate Syn sequences, the ARG boxes are indicated in italics, and the thase, and optionally, wild-type N-acetylglutamate start codon of each gene is boxed. The RNA polymerase synthetase, such that ArgR binding is reduced or eliminated, binding sites are underlined (Cunin, 1983; Maas, 1994). In thereby derepressing the regulon and enhancing citrulline 35 Some embodiments, the underlined sequences are not biosynthesis. In some embodiments, the genetically engi altered. Bases that are protected from DNA methylation neered bacteria capable of producing citruline is particu during ArgR binding are highlighted, and bases that are larly advantageous, because citrulline further serves as a protected from hydroxyl radical attack during ArgR binding therapeutically effective supplement for the treatment of are bolded (Charlier et al., 1992). The highlighted and certain urea cycle disorders (National Urea Cycle Disorders 40 bolded bases are the primary targets for mutations to disrupt Foundation). ArgR binding. In some embodiments, the genetically engineered bacteria In some embodiments, more than one ARG box may be encode an arginine feedback resistant N-acetylglutamate present in a single operon. In one aspect of these embodi synthase, argininosuccinate synthase driven by a constitu ments, at least one of the ARG boxes in an operon is mutated tive promoter, and further comprise a mutant arginine regu 45 to produce the requisite reduced ArgR binding to the regu lon comprising one or more nucleic acid mutations in each latory region of the operon. In an alternate aspect of these ARG box for each of the operons that encode N-acetylglu embodiments, each of the ARG boxes in an operon is tamate kinase, N-acetylglutamylphosphate reductase, acety mutated to produce the requisite reduced ArgR binding to lornithine am inotransferase, N-acetylornithinase, ornithine the regulatory region of the operon. For example, the carAB transcarbamylase, argininosuccinate lyase, carbamoylphos 50 operon in E. coli Nissle comprises two ARG boxes, and one phate synthase, and optionally, wild-type N-acetylglutamate or both ARG box sequences may be mutated. The argG synthetase, such that ArgR binding is reduced or eliminated, operon in E. coli Nissle comprises three ARG boxes, and thereby derepressing the regulon and enhancing arginine one, two, or three ARG box sequences may be mutated, biosynthesis. disrupted, or deleted. In some embodiments, all three ARG In some embodiments, the genetically engineered bacteria 55 box sequences are mutated, disrupted, or deleted, and a comprise a mutant arginine regulon and a feedback resistant constitutive promoter, e.g., BBa J23100, is inserted in the ArgA, and when the arginine feedback resistant ArgA is regulatory region of the argG operon. One of skill in the art expressed, are capable of producing more arginine and/or an would appreciate that the number of ARG boxes per regu intermediate byproduct than unmodified bacteria of the same latory region may vary across bacteria, and the nucleotide Subtype under the same conditions. 60 sequences of the ARG boxes may vary for each operon. Arginine Repressor Binding Sites (ARG Boxes) In some embodiments, the ArgR binding affinity to a In some embodiments, the genetically engineered bacteria mutant ARG box or regulatory region of an operon is at least additionally comprise a mutant arginine regulon comprising about 50% lower, at least about 60% lower, at least about one or more nucleic acid mutations in at least one ARG box 70% lower, at least about 80% lower, at least about 90% for one or more of the operons that encode the arginine 65 lower, or at least about 95% lower than the ArgR binding biosynthesis enzymes N-acetylglutamate kinase, N-acetyl affinity to an unmodified ARG box and regulatory region in glutamylphosphate reductase, acetylornithine am inotrans bacteria of the same subtype under the same conditions. In US 9.487,764 B2 29 30 Some embodiments, the reduced ArgR binding to a mutant or more nucleic acid mutations in each ARG box of one or ARG box and regulatory region increases mRNA expression more of the operons that encode the arginine biosynthesis of the gene(s) in the associated operon by at least about enzymes N-acetylglutamate kinase, N-acetylglutamylphos 1.5-fold, at least about 2-fold, at least about 10-fold, at least phate reductase, acetylornithine aminotransferase, N-acety about 15-fold, at least about 20-fold, at least about 30-fold, 5 lornithinase, ornithine transcarbamylase, argininosuccinate at least about 50-fold, at least about 100-fold, at least about synthase, argininosuccinate lyase, ornithine acetyltrans 200-fold, at least about 300-fold, at least about 400-fold, at ferase, and carbamoylphosphate synthase. least about 500-fold, at least about 600-fold, at least about In some embodiments, the genetically engineered bacteria 700-fold, at least about 800-fold, at least about 900-fold, at comprise a feedback resistant form of ArgA, argininosucci least about 1,000-fold, or at least about 1,500-fold. 10 nate synthase driven by a ArgR-repressible regulatory In some embodiments, quantitative PCR (qPCR) is used to amplify, detect, and/or quantify mRNA expression levels region, as well as one or more nucleic acid mutations in each of the arginine biosynthesis genes. Primers specific for ARG box of each of the operons that encode the arginine arginine biosynthesis genes, e.g., argA, argB, argC. arg), biosynthesis enzymes N-acetylglutamate kinase, N-acetyl argE, argF, argG, argH, argl, arg.J. carA, and care, may be 15 glutamylphosphate reductase, acetylornithine aminotrans designed and used to detect mRNA in a sample according to ferase, N-acetylornithinase, ornithine transcarbamylase, methods known in the art (Fraga et al., 2008). In some argininosuccinate lyase, ornithine acetyltransferase, and car embodiments, a fluorophore is added to a sample reaction bamoylphosphate synthase. In these embodiments, the bac mixture that may contain arg mRNA, and a thermal cycler teria are capable of producing citrulline. is used to illuminate the sample reaction mixture with a In some embodiments, the genetically engineered bacteria specific wavelength of light and detect the Subsequent comprise a feedback resistant form of ArgA, argininosucci emission by the fluorophore. The reaction mixture is heated nate synthase expressed from a constitutive promoter, as and cooled to predetermined temperatures for predetermined well as one or more nucleic acid mutations in each ARG box time periods. In certain embodiments, the heating and cool of each of the operons that encode the arginine biosynthesis ing is repeated for a predetermined number of cycles. In 25 enzymes N-acetylglutamate kinase, N-acetylglutamylphos Some embodiments, the reaction mixture is heated and phate reductase, acetylornithine aminotransferase, N-acety cooled to 90-100° C., 60-70° C., and 30-50° C. for a lornithinase, ornithine transcarbamylase, argininosuccinate predetermined number of cycles. In a certain embodiment, synthase, argininosuccinate lyase, ornithine acetyltrans the reaction mixture is heated and cooled to 93-97° C., ferase, and carbamoylphosphate synthase. In these embodi 55-65° C., and 35-45° C. for a predetermined number of 30 cycles. In some embodiments, the accumulating amplicon is ments, the bacteria are capable of producing arginine. quantified after each cycle of the qPCR. The number of Table 3 shows examples of mutant constructs in which cycles at which fluorescence exceeds the threshold is the one or more nucleic acid mutations reduce or eliminate threshold cycle (C). At least one C result for each sample arginine-mediated repression of each of the arginine oper is generated, and the C result(s) may be used to determine 35 ons. The mutant constructs comprise feedback resistant form mRNA expression levels of the arginine biosynthesis genes. of ArgA driven by an oxygen level-dependent promoter, e.g., In some embodiments, the genetically engineered bacteria a FNR promoter. Each mutant arginine regulon comprises comprising one or more nucleic acid mutations in at least one or more nucleic acid mutations in at least one ARG box one ARG box for one or more of the operons that encode the for one or more of the operons that encode N-acetylgluta arginine biosynthesis enzymes N-acetylglutamate kinase, 40 mate kinase, N-acetylglutamylphosphate reductase, acety N-acetylglutamylphosphate reductase, acetylornithine ami lornithine aminotransferase, N-acetylornithinase, ornithine notransferase, N-acetylornithinase, ornithine transcarbamy transcarbamylase, argininosuccinate synthase, argininosuc lase, argininosuccinate synthase, argininosuccinate lyase, cinate lyase, carbamoylphosphate synthase, and wild-type and carbamoylphosphate synthase additionally comprise an N-acetylglutamate synthetase, such that ArgR binding is arginine feedback resistant N-acetylglutamate synthase 45 reduced or eliminated, thereby enhancing arginine and/or mutant, e.g., argA'. intermediate byproduct biosynthesis. Non-limiting In some embodiments, the genetically engineered bacteria examples of mutant arginine regulon constructs are shown in comprise a feedback resistant form of ArgA, as well as one Table 3. TABLE 3 Examples of ARG Box Mutant Constructs Exemplary Constructs (* indicates constitutive): Construct Construct Construct Construct Construct Construct Mutant construct comprises: 1 2 3 4 5 6 Arginine feedback resistant M M M M M M N-acetylglutamate synthetase driven by an oxygen level dependent promoter Wild-type N-acetylglutamate M M M M synthetase Mutation(s) Wild-type N M M M M in at least acetylglutamate one ARG box synthetase for the N-acetylglutamate M M M M M M operon kinase encoding: N M M M M M M US 9.487,764 B2 31 32 TABLE 3-continued Examples of ARG BOX Mutant Constructs Exemplary Constructs (* indicates constitutive): Construct Construct Construct Construct Construct Construct Mutant construct comprises: 1 2 3 4 5 6 acetylglutamylphosphate reductase acetylornithine M M M M M M aminotransferase N-acetylornithinase M M M M M M ornithine M M M M M M transcarbamylase argininosuccinate M M M Mik Mik Mik synthase argininosuccinate lyase M M M M M M ornithine M M M M M M acetyltransferase carbamoylphosphate M M M M M M synthase
The mutations may be present on a plasmid or chromo tide deletions, insertions, or Substitutions. In some embodi some. In some embodiments, the arginine regulon is regu ments, each copy of the functional argR gene normally lated by a single repressor protein. In particular species, present in a corresponding wild-type bacterium is deleted. strains, and/or Subtypes of bacteria, it has been proposed that 25 In some embodiments, the arginine regulon is regulated the arginine regulon may be regulated by two putative by a single repressor protein. In particular species, strains, repressors (Nicoloff et al., 2004). Thus, in certain embodi and/or subtypes of bacteria, it has been proposed that the ments, the arginine regulon of the invention is regulated by arginine regulon may be regulated by two distinct putative more than one repressor protein. repressors (Nicoloff et al., 2004). Thus, in certain embodi In certain embodiments, the mutant arginine regulon is 30 ments, two distinct ArgR proteins each comprising a differ expressed in one species, strain, or Subtype of genetically ent amino acid sequence are mutated or deleted in the engineered bacteria. In alternate embodiments, the mutant genetically engineered bacteria. arginine regulon is expressed in two or more species, strains, In some embodiments, the genetically modified bacteria and/or subtypes of genetically engineered bacteria. comprising a mutant or deleted arginine repressor addition Arginine Repressor (ArgR) 35 ally comprise an arginine feedback resistant N-acetylgluta The genetically engineered bacteria of the invention com mate synthase mutant, e.g., argA'. In some embodiments, prise an arginine regulon comprising one or more nucleic the genetically engineered bacteria comprise a feedback acid mutations that reduce or eliminate arginine-mediated resistant form of ArgA, lack any functional arginine repres repression of one or more of the operons that encode the Sor, and are capable of producing arginine. In certain enzymes responsible for converting glutamate to arginine 40 embodiments, the genetically engineered bacteria further and/or an intermediate byproduct in the arginine biosynthe lack functional ArgG and are capable of producing citrulline. sis pathway. In some embodiments, the reduction or elimi In some embodiments, the argR gene is deleted in the nation of arginine-mediated repression may be achieved by genetically engineered bacteria. In some embodiments, the reducing or eliminating ArgR repressor binding, e.g., by argR gene is mutated to inactivate ArgR function. In some mutating at least one ARG box for one or more of the 45 embodiments, the argG gene is deleted in the genetically operons that encode the arginine biosynthesis enzymes (as engineered bacteria. In some embodiments, the argG gene is discussed above) or by mutating or deleting the arginine mutated to inactivate ArgR function. In some embodiments, repressor (discussed here) and/or by reducing or eliminating the genetically engineered bacteria comprise argA' and arginine binding to N-acetylglutamate synthetase (e.g., by deleted ArgR. In some embodiments, the genetically engi mutating the N-acetylglutamate synthetase to produce an 50 neered bacteria comprise argA', deleted ArgR, and deleted arginine feedback resistant N-acetylglutamate synthase argG. In some embodiments, the deleted ArgR and/or the mutant, e.g., argA'). deleted argG is deleted from the bacterial genome and the Thus, in Some embodiments, the genetically engineered argA' is present in a plasmid. In some embodiments, the bacteria lack a functional ArgR repressor and therefore ArgR deleted ArgR and/or the deleted argG is deleted from the repressor-mediated transcriptional repression of each of the 55 bacterial genome and the argA'is chromosomally inte arginine biosynthesis operons is reduced or eliminated. In grated. In one specific embodiment, the genetically modified Some embodiments, the engineered bacteria comprise a bacteria comprise chromosomally integrated argA'. mutant arginine repressor comprising one or more nucleic deleted genomic ArgR, and deleted genomic argG. In acid mutations such that arginine repressor function is another specific embodiment, the genetically modified bac decreased or inactive. In some embodiments, the genetically 60 teria comprise argA' present on a plasmid, deleted genomic engineered bacteria do not have an arginine repressor (e.g., ArgR, and deleted genomic argG. In any of the embodiments the arginine repressor gene has been deleted), resulting in in which argG is deleted, citrulline rather than arginine is derepression of the regulon and enhancement of arginine produced and/or intermediate byproduct biosynthesis. In some In some embodiments, under conditions where a feedback embodiments, each copy of a functional argR gene normally 65 resistant form of ArgAis expressed, the genetically engi present in a corresponding wild-type bacterium is indepen neered bacteria of the invention produce at least about dently deleted or rendered inactive by one or more nucleo 1.5-fold, at least about 2-fold, at least about 10-fold, at least US 9.487,764 B2 33 34 about 15-fold, at least about 20-fold, at least about 30-fold, resistant N-acetylglutamate synthase could be integrated at least about 50-fold, at least about 100-fold, at least about into the bacterial chromosome at one or more different 200-fold, at least about 300-fold, at least about 400-fold, at integration sites to perform multiple different functions. least about 500-fold, at least about 600-fold, at least about Multiple distinct feedback resistant N-acetylglutamate 700-fold, at least about 800-fold, at least about 900-fold, at 5 synthetase proteins are known in the art and may be com least about 1,000-fold, or at least about 1,500-fold more bined in the genetically engineered bacteria. In some arginine, citrulline, other intermediate byproduct, and/or embodiments, the argA' gene is expressed under the con transcript of the gene(s) in the operon as compared to trol of a constitutive promoter. In some embodiments, the unmodified bacteria of the same subtype under the same argA' gene is expressed under the control of a promoter conditions. 10 In some embodiments, quantitative PCR (qPCR) is used that is induced by exogenous environmental conditions. In to amplify, detect, and/or quantify mRNA expression levels Some embodiments, the exogenous environmental condi of the arginine biosynthesis genes. Primers specific for tions are specific to the gut of a mammal. In some embodi arginine biosynthesis genes, e.g., argA, argB, argC. arg), ments, exogenous environmental conditions are molecules argE, argF, argG, argH, argl, arg.J. carA, and care, may be 15 or metabolites that are specific to the mammalian gut, e.g., designed and used to detect mRNA in a sample according to propionate or bilirubin. In some embodiments, the exog methods known in the art (Fraga et al., 2008). In some enous environmental conditions are low-oxygen or anaero embodiments, a fluorophore is added to a sample reaction bic conditions. Such as the environment of the mammalian mixture that may contain arg mRNA, and a thermal cycler gut. is used to illuminate the sample reaction mixture with a Bacteria have evolved transcription factors that are specific wavelength of light and detect the Subsequent capable of sensing oxygen levels. Different signaling path emission by the fluorophore. The reaction mixture is heated ways may be triggered by different oxygen levels and occur and cooled to predetermined temperatures for predetermined with different kinetics. An oxygen level-dependent promoter time periods. In certain embodiments, the heating and cool is a nucleic acid sequence to which one or more oxygen ing is repeated for a predetermined number of cycles. In 25 level-sensing transcription factors is capable of binding, Some embodiments, the reaction mixture is heated and wherein the binding and/or activation of the corresponding cooled to 90-100° C., 60-70° C., and 30-50° C. for a transcription factor activates downstream gene expression. predetermined number of cycles. In a certain embodiment, In one embodiment, the argA' gene is under control of an the reaction mixture is heated and cooled to 93-97° C., oxygen level-dependent promoter. In a more specific aspect, 55-65° C., and 35-45° C. for a predetermined number of 30 the argA' gene is under control of an oxygen level cycles. In some embodiments, the accumulating amplicon is dependent promoter that is activated under low-oxygen or quantified after each cycle of the qPCR. The number of anaerobic environments, such as the environment of the cycles at which fluorescence exceeds the threshold is the mammalian gut. threshold cycle (C). At least one C result for each sample In certain embodiments, the genetically engineered bac is generated, and the C result(s) may be used to determine 35 teria comprise argA' expressed under the control of the mRNA expression levels of the arginine biosynthesis genes. fumarate and nitrate reductase regulator (FNR) promoter. In Feedback Resistant N-acetylglutamate Synthetase E. coli, FNR is a major transcriptional activator that controls In some embodiments, the genetically engineered bacteria the switch from aerobic to anaerobic metabolism (Unden et comprise an arginine feedback resistant N-acetylglutamate al., 1997). In the anaerobic state, FNR dimerizes into an synthase mutant, e.g., argA'. In some embodiments, the 40 active DNA binding protein that activates hundreds of genes genetically engineered bacteria comprise a mutant arginine responsible for adapting to anaerobic growth. In the aerobic regulon comprising an arginine feedback resistant ArgA, and state, FNR is prevented from dimerizing by oxygen and is when the arginine feedback resistant ArgA is expressed, are inactive. In alternate embodiments, the genetically engi capable of producing more arginine and/or an intermediate neered bacteria comprise argA' expressed under the con byproduct than unmodified bacteria of the same subtype 45 trol of an alternate oxygen level-dependent promoter, e.g., under the same conditions. The arginine feedback resistant an anaerobic regulation of arginine deiminiase and nitrate N-acetylglutamate synthetase protein (argA') is signifi reduction ANR promoter (Ray et al., 1997), a dissimilatory cantly less sensitive to L-arginine than the enzyme from the nitrate respiration regulator DNR promoter (Trunk et al., feedback sensitive parent strain (see, e.g., Eckhardt et al., 2010). In these embodiments, the arginine biosynthesis 1975; Rajagopal et al., 1998). The feedback resistant argA 50 pathway is particularly activated in a low-oxygen or anaero gene can be present on a plasmid or chromosome. In some bic environment, such as in the gut. embodiments, expression from the plasmid may be useful In P. aeruginosa, the anaerobic regulation of arginine for increasing argA' expression. In some embodiments, deiminiase and nitrate reduction (ANR) transcriptional regu expression from the chromosome may be useful for increas lator is “required for the expression of physiological func ing stability of argA' expression. 55 tions which are inducible under oxygen-limiting or anaero In some embodiments, any of the genetically engineered bic conditions” (Winteler et al., 1996; Sawers 1991). P bacteria of the present disclosure are integrated into the aeruginosa ANR is homologous with E. coli FNR, and the bacterial chromosome at one or more integration sites. For consensus FNR site (TTGAT-ATCAA) was recognized effi example, one or more copies of the sequence encoding the ciently by ANR and FNR" (Winteler et al., 1996). Like FNR, arginine feedback resistant N-acetylglutamate synthase may 60 in the anaerobic state, ANR activates numerous genes be integrated into the bacterial chromosome. Having mul responsible for adapting to anaerobic growth. In the aerobic tiple copies of the arginine feedback resistant N-acetylglu state, ANR is inactive. Pseudomonas fluorescens, tamate synthase integrated into the chromosome allows for Pseudomonas putida, Pseudomonas Syringae, and greater production of the N-acetylglutamate synthase and Pseudomonas mendocina all have functional analogs of also permits fine-tuning of the level of expression. Alterna 65 ANR (Zimmermann et al., 1991). Promoters that are regu tively, different circuits described herein, such as any of the lated by ANR are known in the art, e.g., the promoter of the kill-switch circuits, in addition to the arginine feedback arcDABC operon (see, e.g., Hasegawa et al., 1998). US 9.487,764 B2 35 36 The FNR family also includes the dissimilatory nitrate the host cell, and the host cell is capable of survival and/or respiration regulator (DNR) (Arai et al., 1995), a transcrip growth in vitro, e.g., in medium, and/or in Vivo, e.g., in the tional regulator that is required in conjunction with ANR for gut. In some embodiments, a bacterium may comprise 'anaerobic nitrate respiration of Pseudomonas aeruginosa' multiple copies of the feedback resistant argA gene. In some (Hasegawa et al., 1998). For certain genes, the FNR-binding embodiments, the feedback resistant argA gene is expressed motifs are probably recognized only by DNR" (Hasegawa et on a low-copy plasmid. In some embodiments, the low-copy al., 1998). Any suitable transcriptional regulator that is plasmid may be useful for increasing stability of expression. controlled by exogenous environmental conditions and cor In some embodiments, the low-copy plasmid may be useful responding regulatory region may be used. Non-limiting for decreasing leaky expression under non-inducing condi examples include ArcA/B, ResD/E, NreA/B/C, and AirSR, 10 tions. In some embodiments, the feedback resistant argA and others are known in the art. gene is expressed on a high-copy plasmid. In some embodi In some embodiments, argA' is expressed under the ments, the high-copy plasmid may be useful for increasing control of an inducible promoter that is responsive to argA' expression. In some embodiments, the feedback specific molecules or metabolites in the environment, e.g., resistant argA gene is expressed on a chromosome. In some the mammalian gut. For example, the short-chain fatty acid 15 embodiments, the bacteria are genetically engineered to propionate is a major microbial fermentation metabolite include multiple mechanisms of action (MOAS), e.g., cir localized to the gut (Hosseini et al., 2011). In one embodi cuits producing multiple copies of the same product or ment, argA' gene expression is under the control of a circuits performing multiple different functions. Examples propionate-inducible promoter. In a more specific embodi of insertion sites include, but are not limited to, malE/K, ment, argA' gene expression is under the control of a insB/I, araC/BAD, lacZ, dap A, cea, and other shown in FIG. propionate-inducible promoter that is activated by the pres 22. For example, the genetically engineered bacteria may ence of propionate in the mammalian gut. Any molecule or include four copies of argA' inserted at four different metabolite found in the mammalian gut, in a healthy and/or insertion sites, e.g., malE/K, insB/I, araC/BAD, and lacz. disease state, may be used to induce argA' expression. Alternatively, the genetically engineered bacteria may Non-limiting examples include propionate, bilirubin, aspar 25 include three copies of argA' inserted at three different tate aminotransferase, alanine aminotransferase, blood insertion sites, e.g., malE/K, insB/I, and lac7, and three coagulation factors II, VII, IX, and X, alkaline phosphatase, mutant arginine regulons, e.g., two producing citruline and gamma glutamyl transferase, hepatitis antigens and antibod one producing arginine, inserted at three different insertion ies, alpha fetoprotein, anti-mitochondrial, Smooth muscle, sites dap A, cea, and araC/BAD. and anti-nuclear antibodies, iron, transferrin, ferritin, cop 30 In some embodiments, the plasmid or chromosome also per, ceruloplasmin, ammonia, and manganese. In alternate comprises wild-type ArgR binding sites, e.g., ARG boxes. In embodiments, argA' gene expression is under the control some instances, the presence and/or build-up of functional of a p3AD promoter, which is activated in the presence of ArgR may result in off-target binding at sites other than the the Sugar arabinose (see, e.g., FIG. 18). ARG boxes, which may cause off-target changes in gene Subjects with hepatic encephalopathy (HE) and other 35 expression. A plasmid or chromosome that further comprises liver disease or disorders have chronic liver damage that functional ARG boxes may be used to reduce or eliminate results in high ammonia levels in their blood and intestines. off-target ArgR binding, i.e., by acting as an ArgR sink. In In addition to ammonia, these patients also have elevated Some embodiments, the plasmid or chromosome does not levels of bilirubin, aspartate aminotransferase, alanine ami comprise functional ArgR binding sites, e.g., the plasmid or notransferase, blood coagulation factors II, VII, IX, and X, 40 chromosome comprises modified ARG boxes or does not alkaline phosphatase, gamma glutamyl transferase, hepatitis comprise ARG boxes. antigens and antibodies, alpha fetoprotein, anti-mitochon In some embodiments, the feedback resistant argA gene is drial, Smooth muscle, and anti-nuclear antibodies, iron, present on a plasmid and operably linked to a promoter that transferrin, ferritin, copper, ceruloplasmin, ammonia, and is induced under low-oxygen or anaerobic conditions. In manganese in their blood and intestines. Promoters that 45 Some embodiments, the feedback resistant argA gene is respond to one of these HE-related molecules or their present in the chromosome and operably linked to a pro metabolites can be used to engineer bacteria of the present moter that is induced under low-oxygen or anaerobic con disclosure that would only be induced to express argA' in ditions. In some embodiments, the feedback resistant argA the intestines of HE patients. These promoters would not be gene is present on a plasmid and operably linked to a expected to be induced in UCD patients. 50 promoter that is induced by molecules or metabolites that In some embodiments, the argA' gene is expressed are specific to the mammalian gut. In some embodiments, under the control of a promoter that is induced by exposure the feedback resistant argA gene is present on a chromosome to tetracycline. In some embodiments, gene expression is and operably linked to a promoter that is induced by further optimized by methods known in the art, e.g., by molecules or metabolites that are specific to the mammalian optimizing ribosomal binding sites, manipulating transcrip 55 gut. In some embodiments, the feedback resistant argA gene tional regulators, and/or increasing mRNA stability. is present on a chromosome and operably linked to a In some embodiments, arginine feedback inhibition of promoter that is induced by exposure to tetracycline. In N-acetylglutamate synthetase is reduced by at least about Some embodiments, the feedback resistant argA gene is 50%, at least about 60%, at least about 70%, at least about present on a plasmid and operably linked to a promoter that 80%, at least about 90%, or at least about 95% in the 60 is induced by exposure to tetracycline. genetically engineered bacteria when the arginine feedback In some embodiments, the genetically engineered bacteria resistant N-acetylglutamate synthetase is active, as com comprise multiple mechanisms of action (MOAS), e.g., pared to a wild-type N-acetylglutamate synthetase from circuits producing multiple copies of the same product (to bacteria of the same subtype under the same conditions. enhance copy number) or circuits performing multiple dif In some embodiments, the genetically engineered bacteria 65 ferent functions. Examples of insertion sites include, but are comprise a stably maintained plasmid or chromosome car not limited to, malE/K, insB/I, araC/BAD, lacz, dap A, cea, rying the argA' gene, such that argA' can be expressed in and other shown in FIG. 22. US 9.487,764 B2 37 38 In some embodiments, the genetically engineered bacteria NO: 25), nirB promoter fused to a crp binding site (SEQ ID comprise a variant or mutated oxygen level-dependent tran NO: 26), and finrS fused to a crp binding site (SEQ ID NO: scriptional regulator, e.g., FNR, ANR, or DNR, in addition 27). to the corresponding oxygen level-dependent promoter. The In some embodiments, the genetically engineered bacteria variant or mutated oxygen level-dependent transcriptional comprise the nucleic acid sequence of SEQ ID NO: 28 or a regulator increases the transcription of operably linked functional fragment thereof. In some embodiments, the genes in a low-oxygen or anaerobic environment. In some genetically engineered bacteria comprise a nucleic acid embodiments, the corresponding wild-type transcriptional sequence that, but for the redundancy of the genetic code, regulator retains wild-type activity. In alternate embodi encodes the same polypeptide as SEQ ID NO: 28. In some ments, the corresponding wild-type transcriptional regulator 10 embodiments, genetically engineered bacteria comprise a is deleted or mutated to reduce or eliminate wild-type nucleic acid sequence that is at least about 80%, at least activity. In certain embodiments, the mutant oxygen level about 85%, at least about 90%, at least about 95%, or at least dependent transcriptional regulator is a FNR protein com about 99% homologous to the DNA sequence of SEQ ID prising amino acid Substitutions that enhance dimerization NO: 28, or a nucleic acid sequence that, but for the redun and FNR activity (see, e.g., Moore et al., 2006). 15 dancy of the genetic code, encodes the same polypeptide as In some embodiments, the genetically engineered bacteria SEQ ID NO. 28. comprise an oxygen level-dependent transcriptional regula In other embodiments, argA' is expressed under the tor from a different bacterial species that reduces and/or control of an oxygen level-dependent promoter fused to a consumes ammonia in low-oxygen or anaerobic environ binding site for a transcriptional activator, e.g., CRP, CRP ments. In certain embodiments, the mutant oxygen level (cyclic AMP receptor protein or catabolite activator protein dependent transcriptional regulator is a FNR protein from N. or CAP) plays a major regulatory role in bacteria by repress gonorrhoeae (see, e.g., Isabella et al., 2011). In some ing genes responsible for the uptake, metabolism and embodiments, the corresponding wild-type transcriptional assimilation of less favorable carbon sources when rapidly regulator is left intact and retains wild-type activity. In metabolizable carbohydrates. Such as glucose, are present alternate embodiments, the corresponding wild-type tran 25 (Wu et al., 2015). This preference for glucose has been Scriptional regulator is deleted or mutated to reduce or termed glucose repression, as well as carbon catabolite eliminate wild-type activity. repression (Deutscher, 2008; Görke and Stilke, 2008). In In some embodiments, the genetically engineered bacteria some embodiments, argA' expression is controlled by an comprise argA' expressed under the control of an oxygen oxygen level-dependent promoter fused to a CRP binding level-dependent promoter, e.g., a FNR promoter, as well as 30 site. In some embodiments, argA' expression is controlled wild-type argA expressed under the control of a mutant by a FNR promoter fused to a CRP binding site. In these regulatory region comprising one or more ARG box muta embodiments, cyclic AMP binds to CRP when no glucose is tions as discussed above. In certain embodiments, the present in the environment. This binding causes a confor genetically engineered bacteria comprise argA' expressed mational change in CRP, and allows CRP to bind tightly to under the control of an oxygen level-dependent promoter, 35 its binding site. CRP binding then activates transcription of e.g., a FNR promoter and do not comprise wild-type argA. the argA' gene by recruiting RNA polymerase to the FNR In still other embodiments, the mutant arginine regulon promoter via direct protein-protein interactions. In the pres comprises argA' expressed under the control of an oxygen ence of glucose, cyclic AMP does not bind to CRP and level-dependent promoter, e.g., a FNR promoter, and further argA' gene transcription is repressed. In some embodi comprises wild-type argA without any ARG box mutations. 40 ments, an oxygen level-dependent promoter (e.g., a FNR In some embodiments, the genetically engineered bacteria promoter) fused to a binding site for a transcriptional express ArgA' from a plasmid and/or chromosome. In activator is used to ensure that argA' is not expressed under some embodiments, the argA' gene is expressed under the anaerobic conditions when Sufficient amounts of glucose are control of a constitutive promoter. In some embodiments, present, e.g., by adding glucose to growth media in vitro. the argA' gene is expressed under the control of an induc 45 Arginine Catabolism ible promoter. In one embodiment, argA' is expressed An important consideration in practicing the invention is under the control of an oxygen level-dependent promoter to ensure that ammonia is not overproduced as a byproduct that is activated under low-oxygen or anaerobic environ of arginine and/or citrulline catabolism. In the final enzy ments, e.g., a FNR promoter. The nucleic acid sequence of matic step of the urea cycle, arginase catalyzes the hydro a FNR promoter-driven argA' plasmid is shown in FIG. 8, 50 lytic cleavage of arginine into ornithine and urea (Cunin et with the FNR promoter sequence bolded and argA' al., 1986). Urease, which may be produced by gut bacteria, sequence boxed. catalyzes the cleavage of urea into carbon dioxide and FNR promoter sequences are known in the art, and any ammonia (Summerskill, 1966: Aoyagi et al., 1966; Cunin et suitable FNR promoter sequence(s) may be used in the al., 1986). Thus, urease activity may generate ammonia that genetically engineered bacteria of the invention. Any Suit 55 can be “toxic for human tissue' (Konieczna et al., 2012). In able FNR promoter(s) may be combined with any suitable Some bacteria, including E. coli Nissle, the gene arcD feedback-resistant ArgA (exemplary sequence, SEQID NO: encodes an argininefornithine antiporter, which may also 8A). Non-limiting FNR promoter sequences are provided in liberate ammonia (Vander Wauven et al., 1984: Gamper et FIG. 7. In some embodiments, the genetically engineered al., 1991: Meng et al., 1992). bacteria of the invention comprise one or more of: SEQ ID 60 AStA is an enzyme involved in the conversion of arginine NO: 16, SEQID NO: 17, nirB1 promoter (SEQID NO: 18), to Succinate, which liberates ammonia. SpeA is an enzyme nirB2 promoter (SEQ ID NO: 19), nirB3 promoter (SEQ ID involved in the conversion of arginine to agnatine, which NO: 20), ydf7 promoter (SEQ ID NO: 21), nirB promoter can be further catabolized to produce ammonia. Thus, in fused to a strong ribosome binding site (SEQ ID NO: 22), Some instances, it may be advantageous to prevent the ydf/ promoter fused to a strong ribosome binding site (SEQ 65 breakdown of arginine. In some embodiments, the geneti ID NO. 23), finrS, an anaerobically induced small RNA gene cally engineered bacteria comprising a mutant arginine (fnrS1 promoter SEQID NO: 24 or finrS2 promoter SEQID regulon additionally includes mutations that reduce or elimi US 9.487,764 B2 39 40 nate arginine catabolism, thereby reducing or eliminating naturally in the human gut in vivo. In some embodiments, further ammonia production. In some embodiments, the the bacterial cell of the disclosure is auxotrophic in a gene genetically engineered bacteria also comprise mutations that that is complemented when the bacterium is present in the reduce or eliminate ArcD activity. In certain embodiments, mammalian gut. Without Sufficient amounts of thymine, the ArcD is deleted. In some embodiments, the genetically 5 thy A auxotroph dies. In some embodiments, the auxotrophic engineered bacteria also comprise mutations that reduce or modification is used to ensure that the bacterial cell does not eliminate AStA activity. In certain embodiments, AStA is Survive in the absence of the auxotrophic gene product (e.g., deleted. In some embodiments, the genetically engineered outside of the gut). bacteria also comprise mutations that reduce or eliminate Diaminopimelic acid (DAP) is an amino acid synthetized SpeA activity. In certain embodiments, SpeA is deleted. In 10 within the lysine biosynthetic pathway and is required for Some embodiments, the genetically engineered bacteria also bacterial cell wall growth (Meadow et al., 1959; Clarkson et comprise mutations that reduce or eliminate arginase activ al., 1971). In some embodiments, any of the genetically ity. In certain embodiments, arginase is deleted. In some engineered bacteria described herein is a dapD auxotroph in embodiments, the genetically engineered bacteria also com which dapD is deleted and/or replaced with an unrelated prise mutations that reduce or eliminate urease activity. In 15 gene. A dapD auxotroph can grow only when Sufficient certain embodiments, urease is deleted. In some embodi amounts of DAP are present, e.g., by adding DAP to growth ments, one or more other genes involved in arginine catabo media in vitro. Without sufficient amounts of DAP, the dapD lism are mutated or deleted. auxotroph dies. In some embodiments, the auxotrophic Essential Genes and Auxotrophs modification is used to ensure that the bacterial cell does not As used herein, the term "essential gene' refers to a gene Survive in the absence of the auxotrophic gene product (e.g., which is necessary to for cell growth and/or survival. outside of the gut). Bacterial essential genes are well known to one of ordinary In other embodiments, the genetically engineered bacte skill in the art, and can be identified by directed deletion of rium of the present disclosure is a uraA auxotroph in which genes and/or random mutagenesis and screening (see, for ura A is deleted and/or replaced with an unrelated gene. The example, Zhang and Lin, 2009, DEG 5.0, a database of 25 uraA gene codes for UraA, a membrane-bound transporter essential genes in both prokaryotes and eukaryotes, Nucl. that facilitates the uptake and subsequent metabolism of the Acids Res., 37:D455-D458 and Gerdes et al., Essential pyrimidine uracil (Andersen et al., 1995). Aura A auxotroph genes on metabolic maps, Curr. Opin. Biotechnol., 17(5): can grow only when Sufficient amounts of uracil are present, 448-456, the entire contents of each of which are expressly e.g., by adding uracil to growth media in vitro. Without incorporated herein by reference). 30 Sufficient amounts of uracil, the uraA auxotroph dies. In An “essential gene' may be dependent on the circum Some embodiments, auxotrophic modifications are used to stances and environment in which an organism lives. For ensure that the bacteria do not survive in the absence of the example, a mutation of modification of, or excision of an auxotrophic gene product (e.g., outside of the gut). essential gene may result in the recombinant bacteria of the In complex communities, it is possible for bacteria to disclosure becoming an auxotroph. An auxotrophic modifi 35 share DNA. In very rare circumstances, an auxotrophic cation is intended to cause bacteria to die in the absence of bacterial strain may receive DNA from a non-auxotrophic an exogenously added nutrient essential for Survival or strain, which repairs the genomic deletion and permanently growth because they lack the gene(s) necessary to produce rescues the auxotroph. Therefore, engineering a bacterial that essential nutrient. strain with more than one auxotroph may greatly decrease An auxotrophic modification is intended to cause bacteria 40 the probability that DNA transfer will occur enough times to to die in the absence of an exogenously added nutrient rescue the auxotrophy. In some embodiments, the geneti essential for survival or growth because they lack the cally engineered bacteria of the invention comprise a dele gene(s) necessary to produce that essential nutrient. In some tion or mutation in two or more genes required for cell embodiments, any of the genetically engineered bacteria Survival and/or growth. described herein also comprise a deletion or mutation in a 45 Other examples of essential genes include, but are not gene required for cell Survival and/or growth. In one limited to yhbV, yagG, hemB, secD, secF, ribD, ribE, thiL, embodiment, the essential gene is a DNA synthesis gene, for dxs, ispA. dnaX, adk, hemH. lpxH, cysS, fold, rplT, inf(c. example, thy A. In another embodiment, the essential gene is thrS. nadE, gap.A., yeaZ, aspS, argS. pgs A, yefM, metG, a cell wall synthesis gene, for example, dap A. In yet another folE, ye M, gyrA, nrdA, nrdB, folC, accD, fabB. gltX, ligA, embodiment, the essential gene is an amino acid gene, for 50 Zip A, dapE, dap A, der, hiss, ispG, SuhB, tadA, acpS, era, example, serA or MetA. Any gene required for cell Survival rnc. ftsB, eno, pyrC, chpR, lgt, fbaA, pgk, yogD, metK, and/or growth may be targeted, including but not limited to, ydgF, plSC, ygiT, pare, ribB, cca, ygD, tdcF, yraL, yih A. cySE, gln.A, ilvD. leuB, lySA, serA, metA, gly A, hisB, ilvA. ftsN, murl, murB, birA, secE, nusG, rpl.J. rpl. rpoB, rpoC, phea, proA, thrC, trpC, tyra, thy A, uraA, dap A, dapB. ubiA, plsB. leXA, dnaB, Ssb, alsK, groS, psd orn, yieE. dapD, dapE, dapF, flhD, metB, metC, proAB, and thi1, as 55 rpsR, chp.S. ppa, ValS, yigP, yigQ, dnaC, ribE, lSpA. ispH, long as the corresponding wild-type gene product is not dapb, folA, imp, yabQ, ftsL. ftsI, murE, murF, mraY. murD. produced in the bacteria. For example, thymine is a nucleic ftsW. murG, murc. fts.O. fts A, fisZ, IpxC, secM, secA, can, acid that is required for bacterial cell growth; in its absence, folK, heml, yadR, dapD, map, rpsB, infB nuSA, ftsH. bacteria undergo cell death. The thy A gene encodes thim obgE, rpm.A, rplu, ispB, murA, yrbB, yrbK, yhbN. rpsl. idylate synthetase, an enzyme that catalyzes the first step in 60 rplM. degS. mreD, mreC, mreB, accB, accC. yrdC, def, fmt, thymine synthesis by converting dUMP to dTMP (Sat et al., rplQ, rpoA, rpsD. rpsK, rpsM, ent D. mrdB, mrdA, nad D, 2003). In some embodiments, the bacterial cell of the hlep3, rpoB, pss A, yfiO, rplS. trmD, rpsP. ffh, grpE, yf B. disclosure is a thy A auxotroph in which the thy A gene is csrA, ispF. isp), rplW. rplD. rplC, rps.J., fusA. rpsG. rpsL, deleted and/or replaced with an unrelated gene. A thy A trpS, yrff, asd, rpoH, fisX, ftsB. fts Y. frr, dxr. ispU, rfaK, auxotroph can grow only when Sufficient amounts of thy 65 kdtA, coal), rpmB, dfp, dut, gmk, spot, gyrB, dnaN. dnaA, mine are present, e.g., by adding thymine to growth media rpmH., rnpA, yidC., tmaB, glimS, glimU. WZyE, hemD, hemC, in vitro, or in the presence of high thymine levels found yigP. ubiB. ubiD, hemC, SecY, rplO. rpm.D. rpsB. rplR, rplF. US 9.487,764 B2 41 42 rpsH. rpsN. rplE. rplX, rplN. rpsQ, rpmC, rplP. rpsC, rplV. renders it auxotrophic to a ligand. In some embodiments, the rps.S. rplB, cds.A., yaeL, yaeT, lpxD, fabZ., 1pxA, lpxB, dnaE, bacterial cell comprises mutations in two essential genes. accA, tilS, proS, yaff, tsf, pyrH, olA, rlpb, leuS, Int, glnS, For example, in some embodiments, the bacterial cell com fldA, cydA, infA, cydC. ftsk, lol A, serS. rps A, msbA, IpxK, prises mutations in tyrS (L36V. C38A, and F40G) and metG kdsE, mukP, mukBE, mukB, asnS, fabA, mviN., rne, yeeO. (E45Q, N47R, I49G, and A51 C). In other embodiments, the fabl), fabG, acpp., tmk, holB, lolC, loll), lolE, purB, ymfK, bacterial cell comprises mutations in three essential genes. minE, mind, pth, rSA, ispE, loIB, hemA, prfA, primC, k.dsA, For example, in some embodiments, the bacterial cell com top A, ribA, fabl, racR, dicA, ydfB, tyrS, ribC, ydiL, pheT. prises mutations in tyrS (L36V. C38A, and F40G), metG pheS, yhhCR, bcsB, glyO, yib.J. and gpSA. Other essential (E45Q, N47R, I49G, and A51C), and pheS (F125G, P183T, genes are known to those of ordinary skill in the art. 10 P184A, R186A, and I188L). In some embodiments, the genetically engineered bacte In some embodiments, the genetically engineered bacte rium of the present disclosure is a synthetic ligand-depen rium is a conditional auxotroph whose essential gene(s) is dent essential gene (SLiDE) bacterial cell. SLiDE bacterial replaced using the arabinose system shown in FIGS. 38, 48. cells are synthetic auxotrophs with a mutation in one or more 61, and 62. essential genes that only grow in the presence of a particular 15 In some embodiments, the genetically engineered bacte ligand (see Lopez and Anderson “Synthetic Auxotrophs with rium of the disclosure is an auxotroph and also comprises Ligand-Dependent Essential Genes for a BL21 (DE3 Bio kill-switch circuitry, Such as any of the kill-switch compo safety Strain, ACS Synthetic Biology (2015) DOI: nents and systems described herein. For example, the recom 10.1021/acssynbio.5b00085, the entire contents of which are binant bacteria may comprise a deletion or mutation in an expressly incorporated herein by reference). essential gene required for cell Survival and/or growth, for In some embodiments, the SLiDE bacterial cell comprises example, in a DNA synthesis gene, for example, thy A, cell a mutation in an essential gene. In some embodiments, the wall synthesis gene, for example, dap A and/or an amino acid essential gene is selected from the group consisting of pheS, gene, for example, serA or MetA and may also comprise a dnaN, tyrS, metG and adk. In some embodiments, the toxin gene that is regulated by one or more transcriptional essential gene is dnaN comprising one or more of the 25 activators that are expressed in response to an environmental following mutations: H191N, R240C, I317S, F319V. condition(s) and/or signal(s) (Such as the described arab L340T, V347I, and S345C. In some embodiments, the inose system) or regulated by one or more recombinases that essential gene is dnaN comprising the mutations H191N, are expressed upon sensing an exogenous environmental R240C, I317S, F319V, L340T, V347I, and S345C. In some condition(s) and/or signal(s) (such as the recombinase sys embodiments, the essential gene is pheS comprising one or 30 tems described herein and in FIGS. 38, 39, and 49). Other more of the following mutations: F125G, P183T, P184A, embodiments are described in Wright et al., “GeneGuard: A R186A, and I188L. In some embodiments, the essential Modular Plasmid System Designed for Biosafety.” ACS gene is pheS comprising the mutations F125G, P183T. Synthetic Biology (2015) 4: 307-16, the entire contents of P184A, R186A, and I188L. In some embodiments, the which are expressly incorporated herein by reference). In essential gene is tyrS comprising one or more of the fol 35 Some embodiments, the genetically engineered bacterium of lowing mutations: L36V. C38A and F40G. In some embodi the disclosure is an auxotroph and also comprises kill-switch ments, the essential gene is tyrS comprising the mutations circuitry, such as any of the kill-switch components and L36V, C38A and F40G. In some embodiments, the essential systems described herein, as well as another biosecurity gene is metG comprising one or more of the following system, such a conditional origin of replication (see Wright mutations: E45Q, N47R, I49G, and A51C. In some embodi 40 et al., Supra). ments, the essential gene is metG comprising the mutations In other embodiments, auxotrophic modifications may E45Q, N47R, I49G, and A51 C. In some embodiments, the also be used to Screen for mutant bacteria that consume essential gene is adk comprising one or more of the follow excess ammonia. In a more specific aspect, auxotrophic ing mutations: I4L, L5I and L6G. In some embodiments, the modifications may be used to screen for mutant bacteria that essential gene is adk comprising the mutations I4L, L5I and 45 consume excess ammonia by overproducing arginine. As L6G. described herein, many genes involved in arginine metabo In some embodiments, the genetically engineered bacte lism are subject to repression by arginine via its interaction rium is complemented by a ligand. In some embodiments, with ArgR. The astC gene promoter is unique in that the the ligand is selected from the group consisting of benzo arginine-ArgR complex acts as a transcriptional activator, as thiazole, indole, 2-aminobenzothiazole, indole-3-butyric 50 opposed to a transcriptional repressor. AstC encodes Succi acid, indole-3-acetic acid, and L-histidine methyl ester. For nylornithine aminotransferase, the third enzyme of the example, bacterial cells comprising mutations in metG ammonia-producing arginine Succinyltransferase (AST) (E45Q, N47R, I49G, and A51 C) are complemented by pathway and the first of the astCADBE operon in E. coli benzothiazole, indole, 2-aminobenzothiazole, indole-3-bu (Schneider et al., 1998). In certain embodiments, the geneti tyric acid, indole-3-acetic acid or L-histidine methyl ester. 55 cally engineered bacteria are auxotrophic for a gene, and Bacterial cells comprising mutations in dnaN (H191N, express the auxotrophic gene product under the control of an R240C, I317S, F319V, L340T, V347I, and S345C) are astC promoter. In these embodiments, the auxotrophy is complemented by benzothiazole, indole or 2-aminobenzo Subject to a positive feedback mechanism and used to select thiazole. Bacterial cells comprising mutations in pheS for mutant bacteria which consume excess ammonia by (F125G, P183T, P184A, R186A, and I188L) are comple 60 overproducing arginine. A non-limiting example of a posi mented by benzothiazole or 2-aminobenzothiazole. Bacte tive feedback auxotroph is shown in FIGS. 32A and 32B. rial cells comprising mutations in tyrS (L36V. C38A, and Genetic Regulatory Circuits F40G) are complemented by benzothiazole or 2-aminoben In some embodiments, the genetically engineered bacteria Zothiazole. Bacterial cells comprising mutations in adk (I4L, comprise multi-layered genetic regulatory circuits for L5I and L6G) are complemented by benzothiazole or indole. 65 expressing the constructs described herein (see, e.g., U.S. In some embodiments, the genetically engineered bacte Provisional Application No. 62/184,811, incorporated herein rium comprises more than one mutant essential gene that by reference in its entirety). US 9.487,764 B2 43 44 In certain embodiments, the invention provides methods trophic gene). In some embodiments, the mutant arginine for selecting genetically engineered bacteria that overpro regulon comprising a two-repressor activation circuit is duce arginine. In some embodiments, the invention provides Subjected to mutagenesis, and mutants that reduce excess methods for selecting genetically engineered bacteria that ammonia are selected by growth in the absence of the gene consume excess ammonia via an alternative metabolic path- 5 product required for Survival and/or growth. In some way, e.g., a histidine biosynthesis pathway, a methionine embodiments, the mutant arginine regulon comprising a biosynthesis pathway, a lysine biosynthesis pathway, an two-repressor activation circuit is used to ensure that the asparagine biosynthesis pathway, a glutamine biosynthesis bacteria do not survive in the absence of high levels of pathway, and a tryptophan biosynthesis pathway. In some arginine (e.g., outside of the gut). embodiments, the invention provides genetically engineered 10 Host-Plasmid Mutual Dependency bacteria comprising a mutant arginine regulon and an ArgR In some embodiments, the genetically engineered bacteria regulated two-repressor activation genetic regulatory circuit. of the invention also comprise a plasmid that has been The two-repressor activation genetic regulatory circuit is modified to create a host-plasmid mutual dependency. In useful to Screen for mutant bacteria that reduce ammonia or certain embodiments, the mutually dependent host-plasmid rescue an auxotroph. In some constructs, high levels of 15 platform is GeneGuard (Wright et al., 2015). In some arginine and the resultant activation of ArgR by arginine can embodiments, the GeneGuard plasmid comprises (i) a con cause expression of a detectable label or an essential gene ditional origin of replication, in which the requisite replica that is required for cell survival. tion initiator protein is provided in trans; (ii) an auxotrophic The two-repressor activation regulatory circuit comprises modification that is rescued by the host via genomic trans a first ArgR and a second repressor, e.g., the Tet repressor. location and is also compatible for use in rich media; and/or In one aspect of these embodiments, ArgR inhibits transcrip (iii) a nucleic acid sequence which encodes a broad-spec tion of a second repressor, which inhibits the transcription of trum toxin. The toxin gene may be used to select against a particular gene of interest, e.g., a detectable product, which plasmid spread by making the plasmid DNA itself disad may be used to screen for mutants that consume excess vantageous for Strains not expressing the anti-toxin (e.g., a ammonia, and/or an essential gene that is required for cell 25 wild-type bacterium). In some embodiments, the Gene Survival. Any detectable product may be used, including but Guard plasmid is stable for at least 100 generations without not limited to, luciferase, B-galactosidase, and fluorescent antibiotic selection. In some embodiments, the GeneGuard proteins such as GFP. In some embodiments, the second plasmid does not disrupt growth of the host. The GeneGuard repressor is a Tet repressor protein (TetR). In this embodi plasmid is used to greatly reduce unintentional plasmid ment, an ArgR-repressible promoter comprising wild-type 30 propagation in the genetically engineered bacteria of the ARG boxes drives the expression of TetR, and a TetR invention. repressible promoter drives the expression of at least one The mutually dependent host-plasmid platform may be gene of interest, e.g., GFP. In the absence of ArgR binding used alone or in combination with other biosafety mecha (which occurs at low arginine concentrations), tetR is tran nisms, such as those described herein (e.g., kill Switches, scribed, and TetR represses GFP expression. In the presence 35 auxotrophies). In some embodiments, the genetically engi of ArgR binding (which occurs at high arginine concentra neered bacteria comprise a GeneGuard plasmid. In other tions), tetR expression is repressed, and GFP is generated. embodiments, the genetically engineered bacteria comprise Examples of other second repressors useful in these embodi a GeneGuard plasmid and/or one or more kill switches. In ments include, but are not limited to, ArsR, AscG, LacI. other embodiments, the genetically engineered bacteria CscR, DeoR, DgoR, FruR, GalR, GatR, CI, Lex A, RafR, 40 comprise a GeneGuard plasmid and/or one or more auxo QacR, and PtxS (US20030166191). In some embodiments, trophies. In still other embodiments, the genetically engi the mutant arginine regulon comprising a Switch is subjected neered bacteria comprise a GeneGuard plasmid, one or more to mutagenesis, and mutants that reduce ammonia by over kill Switches, and/or one or more auxotrophies. producing arginine are selected based upon the level of Kill Switch detectable product, e.g., by flow cytometry, fluorescence 45 In some embodiments, the genetically engineered bacteria activated cell sorting (FACS) when the detectable product of the invention also comprise a kill Switch (see, e.g., U.S. fluoresces. Provisional Application Nos. 62/183,935 and 62/263.329 In some embodiments, the gene of interest is one required incorporated herein by reference in their entireties). The kill for Survival and/or growth of the bacteria. Any such gene switch is intended to actively kill engineered microbes in may be used, including but not limited to, cysE, gln.A, ilvD. 50 response to external stimuli. As opposed to an auxotrophic leuB, lySA, serA, metA, gly A, hisB, ilvA, phe A, proA, thrC, mutation where bacteria die because they lack an essential trpC, tyra, thy A, uraA, dap A, dapB, dapD, dapF, dapF. nutrient for survival, the kill switch is triggered by a flhD, metB, metC, pro AB, and thi1, as long as the corre particular factor in the environment that induces the pro sponding wild-type gene has been removed or mutated so as duction of toxic molecules within the microbe that cause cell not to produce the gene product except under control of 55 death. ArgR. In some embodiments, an ArgR-repressible promoter Bacteria engineered with kill switches have been engi comprising wild-type ARG boxes drives the expression of a neered for in vitro research purposes, e.g., to limit the spread TetR protein, and a TetR-repressible promoter drives the of a biofuel-producing microorganism outside of a labora expression of at least one gene required for Survival and/or tory environment. Bacteria engineered for in vivo adminis growth of the bacteria, e.g., thy A, uraA (Sat et al., 2003). In 60 tration to treat a disease or disorder may also be programmed Some embodiments, the genetically engineered bacterium is to die at a specific time after the expression and delivery of auxotrophic in a gene that is not complemented when the a heterologous gene or genes, for example, a therapeutic bacterium is present in the mammalian gut, wherein said gene(s) or after the Subject has experienced the therapeutic gene is complemented by an second inducible gene present effect. For example, in some embodiments, the kill switch is in the bacterium; transcription of the second gene is ArgR 65 activated to kill the bacteria after a period of time following repressible and induced in the presence of sufficiently high oxygen level-dependent expression of arg'. In some concentrations of arginine (thus complementing the auxo embodiments, the kill switch is activated in a delayed