DOCSLIB.ORG

Binds Multiple Sites Within the Aroh and Trp Operators

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Binds Multiple Sites Within the Aroh and Trp Operators Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Escherichia cod tryptophan repressor binds multiple sites within the aroH and trp operators Andrew A. Kumamoto, ~ William G. Miller, 2 and Robert P. GunsalusL2 1Molecular Biology Institute and the 2Department of Microbiology, University of Califomia, Los Angeles, Califomia 90024 USA DNase I footprinting and methylation protection studies have been used to analyze the binding of Escherichia coli Trp repressor to the trpR, aroH, and trp operators. The methylation protection assay shows that Trp repressor binds in two successive major grooves of the trpR operator, three successive major grooves of the aroH operator, and four successive major grooves of the trp operator. The simplest model that explains the difference in Trp repressor interaction at the three operators is that the aroH and trp operators are composed of multiple, helically stacked binding sites. When viewed in three dimensions, each site is positioned on a different face of the DNA, and together process up the surface of the DNA helix. Analysis of a deletion derivative of the trp operator supports this model. [Key Words" Trp repressor; aroH operator; trp operator; repressor binding] Received February 23, 1987; revised version accepted June 6, 1987. The Trp repressor of Escherichia coli coordinately regu- and by the isolation of constitutive mutations within lates the expression of the trp, aroH, and trpR operons in the trp operator {Bennett and Yanofsky 1978). These op- response to the intracellular levels of L-tryptophan erator constitutive mutations map at positions -16, (Cohen and Jacob 1959; Brown 1968; Rose et al. 1973; -15, -7, and -6 in the trp promoter sequence. The Gunsalus and Yanofsky 1980). The trpR operon, located DNA sequences of the trpR and aroH operons reveal at 99.5 min, codes for the Trp aporepressor and is auto- sites that exhibit significant sequence homology to the regulated (Morse and Yanofsky 1969; Gunsalus and Yan- trp operator (Gunsalus and Yanofsky 1980; Singelton et ofsky 1980; Kelley and Yanofsky 1982; Bachman 1983; al. 1980; Zurawski et al. 19811. In Figure 1, the se- Gunsalus et al. 1986). The aroH operon, located at 37 quences of the three operators are aligned to show max- min, encodes one of the three isozymes of 3-deoxy- D-arabino-heptulosonic acid-7-phosphate synthetase -io '÷1 +10 (DAHP). This enzyme catalyzes the first step in the i trpR TGCTATCGTACTCTT I AGCGAGTACAACCGGGG common pathway of aromatic amino acid biosynthesis • • :::: : • • (Brown 1968; Pittard et al. 1969; Zurawski et al. 1981). ..... ~so :::: 4o • .-30 The third operon, trp, is located at 27 min on the E. coli • ; ..... i aro H GCCGAATGTACTAGAG .A.AdTAG+~CATTAGCTT genetic map and encodes the enzymes that carry out the • . • . • . • . • . • . • . • . • final steps of L-tryptophan biosynthesis from the cellular • ::::~ • . -20 ..... :-I0 " " " +I • intermediate, chorismic acid (Yanofsky 1971). ; . The native form of the Trp aporepressor is a dimer AATCATCGAACTAGTI" ACTAG+ACGCXAGTTC composed of identical subunits of 108 amino acids (Gunsalus and Yanofsky 1980; Joachimiak et al. 1983; Figure 1. DNA sequence comparison of the operator regions of Arvidson et al. 1986). Binding of the corepressor, L-tryp- the trpR, aroH, and trp operons. The nucleotide sequence of tophan increases the affinity of Trp repressor for oper- each operator region is numbered relative to the start of tran- ator DNA, leading to the formation of the ternary re- scription. Sequence similarity between the operators is indi- pressor DNA complex (Rose et al. 1973). The binding of cated by the vertical dashes• The solid vertical double-headed arrow represents the sequence axis of symmetry. The compar- Trp repressor to its operators inhibits the initiation of ison of the trpR and aroH operators shows conservation of 13 of transcription of the trpR, aroH, and trp operon messages 22 base pairs, the aroH and trp sequences have 15 of 22 con- by preventing RNA polymerase from binding to the pro- served base pairs, while the trpR and the trp operator regions moters (Oppenheim et al. 1980). show 16 out of 22 conserved base pairs• No conservation of The physical location of the trp operator was pre- DNA sequence is seen in the flanking regions of the three oper- viously defined by deletion studies (Bennett et al. 1976) ators. 556 GENES& DEVELOPMENT 1:556-564 © 1987 by Cold Spring Harbor Laboratory ISSN 0890-9369/87 $1.00 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press trpR, aroH, and trp operators imum identity. The binding of Trp repressor at the trpR ence and absence of Trp repressor over a range of dif- and aroH operators was demonstrated by a RsaI endonu- ferent DNA and protein concentrations. DNase I clease protection assay (Gunsalus and Yanofsky 1980; footprints of the trpR, aroH, and trp operators are shown Zurawski et al. 1981). In this assay bound Trp repressor in Figure 2. protects a RsaI endonuclease site, located in the oper- The DNase I cleavage pattern for the trpR operator in ator, from cleavage by RsaI. the presence of Trp repressor reveals interactions that In this report, we explore the specific interactions be- extend from positions - 10 to + 15 on the top strand of tween the E. coli Trp repressor and the trpR, aroH, and the trpR operator and from positions - 14 to + 12 on the trp operators by biochemical protection experiments. bottom strand. These results are summarized in Figure These interactions are defined by the ability of Trp re- 3, and show that the site protected by Trp repressor ex- pressor to protect each operator from methylation by the tends over a 30-bp region, is centered at the start point of alkylating agent dimethyl sulfate, or cleavage by the en- transcription, and overlaps the -10 region of the trpR donuclease DNase I. Comparison of the Trp repressor promoter. interactions shows that Trp repressor interacts differ- The DNase I pattern for the Trp repressor interactions ently at each operator. The simplest hypothesis that ac- at the aroH operator is shown in Figure 2B. Protections counts for our data is that Trp repressor binds multiple, extend from positions -46 to -22 on the top strand and helically stacked sites. from positions -54 to -21 on the bottom strand. Trp repressor protects a 33-bp region that overlaps the -35 region of the aroH promoter. Results Figure 2C depicts the changes in the DNase I cleavage pattern of the trp operator in the presence of Trp re- DNase I footprinting of Trp repressor at the trpR, aroH, pressor. These interactions extend from positions -23 and trp operators shows differing domains of protection to + 8 on the top strand and from positions -27 to + 8 We have determined the DNase I footprints of Trp re- on the bottom strand. Interactions between the Trp re- pressor at the trpR, aroH, and trp operators. DNase I-de- pressor and the trp operator span 35 bp, and overlap the pendent cleavage reactions were performed in the pres- -10 region of the trp promoter. This region has also A trpR B aro/-/ C trp B T B T B T G-+ G-+ G-+ G-+ G-+ G-+ +18, -51- -13- +29- +!7.\ -47 +22- +16~ -43- -42 _ +13~. +15~ -49- , .... -40 - +12- +14- -35- -24- -39- ~--= -37 z +9- -54 +6- -32- " " +3- ~ +4- -30- -24- , iii -20- -32- -21- -14- i _- -17- 23_ -9- -6-- -2 m -9- iI6-- . t -58- -3-- -I0- +3- Em o -40- -14- ~ m .... +6- -15- i = +8- +9- ~glPO +i6- +!7- -46-- +18 -20- I.-o ~ " +22- +23- OO +25- ~alD +29- -27- go -26 Figure 2. DNase I footprint of Trp repressor binding at the trpR, aroH, and trp operators. (A, B, and C) DNase I footprints of the trpR, aroH, and trp operators, respectively. In each panel, the G lanes show the DNA guanine cleavage sequence reaction for the bottom {B) and top (T) strands {A > G reaction for aroH) and are used as a reference to align the DNA sequence for the DNase I reaction lanes. The DNase I footprint ladder for each strand in the presence ( + ) and absence (-) of Trp repressor is indicated. Numbering of the DNA sequence is relative to the start of transcription. GENES & DEVELOPMENT 557 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Kumamoto et al. A -20 -I0 :+I +I0 +20 I 'l I - 7 I trpR GATATGC TATC---~TACTCTT T;AGCGAGTAC, AACC GGGGGAGGC AT C TATACGAT AGCATGAGAAAITCG CTCATGTTGG C,j CCC TCCG TA t • -]. i i -50 -40 ' -30 -20 Figure 3. Summary of the DNase I footprint and meth- I , I I, ~ I ylation protection results for Trp repressor binding at the aro H AGTCG r" F-r~AATGTA CTAGAGIIAACTAGTGC ATTAGCTTATTTTTTT TCAGCOSCTTACATGATCTCIT TGATC ACGTAATC GAATAAAAAAA trpR, aroH, and trp operators. The vertical double-headed T_ i -3-- J arrow represents the DNA sequence axis of symmetry as i I shown in Fig. 1. The brackets above and below the DNA I sequences indicate the DNase I-protected regions (Fig. 2) -30 -20 ~-I0 +1 +10 I F I 1: I ~ I of each operator for each strand. Guanine residues repre- AA rTAATCATCGAAC TAGT~AACTAGTAC GCAAGTTCA~C GTAAAA sented in boldface indicate bases that show decreased trp TTAATTAGTAGCTTGATCAAJTTGATCATGCGTTCAAGT GCATTTT -E I I methylation by dimethylsulfate in the presence of Trp l repressor relative to operator DNA alone. t been identified genetically by constitutive mutations at guanines at -43, -35, and -29. No increased meth- (Bennett and Yanofsky 1978). ylation of any guanine residue is observed within the The DNase I protection data for the trpR, aroH, and bottom strand of the operator region, and no changes in trp operators are compared in Figure 3.
Load more

Recommended publications
  • Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for Cellular Control and Differentiation
    Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for cellular control and differentiation. • Understanding “expression” is a “hot” area in Biology. General Mechanisms 1. Regulate Gene Expression 2. Regulate Protein Activity Operon Model • Jacob and Monod (1961) - Prokaryotic model of gene control. • Always on the National AP Biology exam! Operon Structure 1. Regulatory Gene 2. Operon Area a. Promoter b. Operator c. Structural Genes Gene Structures Regulatory Gene • Makes Repressor Protein which may bind to the operator. • Repressor protein blocks transcription. Promoter • Attachment sequence on the DNA for RNA polymerase to start transcription. Operator • The "Switch”, binding site for Repressor Protein. • If blocked, will not permit RNA polymerase to pass, preventing transcription. Structural Genes • Make the enzymes for the metabolic pathway. Lac Operon • For digesting Lactose. • Inducible Operon - only works (on) when the substrate (lactose) is present. If no Lactose • Repressor binds to operator. • Operon is "off”, no transcription, no enzymes made If Lactose is absent If Lactose is present • Repressor binds to Lactose instead of operator. • Operon is "on”, transcription occurs, enzymes are made. If Lactose is present Enzymes • Digest Lactose. • When enough Lactose is digested, the Repressor can bind to the operator and switch the Operon "off”. Net Result • The cell only makes the Lactose digestive enzymes when the substrate is present, saving time and energy. Animation • http://www.biostudio.com/d_%20Lac%20Ope ron.htm trp Operon • Makes/synthesizes Tryptophan. • Repressible Operon. – Predict how it is different from the inducible operon… If no Tryptophan • Repressor protein is inactive, Operon "on” Tryptophan made. • “Normal” state for the cell.
    [Show full text]
  • 16.1 | Regulation of Gene Expression
    436 Chapter 16 | Gene Expression 16.1 | Regulation of Gene Expression By the end of this section, you will be able to do the following: • Discuss why every cell does not express all of its genes all of the time • Describe how prokaryotic gene regulation occurs at the transcriptional level • Discuss how eukaryotic gene regulation occurs at the epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels For a cell to function properly, necessary proteins must be synthesized at the proper time and place. All cells control or regulate the synthesis of proteins from information encoded in their DNA. The process of turning on a gene to produce RNA and protein is called gene expression. Whether in a simple unicellular organism or a complex multi-cellular organism, each cell controls when and how its genes are expressed. For this to occur, there must be internal chemical mechanisms that control when a gene is expressed to make RNA and protein, how much of the protein is made, and when it is time to stop making that protein because it is no longer needed. The regulation of gene expression conserves energy and space. It would require a significant amount of energy for an organism to express every gene at all times, so it is more energy efficient to turn on the genes only when they are required. In addition, only expressing a subset of genes in each cell saves space because DNA must be unwound from its tightly coiled structure to transcribe and translate the DNA. Cells would have to be enormous if every protein were expressed in every cell all the time.
    [Show full text]
  • Formation of Heterodimers Between Wild Type and Mutant Trp Aporepressor Polypeptides of Eschem'chia Coli Thomas J
    PROTEINS: Structure, Function, and Genetics 4:173-181 (1988) Formation of Heterodimers Between Wild Type and Mutant trp Aporepressor Polypeptides of Eschem'chia coli Thomas J. Graddis,' Lisa S. Klig,' Charles Yanofsky,' and Dale L. Oxender' 'Department of Biological Chemistry, University of Michigan, Ann Arbor, Michigan 48109 and 'Department of Biological Sciences, Stanford University, Stanford, California 94305 ABSTRACT Availability of the three-dimen- tophan.1-6 The trp aporepressor is activated by the sional structure of the trp repressor of Escherichia binding of two molecules of its corepressor. Once ac- coli and a large group of repressor mutants has per- tivated, trp repressor binds to the operators of the trp, mitted the identification and analysis of mutants aroH, and trpR operons, regulating transcription ini- with substitutions of the amino acid residues that tiati~n.~,'The aroH and trp operons encode biosyn- form the tryptophan binding pocket. Mutant apore- thetic enzymes, whereas the trpR operon encodes the pressors selected for study were overproduced using trp aporepressor. The trpR gene has been cloned and a multicopy expression plasmid. Equilibrium di- its nucleotide sequence determined.3 The aporepres- alysis with ''C-tryptophan and purified mutant and sor and repressor have been purified and the crystal wild type aporepressors was employed to determine structures of both have been solved at high resolu- tryptophan binding constants. The results obtained ti~n.~-"The trp aporepressor is a dimer of identical indicate that replacement of threonine 44 by methi- 107 residue polypeptides." The existence of the three- onine (TM44) or arginine 84 by histidine (RH84) low- dimensional structures, and the availability of many ers the affinity for tryptophan approximately two- repressor mutants,2i12has facilitated this analysis of and four-fold, respectively.
    [Show full text]
  • RNA-Based Regulation of Genes of Tryptophan Synthesis and Degradation, in Bacteria
    REVIEW RNA-based regulation of genes of tryptophan synthesis and degradation, in bacteria CHARLES YANOFSKY Department of Biological Sciences, Stanford University Stanford, California 94305, USA ABSTRACT We are now aware that RNA-based regulatory mechanisms are commonly used to control gene expression in many organisms. These mechanisms offer the opportunity to exploit relatively short, unique RNA sequences, in altering transcription, translation, and/or mRNA stability, in response to the presence of a small or large signal molecule. The ability of an RNA segment to fold and form alternative hairpin secondary structures—each dedicated to a different regulatory function—permits selection of specific sequences that can affect transcription and/or translation. In the present paper I will focus on our current understanding of the RNA-based regulatory mechanisms used by Escherichia coli and Bacillus subtilis in controlling expression of the tryptophan biosynthetic operon. The regulatory mechanisms they use for this purpose differ, suggesting that these organisms, or their ancestors, adopted different strategies during their evolution. I will also describe the RNA-based mechanism used by E. coli in regulating expression of its operon responsible for tryptophan degradation, the tryptophanase operon. Keywords: trp operon; trp suboperon; aro supraoperon; tna operon; transcription attenuation; T box regulation; tryptophan as a regulatory signal; tRNATrp as a regulatory signal; peptidyl-tRNA; ribosome mediated regulation INTRODUCTION A second regulatory lesson learned over the years is that information within mRNAs, or other RNAs, as well as small Studies over the past 50+ years have revealed that metabolites and other molecules—in addition to DNA and optimization of gene expression has been a major evolu- proteins—often provides specific regulatory signals, or tionary objective for most species.
    [Show full text]
  • Chapter 3. the Beginnings of Genomic Biology – Molecular
    Chapter 3. The Beginnings of Genomic Biology – Molecular Genetics Contents 3. The beginnings of Genomic Biology – molecular genetics 3.1. DNA is the Genetic Material 3.6.5. Translation initiation, elongation, and termnation 3.2. Watson & Crick – The structure of DNA 3.6.6. Protein Sorting in Eukaryotes 3.3. Chromosome structure 3.7. Regulation of Eukaryotic Gene Expression 3.3.1. Prokaryotic chromosome structure 3.7.1. Transcriptional Control 3.3.2. Eukaryotic chromosome structure 3.7.2. Pre-mRNA Processing Control 3.3.3. Heterochromatin & Euchromatin 3.4. DNA Replication 3.7.3. mRNA Transport from the Nucleus 3.4.1. DNA replication is semiconservative 3.7.4. Translational Control 3.4.2. DNA polymerases 3.7.5. Protein Processing Control 3.4.3. Initiation of replication 3.7.6. Degradation of mRNA Control 3.4.4. DNA replication is semidiscontinuous 3.7.7. Protein Degradation Control 3.4.5. DNA replication in Eukaryotes. 3.8. Signaling and Signal Transduction 3.4.6. Replicating ends of chromosomes 3.8.1. Types of Cellular Signals 3.5. Transcription 3.8.2. Signal Recognition – Sensing the Environment 3.5.1. Cellular RNAs are transcribed from DNA 3.8.3. Signal transduction – Responding to the Environment 3.5.2. RNA polymerases catalyze transcription 3.5.3. Transcription in Prokaryotes 3.5.4. Transcription in Prokaryotes - Polycistronic mRNAs are produced from operons 3.5.5. Beyond Operons – Modification of expression in Prokaryotes 3.5.6. Transcriptions in Eukaryotes 3.5.7. Processing primary transcripts into mature mRNA 3.6. Translation 3.6.1.
    [Show full text]
  • Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the Tna Operon of Escherichia Coli
    JOURNAL OF BACTERIOLOGY, Aug. 1995, p. 4451–4456 Vol. 177, No. 15 0021-9193/95/$04.0010 Copyright 1995, American Society for Microbiology Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the tna Operon of Escherichia coli CHARLES YANOFSKY* AND VIRGINIA HORN Department of Biological Sciences, Stanford University, Stanford, California 94305-5020 Received 13 March 1995/Accepted 27 May 1995 The growth-inhibiting drug bicyclomycin, known to be an inhibitor of Rho factor activity in Escherichia coli, was shown to increase basal level expression of the tryptophanase (tna) operon and to allow growth of a tryptophan auxotroph on indole. The drug also relieved polarity in the trp operon and permitted growth of a trp double nonsense mutant on indole. Nine bicyclomycin-resistant mutants were isolated and partially characterized. Recombination data and genetic and biochemical complementation analyses suggest that five have mutations that affect rho, three have mutations that affect rpoB, and one has a mutation that affects a third locus, near rpoB. Individual mutants showed decreased, normal, or increased basal-level expression of the tna operon. All but one of the resistant mutants displayed greatly increased tna operon expression when grown in the presence of bicyclomycin. The tna operon of the wild-type drug-sensitive parent was also shown to be highly expressed during growth with noninhibitory concentrations of bicyclomycin. These findings demonstrate that resistance to this drug may be acquired by mutations at any one of three loci, two of which appear to be rho and rpoB. Zwiefka et al. (24) found that the antibiotic bicyclomycin segment and interacts with the transcribing RNA polymerase (bicozamycin), an inhibitor of the growth of several gram- molecule, causing it to terminate transcription (7, 9).
    [Show full text]
  • I = Chpt 15. Positive and Negative Transcriptional Control at Lac BMB
    BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac B M B 400 Part Four: Gene Regulation Section I = Chapter 15 POSITIVE AND NEGATIVE CONTROL SHOWN BY THE lac OPERON OF E. COLI A. Definitions and general comments 1. Operons An operon is a cluster of coordinately regulated genes. It includes structural genes (generally encoding enzymes), regulatory genes (encoding, e.g. activators or repressors) and regulatory sites (such as promoters and operators). 2. Negative versus positive control a. The type of control is defined by the response of the operon when no regulatory protein is present. b. In the case of negative control, the genes in the operon are expressed unless they are switched off by a repressor protein. Thus the operon will be turned on constitutively (the genes will be expressed) when the repressor in inactivated. c. In the case of positive control, the genes are expressed only when an active regulator protein, e.g. an activator, is present. Thus the operon will be turned off when the positive regulatory protein is absent or inactivated. Table 4.1.1. Positive vs. negative control BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac 3. Catabolic versus biosynthetic operons a. Catabolic pathways catalyze the breakdown of nutrients (the substrate for the pathway) to generate energy, or more precisely ATP, the energy currency of the cell. In the absence of the substrate, there is no reason for the catabolic enzymes to be present, and the operon encoding them is repressed. In the presence of the substrate, when the enzymes are needed, the operon is induced or de-repressed.
    [Show full text]
  • Application of Models for Biomolecular Structure and Interactions to Understand and Influence Biological Function
    Application of Models for Biomolecular Structure and Interactions to Understand and Influence Biological Function Zur Erlangung des akademischen Grades eines DOKTORS DER NATURWISSENSCHAFTEN (Dr. rer. nat.) Fakultät für Chemie und Biowissenschaften Karlsruher Institut für Technologie (KIT) - Universitätsbereich genehmigte DISSERTATION von Irene Meliciani aus Rom (Italien) Dekan: Prof. Dr. Martin Bastmeyer Referent: Prof. Dr. Stefan Bräse Korreferent: Apl. Prof. Dr. Wolfgang Wenzel Tag der mündlichen Prüfung: 19.10.2011 a mamma e papà Application of Models for Biomolecular Structure and Interactions to Understand and Influence Biological Function Irene Meliciani Karlsruher Institut für Technologie Institut für Nanotechnologie Intitut für Organische Chemie Zusammenfassung Die Forschung in den Lebenswissenschaften hat in den letzten Jahrzehnten zu einem enormen Wissensgewinns bezüglich der Abläufe zellulärer Prozesse und ihrer Steuerung geführt. Die Steuerung biologischer Prozesse wird vielfach über Kontaktwechselwirkungen der daran beteiligten Biomoleküle bewältigt. Mit dieser Arbeit möchte ich zu einem besseren Verständnis biomolekularer Interaktionen beitragen. Ein Teil dieser Arbeit beschäftigt sich mit der Untersuchung von Proteininteraktionen, wobei als Methoden für die Modellierung von Protein-Protein-Wechselwirkungen (POEM) und für die Protein-Liganden-Wechselwirkung (FLEXSCREEN) eingesetzt wurden. Es wurden die Interaktionen der Chemokinrezeptoren CCR3 und CXCR1 mit für den Entzündungsverlauf wichtigen Steuerungsmolekülen (Chemokinen)
    [Show full text]
  • Teaching Gene Regulation in the High School Classroom, AP Biology, Stefanie H
    Wofford College Digital Commons @ Wofford Arthur Vining Davis High Impact Fellows Projects High Impact Curriculum Fellows 4-30-2014 Teaching Gene Regulation in the High School Classroom, AP Biology, Stefanie H. Baker Wofford College, [email protected] Marie Fox Broome High School Leigh Smith Wofford College Follow this and additional works at: http://digitalcommons.wofford.edu/avdproject Part of the Biology Commons, and the Genetics Commons Recommended Citation Baker, Stefanie H.; Fox, Marie; and Smith, Leigh, "Teaching Gene Regulation in the High School Classroom, AP Biology," (2014). Arthur Vining Davis High Impact Fellows Projects. Paper 22. http://digitalcommons.wofford.edu/avdproject/22 This Article is brought to you for free and open access by the High Impact Curriculum Fellows at Digital Commons @ Wofford. It has been accepted for inclusion in Arthur Vining Davis High Impact Fellows Projects by an authorized administrator of Digital Commons @ Wofford. For more information, please contact [email protected]. High Impact Fellows Project Overview Project Title, Course Name, Grade Level Teaching Gene Regulation in the High School Classroom, AP Biology, Grades 9-12 Team Members Student: Leigh Smith High School Teacher: Marie Fox School: Broome High School Wofford Faculty: Dr. Stefanie Baker Department: Biology Brief Description of Project This project sought to enhance high school students’ understanding of gene regulation as taught in an Advanced Placement Biology course. We accomplished this by designing and implementing a lab module that included a pre-lab assessment, a hands-on classroom experiment, and a post-lab assessment in the form of a lab poster. Students developed lab skills while simultaneously learning about course content.
    [Show full text]
  • Mutant Tryptophan Aporepressors with Altered Specificities Of
    Copyright 0 1991 by the Genetics Society of America Mutant Tryptophan Aporepressors With Altered Specificitiesof Corepressor Recognition Dennis N. Arvidson,' Michael Shapiro' and Philip Youderian' Department of Biological Sciences, University of Southern Calqornia, Los Angeles, Calqornia 90089 Manuscript received November 20, 1990 Accepted for publication January 19, 199 1 ABSTRACT The Escherichia coli trpR gene encodes tryptophan aporepressor, which binds the corepressor ligand, L-tryptophan, to form an active repressor complex. The side chain of residue valine 58 of Trp aporepressor sits at the bottom of the corepressor @-tryptophan) binding pocket. Mutant trpR genes encoding changes of Vals8 to the other 19 naturally occurring amino acids were made. Each of the mutant proteins requires a higher intracellular concentration of tryptophan for activation of DNA binding than wild-type aporepressor. Whereas wild-type aporepressor is activated better by 5- methyltryptophan (5-MT) than by tryptophan, IlesHand other mutant aporepressors prefer tryptophan to 5-MT as corepressor, and Ala5' and GIY'~prefer 5-MT much more strongly than wild-type aporepressor in vivo. These mutant aporepressors are the first examples of DNA-binding proteins with altered specificities ofcofactor recognition. ANY regulatory proteins areallosteric, and bind intermonomer interactions stabilize its extraordinary M small metabolic intermediates that modify their hydrophobic core. The aporepressor dimer denatures activities, allowing the intracellular pattern of gene at a very high temperature (>go") (BAEet al. 1988). expression to respond to physiologicalchange. For Comparisons of the crystal structures of repressor example, the Escherichia coli tryptophan aporepressor (SCHEVITZet al. 1985; LAWSONet al. 1988;OTWI- (TrpR) protein binds DNA poorly. However, when NOWSKI et al.
    [Show full text]
  • Development of Novel Transgenic Zebrafish
    DEVELOPMENT OF NOVEL TRANSGENIC ZEBRAFISH MODELS AND THEIR APPLICATION TO STUDIES ON ENVIRONMENTAL OESTROGENS Submitted by Jon Marc Green to the University of Exeter as a thesis for the degree of Doctor of Philosophy in Biological Sciences, September 2016 This thesis is available for Library use on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. I certify that all material in this thesis which is not my own work has been identified and that no material has previously been submitted and approved for the award of a degree by this or any other University. (Signature) ……………………………………………(Jon Marc Green) 1 Abstract Oestrogenic chemicals have become increasingly associated with health effects in wildlife populations and humans. Transgenic animal models have been developed to understand the mechanisms by which these oestrogenic chemicals alter hormonal signalling pathways and how these alterations can lead to chronic health effects. The use of highly informative transgenic animal models will also result in better use and potential reduction of intact animals used in animal testing in line with the principles of the 3Rs. In this thesis work, two novel oestrogen responsive transgenic zebrafish models have been generated to investigate the effects of oestrogenic chemicals, identify their tissue targets and better understand the temporal dynamics of these responses. Both models express the pigment-free ‘Casper’ (a mutant line lacking skin pigment) phenotype, which facilitate identification of responding target tissues in the whole fish in all fish life stages (embryos to adults). The oestrogen response element green fluorescent (ERE-GFP)-Casper model was generated by crossing an established ERE-GFP line with the skin pigment free Casper line.
    [Show full text]
  • Pathogen Xylella Fastidiosa
    articles The genome sequence of the plant pathogen Xylella fastidiosa The Xylella fastidiosa Consortium of the Organization for Nucleotide Sequencing and Analysis*,Sa˜o Paulo, Brazil * A full list of authors appears at the end of this paper ............................................................................................................................................................................................................................................................................ Xylella fastidiosa is a fastidious, xylem-limited bacterium that causes a range of economically important plant diseases. Here we report the complete genome sequence of X. fastidiosa clone 9a5c, which causes citrus variegated chlorosis—a serious disease of orange trees. The genome comprises a 52.7% GC-rich 2,679,305-base-pair (bp) circular chromosome and two plasmids of 51,158 bp and 1,285 bp. We can assign putative functions to 47% of the 2,904 predicted coding regions. Efficient metabolic functions are predicted, with sugars as the principal energy and carbon source, supporting existence in the nutrient-poor xylem sap. The mechanisms associated with pathogenicity and virulence involve toxins, antibiotics and ion sequestration systems, as well as bacterium–bacterium and bacterium–host interactions mediated by a range of proteins. Orthologues of some of these proteins have only been identified in animal and human pathogens; their presence in X. fastidiosa indicates that the molecular basis for bacterial pathogenicity is both conserved and independent of host. At least 83 genes are bacteriophage-derived and include virulence-associated genes from other bacteria, providing direct evidence of phage-mediated horizontal gene transfer. Citrus variegated chlorosis (CVC), which was first recorded in Brazil meningitidis10 (53.7%). This may reflect the lack of previous in 1987, affects all commercial sweet orange varieties1. Symptoms complete genome sequences from phytopathogenic bacteria.
    [Show full text]