The Pennsylvania State University

The Graduate School Eberly College of Science

REGULATION OF BY NusA AND NusG IN Bacillus subtilis

A Dissertation in

Biochemistry, Microbiology, and

by

Smarajit Mondal

© 2016 Smarajit Mondal

Submitted in Partial Fulfillment of the Requirements

for the Degree of

Doctor of Philosophy

May 2016

The dissertation of Smarajit Mondal was reviewed and approved* by the following:

Paul Babitzke Professor Biochemistry and Molecular Biology Dissertation Adviser Chair of Committee

David S. Gilmour Professor of Biochemistry and Molecular Biology

Joseph C. Reese Professor of Biochemistry and Molecular Biology

Katsuhiko Murakami Professor of Biochemistry and Molecular Biology

Philip C. Bevilacqua Professor Chemistry

Scott B. Selleck Head of the Department of Biochemistry and Molecular Biology

*Signatures are on file in the Graduate School.

ii ABSTRACT

Transcription in is regulated at the level of initiation, elongation and termination.

Although the regulation of transcriptional initiation is well studied, the regulation of elongation and termination are not well understood. This thesis focuses on understanding the role of NusA on and the role of NusG on RNA polymerase pausing using genomic, biochemical and computational analyses.

Tight regulation of transcription termination is required to maintain proper levels of gene expression in bacteria, because termination failure abolishes boundaries, leading to misregulation of downstream genes. NusA is a negative transcription elongation factor that was known to cause a slight stimulation of termination at intrinsic terminators in vitro, but its impact on termination and global gene expression in vivo was not known. In this thesis, I describe the mapping of intrinsic terminators genome wide in B subtilis and measure the effect of NusA on the efficiency of these terminators in vivo using a novel high resolution 3’ end-mapping technique coupled with mRNA profiling. Based on these studies, I report the existence of a subclass of previously unidentified pseudo-intrinsic terminators that are dependent on NusA for termination.

Sequence comparison of different terminators reveals that weak hairpins and/or distal U-tract interruptions favors NusA-dependent termination, supporting a model in which NusA assists hairpin folding and slows down RNA polymerase near the termination window. These studies also revealed that readthrough of NusA-dependent terminators increases transcription of genes related to replication and DNA metabolism, suggesting a role of NusA in maintaining genome stability. I further show that nusA is autoregulated by a transcription attenuation mechanism that does not rely on antiterminator structures to prevent termination. Instead, NusA-stimulated termination in its 5'UTR dictates the extent of transcription into the operon.

iii Another major focus of this thesis is to understand the regulation of transcription elongation by NusG-stimulated pausing of RNA polymerase. NusG is a positive elongation factor in E. coli that accelerates transcription by reducing the dwell time of RNA polymerase at pause sites. In B. subtilis, NusG stimulates pausing at positions U107 and U144 in the trp-leader transcript. NusG-stimulated pausing at U144 requires a short sequence in the non-template DNA strand and participates in the TRAP-dependent repression mechanism. In this thesis, I report the characterization of the NusG-stimulated U107 pause signal and show that disruption of the NusG recognition motif dramatically reduces pausing. These results suggest a mechanism in which RNA polymerase pausing at this site participates in the transcription attenuation mechanism by increasing additional time for TRAP binding to the nascent transcript.

iv TABLE OF CONTENTS

LIST OF FIGURE…………………………………………………………………...vii LIST OF TABLES…………………………………………………………………..viii ABBREVIATIONS………………………………………………………………….ix ACKNOWLEDGEMENTS………………………………………………………….x DEDICATION……………………………………………………………….………xi

Chapter 1: Introduction: An overview of transctiption in bacteria ...... 1

1.1 Components involved in prokaryotic transcription ...... 1 1.1.1 The RNA polymerase core enzyme ...... 1 1.1.2 The sigma factor and RNAP holoenzyme ...... 5 1.1.3 Other Regulatory factors ...... 7 1.1.3.1 Factors interacting with the secondary channel ...... 7 1.1.3.2 NusA: a conserved termination and pausing factor ...... 11 1.1.3.3 NusG: a cofactor of Rho-dependent termination ...... 14 1.2 The transcription cycle ...... 18 1.2.1 recognition and initiation ...... 18 1.2.2 Promoter clearence and elongation ...... 21 1.2.3 Termination and dissociation of individual components ...... 22 1.2.3.1 Intrinsic termination ...... 22 1.2.3.2 Rho-dependent termination ...... 25 1.2.3.3 Importance of termination ...... 26 1.3 Transcriptional pausing ...... 28 1.4 Transcriptional attenuation ...... 32 1.4.1 Riboswitch-mediated attenuation ...... 32 1.4.2 T-box antitermination ...... 34 1.4.3 Attenuation by ribosomal stalling ...... 34 1.4.4 Attenuation by RNA-binding proteins ...... 35 1.5 References ...... 37

Chapter 2: NusA-dependent Transcription Termination Prevents Misregulation of Global Gene Expression ...... 57

2.1 Abstract ...... 58 2.2 Introduction ...... 59 2.3 Results ...... 60 2.3.1 Construction of a NusA depletion strain ...... 60 2.3.2 Identification of terminators by 3’ end-mapping ...... 61 2.3.3 Identification of NusA-dependent termination in vivo ...... 66 2.3.4 features that affect their response to NusA ...... 69 2.3.5 Weak terminators favor NusA-dependent termination ...... 73 2.3.6 Examination of NusA-inhibited terminators in vitro ...... 75 2.3.7 NusA depletion leads to global gene expression defects ...... 75 2.3.8 Misregulation of replication and DNA metabolism genes ...... 77 2.3.8. Autoregulation of nusA expression ...... 79 v 2.4 Discussion ...... 82 2.5 Materials and Methds ...... 85 2.5.1 Library preparation ...... 85 2.5.2 Data analysis ...... 86 2.5.2.1 Identification of 3’ ends ...... 87 2.5.2.2 Terminator screening and characterization ...... 87 2.5.2.3 Calculation of termination efficiency ...... 88 2.5.2.4 Differential expression and GO-term analysis ...... 89 2.5.3 Primer extension ...... 90 2.5.4 Western blot ...... 90 2.5.5 DNA templates, plasmids and proteins ...... 90 2.5.6 In vitro termination ...... 91 2.5.5 β-galactosidase assay ...... 91 2.6 References ...... 92

Chapter 3: Characterization of the NusG-stimulated U107 Pause Signal in B. subtilis trp Leader and its Role in Attenuation Control of the trpEDCFBA Operon ...... 137

3.1 Abstract ...... 138 3.2 Introduction ...... 139 3.3 Results ...... 144 3.3.1 T98 and T100-T102 are components of the U107 pause signal ...... 144 3.3.2 T100-T102 is required for NusG-stimulated pausing at U107 ...... 146 3.3.3 Pausing at U107 participates in the attenuation mechanism in vitro ...... 148 3.4 Discussion and future directions ...... 150 3.5 Materials and methods ...... 152 3.5.1 DNA templates and proteins ...... 152 3.5.2 in vitro pausing assays ...... 152 3.5.3 in vitro termination assays ...... 153 3.6 References ...... 154

Chapter 4: Summary and Future Perspectives ...... 157

4.1 Introduction ...... 158 4.2 High resolution mapping of intrinsic terminators ...... 159 4.3 Identification of stable degradation products ...... 160 4.4 Characterization of new small RNAs ...... 162 4.5 Identification of new attenuators ...... 164 4.6 Understanding the indispensability of NusA ...... 164 4.7 References ...... 165

vi

LIST OF FIGURES

Figure 1-1. Cartoon schematics of elongating RNAP ………………….………………………..2 Figure 1-2. σ factor and the σ cycle ……………………………………………………………...6 Figure 1-3. Transcription factors that interact with RNAP secondary channel …………….....…9 Figure 1-4. Structure of elongation factor NusA. .………………………………………………12 Figure 1-5. NusG and its homologs. .…………….……………………………………………...16 Figure 1-6. σ70 promoter and the transcription cycle. .……………………………………..……19 Figure 1-7. Mechanism of intrinsic termination. ………………………………………………..23 Figure 1-8. Impact of termination on gene expression.…...……………………………………..27 Figure 1-8. Hairpin dependent and backtracking-mediated pausing. ……...……………………29 Figure 1-9. The major classes of bacterial attenuators and their mechanisms. …………………33 Figure 2-1. The B. subtilis NusA depletion strain PLBS802.……………………………...…….62 Figure 2-2. Library construction and determination of termination efficiency (%T).…………...64 Figure 2-3. Effect of NusA on intrinsic termination in vivo.…………………………………….67 Figure 2-4. In vitro effect of NusA on NusA-dependent terminators identified in vivo.……...…68 Figure 2-5. Terminator features contributing to stimulation by NusA.…………………...……...70 Figure 2-6. Distal U-tract interruptions and weak hairpin stems favor NusA-dependent termination……………………………………………………………………………………….74 Figure 2-7. NusA depletion alters expression of genes directly and indirectly………………….76 Figure 2-8. Impact of NusA-dependent terminators on global gene expression…………………78 Figure 2-9. Autoregulation of nusA expression…………………………………………………..81 Figure 3-1. Regulation of trp operon expression in B. subtilis………………………………….140 Figure 3-2. The U107 and U144 pause sites and their sequence determinants…………………142 Figure 3-3. T98 and T100-102 participate in U107 pausing……………………………………145 Figure 3-4. T100-102 is required for NusG stimulated pausing at U107……………………….147 Figure 3-5. Pausing at U107 participate in attenuation mechanism in presence of NusA and NusG…………………………………………………………………………………149 Figure 4-1. Stable decay intermediates of the rapA gene identified by 3’ end-mapping……….161 Figure 4-2. Examples of possible small RNAs identified by RNA-Seq………………………...163

vii LIST OF TABLES

Table 1: Top 10 NusA-dependent terminators………...…………………………………………68 Table 2: Pairwise P-values for Figure 2-5 b……………………………………………...………72 Table 3: Pairwise P-values for Figure 2-5 f…………...…………………………….……………72 Table 4. Terminators identified by 3’ end-mapping and the effect of NusA depletion………..…99 Table 5. Genes that are differentially expressed twofold or more upon NusA depletion……….131

viii ABBREVIATIONS

5’ SL 5' stem-loop ACH Acid casein hydrolysate AR1/2 Autoregulatory domain 1 or 2 BWA Burrows-Wheeler aligner CTD C-terminal domain DAVID Database for Annotation, Visualization and Integrated Discovery GO Gene ontology HBS Hybrid binding site IGV Integrative Genomics Viewer IPTG Isopropyl β-D-1-thiogalactopyranoside KCl Potassium chloride KH1/2 K-homology domain 1 or 2 LB Luria-Bertani broth NER Nucleotide excision repair NET-Seq Native elongating transcript sequencing NGN NusG N-terminal domain NTD N-terminal domain ntDNA Non-template DNA ops Operon polarity suppressor p-adj Adjusted P-value PEG Polyethylene glycol POT Point of termination RNAP RNA polymerase rRNA Ribosomal RNA SD Shine-Dalgarno sequence SDS Sodium dodecyl sulfate SE/SEM Standard error of the mean sRNA Small RNA

T1/2 Pause half- TCR Transcription coupled repair TEC Transcription elongation complex TLS Trans-lesion synthesis TRAP trp RNA-binding attenuation protein UBS Upstream binding site UTR Untranslated region WT Wild-type αCTD C-terminal domain of RNAP α subunit

ix ACKNOWLEDGEMENTS

I would like to take this opportunity to express my deepest gratitude towards individuals whose constant support, encouragement and advice helped me complete this thesis. First and foremost, I would like to thank my thesis advisor Dr. Paul Babitzke for providing me the opportunity to become a part of his research group and providing me the perfect environment to grow as a scientist. The part of Paul’s mentorship that helped me the most was to give me freedom to explore my own scientific ideas without being worried about failure. His positive attitude, thoughtful reasoning and constant motivation played a pivotal role in making this thesis a reality. Outside science, I am also grateful to Paul for his constant effort to improve my public speaking and scientific writing skills. I am also indebted to my dissertation committee Dr. David

Gilmour, Dr. Joseph Reese, Dr. Katsuhiko Murakami and Dr. Phillip Bevilacqua for their thoughtful suggestions and constant motivation through all these years. In particular, the open- ended discussions in RNA club played a pivotal role to shape my research.

I would like to extend my thanks to my present and past lab members, in particular Dr.

Alex Yakhnin, whose active support, suggestions and comments played a crucial role in completion of this work. I also thank Dr. Craig Praul and the Penn State Genomics Core Facility for helping me with the RNA-seq library preparation and sequencing. I share a deep sense of appreciation toward Dr. Istvan Albert and Aswathy Sebastian for their help with in silico analysis of the deep sequencing data. I thank Dr. Ibrahim Moustafa for his assistance with statistical analysis and Dr. Mike Axtell for initial consultation.

My parents have been my primary source of encouragement; they constantly inspired me to chase my dreams and supported me in every respect to fulfill my aspirations. On a personal note, I would like to thank my wife Sravani Banerjee, who has always been there through thick and thin to help me achieve this important milestone. I have also been fortunate to have wonderful friends around me; this journey would have been less exciting without their presence.

x

DEDICATION

To my dad (bapi)

Sanjit Kumar Mondal

For making me the person I am and sacrificing all his happiness for my success

xi Chapter 1

Introduction: An overview of transcription in bacteria

Transcription is the process in which the genetic information encoded in DNA is copied into RNA. The monomeric ribonucleoside triphosphates (NTPs) are bound specifically and sequentially to the DNA template via complementary base pairing. Each NTP is added to the 3′ end of the growing RNA chain by phosphodiester bond formation catalyzed by an enzyme known as RNA polymerases (RNAP), which advances processively along the DNA template. The process of transcription is controlled by specific signals embedded in the DNA sequences and various cellular transcription factors that determine the length, magnitude and timing of transcription. Together, these factors determine which genes are selectively transcribed at various stages of growth to help the cell maintain homeostasis and to cope with environmental changes.

1.1 Components Involved in Prokaryotic Transcription

Transcription requires a double stranded DNA template, the four NTPs, RNAP, and

Mg2+. Apart from these basic factors, several other proteins associate with the elongating polymerase as various times and modify the elongation process, e.g. NusA, NusG, NusE,

RfaH, and Rho.

1.1.1 The RNA Polymerase Core Enzyme

RNAP is the enzyme responsible for copying a DNA sequence into an RNA sequence during transcription. Cellular RNAP is a multisubunit enzyme, the basic architecture of which is conserved in all living organisms (Figure 1-1). RNAP is a large (~500

1

Figure 1-1. Cartoon schematics of elongating RNAP. The top row shows the β’ side view and the bottom row gives the β side view. The active center Mg2+ ions are shown as yellow spheres, while other important structural elements of RNAP are shown in magenta (bridge helix, lid, rudder, trigger loop). In the cross-sectional views, binding sites for RNAP ligands or effectors are highlighted as: A-site (NTP), green; Gre. (Adapted from Darst S., 2009).

2 kDa) and complex enzyme consisting of five different subunits (α, β, β′, ω, σ) (Burgess RR,

1969; Burgess and Travers, 1970; Geszvain and Landick, 2004). The subunit composition of the entire enzyme, also called the holoenzyme, is α2ββ′ωσ. The σ subunit helps RNAP to bind the promoter element, participates in the initiation of RNA synthesis, and subsequently dissociates from the rest of the enzyme after promoter clearance. RNAP without the σ factor

(α2ββ′ω) is called the core enzyme (Hinkle and Chamberlin, 1972). The structure of Thermus aquaticus core RNAP first revealed the general shape of the enzyme (Zhang et al., 1999), which is conserved in all living organisms. The β and β′ subunits together constitute a conserved crab claw-like structure through which the DNA template is passed and nascent

RNA is synthesized (Severinov et al., 1996). The positively charged channel of the enzyme interacts with nucleic acid, whereas the outside surface of RNAP is negatively charged. The two α subunits, referred to as αI and αII, are involved in distinct functions in the core enzyme

(Zhang et al., 1999). The αI subunit contacts the β subunit while αII contacts β′ (Ishihama et al., 1987). Each α subunit is divided into two functional domains (N-terminal and C-terminal) that are connected by a flexible linker. The NTDs of the α subunits are placed on the outer surface of RNAP, while the CTDs and linkers are disordered (Murakami et al., 2002a;

Murakami et al., 2002b; Zhang et al., 1999). The NTDs of the α subunits play a major role in the structural assembly of the core enzyme, while the CTDs interact with an upstream region in the DNA (UP element) to increase specificity. The CTDs also interact with transcriptional activators and that modulate polymerase processivity (Blatter et al., 1994; Benoff et al., 2002). As compared to the other subunits of RNAP, the function of the ω subunit is poorly characterized. It is thought to contribute to the structural assembly of the core enzyme as it interacts and stabilizes the CTD tail of the β′ subunit (Minakhin et al., 2001).

3 The active-site channel or main channel of RNAP is formed by the cleft in the center of the crab claw structure and is composed of several fixed and mobile elements (Lee and

Landick, 1992; Komissarova and Kashlev, 1998; Korzheva et al., 1998; Sidorenkov et al.,

1998). The catalytic center is buried deep in the cleft, featuring an all important Mg2+ ion chelated by three Asp residues from the universally conserved Asn-Ala-Asp-Phe-Asp-Gly-

Asp motif of the β’ subunit. Two important structures called the βD loop and the bridge helix lie just downstream of the catalytic site (Fig 1-1). A loop-like structure is located upstream of the active site, called the rudder (Darst et al., 2001 and references therein; Vassylyev et al.,

2002). Further upstream, the β’ flap, lid and zipper domains are located at the end of the main channel. The main channel branches into two separate channels downstream of the active center. The template DNA occupies one of these channels during transcription, while the narrower secondary channel functions as the entry point for the incoming NTPs. A mobile element inside the secondary channel, called the β’ trigger loop, works in concert with the bridge helix to ensure proper placement of the correct NTP at the active site and for RNAP translocation. As the 5’ end of the nascent transcript exits the main channel, it enters a narrow path below the β-flap called the RNA exit-channel. The exit channel accommodates a portion of the nascent RNA and has important implications in initiation, pausing, and termination by

RNAP. A portion of the duplex DNA downstream of the active center occupies the downstream DNA channel, which is formed by the β lobe and the β’ jaw domains. Disruption or shortening of this duplex destabilizes the elongation complex (Nudler et al., 1996). The sequence of this region regulates the rate of elongation by modulating the response to pause and termination signals (Lee et al., 1990; Sweetser et al., 1987; Holmes and Erie, 2003).

The core RNAP of Bacillus subtilis is composed of α2ββ’δεω (Wiedermannova et al.,

2014). The δ subunit is encoded by the rpoE gene and is involved in increasing promoter

4 specificity and RNAP recycling (Juang and Helman, 1994; Wiedermannova et al., 2014;

Rabatinova et al., 2014). Although δ is conserved across the Gram-positive bacteria, it is dispensable and deletion strains do not exhibit growth defects. ε, previously identified as ω1, is a small auxiliary subunit of B. subtilis RNAP that is encoded by the rpoY gene. ε is structurally similar to bacteriophage T7 Gp2 protein, which inhibits host cell transcription through interaction with RNAP (Keller et al., 2014). Like the δ subunit, ε is also dispensable without any growth defect. The ω subunit is encoded by the rpoZ gene and is similar to the ω subunit of E. coli (Helmann, 2003). Apart from the difference in core RNAP composition, B. subtilis contains a small protein HelD (encoded by yvgS) that interacts with the δ subunit and is co-purified with RNAP (Wiedermannova et al., 2014). HelD stimulates transcription in an

ATP-dependent manner and enhances the RNAP recycling rate, which is further stimulated in the presence of δ.

1.1.2 The Sigma Factor and RNAP Holoenzyme

Bacterial RNAP utilizes a dissociable specificity factor called sigma (σ) that transiently associates with the core enzyme (α2ββ′ω) during initiation to form the RNAP holoenzyme (Figure 1-2 a, b). The sigma factor guides RNAP to recognize promoter elements as well as helps in formation of the initiation complex and promoter clearance, after which it dissociates. In E. coli, σ70 is the primary sigma factor (also known as the housekeeping sigma factor) that is responsible for promoter recognition of most transcribed genes in normal growth conditions (Lonetto et al., 1992). Housekeeping sigma factors are the principal sigma factors in any bacterial species, and are involved in expressing the essential genes required for normal growth, for example σA of B. subtilis (Losick and Pero, 1981; Ishihama 2000, and references therein). Genes recognized by σ70 in E. coli contain promoter sequences that are marked by

5

Fig 1-2. σ factor and the σ cycle. a and b, Structural overview of the T. aquaticus σA and

RNAP holoenzyme (only σ2, σ3 and σ4 regions are shown). c, Promoter recognition by σ factor. d, The σ cycle. NusA and NusG are two general transcription elongation factors.

(Adapted from Darst S., 2009 and Mooney et al., 2005).

6 two conserved hexamers located 10 and 35 nucleotides upstream from the transcription start site (known as –10 and –35 elements, respectively) (Fenton et al., 2000) (Figure 1-2 c).

σ usually is released after initiation of transcription and promoter clearance, and does not bind to RNAP during elongation. The released σ factor can then associate with another

RNAP core enzyme and initiate another initiation cycle (Figure 1-2 d). This process is known as the σ cycle and it enables RNAP to utilize alternative σ factors, redirecting RNAP to distinct promoters in response to a stimulus or during nonstandard growth conditions. The σ cycle also allows RNAP to associate with the elongation factors NusA and NusG (described later). Thus, the σ cycle allows cells to express genes rapidly to optimize cellular processes required for adapting to the external conditions and cellular signaling.

With few exceptions (e.g., σ54 family), σ factors contain four conserved regions that fall into distinct protein domains (domains 1-4) (Buck et al., 2000) (Figure 1-2 a). In free

RNAP holoenzyme, domain 1 is placed into the crab-claw cleft of the RNAP while the other domains are exposed outside for interaction with DNA (Severinova et al., 1996) (Figure 1-2 b). Recognition of the –35 and –10 promoter elements by σ domains 2, 3 and 4 triggers formation of the pre-initiation complex in which domain 1 is evicted from the crab-claw channel and DNA surrounding the start site is loaded into RNAP (Dombroski et al., 1992;

Dombroski et al., 1996; Barne et al., 1997; Chen et al., 2003).

1.1.3 Other Regulatory Factors

1.1.3.1 Factors Interacting with the Secondary Channel

Transcription by RNAP is regulated by various factors that interact with different regions of the enzyme. Unlike the main channel and RNA exit channels that are occupied by

7 nucleic acids, the secondary channel provides direct access of several protein factors to the

RNAP catalytic center (Figure 1-3). Several factors have been described that bind RNAP in the secondary channel and affect the rate of RNA synthesis, e.g., GreA and GreB transcript cleavage factors, the pH-dependent transcription inhibition factor Gfh1, and the ppGpp cofactor DksA.

The GreA and GreB factors are required for rescue of RNAP from transcriptional arrest (backtracked) sites. During backtracking, the growing 3’ end of the nascent RNA is dislodged from the active site, causing inactivation of the elongation complex (described later). Cleavage factors GreA and GreB allow transcription to resume by inducing RNAP to cleave the RNA such that a new 3’ end is created at the catalytic center (Laptenko et al., 2003;

Sosunova et al., 2003). E. coli GreA and GreB are paralogs that have homologs in many bacterial species (Borukhov et al., 1993; Stebbins et al., 1995). Although both GreA and GreB can stimulate cleavage of the nascent transcript, GreA can only induce cleavage 2-3 nt behind the protruding 3’ end while GreB can induce cleavage further upstream to release longer transcripts. For this reason, GreA can only prevent RNAP from entering into a backtracking state while GreB can also rescue pre-existing backtracked complexes (Feng et al., 1994a; Lee et al., 1994; Fish et al., 2002). Gre-factors function by inserting the N-terminal coiled-coil domain into the secondary channel, which reaches the active center and stabilizes the second

Mg2+ ion. The functional difference between GreA and GreB activity is due to their structural difference and the arrangement of basic amino acids on the tip of the N-terminal coiled-coil domain (Opalka wt al., 2003; Vassylyeva et al, 2007).

8

Figure 1-3. Transcription factors that interact with the RNAP secondary channel. The long N-terminal coiled-coil domains of these factors protrude through the secondary channel of RNAP and reach the catalytic center, while the C-terminal globular domain coordinates interaction with RNAP. (Adapted from Zenkin and Yuzenkova, 2015).

9 The Gram-negative thermophilic bacterium T. aquaticus contains a homolog of E. coli

Gre factors, known as Gfh1. However, unlike the Gre factors that reduce backtrack-mediated pausing to activate transcription, Gfh1 factor inhibits transcription (Hogan et al., 2003).

Biochemical and structural studies suggested that Gfh1 exists in two alternative forms in the cell, with the inactive form of Gfh1 undergoing a conformational change before binding to

RNAP (Lamour et al., 2006; Symersky et al., 2006). The effect of Gfh1 on transcription is sensitive to changes in pH, so it is assumed that Gfh1 controls transcriptional output in response to pH change in the environment (Laptenko et al., 2006).

DksA is a cofactor of the stringent response regulator ppGpp that also binds the secondary channel (Choy H. E., 2000; Barker et al., 2001). DksA was first identified as a suppressor of a dnaK mutant, but subsequently it was discovered that DksA is required for the regulation of rRNA by the stringent regulator ppGpp. In vitro mechanistic studies showed that DksA enhances the inhibitory effect of ppGpp on initiation by reducing the half- life of open promoter complexes. DksA also aids ppGpp for activation of the amino acid biosynthetic operons during the stringent response. (Kang and Craig, 1980; Paul et al., 2004).

Unlike Gfh1, DksA has no sequence homology with GreA and GreB, but the overall structure closely resembles that of GreA (Perederina et al., 2004). DksA also features a globular head and a coiled-coil domain, which is inserted into the secondary channel to reach the RNAP catalytic center. DksA exerts its effect by coordinating the all-important Mg2+ in the active center through two aspartate residues located at the tip of the coiled-coil domain. Like GreA,

DksA can also prevent RNAP from entering a backtracked state, although lacks the ability to induce RNAP cleavage activity (Rutherford et al., 2007).

10 1.1.3.2 NusA: A Conserved Termination and Pausing Factor

NusA is an essential general transcription elongation factor that is universally conserved in eubacteria and archaea but not in eukaryotes (Ingham et al., 1999; Roberts et al.,

2008). NusA was first identified as a mutation that limits bacteriophage λ (lambda) growth; hence it was named N utilization substance A or NusA. It was subsequently shown that NusA is part of a multiprotein complex involving other Nus-factors (NusG, NusB, NusE) at the

RNA nut site that allows RNAP to read past terminator signals (Das et al., 1996; Horwitz et al., 1987). During exponential growth, NusA promotes expression of the ribosomal RNA

(rRNA) operons by formation of an antitermination complex (Squires et al., 1993). However, during transcription in vitro NusA enhances RNAP pausing (Shankar et al., 2007), modulates

Rho-dependent termination (Schmidt and Chamberlin, 1984; Carlomagno and Nappo, 2003), and stimulates intrinsic termination, although the extent of stimulation is only about 10-20% at canonical intrinsic terminators (Schmidt and Chamberlin, 1987; Gusarov and Nudler, 2001;

Yakhnin and Babitzke, 2002).

E. coli NusA is an elongated L-shaped protein consisting of 495 amino acids

(~55kDa) (Figure 1-4 a) (Gopal et al., 2001; Worbs et al., 2001; Shin et al., 2003). The amino terminal domain (NTD, amino acids 1-137) shares structural homology with the sigma factor and binds to RNAP near the exit channel upon dissociation of the sigma factor. The NTD is linked to three well-characterized RNA binding subdomains, S1 (amino acids 138–201), KH1

(amino acids 202–276) and KH2 (amino acids 277–344). These domains are primarily responsible for the RNA-binding ability of NusA. E. coli NusA contains two additional acidic repeats (AR1, amino acids 345–426, and AR2, amino acids 345–426) downstream of the KH2 domain, which are also known as the autoinhibitory domains. However, the AR1 and AR2 domains are not found in B. subtilis or archeal NusA (Schauer et al., 1987). The AR1 domain

11

Fig 1-4. Structure of elongation factor NusA. a, Crystal structure of Thermotoga maritima

NusA. The helical body domain, the globular head domain, and the S1, KH1, and KH2 domains are shown in a ribbon structure. b, A model of E. coli NusA NTD interactions with elongating RNAP. The interacting αCTD and autoregulatory (AR) domains are also shown, however their position with respect to the NusA-RNAP complex is hypothetical. The dotted red line indicates the path of nascent RNA exiting from RNAP (adapted from Shin et al., 2003 and Ha et al., 2010).

12 is responsible for interaction with the bacteriophage λ N protein, which plays an important role during antitermination (Prasch et al., 2006). The AR2 domain can make intramolecular contact with the SKK (S1, KH1 and KH2) domain, thereby masking the RNA-binding ability of NusA. AR2 is also able to make contact with the CTD of the α-subunits (αCTD), which substantially reduces its affinity for the UP-element in the DNA (Mah et al., 1999; Mah et al.,

2000; Eisenmann et al., 2005).

Although the mechanism by which NusA stimulates pausing has been debated

(Gusarov et al., 2001; Ha et al., 2010), it has been shown that the N-terminal domain of E. coli

NusA is necessary and sufficient for pause stimulation via interaction with the RNA exit channel of RNAP (Ha et al., 2010). According to this hypothesis, the NTD of NusA binds near the RNA exit channel of the RNAP, which produces an impeding force to the exiting RNA

(Ha et al., 2010; Toulokhonov et al., 2001; Yang et al., 2009). Additionally, the interaction between the positive surface charge of NusA (Worbs et al., 2001) and negative charge of the nascent RNA produces a hindering load, since NusA-mediated capping of the exit channel increases the effective length of the exit channel. The enhanced protein-RNA interaction might increase the resistance of the exit channel toward the RNA passing through it, thereby facilitating hairpin nucleation. Binding of NusA near the RNAP exit channel might also affect the mobile elements of the active center allosterically, thereby modulating translocation without significantly altering the rate of catalysis (Gusarov and Nudler, 2001).

NusA has been proposed to stimulate intrinsic termination by assisting with folding of the hairpin, stimulating pausing of the RNAP at the U-rich tract, or a combination of both

(Reviewed in Santangelo and Artsimovitch, 2011). NusA has been suggested to assist hairpin folding by two distinct mechanisms. In the indirect mechanism (Gusarov et al., 2001), it was proposed that NusA helps hairpin folding by displacing upstream single-stranded RNA from

13 the E. coli RNAP surface in the upstream binding site (UBS) that otherwise impedes hairpin folding. Hence, the indirect model suggests that the termination-inducing function of NusA is a result of removing inhibitory interactions between RNAP and the unfolded hairpin. In the direct model (Ha et al., 2012), NusA functions like an RNA chaperon to stabilize the pause/termination hairpin by making direct contacts with the duplex RNA. However, it is also possible that NusA functions via a combination of the indirect and direct mechanisms.

Although it is believed that NusA-induced pausing at the U-tract of the terminator (described later) assists termination by providing additional time for the hairpin to form, it has been experimentally shown that NusA-mediated pause stimulation at the U7 residue (point of termination) of the λ tR2 terminator contributes only a small fraction of the effect exerted by

NusA on termination.

NusA also participates in transcription-coupled DNA repair (TCR). NusA recruits the conserved trans-lesion synthesis (TLS) polymerase DinB (DNA pol IV) at sites where RNAP is stalled because of a gap in the DNA (Cohen et al., 2009). Upon NusA-guided recruitment,

DinB fills the gap to provide a continuous template for transcription. However, DinB is not capable of efficiently repairing a certain class of lesions, such as the N2-f-dG lesion. In this case, NusA participates in a nucleotide excision repair (NER)-dependent process to remove the damaged DNA and promote nitrofurazone resistance (Cohen and Walker, 2010).

1.1.3.3 NusG: A Pausing Factor and Cofactor of Rho-dependent Termination

Similar to NusA, NusG is another general transcription elongation factor that was first identified as a protein involved in N-mediated antitermination in bacteriophage λ. Subsequent studies in E. coli revealed that NusG could modulate the rate of transcription by affecting

14

Figure 1-5. NusG and its homologs. a, NusG proteins in bacteria and archaea consist of

NGN and KOW domains. Eukaryotic Spt5 is an RNAP elongation factor homologous to

NusG. The linear maps of the eukaryotic Spt5 and NusG are shown; conserved motifs are shown as boxes. b, Structure of E. coli NusG. c, A model of interaction between B. subtilis

NusA, NusG, RNAP and DNA template during pause stimulation; NusG simultaneously binds

RNAP and a conserved motif in the non-template DNA strand of the paused transcription bubble. (Adapted from Guo at al., 2008; Yakhnin and Babitzke, 2014).

15 RNAP pausing; affect termination by acting as a cofactor of Rho, and couple transcription with translation by interacting with ribosomal protein S10 (Sullivan et al., 1992; Li et al, 1992;

Mason and Greenblatt, 1992).

NusG is the only transcription factor that is conserved in all forms of life. Bacterial

NusG contains an N-terminal conserved NGN domain, which is linked to a C-terminal KOW domain via a flexible linker (Kyrpides et al., 1996). Bacterial NusG is a simplified version of the eukaryotic Spt5 protein featuring multiple KOW domains, an N-terminal acidic region and a C-terminal repeat domain in addition to the NGN domain (Steiner et al., 2002; Guo et al.,

2008; Zhou et al., 2009). Eukaryotic and archaeal Spt5 forms a complex with a protein known as Spt4, which is absent in bacteria. E. coli NusG is an essential protein consisting of 181 amino acid residues. It binds to RNAP through its NGN domain, while the KOW domain interacts with additional regulatory factors (Mooney et al., 2009). Like NusA, NusG is also recruited to elongating RNAP after promoter clearance and σ factor release, so NusG cannot directly influence initiation of transcription (Zhang et al., 2012; Daube and von Hippel, 1999).

NusG is a cofactor of the termination factor Rho and stimulates Rho-dependent termination. (Burns and Richardson, 1995; Chalissery et al., 2011). NusG interacts with Rho through its C-terminal KOW domain while the NGN domain contacts the crab-claw cleft of

RNAP, enclosing the DNA (Klein et al., 2010). It has been shown that E. coli NusG helps Rho to prevent expression of horizontally transferred genes (Cardinale et al., 2008) and substantially reduces synthesis of pervasive antisense transcripts (Peters et al., 2012).

Although NusG and Rho are essential for E. coli survival (Downing et al., 1990), it has been suggested that the only essential function of NusG in this bacteria is to silence the toxic kil gene from the horizontally acquired rac prophage. NusG stimulates termination at a Rho- dependent terminator upstream of the kil gene; deletion of the kil gene from the E. coli

16 chromosome makes NusG dispensable. However, the nusG knockout strain of E. coli shows severe growth defects and poor stationary phase survival (Cardinale et al., 2008).

Like NusA, NusG also participates in antitermination at rRNA operons and bacteriophage λ lytic operons to suppress termination. Antitermination involves formation of multiprotein complexes that help RNAP to read past multiple terminator signals and express the downstream genes (Zellars and Squires, 1999; Zhou et al., 2002). However, E. coli NusG itself serves as a positive elongation factor that enhances the rate of transcription. The general ability of NusG to reduce RNAP pausing is thought to contribute to this effect (described later) (Burova and Gottesman, 1995; Burns and Richardson, 1995; Artsimovitch and Landick,

2000). The NGN domain of NusG interacts with the β′ subunit of RNAP near the crab-claw clamp, which stabilizes the clamp in a closed conformation. This structural alteration is thought to transform RNAP into a pause-resistant form, thereby increasing the overall processivity of the enzyme (Klein et al., 2011; Weixlbaumer et al., 2013; Mooney et al.,

2009). Although NusG functions as a positive elongation factor by reducing pausing in E. coli,

B. subtilis NusG has been shown to possess both pause suppressing (Yakhnin et al., 2008) and pause stimulating activity. NusG strongly stimulates pausing at two hairpin-dependent pause sites at the 5’ untranslated leader of the B. subtilis trp operon. Pausing at these sites is sequence-dependent; RNAP associated NusG binds to two a conserved motif in the non- template DNA strand at these sites, thereby hindering elongation of the paused complex

(Yakhnin et al., 2008; Yakhnin et al., 2010). E. coli NusG fails to stimulate pausing at these two sites, since the amino acids responsible for recognition of these pause sites are not conserved in E. coli (Yakhnin, Murakami and Babitzke, in press).

Another function of bacterial NusG is that it “couples” transcription with translation.

In E. coli, the C-terminal domain of the elongation complex-associated NusG makes an

17 alternative interaction with Rho or ribosomal protein S10 (NusE), thereby linking transcription with translation (Burmann et al., 2010). This mutually exclusive interaction suggests a mechanism by which Rho-dependent termination is prevented when transcription and translation are coupled.

1.2 The Transcription Cycle

The cycle is divided into initiation, elongation and termination.

Initiation of transcription takes place by σ factor-directed binding of the holoenzyme at promoters, which is then followed by a fast elongation phase in which the sequence of DNA is copied into RNA. At the end of the transcription unit, terminator signals promote transcript release so that RNAP can participate in another round of transcription.

1.2.1 Promoter Recognition and Initiation

The RNAP core enzyme has a general nonspecific affinity for DNA, which is not optimal for effective transcription initiation. Binding of the σ factor reduces the affinity of

RNAP for nonspecific sites and dramatically enhances its affinity for promoter sequences.

Although different promoters featuring distinct sequences are recognized by different σ factors, the housekeeping σ factor (σ70 in E. coli, σA for B. subtilis) is responsible for transcribing the majority of genes at normal physiological conditions. The most conserved sequence of the E. coli σ70 or B. subtilis σA promoter is a sequence located approximately 10 nucleotides upstream of the transcription start site (Figure 1-6 a) (Pribnow, 1975). This region features a consensus TATAAT sequence, in which the first two nucleotides (TA) and the last

18

19 Fig 1-6. σ70 promoter and the transcription cycle. a, b, Conserved elements of the σ70 promoter and their role in recruiting the RNAP holoenzyme. The -10 and -35 elements specifically interact with σ region 2 and 4, respectively. c, The bacterial transcription cycle.

Transcription initiates by loading of promoter DNA into the RNAP holoenzyme to form a closed complex, followed by strand separation and formation of an open promoter complex.

Then, RNAP enters a productive elongation phase, which can be punctuated by transient pausing or arrest. Transcription is terminated at the end of the transcription unit by intrinsic or

Rho-dependent termination. (Modified from Tomar and Artsimovich, 2013).

nucleotide (T) is highly conserved in most promoters. The -10 consensus sequence is important since DNA unwinding by RNAP is thought to be initiated at this position

(Schroeder and deHaseth, 2005). Some promoters contain a short conserved sequence immediately upstream of the consensus -10 hexamer, which is recognized by the domain 3 of

E. coli σ70. When present, this extended -10 sequence can increase promoter strength by up to

20-fold (Barne et al., 1997). Another conserved sequence, which is known as the -35 element, is located approximately 16-18 nucleotide upstream of the consensus -10 element (~ 35 nucleotides upstream of the start site). The consensus sequence of this region is TTGACA, in which the first 3 bases (TTG) are most highly conserved. The protruding C-terminal domains of the α subunits (αCTD) can establish contacts with a 20 bp sequence upstream of the

20 conserved -35 hexamer, also known as the UP element. Although not present at all promoters, this region can enhance promoter strength up to 50-fold by increasing the specificity of promoter-RNAP interaction (Ross et al., 1993) (Figure 1-6 b). The transcription start site (+1) is a purine (A or G) in most cases, although pyrimidines (C or T) are present in some rare promoters (Figure 1-6 a, b).

1.2.2 Promoter Clearance and Elongation

Transcription is initiated by binding of the RNAP holoenzyme to the base-paired promoter region, which is called the closed complex. The initial binding is followed by denaturation of the AT-rich DNA surrounding the -10 element. The overall negative supercoiling of the bacterial chromosome facilitates the denaturation process (deHaseth et al.,

1998 and the references therein). Unwinding of DNA results in incorporation of the template strand into the crab-claw cleft of RNAP, forming an open complex. As compared to the closed complex that is easily dissociable, formation of the open complex dramatically enhances the stability of RNAP on the promoter, hence this process is referred to as tight binding. The first

9 bases of RNA are added without forward translocation of RNAP, and a significant fraction of RNAP molecules dissociat after this step in a process known as

(McClure, 1980). The remaining RNAP fraction that does not dissociate moves along the

DNA and releases the bound σ factor. This step is called promoter clearance. The elongating

RNAP, often referred to as the transcription elongation complex (TEC), maintains ~14 nt separated DNA known as the transcription bubble, in which 9-10 nt of the template strand is involved in base-pairing with the nascent RNA, thereby forming a DNA-RNA hybrid. The general transcription elongation factors NusA and NusG associate with the TEC soon after σ release (Mooney et al., 2009) (Figure 1-6 c).

21 1.2.3 Termination and Dissociation of Individual Components

RNAP remains associated with the DNA template and continues transcription until a termination-signal is encountered, which causes transcript release. Two types of termination have been identified in bacteria, intrinsic termination and Rho-dependent termination.

1.2.3.1 Intrinsic Termination

Termination signals encoded in DNA that do not require additional protein factors are called factor-independent or intrinsic terminators. Studies by several groups involving biochemical, in-silico analysis, and high-throughput sequencing suggest that intrinsic terminators define the ends of the majority of transcription units in E. coli and B. subtilis

(Lesnik et al., 2001; Peters et al., 2011 and the references therein). A canonical intrinsic terminator is composed of a GC-rich palindromic sequence that is followed by 5-9 uninterrupted T-residues (Figure 1-7). This sequence, when transcribed by RNAP, folds into a stable RNA hairpin followed by consecutive U-residues (U-tract). This structure causes termination of transcription and release of RNAP 7-9 nt downstream of the hairpin without the assistance of any other factor (Goliger et al., 1989; Telesnitsky and Chamberlin., 1989a;

Telesnitsky and Chamberlin., 1989b; Yakhnin and Babitzke, 2002; King et al., 2004) (Figure

1-7 a, b). The RNA hairpin and U-tract is necessary and sufficient for efficient termination, although the sequences upstream and downstream have also been shown to influence termination to some extent (Tadigotla et al., 2006; Vassylyev et al., 2007). One recent combinatorial study concluded that the strongest contributor of termination strength is the U- tract, although the free energy of the DNA:RNA hybrid, the hairpin loop, the base of the hairpin, and the presence of an A-tract upstream of the hairpin also contribute to terminator strength (Chen et al., 2013).

22

Fig 1-7. Mechanism of intrinsic termination. a, b, E. coli λ tR2 terminator and an illustration of intrinsic termination. Intrinsic terminator is composed of a GC-rich RNA hairpin immediately followed by 5-9 uninterrupted U-residues in the nascent RNA. c,

Comparison of the forward translocation and allosteric models of intrinsic termination. In the forward translocation model, the hairpin causes RNAP to translocate forward without elongation, thereby detaching the 3’-end of the RNA from the active site. d, In the allosteric model the hairpin invades the main channel and inactivates RNAP by causing structural changes. (Adapted from Epshtein et al., 2007).

23 The mechanism by which an intrinsic terminator induces termination has been extensively investigated by different groups. When the TEC synthesizes an intrinsic terminator, the U-tract induces a brief pause at the point of termination. This initial pausing event takes place regardless of the RNA hairpin. Since elongation and termination are kinetically coupled, pausing plays a major role by increasing the probability of termination.

Additionally, the pause provides time for hairpin nucleation to begin. Also, the DNA-RNA hybrid primarily contains weak dA:rU base-pairs as RNAP synthesizes the U-tract, which facilitates denaturation of the hybrid (Martin and Tinoco, 1980). The role of the RNA hairpin has also been under extensive investigation and debated by different groups. Three models have been proposed to explain the role of the hairpin in the termination process. The forward translocation model (Yarnell and Roberts, 1999; Santangelo and Roberts, 2004) suggests that hairpin formation causes RNAP to move forward along the duplex DNA without transcript elongation. This forced forward movement of RNAP melts downstream DNA and shortens the

RNA:DNA hybrid, thereby destabilizing the TEC. This model is based on the observations that prevention of DNA melting by inter-strand crosslinking downstream of the termination site or impeding forward translocation of RNAP by road blocking inhibits termination. The

RNA pullout model suggests that formation of the hairpin inside the exit channel shears the weak DNA:RNA hybrid, facilitating its melting (Macdonald et al., 1993; Toulokhonov and

Landick, 2003). Forward translocation of RNAP may not play a major role in this model. The presence of an A-tract upstream of the terminator hairpin (characteristic of bi-directional terminators) may facilitate shearing by forming additional base pairing with the U-tract.

According to the allosteric model of intrinsic termination (Gusarov and Nudler, 1999;

Epshtein et al., 2007), the hairpin invades the crab-claw cleft (main channel) of RNAP and establishes contacts with the mobile elements in the catalytic center. Hairpin invasion causes a

24 conformational change throughout the RNAP molecule, which traps the TEC in an inactive state and subsequently releases the transcript and DNA. A study involving a single-molecule technique has proposed that the forward translocation and/or shearing mechanism might operate at different terminators, depending on the sequence (Larson et al., 2008).

Although intrinsic terminators do not require additional factors for efficient transcript release, the general transcription elongation factor NusA causes a small increase in the termination efficiency of model intrinsic terminators (Schmidt and Chamberlin, 1987;

Gusarov and Nudler, 2001; Yakhnin and Babitzke, 2002). However, the effect of NusA on termination has been restricted to in vitro studies since NusA is essential for viability.

1.2.3.2 Rho-dependent termination

Rho-dependent termination constitutes an alternative mechanism of termination in most bacteria that utilizes a RNA/DNA helicase called Rho (Roberts JW, 1969; Richardson

JP, 1996). The is a large (276 kDa) ring-shaped protein, comprised of six identical subunits (46 kDa each) (Skordalakes and Berger, 2006). Rho-dependent terminators generally stretch out over 100-200 bp of DNA and the termination site is not localized (Hart and

Roberts, 1991). The Rho binding site, often referred to as the Rho-utilization (rut) site, is a C- rich sequence that lacks any secondary structure. Termination can take place up to 120 bp distal from the rut site (Lau et al., 1983; Jin et al., 1992). The termination process begins with

Rho binding to the nascent transcript, although a recent study suggested that Rho associates with RNAP throughout the transcription cycle (Epshtein et al., 2010). Once associated with

RNA, Rho translocates along RNA in the 5’à 3’ direction, which requires hydrolysis of ATP

(Skordalakes and Berger, 2006). RNAP pausing is thought to allow Rho to catch up to the elongation complex. Once Rho catches up to the elongating RNAP, it pulls the nascent RNA

25 away from the TEC, causing termination. The mechanism by which Rho dissociates the TEC has been under extensive investigation. A recent study suggested that Rho-dependent termination is a two-step process involving a rapid TEC inactivation (or trapping) phase, and a relatively slow dissociation phase. The trapping phase induces allosteric modifications of the

RNAP catalytic center, which is also required for TEC dissociation (Epshtein et al., 2010).

The general elongation factors NusA and NusG are two cofactors of Rho-dependent termination. Biochemical assays suggest that NusG enhances the efficiency Rho-dependent termination in vitro (Li et al. 1993; Pasman and von Hippel 2000; Mooney et al. 2009;

Chalissery et al. 2011) but only to a subset of terminators in vivo. A genomic study suggested that NusG highly stimulates termination at ~20% Rho-dependent terminators with low C/G sequence ratio (Peters et al., 2012). The effect of NusA on Rho-dependent terminators have been debated with inconsistent effects in vitro (Ward and Gottesman 1981; Burns and

Richardson 1995; Saxena and Gowrishankar 2011a); however, NusA was proposed to stimulate all Rho-dependent terminators in vivo in a genomic study (Cardinale et al. 2008). A major function of Rho is suppression of pervasive antisense transcription that occurs at the junction of converging transcription units (Peters et al., 2012).

1.2.3.3 Importance of termination

Regulation of gene expression is a key step in maintaining normal cellular physiology and for responding to stress or external stimuli. Although gene expression is controlled by multiple factors in higher eukaryotes, it is primarily controlled by regulation of transcription in bacteria. Most regulatory events converge at the transcription initiation phase (described later), because it provides an energy-efficient process to turn transcription on or off. However, transcription can also be regulated after initiation and promoter clearance, at the steps of

26

Fig 1-8. Impact of termination on gene expression. a, expression of downstream operon and b, synthesis of antisense RNA by readthrough transcription. c, misregulation of transcription by disruption of attenuation control. Terminators are shown in red and promoters are shown as black arrows.

27 elongation (e.g., pausing) and termination. Although termination is the last step in the transcription cycle, it has several functional implications in the regulation of gene expression apart from its role in recycling RNAP and associated factors. Bacterial genes are closely packed in a small chromosome in the same or opposite orientation. Since the 3’ boundary of most operons are defined be intrinsic terminators in E. coli and B. subtilis, failure of termination causes readthrough of RNAP into the next operon. Such events turn on the repressed genes and overexpresses genes that are synthesized at a moderate rate under normal conditions (Figure 1-8 a). Failure of termination can also lead to the synthesis of antisense transcripts at the junction of convergent transcriptional units (Figure 1-8 b). Furthermore, expression of some operons is regulated by attenuation that depends on conditional utilization of an intrinsic terminator in the 5’ UTR (described later). Failure of termination renders this mechanism dysfunctional and leads to uncontrolled expression of the associated operons

(Figure 1-8 c).

1.3 Transcription Pausing

The elongating RNAP often becomes temporarily stalled on the DNA template, after which it resumes transcription. This phenomenon is known as RNAP pausing. Although initially discovered as an aberration of elongation, pausing has been shown to play important role in synchronizing RNAP position with regulatory factor binding and RNA secondary structure formation. Three general categories of RNAP pause sites have been identified in bacteria: promoter proximal, hairpin-dependent, and backtrack-mediated pausing.

28

Fig 1-9. Hairpin dependent and backtracking-mediated pausing. In hairpin-dependent pausing, interaction of the pause hairpin with the β flap domain of RNAP slows down the rate of elongation. In backtrack pausing, RNAP moves backwards, thereby detaching the 3’ end of the nascent RNA from the active site, which enters the secondary channel and blocks entry of incoming NTPs.

29 Promoter proximal pausing is mediated by σ70 interaction with the nontemplate

(ntDNA) strand of a –10 promoter-like element in the promoter proximal region when σ70 is still associated with the initiation complex (Ring et al., 1996). It has been shown that sequence-specific recognition of the ntDNA strand within the single-stranded DNA transcription bubble is required for pausing. Promoter proximal pausing has also been reported in eukaryotes; however, the mechanism and regulation differs (Rougvie and Lis, 1988;

Rasmussen and Lis, 1993; reviewed Li and Gilmour, 2011).

Hairpin dependent pause signals are frequently found at the 5’ untranslated leaders of amino acid biosynthetic operons and have been shown to participate in attenuation mechanisms by providing additional time for regulatory factor binding and/or RNA folding

(Figure 1-9). Extensive studies of the E. coli his and B. subtilis trp pause sites (Winkler and

Yanofsky, 1981; Mooney et al, 1998) provided important mechanistic insight about hairpin dependent pausing. The pause sequence consists of a unique motif that signals RNAP to stall, which is stabilized by an RNA hairpin located approximately 10-12 nt upstream of the pause site. The identity of the 3’ end of the nascent transcript and the downstream DNA region (~14 bp) also plays important roles in pausing (Landick, 1997; Mooney et al., 1998). It is assumed that interaction of the pause hairpin with the β flap domain allosterically modifies the RNAP conformation in such a way that the growing end of the transcript (3’ end of RNA) in the active site is not properly aligned for the incoming NTP. Although the basal pause signal is sufficient to induce pausing, the general elongation factors NusA and NusG can modify the pause half-life by directly participating in hairpin-dependent pausing. The N-terminal domain

(NTD) of NusA interacts with the β flap-tip domain of RNAP near the exit channel, which stabilizes the pause hairpin and enhances pausing (Artsimovitch and Landick, 1998;

Artsimovitch and Landick, 2000). The NGN domain of NusG interacts with the β′ subunit of

30 RNAP near the crab-claw clamp, which stabilizes the clamp in closed conformation and reduce pausing (Mooney at al., 2009). Apart from the well studied E. coli his and B. subtilis trp pause sites mentioned above, hairpin dependent pausing has also been identified in several other operons, for example the E. coli trp, tna and S10 leaders, the B. subtilis pyr and glyQS leaders, and bacteriophage λ late transcripts (Gong and Yanofsky, 2003; Grundy and Henkin,

2004; Zhang et al., 2005).

In a backtrack pause, the 3' end of the nascent RNA is displaced form the active site of the RNAP. In this case, RNAP moves backward with respect to the DNA template and the

RNA transcript such that the growing end (3' end) of the transcript is detached from the catalytic center and extruded into the RNAP secondary channel, blocking the entry of incoming NTPs (Komissarova and Kashlev, 1997; Nudler et al., 1997) (Figure 1-9). Cleavage factors GreA and GreB can stimulate RNAP to cleave the extruded transcript near the catalytic center, releasing a short transcript. This creates a new extendable 3’ terminus at the catalytic center and allows elongation to resume. Backtrack pausing has been extensively studied at the

E. coli ops (operon polarity suppressor) pause site. Pausing at this site permits binding of

RfaH factor to the RNAP, which allows transcription of downstream genes of the operon by suppressing termination (Bailey et al, 1997; Artsimovitch and Landick, 2000; Santangelo and

Roberts, 2002). It has been proposed that both hairpin-dependent and backtrack-mediated pauses arise from a common intermediate, in which the 3’ OH of the growing transcript is frayed away from the catalytic center (Artsimovitch and Landick, 2000). Nucleotide addition is slow in this frayed intermediate because the incoming NTP is weakly bound to the active center. A recent study involving nascent transcript sequencing (NET-Seq) identified a 16-nt consensus pause sequence in E. coli and B. subtilis that accounts for most previously identified regulatory pause sites and thousands of new pause sites in vivo (Larson et al., 2014).

31 1.4 Transcription Attenuation

Transcriptional attenuation is a mechanism of controlling gene expression by conditional utilization of a terminator leading to premature termination. Attenuators are generally located in the 5’ UTRs of genes or operons and involve an RNA element in the nascent transcript that senses specific environmental signals, such as temperature changes, availability of small metabolites (e.g., ions, amino acids, NTPs or vitamins), or availability of macromolecules (e.g., such as tRNAs and regulatory proteins). Attenuation was first discovered in the E. coli trp operon that makes it responsive to the cellular availability of (Yanofsky et al 1981). Subsequently, attenuators have been found to be associated with a variety of sensing mechanisms regulating diverse physiological functions. Transcription attenuators contain two adjacent hairpins in the nascent RNA that are mutually exclusive.

Because these structures share several bases, formation of the upstream hairpin precludes the other. The downstream hairpin is part of an intrinsic terminator, formation of which leads to premature termination of transcription in the 5’ leader. The alternative upstream hairpin is called an antiterminator because formation of this hairpin prevents folding of the terminator, thus allowing the elongation complex to transcribe past the terminator into the downstream genes. Although additional regulatory elements have been shown to participate in many attenuators as described below, the basic mechanism of all attenuators utilize the alternative antiterminator and terminator hairpins.

1.4.1 Riboswitch-mediated attenuation

Riboswitches are attenuators that are regulated via direct binding of a small metabolite

(ligand) to the RNA. In riboswitch-mediated attenuators, binding of the ligand to the aptamer domain causes conformational changes in the RNA, leading to formation of an intrinsic

32

Figure 1-10. The major classes of bacterial attenuators and their mechanisms. a,

Riboswitch-mediated . b, T box-mediated attenuator. c, attenuation by stalling. d, attenuation by an RNA an binding protein. The terminators (T) are shown in each case and antiterminator (AT) hairpins are shown as red dotted lines.

33 terminator, which causes premature termination (Figure 1-10 a). An alternative antiterminator formed in the absence of the ligand prevents formation of the terminator, thereby expressing the downstream genes. The aptamer domain of the riboswitch is a complex three- dimensionally folded scaffold of 100-200 nt length, the structure of which is altered upon binding of the ligand (reviewed in Naville and Gautheret, 2009).

1.4.2 T box antitermination

T box antiterminators function as a cellular surveillance system to monitor and regulate the aminoacylation level of tRNAs. The mechanism of T box antitermination is similar to the metabolite-mediated riboswitches, except that a tRNA molecule functions as the ligand via RNA-RNA interaction. Depletion of a particular amino acid causes reduction in its cognate charged tRNA pool compared to the uncharged tRNA. The uncharged tRNA binds to the sensory domain of T box leaders in a way that stabilizes the antiterminator structure such that folding of the terminator is prevented, allowing expression of the downstream genes

(Figure 1-10 b). T box antiterminators are frequently found in firmicutes regulating expression of genes encoding aminoacyl tRNA synthetases and amino acid biosynthesis, which in turn regulate the level of charged tRNAs (Reviewed in Naville and Gautheret, 2009; Henkin,

2008).

1.4.3 Attenuation by ribosome stalling

Some attenuators utilize an initial short peptide-coding sequence to sense the availability of particular amino acids, which regulate expression of its corresponding biosynthetic operon. The leader RNA of such attenuators contains multiple codons for the specific amino acid that it senses. When the specific amino acid is high in supply (and

34 therefore charged cognate tRNAs), the ribosome easily translates these codons in the leader

RNA and occupies a position on the antiterminator, which prevents it from folding. Hence, the terminator hairpin forms and premature termination prevents expression of the downstream genes. Alternatively, lack of an adequate supply of the specific amino acid causes a deficiency in the pool of specific charged tRNAs, which results in stalling in a position upstream of the antiterminator (Vitreschak et al., 2004; Liubetskaia et al., 2003). Hence, ribosome stalling allows the formation of the antiterminator hairpin, leading to transcription readthrough and synthesis of the downstream genes (Figure 1-10 c). The E. coli trp attenuator is a classic example of this kind of attenuation mechanism. This family of attenuators is of particular interest because they illustrate the importance of transcription-translation coupling in bacteria.

1.4.4 Attenuation by RNA binding proteins

Synthesis of several ribosomal proteins is autoregulated by an attenuation mechanism that is controlled by the protein itself interacting with its own transcript. Accumulation of the specific ribosomal protein leads to its binding not only to the rRNA molecules for ribosome assembly, but also to a regulatory region in the 5’ leader of its own transcripts that mimics its rRNA binding site. (Nomura et al., 1980; Draper, 1989). Binding of the protein prevents folding of the antiterminator and allows formation of the terminator, causing premature termination and repression of the downstream protein-coding gene. When the level of the protein is below a threshold, the antiterminator hairpin can form in the absence of the interacting protein, thereby preventing formation of the terminator hairpin and promoting transcription of the protein-coding gene (Figure 1-10 d). The ribosomal protein complex

L10(L12)4 is an example of this kind of attenuation in B. subtilis. The L10(L12)4 complex is

35 encoded by the rplJL operon, the expression of which is autoregulated by binding of the

L10(L12)4 complex to its 5’ leader, leading to termination (Yakhnin et al., 2015).

A specialized protein that specifically interacts with a sequence motif overlapping the antiterminator can also regulate attenuation. In this case, binding of the protein promotes termination by preventing antiterminator formation. The activity of the regulatory protein is, in turn, regulated by binding of a metabolite, which alters its activity (Figure 1-10 d). The transcription attenuation mechanisms that regulate the B. subtilis trp and pyr operons represent examples of this kind of attenuation (reviewed in Babitzke et al., 2004; Bonner et al., 2001). In the B. subtilis trp operon, the regulator is a multisubunit protein known as the trp RNA- binding attenuation protein (TRAP), which becomes activated when bound by tryptophan.

When tryptophan is high in supply, Trp-activated TRAP binds to a region of the trp leader

RNA in a way that blocks antiterminator formation, which allows formation of the terminator hairpin. Alternatively, TRAP remains inactive when tryptophan is low in supply and doesn’t bind to RNA, leading to formation of the antiterminator hairpin. This mechanism is described in detail in Chapter 3.

36 1.5 References

Artsimovitch I, Landick R. (2000) Pausing by bacterial RNA polymerase is mediated by mechanistically distinct classes of signals. Proc Natl Acad Sci U S A. 97(13):7090-7095.

Artsimovitch I, Landick R. (1998) Interaction of a nascent RNA structure with RNA polymerase is required for hairpin-dependent transcriptional pausing but not for transcript release. Genes Dev. 12(19):3110-3122.

Bailey MJ, Hughes C, Koronakis V. (1997) RfaH and the ops element, components of a novel system controlling bacterial transcription elongation. Mol Microbiol. 26(5):845-851.

Barker MM, Gaal T, Josaitis CA, Gourse RL. (2001) Mechanism of regulation of transcription initiation by ppGpp. I. Effects of ppGpp on transcription initiation in vivo and in vitro. J Mol Biol. 305(4):673-688.

Barne KA, Bown JA, Busby SJ, Minchin SD. (1997) Region 2.5 of the Escherichia coli RNA polymerase sigma70 subunit is responsible for the recognition of the 'extended-10' motif at promoters. EMBO J. 16(13):4034-4040.

Benoff B, Yang H, Lawson CL, Parkinson G, Liu J, Blatter E, Ebright YW, Berman HM, Ebright RH. (2002) Structural basis of transcription activation: the CAP-alpha CTD-DNA complex. Science. 297(5586):1562-1566.

Blatter EE, Ross W, Tang H, Gourse RL, Ebright RH. (1994) Domain organization of RNA polymerase alpha subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding. Cell. 78(5):889-896.

Bonner ER, D'Elia JN, Billips BK, Switzer RL. (2001) Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR. Nucleic Acids Res. 29(23):4851-4865.

37 Borukhov S, Sagitov V, Goldfarb A. (1993) Transcript cleavage factors from E. coli. Cell. 72(3):459-466.

Buck M, Gallegos MT, Studholme DJ, Guo Y, Gralla JD. (2000) The bacterial - dependent sigma(54) (sigma(N)) transcription factor. J Bacteriol. 182(15):4129-4136.

Burgess RR. Separation and characterization of the subunits of ribonucleic acid polymerase. (1969) J Biol Chem. 244(22):6168-6176.

Burgess RR, Travers AA, Dunn JJ, Bautz EK. Factor stimulating transcription by RNA polymerase. (1969) Nature. 221(5175):43-46.

Burgess RR, Travers AA. (1970) Escherichia coli RNA polymerase: purification, subunit structure, and factor requirements. Fed Proc. 29(3):1164-1169.

Burmann BM, Schweimer K, Luo X, Wahl MC, Stitt BL, Gottesman ME, Rösch P. (2010) A NusE:NusG complex links transcription and translation. Science. 328(5977):501-504.

Burns CM, Richardson JP. (1995) NusG is required to overcome a kinetic limitation to Rho function at an intragenic terminator. Proc Natl Acad Sci U S A. 92(11):4738-4742.

Burova E, Gottesman ME. (1995) NusG overexpression inhibits Rho-dependent termination in Escherichia coli. Mol Microbiol. 17(4):633-641.

Burova E, Hung SC, Chen J, Court DL, Zhou JG, Mogilnitskiy G, Gottesman ME. (1999) Escherichia coli nusG mutations that block transcription termination by coliphage HK022 Nun protein. Mol Microbiol. 31(6):1783-1793.

38 Cardinale CJ, Washburn RS, Tadigotla VR, Brown LM, Gottesman ME, Nudler E. (2008) Termination factor Rho and its cofactors NusA and NusG silence foreign DNA in E. coli. Science. 320(5878):935-938.

Carlomagno MS, Nappo A. (2003) NusA modulates intragenic termination by different pathways. Gene. 308:115-128.

Chalissery J, Muteeb G, Kalarickal NC, Mohan S, Jisha V, Sen R. (2011) Interaction surface of the transcription terminator Rho required to form a complex with the C-terminal domain of the antiterminator NusG. J Mol Biol. 405(1):49-64.

Chan CL, Wang D, Landick R. (1997) Multiple interactions stabilize a single paused transcription intermediate in which hairpin to 3' end spacing distinguishes pause and termination pathways. J Mol Biol. 268(1):54-68.

Chen H, Tang H, Ebright RH. (2003) Functional interaction between RNA polymerase alpha subunit C-terminal domain and sigma70 in UP-element- and activator-dependent transcription. Mol Cell. 11(6):1621-1633.

Chen YJ, Liu P, Nielsen AA, Brophy JA, Clancy K, Peterson T, Voigt CA. (2013) Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nat Methods. 10(7):659-664.

Choy HE. (2000) The study of guanosine 5'-diphosphate 3'-diphosphate-mediated transcription regulation in vitro using a coupled transcription-translation system. J Biol Chem. 275(10):6783- 6789.

Cohen SE, Godoy VG, Walker GC. (2009) Transcriptional modulator NusA interacts with translesion DNA polymerases in Escherichia coli. J Bacteriol. 191(2):665-672.

39 Cohen SE, Walker GC. (2010) The transcription elongation factor NusA is required for stress- induced mutagenesis in Escherichia coli. Curr Biol. 20(1):80-85.

Darst SA, Opalka N, Chacon P, Polyakov A, Richter C, Zhang G, Wriggers W. (2002) Conformational flexibility of bacterial RNA polymerase. Proc Natl Acad Sci U S A. 99(7):4296- 4301.

Das A, Pal M, Mena JG, Whalen W, Wolska K, Crossley R, Rees W, von Hippel PH, Costantino N, Court D, Mazzulla M, Altieri AS, Byrd RA, Chattopadhyay S, DeVito J, Ghosh B. (1996) Components of multiprotein-RNA complex that controls transcription elongation in Escherichia coli phage lambda. Methods Enzymol. 274:374-402.

Daube SS, von Hippel PH. (1999) Interactions of Escherichia coli sigma(70) within the transcription elongation complex. Proc Natl Acad Sci U S A. 96(15):8390-8395. deHaseth PL, Zupancic ML, Record MT Jr. (1998) RNA polymerase-promoter interactions: the comings and goings of RNA polymerase. J Bacteriol. 180(12):3019-3025.

Dombroski AJ, Walter WA, Gross CA. (1993) Amino-terminal amino acids modulate sigma- factor DNA-binding activity. Genes Dev. 7(12A):2446-2455.

Dombroski AJ, Walter WA, Record MT Jr, Siegele DA, Gross CA. (1992) Polypeptides containing highly conserved regions of transcription initiation factor sigma 70 exhibit specificity of binding to promoter DNA. Cell. 70(3):501-512.

Downing WL, Sullivan SL, Gottesman ME, Dennis PP. (1990) Sequence and transcriptional pattern of the essential Escherichia coli secE-nusG operon. J Bacteriol. 172(3):1621-1627.

Draper DE. (1989) How do proteins recognize specific RNA sites? New clues from autogenously regulated ribosomal proteins. Trends Biochem Sci. 14(8):335-338.

40 Eisenmann A, Schwarz S, Prasch S, Schweimer K, Rösch P. (2005) The E. coli NusA carboxy- terminal domains are structurally similar and show specific RNAP- and lambdaN interaction. Protein Sci. 14(8):2018-2029.

Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E. (2007) An allosteric path to transcription termination. Mol Cell. 28(6):991-1001.

Epshtein V, Dutta D, Wade J, Nudler E. (2010) An allosteric mechanism of Rho-dependent transcription termination. Nature. 463(7278):245-249.

Feng GH, Lee DN, Wang D, Chan CL, Landick R. (1994) GreA-induced transcript cleavage in transcription complexes containing Escherichia coli RNA polymerase is controlled by multiple factors, including nascent transcript location and structure. J Biol Chem. 269(35):22282-22294.

Fenton MS, Lee SJ, Gralla JD. (2000) Escherichia coli promoter opening and -10 recognition: mutational analysis of sigma70. EMBO J. 19(5):1130-1137.

Fish RN, Kane CM. (2002) Promoting elongation with transcript cleavage stimulatory factors. Biochim Biophys Acta. 1577(2):287-307.

Geszvain K.M. and Landick, R. 2004. The structure of bacterial RNA polymerase. In The bacterial chromosome (ed. N.P. Higgins), pp. 283-296. American Society for Microbiology, Washington, DC.

Goliger JA, Yang XJ, Guo HC, Roberts JW. (1989) Early transcribed sequences affect termination efficiency of Escherichia coli RNA polymerase. J Mol Biol. 205(2):331-341.

Gong F, Yanofsky C. (2003) A transcriptional pause synchronizes translation with transcription in the tryptophanase operon leader region. J Bacteriol. 185(21):6472-6476.

41 Gopal B, Haire LF, Gamblin SJ, Dodson EJ, Lane AN, Papavinasasundaram KG, Colston MJ, Dodson G. (2001) Crystal structure of the transcription elongation/anti-termination factor NusA from Mycobacterium tuberculosis at 1.7 A resolution. J Mol Biol. 314(5):1087-1095.

Grundy FJ, Henkin TM. (2004) Kinetic analysis of tRNA-directed transcription antitermination of the Bacillus subtilis glyQS gene in vitro. J Bacteriol. 186(16):5392-5399.

Guo M, Xu F, Yamada J, Egelhofer T, Gao Y, Hartzog GA, Teng M, Niu L. (2008) Core structure of the yeast spt4-spt5 complex: a conserved module for regulation of transcription elongation. Structure. 16(11):1649-1658.

Gusarov I, Nudler E. (2001) Control of intrinsic transcription termination by N and NusA: the basic mechanisms. Cell. 107(4):437-449.

Gusarov I, Nudler E. (1999) The mechanism of intrinsic transcription termination. Mol Cell. 3(4):495-504.

Ha KS, Toulokhonov I, Vassylyev DG, Landick R. (2010) The NusA N-terminal domain is necessary and sufficient for enhancement of transcriptional pausing via interaction with the RNA exit channel of RNA polymerase. J Mol Biol. 401(5):708-725.

Hart CM, Roberts JW. (1991) Rho-dependent transcription termination. Characterization of the requirement for cytidine in the nascent transcript. J Biol Chem. 266(35):24140-24148.

Helmann JD. (2003) Purification of Bacillus subtilis RNA polymerase and associated factors. Methods Enzymol.370:10-24.

Hinkle DC, Chamberlin MJ. (1972) Studies of the binding of Escherichia coli RNA polymerase to DNA. II. The kinetics of the binding reaction. J Mol Biol. 70(2):187-195.

42 Hogan BP, Hartsch T, Erie DA. (2002) Transcript cleavage by Thermus thermophilus RNA polymerase. Effects of GreA and anti-GreA factors. J Biol Chem. 277(2):967-975.

Horwitz RJ, Li J, Greenblatt J. (1987) An elongation control particle containing the N gene transcriptional antitermination protein of bacteriophage lambda. Cell. 51(4):631-641.

Ingham CJ, Dennis J, Furneaux PA. (1999) Autogenous regulation of transcription termination factor Rho and the requirement for Nus factors in Bacillus subtilis. Mol Microbiol. 31(2):651- 663.

Ishihama A, Fujita N, Glass RE. (1987) Subunit assembly and metabolic stability of E. coli RNA polymerase. Proteins. 2(1):42-53.

Ishihama A. (2000 ) Functional modulation of Escherichia coli RNA polymerase. Annu Rev Microbiol. 54:499-518.

Juang YL, Helmann JD. (1994) The delta subunit of Bacillus subtilis RNA polymerase. An allosteric effector of the initiation and core-recycling phases of transcription. J Mol Biol. 27;239(1):1-14.

Kang PJ, Craig EA. (1990) Identification and characterization of a new Escherichia coli gene that is a dosage-dependent suppressor of a dnaK deletion mutation. J Bacteriol. 172(4):2055-2064.

Keller AN, Yang X, Wiedermannová J, Delumeau O, Krásný L, Lewis PJ. (2014) ε, a new subunit of RNA polymerase found in gram-positive bacteria. J Bacteriol. 196(20):3622-3632.

King RA, Markov D, Sen R, Severinov K, Weisberg RA. (2004) A conserved zinc binding domain in the largest subunit of DNA-dependent RNA polymerase modulates intrinsic transcription termination and antitermination but does not stabilize the elongation complex. J Mol Biol. 342(4):1143-1154.

43 Klein BJ, Bose D, Baker KJ, Yusoff ZM, Zhang X, Murakami KS. (2011) RNA polymerase and transcription elongation factor Spt4/5 complex structure. Proc Natl Acad Sci U S A. 108(2):546- 550.

Komissarova N, Kashlev M. (1998) Functional topography of nascent RNA in elongation intermediates of RNA polymerase. Proc Natl Acad Sci U S A. 95(25):14699-14704.

Komissarova N, Kashlev M. (1997) Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3' end of the RNA intact and extruded. Proc Natl Acad Sci U S A. 94(5):1755-1760.

Korzheva N, Mustaev A, Nudler E, Nikiforov V, Goldfarb A. (1998) Mechanistic model of the elongation complex of Escherichia coli RNA polymerase. Cold Spring Harb Symp Quant Biol.63:337-345.

Kyrpides NC, Woese CR, Ouzounis CA. (1996) KOW: a novel motif linking a bacterial transcription factor with ribosomal proteins. Trends Biochem Sci. 21(11):425-426.

Lamour V, Hogan BP, Erie DA, Darst SA. (2006) Crystal structure of Thermus aquaticus Gfh1, a Gre-factor paralog that inhibits rather than stimulates transcript cleavage. J Mol Biol. 356(1):179- 188.

Laptenko O, Lee J, Lomakin I, Borukhov S. (2003) Transcript cleavage factors GreA and GreB act as transient catalytic components of RNA polymerase. EMBO J. 22(23):6322-6334

Laptenko O, Kim SS, Lee J, Starodubtseva M, Cava F, Berenguer J, Kong XP, Borukhov S. (2006) pH-dependent conformational switch activates the inhibitor of transcription elongation. EMBO J. 25(10):2131-2141.

44 Larson MH, Mooney RA, Peters JM, Windgassen T, Nayak D, Gross CA, Block SM, Greenleaf WJ, Landick R, Weissman JS. (2014) A pause sequence enriched at translation start sites drives transcription dynamics in vivo. Science. 344(6187):1042-1047.

Lau LF, Roberts JW, Wu R. (1983) RNA polymerase pausing and transcript release at the lambda tR1 terminator in vitro. J Biol Chem. 258(15):9391-9397.

Lee DN, Phung L, Stewart J, Landick R. (1990) Transcription pausing by Escherichia coli RNA polymerase is modulated by downstream DNA sequences. J Biol Chem. 265(25):15145-15153.

Lee DN, Landick R. (1992) Structure of RNA and DNA chains in paused transcription complexes containing Escherichia coli RNA polymerase. J Mol Biol. 228(3):759-777.

Lee DN, Feng G, Landick R. (1994) GreA-induced transcript cleavage is accompanied by reverse translocation to a different transcription complex conformation. J Biol Chem. 269(35):22295- 222303.

Lesnik EA, Sampath R, Levene HB, Henderson TJ, McNeil JA, Ecker DJ. (2001) Prediction of rho-independent transcriptional terminators in Escherichia coli. Nucleic Acids Res. 29(17):3583- 3594.

Li J, Horwitz R, McCracken S, Greenblatt J. (1992) NusG, a new Escherichia coli elongation factor involved in transcriptional antitermination by the N protein of phage lambda. J Biol Chem. 267(9):6012-6019.

Li J, Mason SW, Greenblatt J. (1993) Elongation factor NusG interacts with termination factor rho to regulate termination and antitermination of transcription. Genes Dev. 7(1):161-172.

Li J and Gilmour, DS. (2011) Promoter proximal pausing and the control of gene expression. Curr Opin Genet Dev. 21(2):231-235

45 Lonetto M, Gribskov M, Gross CA. (1992) The sigma 70 family: sequence conservation and evolutionary relationships. J Bacteriol. 174(12):3843-3849.

Losick R, Pero J. (1981) Cascades of Sigma factors. Cell. 25(3):582-584.

Macdonald LE, Zhou Y, McAllister WT. (1993) Termination and slippage by bacteriophage T7 RNA polymerase. J Mol Biol. 232(4):1030-1047.

Mah TF, Kuznedelov K, Mushegian A, Severinov K, Greenblatt J. (2000) The alpha subunit of E. coli RNA polymerase activates RNA binding by NusA. Genes Dev. 14(20):2664-2675.

Mah TF, Li J, Davidson AR, Greenblatt J. (1999) Functional importance of regions in Escherichia coli elongation factor NusA that interact with RNA polymerase, the bacteriophage lambda N protein and RNA. Mol Microbiol. 34(3):523-537.

Marr MT, Roberts JW. (2000) Function of transcription cleavage factors GreA and GreB at a regulatory pause site. Mol Cell. 6(6):1275-1285.

Martin FH, Tinoco I Jr. (1980) DNA-RNA hybrid duplexes containing oligo(dA:rU) sequences are exceptionally unstable and may facilitate termination of transcription. Nucleic Acids Res. 8(10):2295-2299.

Mason SW, Li J, Greenblatt J. (1992) Host factor requirements for processive antitermination of transcription and suppression of pausing by the N protein of bacteriophage lambda. J Biol Chem. 267(27):19418-19426.

McClure WR. (1980) Rate-limiting steps in RNA chain initiation. Proc Natl Acad Sci U S A. 77(10):5634-5638.

46 Minakhin L, Bhagat S, Brunning A, Campbell EA, Darst SA, Ebright RH, Severinov K. (2001) Bacterial RNA polymerase subunit omega and eukaryotic RNA polymerase subunit RPB6 are sequence, structural, and functional homologs and promote RNA polymerase assembly. Proc Natl Acad Sci U S A. 98(3):892-897.

Mooney RA, Darst SA, Landick R. (2005) Sigma and RNA polymerase: an on-again, off-again relationship? Mol Cell. 20(3):335-345.

Mooney RA, Davis SE, Peters JM, Rowland JL, Ansari AZ, Landick R. (2009) Regulator trafficking on bacterial transcription units in vivo. Mol Cell. 33(1):97-108.

Mooney RA, Schweimer K, Rösch P, Gottesman M, Landick R. (2009) Two structurally independent domains of E. coli NusG create regulatory plasticity via distinct interactions with RNA polymerase and regulators. J Mol Biol. 391(2):341-358.

Mooney RA, Artsimovitch I, Landick R. (1998) Information processing by RNA polymerase: recognition of regulatory signals during RNA chain elongation. J Bacteriol. 180(13):3265-3275.

Murakami KS, Masuda S, Campbell EA, Muzzin O, Darst SA. (2002) Structural basis of transcription initiation: an RNA polymerase holoenzyme-DNA complex. Science. 296(5571):1285-1290.

Murakami KS, Masuda S, Darst SA. (2002) Structural basis of transcription initiation: RNA polymerase holoenzyme at 4 A resolution. Science. 296(5571):1280-1284.

Markovtsov V, Goldfarb A. (1996) Transcription processivity: protein-DNA interactions holding together the elongation complex. Science. 273(5272):211-217.

47 Nomura M, Yates JL, Dean D, Post LE. (1980) Feedback regulation of ribosomal protein gene expression in Escherichia coli: structural homology of ribosomal RNA and ribosomal protein MRNA. Proc Natl Acad Sci U S A. 77(12):7084-8708.

Nudler E, Mustaev A, Lukhtanov E, Goldfarb A. (1997) The RNA-DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase. Cell. 89(1):33-41.

Opalka N, Chlenov M, Chacon P, Rice WJ, Wriggers W, Darst SA. (2003) Structure and function of the transcription elongation factor GreB bound to bacterial RNA polymerase. Cell. 114(3):335-345.

Pasman Z, von Hippel PH. (2000) Regulation of rho-dependent transcription termination by NusG is specific to the Escherichia coli elongation complex. Biochemistry. 39(18):5573-5585.

Paul BJ, Barker MM, Ross W, Schneider DA, Webb C, Foster JW, Gourse RL. (2004) DksA: a critical component of the transcription initiation machinery that potentiates the regulation of rRNA promoters by ppGpp and the initiating NTP. Cell. 118(3):311-322.

Perederina A, Svetlov V, Vassylyeva MN, Tahirov TH, Yokoyama S, Artsimovitch I, Vassylyev DG. (2004) Regulation through the secondary channel--structural framework for ppGpp-DksA synergism during transcription. Cell. 118(3):297-309.

Peters JM, Mooney RA, Grass JA, Jessen ED, Tran F, Landick R. (2012) Rho and NusG suppress pervasive antisense transcription in Escherichia coli. Genes Dev. 26(23):2621-2633.

Peters JM, Vangeloff AD, Landick R. (2011) Bacterial transcription terminators: the RNA 3'-end chronicles. J Mol Biol. 412(5):793-813.

48 Prasch S, Schwarz S, Eisenmann A, Wöhrl BM, Schweimer K, Rösch P. (2006) Interaction of the intrinsically unstructured phage lambda N Protein with Escherichia coli NusA. Biochemistry. 45(14):4542-4549.

Pribnow D. (1975) Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. Proc Natl Acad Sci U S A. 72(3):784-788.

Rabatinová A, Šanderová H, Jirát Matějčková J, Korelusová J, Sojka L, Barvík I, Papoušková V, Sklenár V, Žídek L, Krásný L. (2013) The δ subunit of RNA polymerase is required for rapid changes in gene expression and competitive fitness of the cell. J Bacteriol. 195(11):2603-2611.

Rasmussen EB, Lis JT. (1993) In vivo transcriptional pausing and cap formation on three Drosophila heat shock genes. Proc Natl Acad Sci U S A. 90(17):7923-7927.

Richardson JP. (1996) Structural organization of transcription termination factor Rho. J Biol Chem. 271(3):1251-1254.

Ring BZ, Yarnell WS, Roberts JW. (1996) Function of E. coli RNA polymerase sigma factor sigma 70 in promoter-proximal pausing. Cell. 86(3):485-493.

Roberts JW, Shankar S, Filter JJ. (2008) RNA polymerase elongation factors. Annu Rev Microbiol.62:211-233.

Roberts JW. (1969) Termination factor for RNA synthesis. Nature. 224(5225):1168-1174.

Ross W, Gosink KK, Salomon J, Igarashi K, Zou C, Ishihama A, Severinov K, Gourse RL. (1993) A third recognition element in bacterial promoters: DNA binding by the alpha subunit of RNA polymerase. Science. 262(5138):1407-1413.

49 Rougvie AE, Lis JT. (1988) The RNA polymerase II molecule at the 5' end of the uninduced hsp70 gene of D. melanogaster is transcriptionally engaged. Cell. 54(6):795-804.

Rutherford ST, Lemke JJ, Vrentas CE, Gaal T, Ross W, Gourse RL. (2007) Effects of DksA, GreA, and GreB on transcription initiation: insights into the mechanisms of factors that bind in the secondary channel of RNA polymerase. J Mol Biol. 366(4):1243-1257.

Santangelo TJ, Artsimovitch I. (2011) Termination and antitermination: RNA polymerase runs a stop sign. Nat Rev Microbiol. 9(5):319-329.

Santangelo TJ, Roberts JW. (2004) Forward translocation is the natural pathway of RNA release at an intrinsic terminator. Mol Cell. 14(1):117-126.

Santangelo TJ, Roberts JW. (2002) RfaH, a bacterial transcription antiterminator. Mol Cell. 9(4):698-700.

Saxena S, Gowrishankar J. (2011) Modulation of Rho-dependent transcription termination in Escherichia coli by the H-NS family of proteins. J Bacteriol. 193(15):3832-3841.

Schauer AT, Carver DL, Bigelow B, Baron LS, Friedman DI. (1987) Lambda N antitermination system: functional analysis of phage interactions with the host NusA protein. J Mol Biol. 194(4):679-690.

Schmidt MC, Chamberlin MJ. (1987) NusA protein of Escherichia coli is an efficient transcription termination factor for certain terminator sites. J Mol Biol. 195(4):809-818.

Schmidt MC, Chamberlin MJ. (1984) Binding of rho factor to Escherichia coli RNA polymerase mediated by nusA protein. J Biol Chem. 259(24):15000-15002.

50 Schroeder LA, deHaseth PL. (2005) Mechanistic differences in promoter DNA melting by Thermus aquaticus and Escherichia coli RNA polymerases. J Biol Chem. 280(17):17422-17429.

Severinov K, Mustaev A, Kukarin A, Muzzin O, Bass I, Darst SA, Goldfarb A. (1996) Structural modules of the large subunits of RNA polymerase. Introducing archaebacterial and chloroplast split sites in the beta and beta' subunits of Escherichia coli RNA polymerase. J Biol Chem. 271(44):27969-27974.

Severinova E, Severinov K, Fenyö D, Marr M, Brody EN, Roberts JW, Chait BT, Darst SA. (1996) Domain organization of the Escherichia coli RNA polymerase sigma 70 subunit. J Mol Biol. 263(5):637-647.

Sha Y, Lindahl L, Zengel JM. (1995) Role of NusA in L4-mediated attenuation control of the S10 r-protein operon of Escherichia coli. J Mol Biol. 245(5):474-485.

Shankar S, Hatoum A, Roberts JW. (2007) A transcription antiterminator constructs a NusA- dependent shield to the emerging transcript. Mol Cell. 27(6):914-927.

Shevtsov MB, Chen Y, Gollnick P, Antson AA. (2005) Crystal structure of Bacillus subtilis anti- TRAP protein, an antagonist of TRAP/RNA interaction. Proc Natl Acad Sci U S A. 102(49):17600-17605.

Shin DH, Nguyen HH, Jancarik J, Yokota H, Kim R, Kim SH. (2003) Crystal structure of NusA from Thermotoga maritima and functional implication of the N-terminal domain. Biochemistry. 42(46):13429-13437.

Skordalakes E, Berger JM. (2006) Structural insights into RNA-dependent ring closure and ATPase activation by the Rho termination factor. Cell. 127(3):553-564.

51 Sosunova E, Sosunov V, Kozlov M, Nikiforov V, Goldfarb A, Mustaev A. (2003) Donation of catalytic residues to RNA polymerase active center by transcription factor Gre. Proc Natl Acad Sci U S A. 100(26):15469-15474.

Squires CL, Greenblatt J, Li J, Condon C, Squires CL. (1993) Ribosomal RNA antitermination in vitro: requirement for Nus factors and one or more unidentified cellular components. Proc Natl Acad Sci U S A. 90(3):970-974.

Stebbins CE, Borukhov S, Orlova M, Polyakov A, Goldfarb A, Darst SA. (1995) Crystal structure of the GreA transcript cleavage factor from Escherichia coli. Nature. 373(6515):636- 640.

Steiner T, Kaiser JT, Marinkoviç S, Huber R, Wahl MC. (2002) Crystal structures of transcription factor NusG in light of its nucleic acid- and protein-binding activities. EMBO J. 21(17):4641-4653.

Sullivan SL, Ward DF, Gottesman ME. (1992) Effect of Escherichia coli nusG function on lambda N-mediated transcription antitermination. J Bacteriol. 174(4):1339-1344.

Sweetser D, Nonet M, Young RA. (1987) Prokaryotic and eukaryotic RNA polymerases have homologous core subunits. Proc Natl Acad Sci U S A. 84(5):1192-1196.

Symersky J, Perederina A, Vassylyeva MN, Svetlov V, Artsimovitch I, Vassylyev DG. (2006) Regulation through the RNA polymerase secondary channel. Structural and functional variability of the coiled-coil transcription factors. J Biol Chem. 281(3):1309-1312.

Tadigotla VR, O Maoiléidigh D, Sengupta AM, Epshtein V, Ebright RH, Nudler E, Ruckenstein AE. (2006) Thermodynamic and kinetic modeling of transcriptional pausing. Proc Natl Acad Sci U S A. 103(12):4439-4444.

52 Telesnitsky A, Chamberlin MJ. (1989) Terminator-distal sequences determine the in vitro efficiency of the early terminators of bacteriophages T3 and T7. Biochemistry. 28(12):5210- 5218.

Telesnitsky AP, Chamberlin MJ. (1989) Sequences linked to prokaryotic promoters can affect the efficiency of downstream termination sites. J Mol Biol. 205(2):315-330.

Toulokhonov I, Artsimovitch I, Landick R. (2001) Allosteric control of RNA polymerase by a site that contacts nascent RNA hairpins. Science. 292(5517):730-733.

Toulokhonov I, Landick R. (2003) The flap domain is required for pause RNA hairpin inhibition of catalysis by RNA polymerase and can modulate intrinsic termination. Mol Cell. 12(5):1125- 1136.

Vassylyev DG, Sekine S, Laptenko O, Lee J, Vassylyeva MN, Borukhov S, Yokoyama S. (2002) Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A resolution. Nature. 417(6890):712-719.

Vassylyev DG, Vassylyeva MN, Perederina A, Tahirov TH, Artsimovitch I. (2007) Structural basis for transcription elongation by bacterial RNA polymerase. Nature. 448(7150):157-162.

Vassylyeva MN, Svetlov V, Dearborn AD, Klyuyev S, Artsimovitch I, Vassylyev DG. (2007) The carboxy-terminal coiled-coil of the RNA polymerase beta'-subunit is the main binding site for Gre factors. EMBO Rep. 8(11):1038-1143.

Ward DF, Gottesman ME. (1981) The nus mutations affect transcription termination in Escherichia coli. Nature. 292(5820):212-215.

Weixlbaumer A, Leon K, Landick R, Darst SA. (2013) Structural basis of transcriptional pausing in bacteria. Cell. 152(3):431-441.

53 Wiedermannová J, Sudzinová P, Kovaľ T, Rabatinová A, Šanderova H, Ramaniuk O, Rittich Š, Dohnálek J, Fu Z, Halada P, Lewis P, Krásny L. (2014) Characterization of HelD, an interacting partner of RNA polymerase from Bacillus subtilis. Nucleic Acids Res. 42(8):5151-5163.

Winkler ME, Yanofsky C. Pausing of RNA polymerase during in vitro transcription of the tryptophan operon leader region. (1981) Biochemistry. 20(13):3738-3744.

Worbs M, Bourenkov GP, Bartunik HD, Huber R, Wahl MC. (2001) An extended RNA binding surface through arrayed S1 and KH domains in transcription factor NusA. Mol Cell. 7(6):1177- 1189.

Yakhnin AV, Babitzke P. (2002) NusA-stimulated RNA polymerase pausing and termination participates in the Bacillus subtilis trp operon attenuation mechanism invitro. Proc Natl Acad Sci U S A. 99(17):11067-11072.

Yakhnin AV, Yakhnin H, Babitzke P. (2008) Function of the Bacillus subtilis transcription elongation factor NusG in hairpin-dependent RNA polymerase pausing in the trp leader. Proc Natl Acad Sci U S A. 105(42):16131-16136..

Yakhnin AV, Babitzke P. (2014) NusG/Spt5: are there common functions of this ubiquitous transcription elongation factor? Curr Opin Microbiol. 18:68-71.

Yakhnin AV, Babitzke P. (2010) Mechanism of NusG-stimulated pausing, hairpin-dependent pause site selection and intrinsic termination at overlapping pause and termination sites in the Bacillus subtilis trp leader. Mol Microbiol. 76(3):690-705.

Yakhnin AV, Yakhnin H, Babitzke P. (2006) RNA polymerase pausing regulates translation initiation by providing additional time for TRAP-RNA interaction. Mol Cell. 24(4):547-557.

54 Yakhnin H, Zhang H, Yakhnin AV, Babitzke P. (2004) The trp RNA-binding attenuation protein of Bacillus subtilis regulates translation of the tryptophan transport gene trpP (yhaG) by blocking ribosome binding. J Bacteriol. 186(2):278-286.

Yang X, Molimau S, Doherty GP, Johnston EB, Marles-Wright J, Rothnagel R, Hankamer B, Lewis RJ, Lewis PJ. (2009) The structure of bacterial RNA polymerase in complex with the essential transcription elongation factor NusA. EMBO Rep. 10(9):997-1002.

Yarnell WS, Roberts JW. (1999) Mechanism of intrinsic transcription termination and antitermination. Science. 284(5414):611-615.

Yanofsky C, Platt T, Crawford IP, Nichols BP, Christie GE, Horowitz H, VanCleemput M, Wu AM. (1981) The complete nucleotide sequence of the tryptophan operon of Escherichia coli. Nucleic Acids Res. 9(24):6647-6668.

Zellars M, Squires CL. (1999) Antiterminator-dependent modulation of transcription elongation rates by NusB and NusG. Mol Microbiol. 32(6):1296-1304.

Zenkin N, Yuzenkova Y. (2015) New Insights into the Functions of Transcription Factors that Bind the RNA Polymerase Secondary Channel. Biomolecules. 5(3):1195-1209.

Zhang G, Campbell EA, Minakhin L, Richter C, Severinov K, Darst SA. (1999) Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution. Cell. 98(6):811-824.

Zhang H, Jørgensen CM, Switzer RL. (2005) Mutations affecting transcription pausing in the Bacillus subtilis pyr operon. Arch Microbiol. 184(2):101-107.

Zhang Y, Feng Y, Chatterjee S, Tuske S, Ho MX, Arnold E, Ebright RH. (2012) Structural basis of transcription initiation. Science. 338(6110):1076-1080.

55 Zhou H, Liu Q, Gao Y, Teng M, Niu L. (2009) Crystal structure of NusG N-terminal (NGN) domain from Methanocaldococcus jannaschii and its interaction with rpoE''. Proteins. 76(4):787- 793.

Zhou Y, Filter JJ, Court DL, Gottesman ME, Friedman DI. (2002) Requirement for NusG for transcription antitermination in vivo by the lambda N protein. J Bacteriol. 184(12):3416-3418.

56 Chapter 2

NusA-dependent Transcription Termination Prevents

Misregulation of Global Gene Expression

Part of this chapter is adapted from

Mondal, S., Yakhnin, A.V., Sebastian, A., Albert, I. and Babitzke, P. (2016) NusA-dependent

Transcription Termination Prevents Misregulation of Global Gene Expression. Nature

Microbiology (2016).

! 57! 2.1 Abstract

Intrinsic transcription terminators consist of an RNA hairpin followed by a U-rich tract, and these signals can trigger termination without the involvement of additional factors. Although

NusA is known to stimulate intrinsic termination in vitro, the in vivo targets and global impact of

NusA are not known because it is essential in E. coli and B. subtilis. Using genome-wide 3’ end- mapping on an engineered Bacillus subtilis NusA depletion strain, we show that weak suboptimal terminators are the principle NusA substrates. Moreover, a subclass of weak non-canonical terminators was identified that completely depend on NusA for effective termination. NusA- dependent terminators tend to have weak hairpins and/or distal U-tract interruptions, supporting a model in which NusA is directly involved in the termination mechanism. Depletion of NusA altered global gene expression directly and indirectly via readthrough of suboptimal terminators.

Readthrough of NusA-dependent terminators caused misregulation of genes involved in essential cellular functions, especially DNA replication and metabolism. We further show that nusA is autoregulated by a transcription attenuation mechanism that does not rely on antiterminator structures. Instead, NusA-stimulated termination in its 5'UTR dictates the extent of transcription into the operon, thereby ensuring tight control of cellular NusA levels.

! 58! 2.2 Introduction

Transcription by RNA polymerase (RNAP) is regulated at the level of initiation and termination, although the regulation of termination is not well understood. Rho-dependent and intrinsic (Rho-independent) termination are the two termination mechanisms that have been identified in bacteria: (Peters et al. 2011). Canonical intrinsic terminators are composed of a GC- rich RNA hairpin followed by ~7 uninterrupted U residues, with termination typically occurring 7 to 9 nucleotides downstream from the base of the hairpin. The U-tract initiates the process of termination by inducing a transcriptional pause, which allows the hairpin to form inside of the

RNA exit channel of RNAP, leading to dissociation of the elongation complex (Gusarov and

Nudler 1999; Komissarova et al. 2002). Approximately 50% of the transcription units in

Escherichia coli and most other proteobacteria are terminated by intrinsic termination (Peters et al. 2011), whereas intrinsic termination is the predominate type of termination in most firmicutes including Bacillus subtilis. Indeed, the gene encoding Rho can be deleted from B. subtilis without any significant growth defect (Ingham et al. 1999). Thus, B. subtilis is an excellent model system for studying intrinsic termination.

While uninterrupted RNA hairpins and U-tracts define canonical intrinsic terminators, some terminators do not contain perfect stem-loops or U-tracts, resulting in lower termination efficiency (Mitra et al. 2009; Potter et al. 2011). A recent study suggested that the strongest contributor of termination strength is the U-tract, although the free energy of the DNA:RNA hybrid, the hairpin loop, the base of the hairpin, and the presence of an A-tract upstream of the hairpin also contribute to terminator strength (Chen et al. 2013).

NusA is a general transcription elongation factor that is universally conserved in eubacteria and archaea and is essential for cell viability (Ingham et al. 1999; Roberts et al. 2008).

E. coli NusA consists of an N-terminal RNAP-binding domain, three RNA-binding domains (S1,

! 59! KH1, and KH2), and two C-terminal autoinhibitory domains (AR1 and AR2), whereas B. subtilis and archaeal NusA lack the AR domains (Mah et al. 2000; Worbs et al. 2001; Yang et al. 2009).

NusA was proposed to enhance termination by promoting hairpin formation (Gusarov and Nudler

2001) or by interacting with the nascent RNA (Ha et al. 2010). The fact that NusA is essential for viability has prevented its assessment on termination in vivo. Using B. subtilis as a model system, we employed a global 3’ end-mapping strategy to identify intrinsic terminators in vivo. Moreover, by using an engineered NusA depletion strain we identified a subpopulation of non-canonical intrinsic terminators that are highly dependent on NusA for efficient termination. We also investigated the determinants of NusA-dependency by comparing the features of ~1500 terminators. Our results indicate that NusA-dependent termination regulates the expression of many genes, suggesting that NusA is essential for viability because its absence leads to global misregulation of gene expression caused by transcription readthrough. Our studies also revealed a novel form of transcription attenuation in which NusA autoregulates the nusA-containing operon via NusA-stimulated termination.

2.3 Results

2.3.1 Construction of a NusA depletion strain

We engineered a B. subtilis NusA depletion strain (PLBS802) in which expression of

NusA is repressed by withholding isopropyl β-D-1-thiogalactopyranoside (IPTG) from the growth medium (Figure 2-1a). In brief, a his-tagged version of B. subtilis nusA was cloned under the IPTG-inducible Physpank promoter. This construct, along with a constitutively expressing lacI gene (coding lac protein) and a spectinomycin resistance marker was then integrated into the amyE locus of the WT B. subtilis genome by homologous recombination. In this strain,

NusA is expressed from the amyE locus in the presence of IPTG in addition to the original nusA

! 60! locus. In the presence of IPTG, the nusA coding region from its original locus was replaced with a kanamycin resistance gene. Expression of nusA from the amyE locus is dependent on IPTG in this strain. To ensure tight repression in the absence of IPTG, additional copies of the lacI gene were introduced on a high copy number plasmid carrying a constitutively expressing lacI. Growth of

PLBS802 was slower in the absence of IPTG, an effect that was most prominent in rich Luria broth (LB) media (Figure 2-1b). Primer extension indicated that the majority of nusA mRNA was rapidly depleted within 15 min of IPTG removal; ~1% of the mRNA was maintained as a consequence of leaky expression (Figure 2-1c), while western blotting confirmed successful depletion of NusA (Figure 2-1d). Because the level of NusA in the depletion strain when grown with 30 µM IPTG was comparable to the level in wild-type (WT) B. subtilis (lane 6), this concentration of IPTG was used for all in vivo studies. Although a trace amount of NusA was present in cells grown without IPTG (Figure 2-1d), to simplify the discussion we refer to the

+IPTG condition as +NusA and the –IPTG condition as –NusA.

2.3.2 Identification of terminators by 3’ end-mapping

An RNA ligation-based high-throughput sequencing strategy was used to simultaneously identify termination sites at single nucleotide resolution and calculate termination efficiency. A unique RNA oligo was ligated to the 3’ end of rRNA-depleted total RNA isolated from PLBS802 grown ± IPTG (six biological replicates each) to mark the native 3’ ends, followed by illumina library preparation and sequencing (Figure 2-2a). Whereas total reads were used for mRNA profiling, oligo-ligated sites precisely identified the 3’ ends of terminated, processed or partially degraded transcripts. Screening of these ends identified 2,130 possible intrinsic terminators; however, we considered 1,473 terminators with significant expression levels for the studies described below (Table 4). Termination efficiency was determined at these terminators by

! 61! ! ! ! ! !

! 62! Figure 2-1. The B. subtilis NusA depletion strain PLBS802. a, His-tagged nusA (red) under the control of an IPTG-inducible promoter (Physpank), along with lacI expressed from a constitutive promoter and a spectinomycin resistance gene, was integrated into the amyE locus. The chromosomal copy of nusA was then replaced with a kanamycin resistance gene. The strain also contains a plasmid expressing lacI for tighter repression. b, Growth curves of the NusA depletion strain. Cells were grown in minimal-ACH medium or LB in the absence (filled circles) or presence (open circles) of 30 µM IPTG. c, Primer extension assay to monitor nusA mRNA depletion. PLBS802 was grown in LB with IPTG to exponential phase, washed, and growth was then resumed without IPTG for the indicated times prior to RNA extraction. This is a representative gel of an experiment that was performed twice. d, Western blot confirming NusA depletion. PLBS802 was grown to exponential phase in ACH medium without (lane 3) or with

A IPTG (10-100 µM, lanes 4-10; lane 6 is 30 µM). Lane 1: Purified NusA6His and σ . Lane 2:

Protein lysate from WT B. subtilis. This is a representative blot of an experiment that was performed three times.!

! 63! ! !

! 64! Figure 2-2. Library construction and determination of termination efficiency (%T). a,

Schematic representation of the library preparation for simultaneous mRNA profiling and 3’ end- mapping. b, Calculation of termination efficiency (%T). The average number of reads in 10 nt windows were calculated both upstream and downstream of the point of termination (POT), leaving a 3 nt gap on both sides. %T was calculated as the percent of total reads that extend past the POT. c, Terminators identified throughout the genome (not to scale) showing basal termination efficiency (%T–NusA). d, Effect of NusA on termination efficiency (Δ%T). e, f, Effect of NusA on strong and weak intrinsic terminators.

! 65! comparing the number of terminated and readthrough reads at each point of termination (Figure

2-2b). NusA increased the termination efficiency of most terminators to some extent, with an average increase of 13.5% (Figure 2-2c, d); however, the stimulatory effect of NusA (Δ%T =

%T+NusA – %T–NusA) was generally much higher on weak terminators (Figure 2-2e). Although most weak terminators were highly stimulated by NusA, the extent of stimulation at weak terminators was poorly correlated with basal terminator strength (%T–NusA) (Figure 2-2f, r =

–0.15), indicating that NusA-mediated stimulation differs greatly among these terminators. NusA also reduced the termination of several terminators, although the extent of inhibition was very low in most cases (Figure. 2-2d).

2.3.3 Identification of NusA-dependent termination in vivo

Although we found a pronounced effect of NusA on weak terminators, the terminators differed greatly in the magnitude to which they were stimulated (Δ%T) (Figure 2-2e, f). We grouped the terminators into four classes based on their response to NusA (Figure 2-3a): NusA- independent (low Δ%T, for example, Trny and TsecY); NusA-stimulated (moderate Δ%T, for example, TpapB); NusA-dependent (high Δ%T, for example, TmetS) and NusA-inhibited (negative

Δ%T, for example, TAttthrS). NusA-independent terminators were subdivided into two groups based on basal termination efficiency (%T–NusA) to distinguish between two mechanistically distinct terminator classes (Figure 2-3a, c). Whereas strong NusA-independent terminators are always associated with small Δ%T values because they have high basal termination efficiencies,

NusA is ineffective at weak NusA-independent terminators despite low basal termination efficiencies. Strong NusA-independent terminators are the most abundant terminators in the B. subtilis genome, and weak NusA-independent and NusA-inhibited terminators are least abundant

(Figure 2-3b).

! 66! ! ! ! ! Figure 2-3. Effect of NusA on intrinsic termination in vivo. a, Classification of the terminators based on their response to NusA in vivo. b, Percentage of different terminator classes in the B. subtilis genome. c,. Examples of the five terminator classes. Bases deviating from a canonical terminator are in red. Normalized coverage ±NusA are in blue and green, respectively.

Termination efficiency (%T) is shown in each box.

! 67! Table&1:&Top&10&NusA0dependent&terminators& ! a Terminator* %T+NusA* SE* %T–NusA* SE* Δ%T* p6value * TydjM" 84" 2.6" 1" 4.4" 83" 1.6E+08" TmetS" 82" 1.6" 1" 3.7" 81" 3.2E+09" TypmT" 90" 3.9" 15" 2.7" 75" 2.5E+08" TyqxC" 81" 1.5" 11" 3.1" 70" 2.2E+09" TyuxK" 77" 2.7" 7" 9.7" 70" 2.1E+05" TyusV" 77" 2.2" 7" 1.3" 70" 1.3E+10" TyfzA" 82" 3.0" 18" 7.7" 64" 2.6E+05" TytzE" 86" 1.8" 22" 4.7" 64" 1.6E+07" TnrdR" 94" 1.8" 31" 5.9" 63" 2.6E+06" Txre" 76" 4.2" 15" 2.4" 61" 1.5E+07" ! ap.values!were!calculated!from!six!replicates!using!a!two.tailed!t.test.!

! ! ! !

! ! ! ! Fig 2-4. In vitro effect of NusA on NusA-dependent terminators identified in vivo. a,

Sequence of the NusA-dependent terminators tested in vitro. b, Autoradiogram of in vitro termination assay. The termination efficiencies in vitro and in vivo are shown at the bottom.

Terminators were tested two (ypmT, yqxC), three (metS, yusV, argT, bioYB) or six (proS) times.!

! 68! NusA-dependent terminators are particularly intriguing as they would greatly affect downstream gene expression depending on NusA availability (Table 1). Indeed, mRNA profiling indicated that the downstream genes are highly upregulated upon depletion of NusA (Table 5).

Because these terminators depend on NusA for efficient termination in vivo, they are not truly intrinsic in nature. Hence, these pseudo-intrinsic terminators constitute a new class of factor- dependent terminators and may represent the most critical NusA substrates. To determine whether a similar level of stimulation is observed in vitro, we tested several NusA-dependent terminators by in vitro transcription and found that stimulation was considerably lower than in vivo (Figure 2-4), indicating that in vitro transcription does not accurately measure the impact of

NusA on termination in vivo.

2.3.4 Terminator features that affect their response to NusA

We aimed to test whether Δ%T is correlated with terminator sequence by comparing the different terminator classes. The U-tracts of strong and weak NusA-independent terminators had the highest and lowest number of U residues, respectively (Figure 2-5a, b). Whereas U was conserved at positions 1-5 in all classes, this feature was most prominent for strong NusA- independent terminators (Figure 2-5c, d). NusA-stimulated terminators exhibited a high occurrence of U at the first two positions, while the prevalence of U at the second position was lower for NusA-dependent terminators. Both of these classes differed considerably from strong

NusA-independent terminators in the conservation of U at positions 3-6, with NusA-dependent terminators having the lowest conservation among these three classes (Figure 2-5c). Weak NusA- independent terminators had the lowest conservation of U, while NusA-inhibited terminators exhibited intermediate conservation (Figure 2-5c, d). The average Δ%T for all terminators containing a single U-tract interruption was highest when the non-U residue was at position 4 to 6

(Figure 2-5e). Together, these findings indicate that NusA-dependency is correlated with

! 69! ! ! ! ! ! ! ! ! ! ! ! 70! Fig 2-5. Terminator features contributing to stimulation by NusA. a, Diagram of an intrinsic terminator. Bases of the A-tract (–1 to –6), bottom of the stem (b1 to b5) and U-tract (1 to 9) are marked. b, Boxplot showing the total number of U residues in the U-tracts of different terminator classes. P-values were determined using Wilcoxon test with 95% confidence interval (* <0.05;

**<0.005; ***< 0.0005, also see table 2) c, d, Conservation of U residues in U-tracts of different terminator classes. e, Average Δ%T plotted as a function of the position of a single non-U base in the U-tract, error bars indicate SEM. f, Box plot of hairpin strength (ΔG, kcal mol-1) in different terminator classes (see table 5). The whiskers represent maximum and minimum ΔG values for each class. g, Scatterplot of 357 terminators with U at position 1-7 of the U-tract. Δ%T plotted as a function of ΔG. h, Average Δ%T plotted as a function of average ΔG for terminators described in e; , error bars indicate SEM. i, Probability of A at positions –7 to –1 of the A-tract. j,

Probability of G or C at positions b5-b1 of the stem. k, Probability of G or C at positions 10-24 of the downstream element. l, Probability of U at positions 10-24 of the downstream element. The top 50 terminators from the SI, WI, NS and ND classes were used, while 35 were used for NI in figures in panels b-d, f, i-l.

! 71! Table 2: Pairwise P-values for Figure 2-5 b

NS ND WI NI

SI 1.9 x10–7 1.5 x10–8 1.1 x10–9 5.2 x10–3 NS 9.4 x10–1 9.0 x10–2 5.8 x10–2

ND 3.0 x10–2 4.6 x10–2

WI 2.4 x10–3

!

Table 3: Pairwise P-values for Figure 2-5 f&

NS ND WI NI

SI 2.3 x10–3 9.0 x10–10 5.2 x10–3 1.6 x10–2 NS 3.0 x10–3 9.3 x10–1 8.5 x10–6 ND 1.1 x10–2 1.5 x10–10 WI 1.0 x10–5 !

* P-values were determined using Wilcoxon rank sum test with 95% confidence interval.

! 72! a relatively high conservation of U at the first position and a gradual reduction in conservation at positions 2-6, suggesting that occupation of these positions by other bases favors stimulation by

NusA.

We also investigated the relationship between Δ%T and the thermodynamic stability

(ΔG) of terminator hairpins and found that NusA-dependent terminators have the weakest hairpins (Figure 2-5f), suggesting that NusA compensates for weak hairpins by assisting with hairpin folding. To avoid bias associated with different U-tract variations, we examined the effect of ΔG on 357 terminators in which positions 1-7 were all U residues. An overall negative correlation (r = –0.34) was observed between ΔG of hairpins and Δ%T (Figure 2-5g, h), indicating that NusA stimulates terminators with weak hairpins.

As many terminators contain an A-tract upstream of the hairpin, we investigated whether they affect Δ%T. The finding that A-tracts are associated with strong NusA-independent terminators indicates that the A-tract contributes to basal terminator strength but not to Δ%T

(Figure 2-5i). An extended U-tract at positions 10 and 11 was also correlated with basal terminator strength, whereas the GC content of the stem (position b1-b5) and the downstream element (positions 10-24) was not (Figure 2-5j, k, l).

2.3.5 Weak terminators favor NusA-dependent termination

Our RNA-seq data indicated that NusA plays a vital role in the termination of weak non- canonical terminators, with the highest stimulation occurring at terminators containing a weak hairpin and/or distal U-tract interruptions. To test this model we performed a mutational analysis on the B. subtilis trp leader terminator (TtrpL) (Yakhnin and Babitzke, 2002). Whereas NusA resulted in a modest increase in termination at WT TtrpL in vitro, NusA greatly stimulated termination of each mutant terminator (Figure 2-6a). Lowering the ΔG with a hairpin mismatch,

! 73! ! ! ! Figure 2-6. Distal U-tract interruptions and weak hairpin stems favor NusA-dependent termination. a, Mutational analysis of B. subtilis trpL terminator and b, E. coli tR2 terminator.

These are representative gels of an experiment that was performed at least three times. c, NusA- inhibited terminators identified in vivo. This is a representative gel of an experiment that was performed twice. In a-c, single-round in vitro transcription termination assays were performed with B. subtilis RNAP and NusA (a, c) or E. coli RNAP or NusA (b). Termination efficiencies

(%T) and the effect of NusA (Δ%T) are shown for each terminator. Positions of terminated (T) and readthrough (RT) transcripts are marked. Molecular sizes of transcripts are shown on the right of each gel.

! 74! or the interruption of three distal U-tract residues, led to the highest degree of stimulation by

NusA (Δ%T), consistent with our in vivo RNA-seq data. Moreover, combining the mismatch with the U-tract mutations resulted in severe termination defects, with termination being entirely dependent on NusA. We also found that Escherichia coli NusA was capable of exerting a similar effect at weak non-canonical terminators in vitro. As previously observed (Gusarov and Nudler,

2001), NusA caused modest stimulation of the model λtR2 intrinsic terminator, whereas the mutant terminators were highly stimulated by NusA, irrespective of the position of the mutations

(Figure 2-6b). When taken together with our in vivo termination studies, these results suggest that weak non-canonical terminators are critical NusA substrates in both Gram+ and Gram– organisms.

2.3.6 Examination of NusA-inhibited terminators in vitro

Although NusA can inhibit termination via antitermination complex formation at rRNA operons (Vogel and Jensen, 1997), none of the NusA-inhibited terminators that we identified were located in rRNA leaders, suggesting alternative mechanisms of inhibition (Table 4). We therefore performed termination assays on four strongly inhibited terminators and found that all four terminators were actually stimulated by NusA in vitro (Figure 2-6c). These results indicate that the terminators themselves are not responsible for NusA-mediated inhibition, suggesting that inhibition at these terminators in vivo depends on the sequence context surrounding the terminator and/or other unidentified factors.

2.3.7 NusA depletion leads to global gene expression defects

Depletion of NusA resulted in a striking change of gene expression throughout the genome. A total of 926 genes (22%) were significantly upregulated and 730 (16%) were downregulated upon NusA depletion (p<0.05), with expression of 466 (11%) and 238 (5%) being upregulated or downregulated more than twofold, respectively. Expression of genes

! 75! ! !

Figure 2-7. NusA depletion alters expression of genes directly and indirectly. a, Overexpression of polC and ymaB as a direct consequence of readthrough of NusA-dependent terminators. b, Overexpression as a direct consequence of readthrough of NusA-stimulated

(hutHU) and strong NusA-independent (ytkC) terminators when preceded by highly expressed genes. c, Increased expression of antisense RNA by readthrough of a NusA-dependent terminator. d, Indirect NusA-mediated repression (frlBON) or activation (com). Intrinsic terminators are not present upstream of the frl and com operons. e, Possible indirect effect of NusA on transcription initiation. An activator of arginine metabolism, ahrC, is overexpressed by enhanced readthrough of a NusA-dependent terminator. Overexpressed AhrC then activates transcription of the rocABC and rocDE-argI operons. f, The general elongation factor NusG is controlled by an upstream

NusA-dependent terminator. In b, c, red bars indicate coverage is off scale.!

! 76! downstream of NusA-dependent terminators was directly affected by increased readthrough upon

NusA depletion (Figure 2-7a), while NusA-stimulated and NusA-independent terminators also had substantial effects on downstream gene expression when preceded by highly transcribed genes (Figure 2-7b). Furthermore, the absence of NusA resulted in increased antisense transcription at the junction of a number of convergent transcription units (Figure 2-7c); failure to terminate in the absence of NusA caused increased antisense transcription at ~33% of the 580 convergent junctions in the B. subtilis genome, with ~14% exhibiting changes of several fold.

Interestingly, several operons exhibited apparent changes at the level of transcription initiation, as they were not preceded by a NusA-responsive terminator. For example, expression of the frlBON operon was completely repressed by NusA, whereas expression of the comGA-GE operon was completely dependent on NusA (Figure 2-7d). Because NusA binds to elongating

RNA polymerase (RNAP) after initiation, this is probably an indirect outcome of the direct effect of NusA on activators or repressors. We identified at least one such example where the arginine activator/repressor protein AhrC was upregulated fourfold upon NusA depletion by readthrough of a NusA-dependent terminator. In a probable indirect effect, the rocABC and rocD-rocE-argI operons, both of which are activated by AhrC (Miller et al., 1997), were upregulated via increased (Figure 2-7e). Further studies are required to explain the wide alteration of promoter activities throughout the genome upon NusA depletion.

2.3.8 Misregulation of replication and DNA metabolism genes

The effect of NusA depletion was most prominent on readthrough of NusA-dependent terminators (Figure 2-8a), suggesting that regulation of downstream gene expression represents a general function of NusA-dependent terminators. Hence, we sought to determine whether NusA- dependent terminators regulate particular cellular processes by modulating readthrough. For this

! 77! ! ! ! ! Figure 2-8. Impact of NusA-dependent terminators on global gene expression. a, Heat map of readthrough transcription. Lines represent transcription units arranged by descending Δ%T.

Average coverage of 10 nt windows upstream and downstream of the POT (red arrowhead). b,

GO-term enrichment analysis of genes directly regulated by NusA-dependent terminators.

Enrichment scores above 1.3 are highly significant. c, Increased expression of replication and

DNA metabolism genes regulated by NusA-dependent termination.!

! 78! purpose, we considered genes that were upregulated at least twofold (p < 0.05) as a direct consequence of termination failure (Table 5). Gene ontology (GO) term analysis of these genes revealed high enrichment of terms related to DNA replication and DNA metabolism, and several other processes were affected to a lesser extent (Figure 2-8b). Highly affected replication and

DNA metabolism genes include polC (DNAP III α subunit), dnaB, dnaD, dnaI, and priA

(primosome), recG (DNA helicase), recN and radA (DNA repair), nth (endonuclease III), disA

(DNA integrity scanning protein), and smc (chromosome condensation and segregation). mRNA profiling showed that each of these genes were overexpressed several-fold in the absence of

NusA (Figure 2-8c), indicating that depletion of NusA causes misregulation of replication and

DNA metabolic pathways. Among the few regulatory factors that were affected, most notable was the RNAP pause-stimulating factor NusG (Yakhnin et al., 2008; Yakhnin and Babitzke,

2010), which was upregulated 2.5-fold as a direct consequence of termination failure (Figure 2-

7f).

2.3.8. Autoregulation of nusA expression

nusA is the second gene of the ylxS-nusA-ylxR-rplGA-infB-ylxP-rbfA operon driven by

A the σ -dependent PylxS promoter (Figure 2-9a). 3’ end-mapping identified two NusA-stimulated terminators (T1 and T2) in the 5' UTR of this operon, suggesting that the operon is regulated by transcription attenuation (Figure 2-9 a, b). The absence of overlapping antiterminator structures to block formation of either T1 or T2 suggested that NusA might control expression of the operon by modulating termination. Indeed, both T1 and T2 function as NusA-stimulated terminators in vitro and in vivo (Figure 2-9c, d).

We also examined the expression of chromosomally integrated PylxS-5'UTR-lacZ transcriptional fusions in which the 5'UTR contained T1 and/or T2, as well as a fusion in which both terminators were deleted. Depletion of NusA resulted in a sixfold increase in expression of

! 79! the fusion containing both terminators (Figure 2-9f, T1T2). Expression of fusions containing only

T1 or T2 indicated that T1 was the primary target of NusA-regulated termination (Figure 2-9f), consistent with the RNA-seq data (Figure 2-9d). In addition, expression of this operon is affected by termination at upstream NusA-dependent (TproS, Figure 2-7a) and NusA-stimulated (TpolC) terminators (Table 4). It is also apparent that NusA depletion indirectly caused an increase of transcription initiation at PylxS (Figure 2-9e). Together, these mechanisms constitute a complex autoregulatory circuit in which a homeostatic level of NusA is maintained in the cell.

! 80! ! ! Figure 2-9. Autoregulation of nusA expression. a, ylxS-nusA region showing positions of T1 and T2. b, NusA-stimulated terminators T1 and T2 with residues deviating from canonical intrinsic terminators in red. c, Single-round in vitro transcription termination assays showing the effect of NusA on termination at T1 and/or T2. Termination efficiencies (%T) are shown for T1 and T2. This is a representative gel of an experiment that was performed three times. d, Effect of

NusA on termination at T1 and/or T2 in vivo. Scales for normalized read counts differ by sevenfold, indicating that expression is much higher without NusA. e, NusA depletion causes increased transcription of the nusA operon via readthrough of upstream terminators and by increased transcription initiation at PylxS. Transcriptional readthrough of the upstream NusA- dependent (TproS) and NusA-stimulated terminators (TpolC) result in increased transcription into the nusA operon. There is also an indirect increase in transcription initiation at PylxS. Normalized coverage ± NusA is at the same scale. f, β-galactosidase activity (Miller units) of ylxS-lacZ transcriptional fusions containing T1 and/or T2. Strains were grown ± 30 µM IPTG to exponential phase. Error bars reflect the standard error of four independent experiments.

! 81! 2.3 Discussion

Depletion of NusA allowed us to assess the genome-wide effect of NusA on termination.

Although our results indicate that NusA causes a slight stimulation at the majority of intrinsic terminators, it also led to the striking discovery that a large number of weak non-canonical terminators depend on NusA for efficient termination in vivo, indicating that this class of terminator is not truly intrinsic.

E. coli NusA consists of an N-terminal RNAP-binding domain, three RNA-binding domains (S1, KH1, and KH2), and two C-terminal autoinhibitory domains (AR1 and AR2), whereas B. subtilis and archaeal NusA lack the AR domains (Mah et al., 2000; Worbs et al.,

2001; Yang et al.,2009). It is thought that NusA stimulates termination by assisting with hairpin folding and/or by slowing elongation of RNAP (Gusarov and Nudler, 2001; Ha et al., 2010;

Toulokhonov et al., 2001). Whereas the upstream U-tract residues are essential for initiation of

RNA:DNA hybrid melting, the downstream U residues are responsible for slowing elongation

(Gusarov and Nudler, 1999). Our studies showed that terminators with distal U-tract disruptions tend to be highly stimulated by NusA in vivo, suggesting that NusA is critical for slowing transcription within interrupted U-tracts. Our finding that weak NusA-independent terminators have the lowest conservation of U at positions 1 and 2 suggests that NusA does not readily compensate for the lack of U residues at these positions. It has also been suggested that NusA promotes hairpin folding, either directly by stabilizing the hairpins through contacts to duplex

RNA (Ha et al., 2010), or indirectly by eliminating inhibitory interactions between RNAP and the hairpin (Gusarov and Nudler, 2001). Our observation that terminators with weak hairpins (ΔG >

–10 kcal mol-1) tend to be NusA-dependent suggests that NusA directly assists with hairpin folding. Sequence features other than the hairpin and U-tract exerted little to no effect on NusA’s ability to enhance termination.

! 82! Our result also sheds light on the mechanism of intrinsic termination. We observed conservation of the A-tract for strong NusA-independent terminators (Figure 2-5 i). The A residues are able to establish additional A:U base pairs with the U-tract, increasing the length of the hairpin. This event may shear the weak dA:rU base pairs of the DNA:RNA hybrid and facilitate hybrid melting. Hence, it is possible that termination at this subclass of terminators is assisted by hybrid shearing as proposed in the RNA pullout model of termination.

Our RNA-seq studies also led to the surprising finding that NusA inhibits termination at

~5% of the intrinsic terminators in vivo, although inhibition was not observed with isolated terminators in vitro. Although it is not clear how NusA would inhibit these terminators, NusA may favor formation of antiterminator-like structures in nascent transcripts because NusA is known to alter co-transcriptional RNA folding pathways (Pan et al., 1999). The fact that 17/78

NusA-inhibited terminators are located in 5’UTRs is consistent with this possibility (Table 4).

Further studies are required to define the mechanism by which NusA inhibits termination at these terminators in vivo.

Our results also establish that NusA regulates global gene expression directly and indirectly by controlling transcription readthrough, particularly at NusA-dependent terminators.

NusA-dependent terminators directly regulate genes involved in replication and DNA metabolism, suggesting that the contribution of NusA to the maintenance of genome stability extends beyond its role in transcription-coupled DNA repair (Cohen et al., 2010). However, changes in gene expression cannot be attributed solely to NusA-dependent terminators, as NusA- stimulated and even NusA-independent terminators contribute to altered expression of downstream genes when preceded by highly expressed genes.

The substantial increase of antisense transcription observed at several converging transcriptional units following NusA depletion is reminiscent of transcription defects caused by

! 83! inhibition of Rho and NusG, which were reported to suppress pervasive antisense transcription in

B. subtilis and E. coli (Nicolas et al., 2012; Peters et al., 2012). Perhaps the concerted action of

Rho, NusG and NusA is required to minimize the synthesis of antisense transcripts, and inhibition of any of these components leads to increased antisense transcription. Further genomic studies involving NusA depletion in Rho and/or NusG knockout strains will be helpful in determining the individual and combined contributions of these factors in reducing pervasive transcription.

The role of NusA might become important during temperature fluctuations in the environment. Elevation of temperature might reduce the efficiency of termination across intrinsic terminators genome wide. While terminators with strong hairpins might not be affected by such small temperature fluctuations, it might affect termination efficiency at terminators with weak hairpins. NusA-dependent termination might rescue termination at these terminators in such conditions and prevent misregulation of gene expression.

We also identified a complex autoregulatory circuit involving NusA-stimulated termination and regulation of promoter activity to maintain tight control of nusA expression in B. subtilis (Figure 2-9). A previous bioinformatics study reported that the 5'UTR of nusA operons of sequenced bacterial genomes might contain a ubiquitous transcription attenuator (Naville and

Gautheret, 2010), although attenuation of the NusA operon had never been verified for any organism until now. Thus, the B. subtilis NusA autoregulatory circuit may be a highly conserved mechanism that operates in many bacterial species. This homeostatic control mechanism would minimize fluctuations of intracellular NusA levels in response to cellular or environmental changes. Quantification of RNAP and NusA in exponentially growing B. subtilis revealed a 1.6- fold excess of NusA, suggesting that there is sufficient NusA for most transcribing RNAPs to be bound (Davies and Dedman, 2005). Then what is the significance of NusA in modulating termination efficiency? The importance of NusA lies in the fact that many imperfect terminators

! 84! are not self-sufficient. In this respect, NusA increases the number of functional terminators in the genome and allows fine-tuning of gene expression. Therefore, NusA probably relaxes the selective pressure on intrinsic terminators to maintain a canonical-like structure.

2.4 Materials and Methods

2.4.1 Library preparation

Six independent replicates of the NusA depletion strain (PLBS802) were grown in minimal-ACH medium supplemented with 12.5 µg ml-1 tetracycline ± 30 µM IPTG and RNA was isolated using the RNeasy kit (Qiagen) as described previously (Yakhnin et al., 2011). Ten µg of

RNA from each sample were dephosphorylated with calf intestinal alkaline phosphatase (New

England Biolabs) and RNA was recovered by phenol-chloroform extraction/ethanol precipitation.

Five µg of dephosphorylated RNA from each sample were subjected to rRNA depletion using the

Ribo-Zero rRNA Removal Kit for Gram-Positive Bacteria according to the manufacturer’s instructions (Epicenter). To ligate the 3’ RNA oligo (5’P-CAGUCAGUACGAUCGCUAGUC- ddC3’) to the RNA, 0.5 µg of RNA from each sample were incubated with 150 pmol oligo in 20

µl reactions containing RNA ligase buffer, 20% PEG-8000, and 20 U T4 RNA ligase 1 (New

England Biolabs) at 16°C for 16 hr. The ligated RNA was subsequently purified using RNeasy columns (Qiagen) and examined with a Bioanalyzer (Agilent). Differentially barcoded libraries were generated using the TruSeq stranded mRNA library kit (Illumina) according to the manufacturer’s instructions, except that the polyA selection step was omitted. The barcoded libraries were examined with a bioanalyzer and qPCR for size and concentration. Equal amounts of the libraries were pooled and subsequently sequenced on one lane of the Illumina HiSeq 2500 in Rapid Run mode using 100 x 100 paired end sequencing.

! 85! 2.4.2 Data analysis

Illumina sequencing generated ~120 million reads for 12 samples (6 biological replicates for –NusA and +NusA each). The reads were parsed into separate samples based on barcode (~10 million paired-end reads per sample) and the illumina adaptors were trimmed using the trimmomatic tool (Bolger et al., 2014). A subset of the dataset consisted of the reads with the unique oligo sequence ligated to their 3’ ends, thus preserving the native 3’ ends. Such reads were extracted and the oligo sequence was removed using the discard-untrimmed option of the cutadapt program (Martin M., 2011). Thus, two clean data sets were obtained; one with all reads for standard RNA-seq (whole), and the other with just the reads that had the oligo sequence

(oligo-only) for 3’ end-mapping. Both whole and oligo-only data sets were mapped separately to the reference genome (Bacillus subtilis str.168, NC_000964.3, downloaded from NCBI) using the

Burrows-Wheeler Aligner (BWA) short read aligner (Li and Durbin, 2009). Next, the 6 samples from each category (+IPTG and –IPTG) were separately merged together using SAMTools (Li

H., 2010) and genome coverage graphs for the merged samples were generated using BEDTools

(Quinlan and Hall, 2010). To make coverage values comparable across samples, the read counts at each position were normalized to library size by dividing them by the total number of mapped reads (~104x106 reads for +IPTG, ~109x106 reads for –IPTG) from the merged whole mapping dataset. Visualization of the mapping was performed using Integrative Genomics Viewer (IGV,

Broad Institute). Reads that were mapped to the forward strand and reverse strands were separated using SAMTools. The strand-specific mapping files were used for all subsequent analyses. RNA-seq data was deposited in GEO (accession number GSE67058).

! 86! 2.4.2.1 Identification of 3’ ends

The oligo-only mapping datasets were used to identify the native 3’ end positions. For each position in the genome, the coverage variation (CV) at that position was calculated as the difference of the average coverage of the 15 nt upstream (CU) and the 15 nt downstream (CD) relative to that position (CV = CU – CD). Hence, the read coverage of the oligo-only dataset was transformed into a coverage variation dataset where every genomic location is characterized by change of read abundance around that location (CV). In this transformed dataset, a large negative

CV corresponds to an increase in read abundance whereas a large positive CV corresponds to a decrease of read abundance. We only processed locations with positive CV values because our objective was to identify the 3’ ends of the transcripts. Since locations with relatively high positive coverage variation (CV) indicate sites of oligo-ligation, we performed peak detection to identify these sites. The heights of the peaks, described as peakheight hereafter, directly correspond to the coverage change that is present at the coordinate of the peak center. A step-size of >3 was used to calculate the local maxima that precisely identified the ligation sites (native 3’ ends). The positions of the peaks in the +IPTG and –IPTG conditions were highly similar; in

>99% of the cases the peak position was found to be within a window of ±3 nt. Peak positions that were not present within 5 nt in both +IPTG and –IPTG samples were considered nonspecific and removed. This method identified 14,455 peaks (7756 in the forward and 6699 in the reverse strand). To further reduce noise, we only considered peaks with peakheight higher than 10, resulting in 5332 considered peaks (2931 in the forward and 2401 in the reverse strand).

2.4.2.2 Terminator screening and characterization

The peakheight reflects the relative abundance of the 3’ ends that are dependent on expression of the transcript and the efficiency of the mechanism by which the 3' end is generated.

A peak with a high peakheight value indicates a highly abundant 3’ end. In bacteria, abundant 3’

! 87! ends can be generated by transcription termination, RNA processing, or via stabilization of RNA degradation intermediates, while the peakheight is directly related to the efficiency of these mechanisms. 3’ ends can also be generated by abortive transcription, transcriptional arrest or by mechanical shearing during the process of RNA isolation. We initially screened the peaks using

FindTerm (SoftBerry) (Solovyev and Salamov, 2011) using a modified configuration file to find intrinsic terminators. Several of the peaks were crosschecked visually using Mfold (Zuker, M.,

2003) and RNAfold (Bellaousov et al., 2013) to confirm the presence of a terminator.

2.4.2.3 Calculation of termination efficiency

To characterize the global effect of NusA on intrinsic terminators, we excluded peaks with a peakheight below 30 (transcripts with low abundance and/or terminators with very low efficiency) to avoid analyzing termination efficiencies with low statistical significance. We thus considered a total of 1492 terminators with a U-tract containing at least 3 U residues within the first 9 nt following a hairpin, of which 726 were from the forward strand and 766 from the reverse strand. In many cases, the 3' end occurred within a 2-3 nt window rather than at a fixed position. In such cases, the nucleotide at which maximum ligation occurred was considered as the point of termination (POT), although exonucleolytic trimming of the U-tracts following termination likely contributed to the 2-3 nt window in some cases. Termination efficiencies were determined for the standard RNA-seq merged datasets and for individual datasets (to determine the statistical significance), using an algorithm to compare the number of terminated versus readthrough reads at each POT. The average number of reads in 10 nt windows were calculated both upstream and downstream of the POT. Three nt on both sides of the POT were excluded from this calculation to eliminate the impact of the 2-3 nt window described above. Percent termination (%T) was calculated using the equation:

! 88! $ − & %" = '('100 $ where, T is termination efficiency, U is the average number of reads in a 10 nt window upstream of the POT and D is the average number of reads in a 10 nt window downstream of the POT.

Negative %T values were obtained for 19 terminators in which an overlapping promoter was present such that the transcription start site was within 14 nt of the POT, causing interference with the calculation. Such terminators were ignored for assessment of the effect of NusA on termination.

2.4.2.4 Differential expression and GO-term analysis

The expression levels of genes were measured and differentially expressed genes were identified using a combination of the EDGE-pro and DESeq programs. EDGE-pro (Magoc et al.,

2013) is designed to quantify the gene expression explicitly in . All trimmed reads were mapped to the reference genome using EDGE-pro in the paired-end mode. The output was converted to a format usable in DESeq (Anders and Huber, 2010) by using the edgeToDeseq.pl script included in the EDGE-pro package. DESeq is an R package designed to calculate the statistical significance of expression differences measured in RNA-seq data based on a negative binomial distribution. In this method, raw p-values are adjusted (p-adj) for multiple testing using the Benjamini-Hochberg method (Benjamini and Hochberg, 1995), which controls the false discovery rate. The read counts that were mapped to each gene in each sample were used as

DESeq input. The top differentially expressed (twofold or more, p-adj < 0.05) genes were inspected manually in IGV to identify the mechanism by which it is differentially expressed.

Genes that are regulated directly by NusA-dependent termination were analyzed using the

DAVID (Database for Annotation, Visualization and Integrated Discovery, v6.7) program for

GO-term enrichment using default settings (medium stringency). Enrichment scores above 1.3 are considered highly significant (Huang et al., 2009a; Huang et al., 2009b). ! 89! 2.4.3 Primer extension

PLBS802 was grown at 37°C in LB with 100 µM IPTG and 12.5 µg ml-1 tetracycline.

Cells were harvested in exponential phase, washed and resuspended in LB lacking IPTG, and growth was resumed. Cells were harvested at various times and RNA was isolated as described

(Yakhnin et al., 2011). Primer extension using a 32P end-labeled primer (5’-

GAGAGCATCTAATAATTCACTGC-3’) was performed as described (Yakhnin et al., 2011).

2.4.4 Western blot

PLBS802 was grown at 37°C in minimal-ACH medium with 12.5 µg ml-1 tetracycline and 0-100 µM IPTG and harvested in exponential phase. Protein samples (1 µg) were fractionated in a 12% SDS gel and transferred to a 0.2 µm nitrocellulose membrane. Purified his-tagged

NusA, σA and cell lysates were probed with rabbit anti-NusA or anti-σA antibodies (1:5,000 dilution) and developed using enhanced chemiluminescence following incubation with HRP- conjugated goat anti-rabbit antibody (GenScript).

2.4.5 DNA templates, plasmids and proteins

The B. subtilis trp 5'UTR was used for testing the effect of NusA on WT and mutant trp leader terminators (TtrpL). All other terminators were cloned in a plasmid from which DNA templates were amplified by PCR. Templates of λtR2 and naturally occurring B. subtilis terminators contained the common sequence

5’GTCATTGACAAAAATACTGAATTGTGTTATAATAAGAACAGGTTAGAAATACACA

AGAGTGTGTATAAAGCAATCTGCAGCGCCGGGATCCGAAAGGATCTGCGCTGAAAC

TATtgccgcgcatgtcgcggcattgttttcatggaagacgaaTATATAGTATTTTATCCTCTCATGTCATCTTC

TCATTCTCC3’ (the -35 and -10 regions of the promoter are underlined) except that the terminator sequences (lowercase font) were different. Templates for λtR2 mutants were generated

! 90! by PCR amplification using primers that introduced the mutation. The ylxS-leader T1T2 construct contained the two terminators in tandem. B. subtilis His-tagged RNAP (Yakhnin et al., 2006),

His-tagged NusA (Yakhnin and Babitzke, 2002) and TRAP (Yakhnin and Babitzke, 2000) proteins were purified as described previously. E. coli NusA was provided by Catherine Squires and E. coli RNAP holoenzyme was obtained from Epicenter. Anti NusA and σA antibodies were provided by Peter Lewis and Masaya Fujita, respectively.

2.4.6 In vitro termination

Single-round in vitro transcription reactions and data analysis of WT and mutant TtrpL terminators were performed as described (Yakhnin and Babitzke, 2002; Yakhnin and Babitzke,

2010). For other B. subtilis terminators, 12-nt halted transcription elongation complexes were formed by withholding CTP. Elongation was resumed by the addition of all four NTPs together with heparin ± 1 µM NusA in buffer containing 100 mM KCl. Similar reactions were performed with WT and mutant λtR2 terminators, except that E. coli RNAP and NusA were used.

Electrophoresis and quantification of radiolabeled transcripts followed published procedures

(Yakhnin and Babitzke, 2002).

2.4.5 β-galactosidase assay

Derivatives of B. subtilis PLBS802 containing PylxS-5'UTR-lacZ transcriptional fusions integrated into the thrC locus were grown at 37°C in minimal-ACH medium with 12.5 µg ml-1 tetracycline ± 30 µM IPTG. Cells were grown to exponential phase and β-galactosidase activity was determined as described (Du and Babitzke, 1998).

! 91! 2.5 References

Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome Biol.

11, R106 (2010).

Bellaousov, S., Reuter, J. S., Seetin, M. G. & Mathews, D. H. RNAstructure: Web servers for

RNA Secondary Structure Prediction and Analysis. Nucleic Acids Res. 41, W471–W474 (2013).

Benjamini, Y. & Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful

Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Stat. Methodol. 57, 289–300 (1995).

Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: A flexible trimmer for Illumina Sequence

Data. Bioinformatics 30, 2114–2120 (2014).

Cardinale, C. J. et al. Termination factor Rho and its cofactors NusA and NusG silence foreign

DNA in E. coli. Science 320, 935–938 (2008).

Cohen, S. E. et al. Roles for the transcription elongation factor NusA in both DNA repair and damage tolerance pathways in Escherichia coli. Proc. Natl. Acad. Sci. USA 107, 15517–15522

(2010).

Davies, K. M., Dedman, A. J., van Horck, S. & Lewis, P. J. The NusA:RNA polymerase ratio is increased at sites of rRNA synthesis in Bacillus subtilis. Mol. Microbiol. 57, 366–379 (2005).

Du, H. & Babitzke, P. trp RNA-binding attenuation protein-mediated long distance RNA refolding regulates translation of trpE in Bacillus subtilis. J. Biol. Chem. 273, 20494–20503

(1998).

! 92! Farnham, P. J., Greenblatt, J. & Platt, T. Effects of NusA protein on transcription termination in the tryptophan operon of Escherichia coli. Cell 29, 945-951 (1982).

Gusarov, I. & Nudler, E. The mechanism of intrinsic transcription termination. Mol. Cell 3, 495–

504 (1999).

Gusarov, I. & Nudler, E. Control of intrinsic transcription termination by N and NusA: the basic mechanisms. Cell 107, 437–449 (2001).

Ha, K. S., Toulokhonov, I., Vassylyev, D. G. & Landick, R. The NusA N-terminal domain is necessary and sufficient for enhancement of transcriptional pausing via interaction with the RNA exit channel of RNA polymerase. J. Mol. Biol. 401, 708–725 (2010).

Huang, D. W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID Bioinformatics Resources. Nature Protoc. 4, 44–57 (2009).

Huang, D. W., Sherman, B. T. & Lempicki, R. A. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 37, 1–13 (2009).

Ingham, C. J., Dennis, J. & Furneaux, P. A. Autogenous regulation of transcription termination factor Rho and the requirement for Nus factors in Bacillus subtilis. Mol. Microbiol. 31, 651–663

(1999).

Komissarova, N., Becker, J., Solter, S., Kireeva, M. & Kashlev, M. Shortening of RNA:DNA hybrid in the elongation complex of RNA polymerase is a prerequisite for transcription termination. Mol. Cell 10, 1151–1162 (2002).

Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler Transform.

Bioinformatics 25, 1754–1760 (2009).

! 93! Li, H. et al. The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics 25,

2078–2079 (2009).

Magoc, T., Wood, D. & Salzberg, S. L. EDGE-pro: Estimated Degree of Gene Expression in

Prokaryotic Genomes. Evol. Bioinform. Online 9, 127–136 (2013).

Mah, T. F., Kuznedelov, K., Mushegian, A., Severinov, K. & Greenblatt, J. The alpha subunit of

E. coli RNA polymerase activates RNA binding by NusA. Genes Dev. 14, 2664–2675 (2000).

Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet

Journal 17, 10–12 (2011).

Miller, C. M., Baumberg, S. & Stockley, P. G. Operator interactions by the Bacillus subtilis arginine repressor/activator, AhrC: novel positioning and DNA-mediated assembly of a transcriptional activator at catabolic sites. Mol. Microbiol. 26, 37–48 (1997).

Mitra, A., Angamuthu, K., Jayashree, H. V. & Nagaraja, V. Occurrence, divergence and evolution of intrinsic terminators across eubacteria. Genomics 94, 110-116 (2009).

Naville, M. & Gautheret, D. Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation. Genome Biol. 11, R97 (2010).

Nicolas, P. et al. Condition-dependent transcriptome reveals high-level regulatory architecture in

Bacillus subtilis. Science 335, 1103-1106 (2012).

Pan, T., Artsimovitch, I., Fang, X. W., Landick, R. & Sosnick, T. R. Folding of a large ribozyme during transcription and the effect of the elongation factor NusA. Proc. Natl. Acad. Sci. USA 96,

9545–9550 (1999).

! 94! Peters, J. M., Vangeloff, A. D. & Landick, R. Bacterial transcription terminators: the RNA 3’-end chronicles. J. Mol. Biol. 412, 793–813 (2011).

Potter, K. D., Merlino, N. M., Jacobs, T. & Gollnick, P. TRAP binding to the Bacillus subtilis trp leader region RNA causes efficient transcription termination at a weak intrinsic terminator.

Nucleic Acids Res. 39, 2092–2102 (2011).

Peters, J. M., et al. Rho and NusG suppress pervasive antisense transcription in Escherichia coli.

Genes Dev. 26, 2621-2633 (2012).

Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).

Schmidt, M. C. & Chamberlin, M. J. nusA protein of Escherichia coli is an efficient transcription termination factor for certain terminator sites. J. Mol. Biol. 195, 809-818 (1987).

Solovyev, V. & Salamov, A. Automatic Annotation of Microbial Genomes and Metagenomic

Sequences. Metagenomics and its Applications in Agriculture, Biomedicine and Environmental

Studies, ed Li, R. W., pp. 61–78 (Nova Science Publishers , 2011).

Toulokhonov, I., Artsimovitch, I. & Landick, R. Allosteric control of RNA polymerase by a site that contacts nascent RNA hairpins. Science 292, 730-733 (2001).

Vogel, U. & Jensen, K. F. NusA is required for ribosomal antitermination and for modulation of the transcription elongation rate of both antiterminated RNA and mRNA. J. Biol. Chem. 272,

12265–12271 (1997).

Wilson, K. S. & von Hippel, P. H. Transcription termination at intrinsic terminators: the role of the RNA hairpin. Proc. Natl. Acad. Sci. USA 92, 8793-8797 (1995).

! 95! Worbs, M., Bourenkov, G. P., Bartunik, H. D., Huber, R. & Wahl, M. C. An extended RNA binding surface through arrayed S1 and KH domains in transcription factor NusA. Mol Cell 7,

1177–1189 (2001).

Yakhnin, A. V. & Babitzke, P. NusA-stimulated RNA polymerase pausing and termination participates in the Bacillus subtilis trp operon attenuation mechanism in vitro. Proc. Natl. Acad.

Sci. USA 99, 11067–11072 (2002).

Yakhnin, A. V. & Babitzke, P. Mechanism of NusG-stimulated pausing, hairpin-dependent pause site selection and intrinsic termination at overlapping pause and termination sites in the Bacillus subtilis trp leader. Mol. Microbiol. 76, 690–705 (2010).

Yakhnin, A. V., Trimble, J. J., Chiaro, C. R. & Babitzke, P. Effects of mutations in the L- tryptophan binding pocket of the trp RNA-binding attenuation protein of Bacillus subtilis. J. Biol.

Chem. 275, 4519-4524 (2000).

Yakhnin, A. V., Yakhnin, H. & Babitzke, P. Function of the Bacillus subtilis transcription elongation factor NusG in hairpin-dependent RNA polymerase pausing in the trp leader. Proc.

Natl. Acad. Sci. USA 105, 16131–16136 (2008).

Yakhnin, A. V., Yakhnin, H. & Babitzke, P. RNA polymerase pausing regulates translation initiation by providing additional time for TRAP–RNA interaction. Mol. Cell 24, 547–557

(2006).

Yakhnin, H. et al. Complex regulation of the global regulatory gene csrA: CsrA-mediated translational repression, transcription from five promoters by Eσ70 and EσS, and indirect transcriptional activation by CsrA. Mol. Microbiol. 81, 689–704 (2011).

! 96! Yang X. et al. (2009). The structure of bacterial RNA polymerase in complex with the essential transcription elongation factor NusA. EMBO Rep. 10, 997-1002 (2009).

Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids

Res. 31, 3406–3415 (2003).!

! 97! Table 4. Terminators identified by 3’ end-mapping and the effect of NusA depletion. The point of termination (POT) indicates the chromosomal coordinate at which maximum termination occurred, while the strand of origin is shown as + (forward) or – (reverse). The distance between the terminator 3’ end and the nearest upstream coding sequence is indicated in column 3. %T+NusA and %T–NusA indicate the calculated termination efficiencies ± NusA, while Δ%T indicates the difference in termination efficiencies (%T+ NusA – %T–NusA). p-values were calculated from six biological replicates from a two-tailed t-test. Sequences upstream of the POT (50 nt except for unusually long terminators) are shown where the predicted terminator hairpins are underlined and the U-tracts are in bold. The free energy of each predicted hairpin (ΔG, kcal mol-1) is indicated in column 10. Hairpin mismatches and bulges are shown in column 11. For example, 1x1 indicates a single base-pair mismatch and 0x1 indicates a 1 nt bulge on the 3' side of the hairpin.

Table 5. Genes that are differentially expressed twofold or more (p-adj < 0.05) upon NusA depletion. baseMean(+NusA) and baseMean(–NusA) indicate mean normalized counts from

+NusA and –NusA conditions, respectively. log2FoldChange indicates the logarithm (to basis 2) of the fold change. Genes that are differentially expressed directly as a consequence of termination failure at NusA-dependent terminators are marked with an asterisk (*). Only these genes were used for the GO-term analysis in Figure 6B.

! 98! Table 4. Terminators identified by 3’ end-mapping and the effect of NusA depletion.

POT$ Str$ Relative$position$ %T$(+)$ %T$(–)$ Δ%T$ p8value$ Terminator$sequence$ ΔG$$ Mismatch$ 1839% +% dnaA+89nt% 71.26% 25.51% 45.75% 4.80E406% UCGGAAGUCAUACACAGUCUGUCCACAUGUGGAUAGGCUGUGUUUCCUGU 420.7% 4% 3113% +% dnaN+38nt% 81.23% 38.34% 42.89% 2.20E406% AGAACCUAUUAAUCCGAUACACUGCUGCCGACCCGUCGGCAGCUUUUCUA 415% 4% 6827% +% gyrB+44nt% 86.22% 59.70% 26.52% 3.40E403% AUCUAAUCAUAAAAAGCCUUAUUUCCAAUAAGAAAUAAGGCUUUUUUCUG 411.9% 4% 9494% +% gyrA+35nt% 99.10% 99.21% 40.11% 5.70E401% CAAGAAGAAGUGUGAAAAAAAGCGCAGCUGAAAUAGCUGCGCUUUUUUGU 413.7% 4% 17435% +% guaB+54nt% 99.13% 96.51% 2.62% 2.30E403% UUGUUACAAAUUAAAAACAUUUGACAGGGUCUCUGACUCUGUCUAUUUUU 411.3% 4% 18910% +% dacA+45% 50.04% 26.58% 23.46% 4.20E404% UUUAAUCAAUUGAAAGAGCUCUGAUGGAUGUUAGGGCUCUUUCGCGUAAU 412.4% 4% 20845% +% yaaE+287nt% 89.88% 95.00% 45.12% 1.10E402% UGGCAACGCGAGAGCUCUCGUCCCUUUAUGGGGAUGAGGGCUCUUUUUAU 425.1% 4% 22197% +% serS+40nt% 99.25% 94.89% 4.36% 1.10E402% GAAACCGUAAAUUAUGGAAAGGCGUGCCUGACAAGGUGCGCCUUUUUGCU 415.2% 4% 22464% +% trnSL4Ser1+80nt% 98.62% 91.35% 7.27% 4.60E405% AUAUAUUGGAGAUUGUUUUGUCCGUUGCAUUCGGUGCGGCGGAUUUUUUA 412.7% 4% 22470% 4% dck+26nt% 84.35% 65.28% 19.07% 7.46E401% AUUCAUGAUAAUCAAAAAAAGUGAAUCUCAGUCGAGAUUCACUUUUUCUU 411.5% 4% 22508% +% trnSL4Ser1+124nt% 62.79% 76.73% 413.94% 1.10E401% UUUUUAUUUUAAAGAAAAAGUGAAUCUCGACUGAGAUUCACUUUUUUUGA 411.1% 4% 26735% +% scr+100nt% 97.74% 87.44% 10.30% 2.70E404% AAAUCAAUCAUCAAAUUUUCAGACUCACCUAAUAUUAGGUGAGUUUUUUG 410.2% 4% 28959% +% yaaK+107nt% 65.06% 46.29% 18.77% 2.30E403% UGAAAUUGCCAGGGAUCGGACCGAAAACAGCGGUUCGUCUGGCUUUUUUU 417.2% 3x0% 42896% +% yabA+38nt% 82.98% 41.94% 41.04% 7.30E405% AAUAAAAAAUAGGGAAAAGGCUUCCGCAUAAGACGGGAGCCUUUUUCAAA 412.5% 4% 44796% 4% abrB+52nt% 99.84% 98.99% 0.85% 3.15E403% AUUUCUUGUACAAAAAACGUUCUUGUUAUGACACAAGAACGUUUUUUUAU 49.9% 4% 44837% +% yabC+38nt% 85.39% 46.10% 39.29% 6.90E403% AUUAAGCAAUAAAAAAACGUUCUUGUGUCAUAACAAGAACGUUUUUUGUA 411.2% 4% 47679% +% metS+52% 81.62% 0.72% 80.90% 3.20E409% AUAAACAAAAGGUGUUUCACGUGUAACAAUUCGUCGAACACCUUUUGUGU 410.1% 1x1,%1x1% 49987% +% yabE+45nt% 97.14% 80.92% 16.22% 8.20E406% AUUAGUAUAUACUUAUGUAUUCAGAGGGUUUUGCGCCCUCUGUUUUUUUC 412.3% 4% 51532% +% ksgA+14nt% 93.86% 84.57% 9.29% 6.40E403% GCGCUGUCUAACGGAUUGUAUAAAGCCCUUUUCUAAAAGGGCUUUUUGUU 48.6% 4% 53057% +% veg+34nt% 94.48% 90.29% 4.19% 9.50E403% CUCAGUGGCAUUUUAACGGGCAGUGAACCUUUUGUUUACUGCUUUUUGUU 410.4% 4% 53408% +% sspF+40nt% 90.75% 90.53% 0.22% 6.80E401% UAACCGAUAAGGAUGUGACCCGGGGGACGUGCUGUUCCCUGGUUUUUUUA 413.9% 4% 55713% +% yabJ+41nt% 96.44% 80.39% 16.05% 4.20E408% GUGAAAUAAUAAGAAAAGUGAUUCUGGGAGAGCCGGGAUCACUUUUUUAU 413.2% 4% 56227% +% spoVG+68nt% 99.82% 99.14% 0.68% 2.40E403% GGACUGCUGAAAGGGCUGACAUAAGCCUUUUGCCGGCGGUCCUUUUUUAA 424.3% 0x2% 59438% +% ctc+41nt% 87.23% 58.31% 28.92% 2.90E407% GAACAAUAAUAGCUUAAGGCGUAACCCUCCCGCGGUUACGUCUUUUGUGC 411.3% 4% 60398% +% yabK+38nt% 29.02% 11.20% 17.82% 5.60E402% UUUAUUCAAUAAAAAGCUUUGGUGUAGACACUAGACCAAAGCGUUUUUCU 413% 4% 64703% +% spoVT+68nt% 96.25% 37.61% 58.64% 3.70E406% AAAAUAGGUAUGUAAAGAACAGCUCUCCUUGGGACGCUGUUCUUUUUCAU 412% 0x1% 70071% +% yabR+59nt% 96.38% 93.65% 2.73% 1.90E402% UUCUAUAAAAUAAAUGAAGCAUCCGUUCAUCCCGACGGAUGCUUUUUUAU 412.9% 4% 70380% +% trnSL4Glu1+42nt% 99.21% 98.50% 0.71% 2.00E402% ACGGGUCAUCCUAACAAAUCGGUUUCUCUUGCAGAAGCCGAUUUUUUUCA 49.8% 4% 74065% +% yabS+222nt% 76.60% 56.00% 20.60% 1.30E402% UUGAAAUCUUUCUCAAAGGCCCAGUCCGUUACGAUGGGGCCUUCUUUUUU 411.5% 1x1% 78946% +% ftsH+49nt% 98.73% 94.77% 3.96% 6.40E403% AUUCGCUUUCUUUCUAAAAAAACUGCCGGCUGACGCUGGCAGUUUUUUUA 413.6% 4% 80776% +% hslO+21nt% 77.12% 82.77% 45.65% 1.70E401% AAGGGCUUCGUGACCAAACUACCCGCUAAGCUCUUUAGCGGGUUUUUAAU 411.1% 4% 82735% +% cysK+38nt% 99.39% 98.08% 1.31% 1.50E402% CAAUUCGAUUAAAAAAAGCCAAAACUCCCGGUUCGCCGGGAGUUUUUUUA 413.4% 4% 84935% +% pabA+61nt% 32.81% 5.75% 27.06% 7.60E405% AACGGCCGGUAUAUGGAGGAGAAAGAUGCAGUUCUUUCUCCUUUUGACCA 412.2% 4% 87572% +% folK+123nt% 19.97% 8.98% 10.99% 7.30E403% AAACCGAUUGCCGUCUGCUGCCAUCAUUCAAGAUGCAGCAGAUGUUUUAA 418.3% 1x0% 90275% +% lysS+49nt% 96.34% 97.33% 40.99% 3.30E401% AUAAAAAAGAGCGGUAUCCUCCAUAGGGAAAGGAUGCCGCUCUUUUUAAA 422.1% 0x2% 106057% +% clpC+53nt% 85.60% 43.66% 41.94% 3.40E407% AGAAGACGGAAAUGAGGCAUACAGCAUGUAAGUGUAUGCCUCACUUUCAU 417.2% 4% 110285% +% yacL+511nt% 62.96% 30.07% 32.89% 1.00E406% AUUGAACGUUCAAGCUUGUGGGCUGUCCAAACGCCACAAGCUUUUCGUCU 411.1% 1x0,%1x0% 112759% +% gltX+261nt% 82.18% 85.80% 43.62% 7.00E402% GCGCGGUUAAAGCGUCUCUGUCAUGUUUACAUGCAGAGACGCUUUUUUUA 420.3% 1x0% 117779% +% secE+68nt% 59.35% 22.61% 36.74% 2.60E403% AUAAUAGAUCAUAAUAUUACUUGCCAAAACCCGUUCAGCGGGUUUUUUAU 45.6% 4% 119065% +% rplK+49% 16.87% 4.90% 11.97% 6.00E405% AUUUGUUUCUUGUCGGGUUGCGAGUUUUAACAAGUUCGCAACCCUUAUUC 415.5% 4% 119987% +% rplA+178nt% 25.32% 25.69% 40.37% 8.90E401% GUUACGUAUGCUUGUAUAUACAGCCUCCAUGUCUCAUGGAGGCUUUUUAU 414.1% 4%

! 99! 121030% +% rplL+52nt% 97.53% 95.03% 2.50% 9.70E406% UUCACUUACCUGUAGGGGAAGCUCGCUUUUAUGAGGCGAGCUUUUUCUUU 411.5% 4% 129213% +% rpoC+52nt% 57.85% 44.95% 12.90% 4.30E402% GAUUUAACUCUGCUGAAAGACUGCAAAAACAGUCUUUCAGCAGAUAUAUU 424.5% 4% 134114% +% tufA+42nt% 99.88% 99.57% 0.31% 1.50E405% CUGAGUAAUAGUAUGGUUUUAAACGAGACCCCUGUGGGUCUCGUUUUUUG 413.3% 4% 145854% +% secY+32nt% 12.41% 15.67% 43.26% 2.70E402% GGAUUUAUGAAAAACUAGAGGAAAUGGAUUUAUCCAUUCCCUCUUAAUAA 46.7% 1x1% 154740% +% rpsI+48nt% 94.70% 88.13% 6.57% 1.20E403% AAUUUUACGUUUUCAAAAAGCUCUCGACCUUGGGUUGGGAGCUUUUUUCU 414% 4% 155957% +% ybaJ+34nt% 69.18% 40.59% 28.59% 2.60E402% AAGCGUGAAAGUAUGAAAAGCAGCGACCUGUUAGAGGGGCUGCUUUUUUC 410.7% 2x1% 158520% +% salA+41nt% 55.85% 63.68% 47.83% 5.60E402% CAGGUAUAAAAGGUGAACCGGGAUUCCAGAUCCCGGCUUUCCCUUUAUUC 414.4% 0x2,%1x0% 178559% +% ybaR+40nt% 91.26% 81.10% 10.16% 5.10E401% GAUGGCAUAAAAUAGAGAAGCCCAGAUGAAUGAGAUCUGGGCUUUUUUAU 412.5% 4% 179582% 4% ybbA+13nt% 93.81% 93.60% 0.21% 6.77E401% CGAAUGGCUAUACGGAAAAAACCGCUCAACCCUAUGAGCGGUUUUUUUAU 410.6% 4% 179619% +% ybaS+34nt% 90.54% 65.26% 25.28% 1.70E404% GUUGCAGAAGGCAUAAAAAAACCGCUCAUAGGGUUGAGCGGUUUUUUCCG 411.4% 4% 182128% 4% feuA+242nt% 39.18% 25.23% 13.95% 1.58E403% CGGAUUCCAAGGGCUGCCGGCGCUCUGCUCAUAGGGGCAGCCCUUGCUGU 417% 0x6% 194653% +% trnSL4Gln2+32nt% 99.34% 97.69% 1.65% 1.90E402% AUCCAGCUAGCCCAGUCACAGACACCUUUGAUCAAAAGGUGUCUUUUUUC 411.9% 4% 196080% +% rsiW+28nt% 96.65% 93.51% 3.14% 3.10E404% CAAUCCGAACGGAGAAGAGUAAAGCGCGUUAGCCGCUUUGCUCUUUUUUU 413.9% 0x1% 202126% +% glmS+47nt% 99.79% 98.73% 1.06% 3.90E404% UAAUAAAUGUUUAACCCCUUUGGAUAAGAUUAUCUAAAGGGGUGUUUUUA 416.4% 4% GCCGACAAUUUUCAGGAUUCAAUGAUCUAACAUAAUCAUUGAAAUUUUGAAGUUGUC 205300% +% adaB+410nt% 99.24% 99.76% 40.52% 1.90E401% GGCUUUUUUG 427.6% 0x1,%1x0% 211158% +% ybcI+212nt% 69.12% 85.71% 416.59% 6.70E401% CCUGUCGAAAGAUCUAACAUCCGCUGUUGUUAUGAGCGGAUGUUUUUUUA 411.1% 4% 211762% +% ybzH+31nt% 98.29% 99.79% 41.50% 1.50E401% UCUUAAAACAGAGAUAUAAAAAUAAACAUCAAAAGAUGUUUAUUUUUACA 46.3% 4% 214159% +% skfA+51nt% 67.52% 70.60% 43.08% 2.70E401% AUUUGAGAAUAGGGAGUUGAGCGUAUUUGCUUAUACUCCUUAUUUUCUCU 415.3% 0x1% 223221% +% ybdK+309nt% 91.41% 89.91% 1.50% 6.00E401% GUUAAUCCAAAAAAAGUUCUUGUUCCGCUUUUGGGACAAGGGUUUUUUUA 412% 4% 224044% 4% ybdN+31nt% 94.03% 91.22% 2.81% 3.24E401% CGUGACAAAGCAGUUUUAACUUAUACCGAGCCGGUUAUCCGGCUCUUUUU 412.8% 4% 226281% +% ybdO+33nt% 88.90% 66.51% 22.39% 1.30E405% CGGGUGUGAAUUAUUAGGUAAGCUGUUCAUGUAGGACAGCUUAUUUUUUA 412.3% 4% 227993% +% ybxG+39nt% 97.57% 92.89% 4.68% 8.70E402% CAGCUGAAUAACGAUAAAAAAGAGACAUUCACGGAUGUCUCUUUUUUUAU 49.7% 4% 230779% 4% ybyB+40nt% 100.00% 98.86% 1.14% 1.49E401% AAAGAAGUAAUCAAAAAGCUCUCUUCGAUAAAGGAAGAGAGCUUUUUAAU 413.5% 4% 233012% +% ybeC+45nt% 99.69% 99.26% 0.43% 1.40E401% AAUAAAAUAUAGAAGAAAACCUUGCGAUAGUUGUCGCAAGGUUUUUUGCU 412.9% 4% 235389% 4% ybfE+2775nt% 92.69% 87.34% 5.35% 3.31E401% GAGGAGAGCCAGGAAUCCAACCCCUUUUGACAAGGGGUGUUUUCUGGCUCUUUUUGU 426.1% 4X2% 238137% 4% ybfE+27nt% 66.05% 78.81% 412.76% 1.07E401% ACAAAAAAAGCAUCUCUGAAUAAUCUCGAAAUCAGAGAUGCUUUCCCUUU 413.7% 4% 239589% 4% ybfG+55% 74.68% 83.53% 48.85% 9.37E401% AUACAAAACUGCAUGAACAUAAGUUAAAAUAUGCUCAUGCAGUUUUUUUA 413.4% 1X1% 245087% +% purT+41nt% 96.22% 95.88% 0.34% 8.50E401% UUAAAAUAGAGUUUGAACAGGUCUUGUCAUGGGACAAGGCCUGUUUUUUU 417% 4% 246526% +% ybfJ+34nt% 92.76% 66.67% 26.09% 2.60E406% AGUCUUCAAAGAAUAGCAGUUUCCUUGAUUUUAAGGGAACUGCCUUUUUU 415.5% 4% 249578% +% psd+38nt% 77.82% 51.32% 26.50% 1.50E404% UACGAAGAAUAAAAAGAGGAGCUUGCAUAAACGCAGCGCCUCUUUUUUUG 411.2% 1x0,%1x1% 249901% +% ybfN+28nt% 95.47% 91.25% 4.22% 8.20E401% GGUGAUGAGAGAAUCCAGCUAAAGCUUCUUUCAACAGAGAAGCUUUUUUU 47.4% 4% 251352% +% ybfO+33nt% 86.69% 78.38% 8.31% 3.10E401% CUGUCAUUAUCAAGUGAGCGGUGUCCCCUGUGGUAAACAGGGGAUUUUUA 414% 4% 253516% +% ybfQ+34nt% 95.83% 85.43% 10.40% 7.80E403% CGCUGCUGCUGAAUAAAAAAAGAACACCUCGUAUUGAGGUGUUCUUUUUU 413.1% 4% 254875% 4% nagP+32nt% 98.68% 98.76% 40.08% 8.06E401% CACAUUCAAAUGAAGUAAAAAAGUCCCCCCUGCUGCGGGGGACUUUUUCG 412.8% 4% 258842% +% ybgB+35nt% 75.79% 82.14% 46.35% 4.20E401% UGUUUAGCGCUCUAAAUCAAACAGCCAGAAUAAAACUGGCUGUUUUCUUU 410.3% 4% 260091% 4% ybgF+32nt% 95.35% 97.02% 41.67% 9.47E401% AUGACUCAUUCAAAAUAAAAAGAACCUGCCUCCGGGCAGGUUCUUUUUCG 415.9% 4% 273983% +% ycbG+45nt% 91.63% 70.61% 21.02% 1.40E403% AAUAAUGGUGAGCAACCGCAGUUGAAACGUAAGAGCUGCGGUUUUUUUAA 410.6% 4% 275780% +% garD+219nt% 13.19% 5.12% 8.07% 4.50E402% GCCCUUAUAUGGUUAUCAAAAAAGAGGGUGGCGUGCCUGCCCUUUUUUGU 46.1% 4% 277081% +% ycbJ+323nt% 96.86% 99.15% 42.29% 2.20E403% AAGGUGGUACCGCGAGACCCUCGUCCUUUGCAUAGGACGGGGGUUUUUUG 418% 4% 281771% +% ycbO+57nt% 65.74% 64.26% 1.48% 7.80E401% CGCCCAAUAUGUAUAAAAGGCCGAUGCUGUCAGCACCGGCCUUUCCAUUA 412.9% 1x1% 283782% +% ycbR+48nt% 90.00% 80.16% 9.84% 1.50E401% AACUGAUAAAGAGCACUGAGUCAUUCUGCGAAAUGGCUCGGUGUUUUUGU 415.2% 4% 288614% 4% lmrB+39nt% 93.33% 95.45% 42.12% 5.13E401% UAGAUCAUUAAUAUGAAAAGCCCCUGACUAGUGUUCAGGGGCUUUUUCAU 414.7% 0x1% 288652% +% ycbU+41nt% 97.62% 86.62% 11.00% 1.20E404% CACAAGUAAACAUGAAAAAGCCCCUGAACACUAGUCAGGGGCUUUUCAUA 414.3% 4% 292887% +% estA+44nt% 83.40% 55.37% 28.03% 1.30E405% AAUUAAUGAAAAACAAAACCUUGAAGAAUGCUAUUCUUCAAGGUUAUUCU 412% 4% 294576% 4% natK+39nt% 88.50% 85.04% 3.46% 2.79E401% UUCAGAAAUAAAAAAACCUUGAAAAGCCUGGCUUUUCAAGGUUUUUUCCA 413.3% 4% 294618% +% yccF+43nt% 99.80% 97.29% 2.51% 1.40E401% CUCAUAAUGGAAAAAACCUUGAAAAGCCAGGCUUUUCAAGGUUUUUUUAU 413.3% 4%

! 100! 299397% 4% ycdA+41nt% 99.19% 100.00% 40.81% 1.47E401% AAAGAAUAAAACACCAAAAGGAAAUAGCCAUGACGGCUAUUUCCUUUUUU 414.6% 4% 305587% +% rapJ+36nt% 98.71% 95.03% 3.68% 5.90E403% AGCGUUUUCAAUAGGAAAUGGCAGAGAACUACAGGUUCUCUGCUUUUUUU 413.5% 4% 309327% +% adcA+36nt% 90.92% 73.20% 17.72% 7.50E406% UGGUUAAAUCAUAAGAUAGUGUGCGCCGGAGGGGUGCACACUAUUUCUUU 418.1% 4% 310882% +% adcB+40nt% 100.00% 98.25% 1.75% 6.80E402% AAGCCGAUAACAUGAAAAGCAGUUUUCCCUAGGGAAAACUGCUUUUUUUA 415.5% 4% 314839% +% yceF+41nt% 77.01% 34.44% 42.57% 3.30E410% GAAGAAUAAAACAAAACAAGGAGGGAGGUUCAAUGUCCUUCCUUUUUUGU 49.7% 1x1% 317643% +% yceH+40nt% 94.99% 73.81% 21.18% 6.00E406% GCAGCAAUAAUAAAAACCCCGCUUGUGGAACAUAAGCGGGGUAUUUCAAU 417.5% 4% 318960% +% yceI+33nt% 46.93% 2.90% 44.03% 3.10E407% AAACUGAGCUAGAAUAGGAAAAGCACCUCUUAAAAGAGGUGCUUUCAGCG 412.3% 4% 319182% +% yceI+255nt% 75.26% 65.44% 9.82% 7.70E402% AAAGAUUUUGUCAACAAUCUGAGGCACCUCUUGAAUGAGGUGCUUUUUUA 412.1% 4% 324036% +% opuAC+36nt% 99.04% 99.23% 40.19% 7.50E401% AUUUGAAGAAGUAAUCAAAAAAGCAGCCUGUGUCAGGCUGCUUUUUUUGC 412.8% 4% 326808% +% ycgA+36nt% 95.20% 82.04% 13.16% 3.00E402% GGGGGCCGUUUUAACGAUUGCUGCCCGCCGGCUUGUACGGCGGGCUUUUG 418% 4% 327895% 4% mdr+4546% 16.11% 18.77% 42.66% 3.22E401% UUGAUACGAUGUCGGCUGAUACAGCCAGUACCAGUUCGACAUGCUUUUAU 411.4% 1x1,%0x1% 329653% +% amyE+56nt% 94.08% 86.67% 7.41% 1.80E402% GGCUAGACGGGACUUACCGAAAGAAACCAUCAAUGAUGGUUUCUUUUUUG 49.6% 4% 332397% 4% mdr+44nt% 98.91% 98.27% 0.64% 7.77E401% AAUUAACAUAAAAAAAGCAGUACAUGCUGGGCAUGUACUGCUUUUUUCUA 416.3% 4% 336131% +% ycgG+41nt% 80.57% 71.91% 8.66% 7.70E401% AUGAAAUAAAUCAAGGACUGGCAGGGCGAUCUUUAUGACCCUGCUUUUUU 48.5% 2x2% 339143% +% nadE+37nt% 97.91% 94.26% 3.65% 1.80E402% CUGGUGGAAAUAAGUUGAAGAAAGCCCGCUCUCGGAGCGGGCUUUUGUCG 414.6% 4% 340615% +% aroK+30nt% 94.37% 84.62% 9.75% 1.10E401% AUCUUUAUCAGCCGAUGUAAAAAGCCGUGCGCAGCGCACGGCUUUUUUUA 413.5% 4% 343537% +% cah+43nt% 32.89% 23.08% 9.81% 2.60E401% AGGCUGAUAAAUGUGAAAAGCCGCCGCAUAUCAUCAGGCGGUUUUUUUCU 48% 4% 344386% +% ycgL+26nt% 78.24% 39.81% 38.43% 3.40E403% GUGUGGAAGGAUGGAGGAAGCUGAUGUUUUUUGUCGCUUCCUUUUCUCCU 49.7% 1x0% 347072% +% ycgN+46% 47.45% 30.66% 16.79% 1.10E404% CUAAGCGGGACUAAAUGGGCAUCCUCCCUGCGGGGGUGUCCAUUUCAUCC 416.1% 4% 348619% +% ycgO+48nt% 64.34% 46.10% 18.24% 1.20E404% AAAGAUCGAAAGGAGGAGGAAGGGGCUGUCCCUUUUUCCUCUUUUCUCCU 419.7% 4% 349995% +% ycgP+36% 69.23% 65.94% 3.29% 7.30E401% UGAAAAAGAAAUAAAAAAGAAACCAGUACUUGUACUGGUUUCGUCUUCAC 413.3% 4% 353864% 4% nasF+36nt% 88.18% 84.74% 3.44% 7.38E401% UCCUUCACACCUGAUGGCAAGCAGCCCUUUUCCUCAAGGGCUGUUUUAUU 411.9% 4% 355375% 4% nasE+37nt% 47.22% 11.66% 35.56% 1.14E404% UCUCGUAUAUUGAUCAAAAGACCGGAUCACUUUUCUAGUGGUCCUUCAUU 410.2% 4% 355648% +% ycgT+1780% 32.07% 20.77% 11.30% 1.50E401% AUGGCGCGGAUGCUUCCGUCUGAAAGCUUGAAAACCGCGAGCUCCUUAUC 43.6% 4% 356366% +% ycgT+2498nt% 51.25% 34.43% 16.82% 4.50E403% CCCGAUGGCAUAUCAAGAUCUUCCCAUACCUUCGGAAGGUCUUCUUUUUU 48.5% 4% 369709% +% yckC+18nt% 98.20% 87.43% 10.77% 1.60E401% AUGCUGACGAAGAGAUUAGAAAGAGCGAAUAAUGGUUCGCUCUUUUUAUU 410% 4% 371691% 4% nin+38nt% 78.09% 85.43% 47.34% 1.84E402% GUUUCUGUGUAAUGAAAAACCCCUGAGAGAAUAACUCUCAGGGACUCUUU 415.3% 4% 374565% 4% hxlB+38nt% 97.80% 99.09% 41.29% 4.90E401% AACCUUGAAUAGCAUCACACAACCGGCCUGAAGAUCAGGCCGGUUUUAUU 416.1% 4% 403152% +% srfAD+36nt% 97.14% 96.96% 0.18% 7.90E401% UCAUUCAACCGUGAUCAAAAGCGGACAGCUUCGGCUGUUCCGCUUUUUUU 416.7% 0x1% 404439% 4% ycxB+19nt% 97.35% 93.69% 3.66% 9.04E401% AAAACUCAAAUUUAAAAAGGAUCAGCAUUGACAGUGCUGAUCCUUUUAUA 414.7% 4% 404478% +% ycxA+35nt% 94.26% 95.64% 41.38% 6.30E401% CACCAUUCAAUAUAAAAGGAUCAGCACUGUCAAUGCUGAUCCUUUUUAAA 413.1% 4% 408211% 4% yczE+29nt% 86.95% 91.50% 44.55% 2.78E401% GCAUCUCCGCCUGUACACUAAAACAAAGCCGCCUUGGCUUUGUUUUUUUA 48.2% 4% 409129% 4% tcyC+79nt% 94.77% 51.60% 43.17% 4.16E409% UCAGAUUAUUGACAAAAUCCUAAAACGAUAUUCGUUUUAGGAUUUUGUGA 412.1% 4% 416234% +% yclE+39nt% 69.72% 58.66% 11.06% 3.00E401% UUGAUCAAUAAAAAACAGCCCGCAGAUCAACAUCCGCGGGCUGUUUCUGA 417.6% 1x1% 428710% +% yclK+42nt% 59.22% 22.81% 36.41% 2.20E404% AGCAAUAGCAUACAGGGCGGCGCAUCAACUGAUGCAUCCGCCUUUUUUGC 415.4% 1x2% 430124% +% phrC+39nt% 99.46% 97.75% 1.71% 6.20E403% GAAUGACGUAAGAACAAGCCCCUUCUCAUUAGCGAGAAGGGGUUUUUCUU 415.9% 4% 430129% 4% yczN+227nt% 82.14% 75.21% 6.93% 2.61E401% GUAAUCUCCAUGAAGGCGGCACCGCAAGACUAUGUCUUGCGGUGUUUUUU 417.4% 4% 430583% 4% yclM+40nt% 78.03% 65.30% 12.73% 5.85E401% GAUCUCUUAAUCGUACAUAAAUAGCGGGCGGCAGCGCCCGCUAUUUUUUU 416.9% 4% 435992% 4% ycnB+44nt% 99.05% 94.96% 4.09% 1.65E401% CGCUGAUUAACAAAAAAAGAGCCCCGCUAUUUAGCGGAGGCUCUUUUUGG 416.8% 0X1% 436030% +% yclQ+41nt% 99.55% 99.18% 0.37% 3.00E401% GAAAAGUAAAACCAAAAAGAGCCUCCGCUAAAUAGCGGGGCUCUUUUUUU 416.8% 1x0% 438475% 4% ycnD+41nt% 97.50% 70.03% 27.47% 2.59E402% GAAAAAUAAGCUCUUAUUCGGCCUGUCGGAUUUUCCGGCAGGCCUUUCAU 420.1% 4% 440052% +% yczG+29nt% 97.58% 97.09% 0.49% 6.20E401% GUAGACCAGGACCGCUGGUGAAUCAAUCCCCUGUAACGGGGAUUUUUUUA 47.8% 4% 444387% +% gabD+49nt% 100.00% 100.00% 0.00% NA% AAAGAAUGCACGCUCCUGAGAGCUGCCGGAUUUUCCGGCAGCUCUUUUUG 416.2% 4% 446132% 4% ycnI+42nt% 99.10% 97.89% 1.21% 3.19E401% GUGCCUAAUAAAGAAAGCGAUCCAGAUGUCAUGUCUGGGUCGCUUUUUAU 417.5% 4% 449570% +% ycnL+19nt% 100.00% 99.33% 0.67% 1.50E401% CAUUUAUAGAGGAAAGAGAAAAGGCUCCUGAAACCAGGAGCCUUUUUAUU 414.6% 4% 452774% +% mtlD+35nt% 91.23% 77.43% 13.80% 5.90E404% AAACUUAAUCAAUAACCGACCACCCGUGACACAAUGUCACGGGCUUUUUU 414.1% 4% 453936% +% ycsA+42nt% 56.92% 45.21% 11.71% 1.40E401% AGCUCUGAUGAAUCAGGCCGGUGGCAGAUGGCUGCCCCGGCCUGUCCAUU 421.8% 1x0%

! 101! 454612% 4% yczH+40% 40.36% 51.61% 411.25% 6.06E401% AUUUUUUUAAACGUGCACGGCGCUUUAUUAUCGGUGCCGUCAUGUUCCAU 415.3% 1x0% 455775% +% ycsD+37nt% 95.66% 84.25% 11.41% 2.60E405% UAUUGAAAAAUGAAAAAAACCCUUCACAACAUUUUGUGAGGGGUUCUAUU 413.6% 4% 456852% +% ycsE+35nt% 100.00% 99.29% 0.71% 8.80E402% CAUUGGGUACUAUAAAAAAAGAGAGUCCUAAGAUGGACUCUCUUUUUUAG 413.5% 4% 462497% +% in%lipC%CDS% 45.51% 17.28% 28.23% 1.30E403% AGCUCUGGGCGAUUCCUUGACGACAGGGAGAGGCUCCGGGCUGUUUUCAC 418.4% 2x2,%1x1% 463069% 4% yczJ+427nt% 77.14% 60.55% 16.59% 5.24E401% UAUUUCGAUCACACAUAAAAAACGCGCCUGUCAUGAGGCGCGUUUUCUAU 412.3% 4% 463105% +% lipC+33nt% 97.71% 94.00% 3.71% 5.80E401% AAUUAUCAGUUUCAUAGAAAACGCGCCUCAUGACAGGCGCGUUUUUUAUG 411.7% 4% 466978% +% ycsN+34nt% 87.31% 79.15% 8.16% 1.30E402% UUACGAUAUUCCAUAAAAAGCAUCAGUUUACCAGCUGAUGCUUUUUCAAU 410.8% 4% 469255% +% mtlR+41nt% 100.00% 87.15% 12.85% 2.70E403% AUACUGUAAACCUGCAUGGCACACGUCAAAAAUUUGGCGUGUGUUUUUCU 412.7% 4% 470978% +% ydaB+41nt% 100.00% 98.74% 1.26% 3.40E401% CAUUCAUAAAAGAAGAAGCCCGUCCACUUUAUGUGGCGGGCUUCUUUGCA 416% 1x0% 474650% +% ydaG+425nt% 99.40% 99.00% 0.40% 8.50E402% AUAGAAAAGAAUAAGACAAACCGCCCGGCGUACGCCGGACGGUUUUUUUA 414.1% 1x1% 475541% 4% ydzA+43nt% 98.44% 88.21% 10.23% 5.79E403% UAAAUAAGGAAGCGCAAAAAGGCUGGAUCUUUAUGAUCCAGCCUUUCUUA 416.5% 4% 478776% +% topB+35nt% 98.09% 91.74% 6.35% 1.40E401% GGUUUGGAUAAAUAAUAAAAAAACCUGUGCCUAUCGCACAGGUUUUUUAU 410.5% 4% 486294% +% ydaN+338nt% 77.81% 57.29% 20.52% 2.00E402% CUGUGUUCGAUGUUAUGGCACAGGGGCAUCCGUUUGCCUCUGUGUUUUUU 416.6% 4% 488293% +% ydaO+38nt% 100.00% 79.38% 20.62% 1.50E407% UUUAAAAAGUAAAGCUCUAGGACCAAGGGAAUCACCUUGGUCCUUUUUAG 416.6% 4% 490681% 4% ydzK+96nt% 90.56% 82.73% 7.83% 9.36E401% AAGGACAAAUGCAUCUUCCUUUGAAACAAGAUGCAUUUGUCCUUUUGUCU 420.6% 4% 491116% 4% mntH+31nt% 97.20% 91.65% 5.55% 3.64E402% UGUAGAUACGUUUCGAUAAAAAAACCGGCUUCUAAAGCCGGUUUUUAUUU 49.2% 4% 494417% +% ydbA+40nt% 98.02% 94.23% 3.79% 3.10E401% GAUGGAAUAGCAGAAAGCAGACGGACACCGCGAUCCGCCUGCUUUUUUUA 49.8% 1x1% 495739% +% ydbC+36nt% 69.80% 42.81% 26.99% 1.20E402% UUCUGAAGGCAUAAUCAAAGCCCAAAACAUCAUGUUUUGGGCUUGUCUCU 413.2% 4% 501467% +% dctP+36nt% 98.92% 97.67% 1.25% 1.30E401% AAACAGCAGUCUGAAAAAAGAACGGCCCAUCCAUGGGCCGUUUUUUUAAU 412.5% 4% 502883% +% ydbI+252nt% 83.05% 76.21% 6.84% 9.10E401% AACAAAUGCUAUAAUACAAACAGUGCCUAAUGUUGGGCACUGUUUAUUUU 413% 4% 505059% +% ydbL+35nt% 94.01% 78.09% 15.92% 1.10E404% GCAAAUCCUGUGUAAUCGCGCUGUUCCCUUGGGGAACGGCGUGUUUUUCU 419.6% 4% 506296% 4% ydbN+26nt% 95.23% 96.49% 41.26% 2.84E401% CUGCAAGAGCAAAACAAUACAUAAAAAGAGCCGGUAAGGCUCUUUUUUUU 47.8% 4% 506326% +% ydbM+29nt% 80.19% 64.10% 16.09% 4.10E403% GCUGAAGCGUUUGAGUCAUAAAAAAAAGAGCCUUACCGGCUCUUUUUAUG 47% 4% 507675% 4% ydbP+78nt% 97.11% 97.57% 40.46% 8.56E401% CAGGCUCUACAUGAACAUGAACAUGAGUGACAUCGUGUUCAUGUUUUAUU 413.8% 4% 509353% +% ddl+41nt% 85.34% 42.78% 42.56% 1.50E407% ACAUUCUAAUGAAGAAGGACACUGCCGGUAAAAGGGCAGUGUUUUUUCCC 411.2% 4% 511005% +% murF+248% 22.54% 22.42% 0.12% 9.70E401% GAUGGAGCAGCAGCCGGCAUAUUCGAGAUGCCGAUCUGCUUCUCAUCUUA 413.6% 1x2% 512686% +% cshA+45nt% 99.41% 97.72% 1.69% 3.30E402% ACUAAUUUGAUCGAUUCAGAGCCCAAAACAUGAUGUUUUGGGCUUUUUUA 412.9% 4% 514957% 4% ydcA+59nt% 65.28% 55.19% 10.09% 4.24E401% CAGAUUGUUGACAAAAUCCUAAAAUGGUUUUCAUUUUAGGAUUUUGUCAU 410.1% 4% 515036% +% ydbT+272nt% 93.29% 92.37% 0.92% 8.80E401% AGGAUUUUGUCAACAAUCUGAAGCGGCGGUUAAUACCGCCGCUCUUUUUU 415.6% 4% 517292% +% ydcC+35nt% 89.12% 82.86% 6.26% 3.00E401% CAAUCAUCGAAAUAACCGCCAAAGGCCAAACAUGAUUUGGCCUUUUUUUC 48.4% 4% 519330% +% ndoA+37nt% 98.11% 95.98% 2.13% 9.30E402% CAUUGAUUUUUAGACAUAUUUGCAGGUUGCUCAAAUAGAGCAACUUUUUU 49% 4% 524290% +% rsbX+41nt% 99.20% 99.89% 40.69% 8.20E402% CUGUCCUAAAAAACCAGAAAAAGAAGCUGGACAUCCGGCUUCUUUUUUUU 412.1% 4% 525678% +% ydcH+29nt% 92.62% 91.49% 1.13% 7.80E401% GAACUAUUGAAACAUGAGUAAAGAUACGGGCAGCGCCAGCUGUCUUUUUU 48.2% 4% 527933% +% ydcI+31nt% 76.55% 51.65% 24.90% 1.20E401% GCUGUCUAUGGUAAAAUAAAAGCACUGCUUACGAGCAGUGUUUUUUCCUA 48.9% 4% 529459% +% trnS4Leu2+37nt% 98.70% 97.63% 1.07% 3.80E403% CUCGGCCGCAUCAAUGAUACCAAGGGUUUUGACACCCUUGGUAUUUUUUU 414% 4% 530891% 4% immR+239nt% 33.66% 33.22% 0.44% 3.45E401% ACCUCCAACAUCAACAAUUUGUAAUUGCCCAUGAAUUAGGGCAUUACUUU 45.9% 4% 545999% +% yddJ+24nt% 98.56% 92.56% 6.00% 1.90E402% GAGAAGAGACAGAGUUAGAGGAGUAAACCGUGUGUUUACUCCUCUUUUAG 415% 4% 548619% +% phrI+62nt% 82.23% 80.36% 1.87% 9.60E401% GAAAAGAGGAAAAAAGCUUAAUCUUUUUUCGAAGGUUAAGCUUUUUCUUU 410.3% 4% 552032% +% lrpA+103nt% 83.72% 66.44% 17.28% 2.80E402% AAAAAGCCCUAGGUUGGAUAUGGAAUUUACCAAGCUGGGGCCUUUUUAUA 418.2% 1x0,%1x1% 557493% +% yddT+44nt% 100.00% 94.40% 5.60% 7.70E402% AGCUAAUUUUAAAAUCACUUUGUCUUUAUAAAGGACAAAGUGAUUUUUUG 414.2% 4% 558112% +% ydzN+54nt% 94.13% 50.45% 43.68% 3.10E403% CAUAAAGUUGGGAAAGAAGGAUGUUACUUAUGUAGUAUCCUUCUUUAUUA 412.4% 4% 559514% +% cspC+50nt% 99.71% 99.21% 0.50% 6.10E403% UCUUCAAUCGUUUAUACAAACAGGCUCUUUAUAUAGGGCCUGUUUUUUUA 412% 4% 559533% 4% ydeB+618nt% 88.52% 79.30% 9.22% 1.28E401% UCUAUUACCUUGUAGCAUCUCCCUACUCGAACGUUGAGUAGGGUUUUUUA 413.2% 4% 568186% +% ydeH+78nt% 79.51% 44.36% 35.15% 1.40E401% CAGUGAAAUAAUUAUACAAAAAGAGAAGGCUUGUGGGCCUUCUUUUUUUG 49.2% 4% 570291% 4% ydeK+80nt% 97.33% 90.18% 7.15% 1.51E401% GCAUGAAGGUAUAAAAAUACCAAGGGUUGCUGGCCCUUGGUAUUUUGUAU 414.8% 4% 573402% 4% ydeN+50nt% 97.32% 96.89% 0.43% 9.75E401% CAUCUUUCACCCAUCUGCUUCAAUCGAGCCCGCGAAAAGCGGGCUUUCUG 412.4% 4% 575666% 4% ydeP+46nt% 82.28% 52.76% 29.52% 7.05E402% CUAAUAACCAGAAAAAAUACCAAGGGUUUUGACGCCCUUGGUAUUUCUGU 415.2% 4%

! 102! 575706% +% ydeO+144nt% 95.22% 93.09% 2.13% 4.80E401% GUCUGAAUCACAGAAAUACCAAGGGCGUCAAAACCCUUGGUAUUUUUUCU 413.5% 4% 579262% +% ydzO+30nt% 95.07% 69.40% 25.67% 6.90E403% AAAAAAUACUUGCAAUGUAAACAGGCCUCUAAAGAGACCUGUUUUUUAAU 47.7% 1x1% 586630% +% ydfF+82nt% 94.96% 71.10% 23.86% 2.50E406% ACGAUAUCUAGGAGGAGUAAGAUUUGUUCUAAUCUUACUCCUUCUUCUUA 414.1% 4% 589655% +% ydfI+54nt% 97.14% 80.58% 16.56% 5.60E402% CAUAUUUGAAAAUUGCCCAAACGUACAUGCCCGAAUGUACGUUUUUUUCA 47.3% 4% 592203% 4% nap+100nt% 90.36% 68.36% 22.00% 1.75E403% AGCCGGGCACUUCAAAAAAUAGAGUCCCUCUUAUGGACUCUAUUUUUCUU 410.2% 4% 592243% +% ydfJ+352nt% 51.46% 55.23% 43.77% 5.40E401% GUUUUGUCCAAGAAAAAUAGAGUCCAUAAGAGGGACUCUAUUUUUUGAAG 410.8% 4% 604085% +% ydgD+145nt% 27.46% 5.93% 21.53% 6.80E402% UAGAGCUCCAUUUCUGUGUUAUUCGUCCGGCAUCAGCUGGGCUUUUUUUA 410.1% 4% 604682% 4% vmlR+54nt% 81.60% 72.06% 9.54% 1.05E401% GAAAGUUCAAGCGGCAUUGAAAAGGACAACAGCUGUUGUCCUUUUUCUUU 49.3% 4% 604716% +% ydgE+140nt% 65.12% 37.47% 27.65% 3.60E404% GAGGCUUGAACAUAUAAAGAAAAAGGACAACAGCUGUUGUCCUUUUCAAU 49.3% 4% 606407% 4% ydgF+292nt% 88.79% 60.72% 28.07% 1.06E404% UCAUGCACAGGCACGGCUAAUCCUUCCAACACAUUUGGGAGGAUUUUUUU 411% 4% 606656% 4% ydgF+43nt% 93.07% 91.16% 1.91% 8.67E401% UCAAUAAGACUCAAAACUCCUGCCUCAAAAAUGAGAGCAGGAGUUUUUUU 416.2% 0x1% 606697% +% ydgE+2121nt% 100.00% 93.55% 6.45% 4.80E401% UUUUCAUCAAAAAAACUCCUGCUCUCAUUUUUGAGGCAGGAGUUUUGAGU 417% 1x0% 608216% 4% dinB+30nt% 99.22% 91.49% 7.73% 1.52E402% CAAAAACUGAAAAAGCAUAAAAAAGCGGCUCCCUAAAUGGAGCCGCUUUU 415.7% 4% 612084% +% ydgH+39nt% 95.10% 75.65% 19.45% 6.70E403% GAAAAGAGUAAUCGAGAGAAGAGUGAUGAAUGGUCAUCACUCUUUUUUCA 411.5% 4% 614880% +% ydgK+31nt% 98.64% 93.55% 5.09% 3.20E401% AGUAGGGCAGAAUUCAUAAAAAAACCUGACAUGACGUCAGGUUUUUUGUU 48% 4% 616593% +% ydhC+48nt% 91.27% 80.41% 10.86% 1.40E402% GAUUUGUAUGAUCCGGUACCAAGGGAGAGCAGAACCCUUGGUAUUUUUUU 412.7% 4% 619320% +% ydhE+38nt% 94.81% 56.25% 38.56% 1.70E404% AAAAACAAAUAAGAAAAAGAACUCCCGUACCUUGUACGGGAGUUCUUGAU 413.5% 4% 622216% 4% ydhH+77nt% 59.06% 49.38% 9.68% 8.03E401% GAAAAGGCGUAACAUAUUUUAUACAGCUCAUAUGUUAUGCCUUUUUCUUCA 412.9% 4% 622270% +% ydhG+52nt% 87.41% 88.19% 40.78% 9.50E401% AAAAAGGCAUAACAUAUGAGCUGUAUAAAAUAUGUUACGCCUUUUCAUUU 410.3% 1x1% 624374% +% ydhJ+24nt% 94.23% 91.55% 2.68% 2.60E401% UGUAUAUAAAAAUCUUAAAGCAGUAAUUGCCGCCUGACAGCGGCUUUUUU 48.1% 4% 626325% 4% ydhU+8326nt% 99.55% 99.38% 0.17% 3.98E401% UAAAAUCCUGAUUACAAAAUUUGUUUAUGACAUUUUUUGUAAUCAGGAUUUUUUUU 420.9% 2X2% 640568% +% trnE4Asp+87nt% 41.53% 10.33% 31.20% 2.10E403% GUGUUUUCUUUUACUGUAUCUUCUGCUUGGUGUCAUAGCCAAGCUUUCUU 49.7% 4% 644316% +% gcp+18nt% 96.12% 84.85% 11.27% 1.70E403% AAUUGACUUCUUAUCAAAGUCUCACGAGAUAAUAGCGUGAGACUUUUUAU 410.7% 4% 644492% 4% ydiF+36nt% 86.89% 78.57% 8.32% 2.28E401% CAGAAGAAGAUUAAAAAAGUCAAGCACCUCUUUUUAGAGGUGCUUUUUAU 412.8% 4% 648704% 4% ydiK+38% 96.13% 89.61% 6.52% 4.27E401% AACCAAAAAUAAAGAAAAUCCAUUUCUCGCAUGAGAAAUGGAUUUUUUAU 412.6% 4% 648744% +% tatCY+40nt% 99.70% 97.90% 1.80% 2.00E402% UGGGCAAUAAUAAAAAAUCCAUUUCUCAUGCGAGAAAUGGAUUUUCUUUA 413% 4% 651937% 4% ydzT+40% 82.26% 72.46% 9.80% 2.76E401% GAAAAGGUCUCCCAACAGUUUAGUAAACUGAUGAAAGACCUUCUCUUUUU 411.6% 1x1,%2x2% 651990% +% groEL+122nt% 94.94% 85.34% 9.60% 2.00E408% AGAGAAGGUCUUUCAUCAGUUUACUAAACUGUUGGGAGACCUUUUCUCCA 416.6% 1x1% 657726% 4% ydzW+67nt% 76.44% 76.65% 40.21% 5.01E401% AAAAAAUUAAAGAUAAAAAACGGAGCUGGUUUUAUCCAGCUCCGAUACUU 417.2% 4% 657762% +% ydiP+65nt% 98.78% 90.33% 8.45% 2.30E402% AGAGCAUACUAAAAAGUAUCGGAGCUGGAUAAAACCAGCUCCGUUUUUUA 416.8% 4% 663330% +% ydjA+303nt% 85.71% 81.24% 4.47% 3.50E401% AUUUUCAAGGCUUCUCAUGAGUUCACCGAACUUGUGAGAAGCUUCUUUUU 419.8% 4% 664731% +% ydjC+62nt% 97.75% 83.45% 14.30% 3.20E403% CUUUAAUAAGAAACGAAAGGCCAACUGCGACUUCAGUUGGCCUUUCCUAU 414.5% 4% 671103% +% ydjE+54nt% 99.57% 99.51% 0.06% 9.90E401% UUGAAGAUGUUUCUUGAAAGUCUUUGGACUUUUGGGGGCAUCUUUUUUUA 416% 1x0% 671968% +% pspA+40nt% 3.73% 3.33% 0.40% 9.90E401% CGAUAAGUAAUACAUAGGAGGCCGCAGCUUUCGGCUGCGGCGUCAUUUUA 416.3% 4% 674835% +% ydjI+50nt% 96.16% 80.77% 15.39% 3.60E406% GAAUCAUACAGUGAAAAGUCCGGAGUGAUCAGCACUCGGGACUUUUUUAU 413.8% 1x1% 677870% 4% bdhA+41nt% 72.38% 58.09% 14.29% 7.52E405% CCUAACUAAUUUGAAACCAAAAAGAAUCCGCACUCGGGUGCGGAUUCUUU 411.5% 4% 679811% +% ydjM+50nt% 84.04% 0.54% 83.50% 1.60E408% UGUACAUAUAUAAUCUGGAAAGCAAGAAGUCACAUUCUUGCUUUUUCUAU 47.5% 4% 680876% 4% ydzJ+31nt% 56.39% 59.45% 43.06% 3.32E401% CCUGCACCUCAUCCAUUAAAAAAGCCACUCAGCUCAUGCCGAGUGGUUUU 411.5% 1x1% 680911% +% ydjN+38nt% 90.10% 86.67% 3.43% 1.70E401% GUGAUUAACUAAUAAAAACCACUCGGCAUGAGCUGAGUGGCUUUUUUAAU 414.9% 4% 681107% 4% ydjO+148nt% 98.77% 94.35% 4.42% 1.32E403% CAAAUACGAAGAAAGAAGCCCAAAACUGUAAACGUUUAGGGCUUUUUUGU 48.4% 1x1% 685112% 4% gabP+43nt% 98.41% 92.08% 6.33% 5.10E403% GCCUUAAUGCUGAUCAAAUCCUAAACGGCCUGCCGUUUAGGAUUUUGUUA 415.1% 4% 688062% +% yeaB+228nt% 99.22% 98.05% 1.17% 2.30E401% UUUAGGAUUUUGUCAACAAUCUGGAGCUUCCUGCCACAGGAAGCUUUUUU 410.6% 4% 692702% +% yebA+125nt% 30.86% 22.62% 8.24% 3.80E401% GGCCUUGCCAAAGAGGGCGGAGCGAGCUUCAUAUCUGUCCUCGUUUUUUU 412.3% 4% 694338% +% guaA+57nt% 99.65% 98.13% 1.52% 3.10E406% UUAAUGGAAACCAUCUUUUUGGCAAUUUUGCCGGGAAGAUGGUUUUAUUU 419.1% 4% 694608% +% guaA+327nt% 47.99% 34.39% 13.60% 3.80E401% UGAAAUCCGUCUGUAGUCAAGCGUCCCAAAAUGUAUUGGGACGUUUUUUA 411.5% 4% 696024% +% pbuG+40nt% 99.36% 98.06% 1.30% 2.10E401% CUUAAAAUAAGGAAUGAAAAACCAGCUGCACUGGCAGCUGGUUUUUUUGU 414.3% 4% 697033% +% yebC+35nt% 97.65% 94.12% 3.53% 3.90E401% UUGAUUCCGCUUUAAUGAAAAAACCGGCUAAUCCUAGCCGGUUUUUUUAU 410.7% 4%

! 103! 697369% +% yebD+45nt% 96.41% 67.67% 28.74% 5.30E403% UCUGACAAUAGAUAUAAAGAGGUGAGUCUGCUGAAAAGCGGGCUUUUUUG 410.3% 4% 698572% +% yebG+283nt% 22.16% 17.60% 4.56% 4.80E401% CCCGGUUUGUAUUGCUUCCUCAUAAGUGCAAUGCAGAGCGGGUAUUUUUU 420.3% 1x1% 706920% +% purF+49nt% 32.56% 20.65% 11.91% 8.30E402% AAACUUGAAAAAUGACAUAAAGGCAGCGCAGUUCGGCUGCCUUUCUCUUU 410.3% 4% 711417% 4% yezC+39nt% 79.50% 75.14% 4.36% 3.41E401% CCGCUUUUUGAUAACAAAAAACCCGCAGCUAUUCUGCGGGUUUUCCUCAC 411.5% 4% 711453% +% purD+37nt% 98.50% 87.40% 11.10% 3.50E405% UGCCCAAAAAUAAGUGAGGAAAACCCGCAGAAUAGCUGCGGGUUUUUUGU 412.3% 4% 716782% +% yerC+37nt% 94.50% 89.25% 5.25% 2.60E405% UUCUUCCAAAUAAAAAACCGCCCUGCCGUCUGGCAAGGGCGGUUUCUUUA 418.3% 0x1% 724865% +% yerH+40nt% 99.77% 96.84% 2.93% 1.20E401% UUAUGACUGAUAGAAAACCCUUGUGCCAUAUUGGCACAAGGGUUUUUAUG 418.6% 4% 726041% +% yerI+44nt% 94.99% 89.20% 5.79% 2.10E402% GUGUAGAUAGAAAAAGCCAAUGGGAUUCCAGUCCCAUUGGCUUUUAUAAU 418.3% 4% 726801% 4% opuE+39nt% 92.40% 84.41% 7.99% 6.82E403% GCAAAAAGUAAGCAAUAAGCCAUCAAGCGCAGCUUGGUGGCUUUUGUGCU 414.5% 4% 731972% +% gatB+33nt% 99.83% 99.74% 0.09% 6.90E401% AAAUUAAAAAACGCUAAUAAAAAAGCAGCCCUUAGAGGCUGCUUUUUUUA 49.9% 4% 736149% +% swrC+36nt% 77.87% 27.02% 50.85% 1.00E409% CGGAAGAAGAGUAAAAAACAAAAAGCCUCAGCUCUGCUGAGGCUUUCAGC 413.1% 4% 736322% +% swrC+209nt% 95.09% 68.78% 26.31% 2.20E406% GUUAAGGAUGACAAAAGCUCAAAACAAGAAUCAGUUUUGAGCUUUUGUGC 410.8% 4% 737420% +% yerQ+73nt% 62.89% 26.87% 36.02% 1.10E405% CAGAAUGUUGACAAAAUCCUAAAACAGUUUUCGUUUUAGGAUUUUGUCAU 49.1% 4% 737576% +% yerQ+229nt% 42.46% 19.19% 23.27% 4.90E404% AAGGUUUGCCUACACGCUGAAACUUGGCUUGAAUAGGCCAAGUUUUUCUU 49.1% 4% 747037% 4% yezG+42nt% 86.19% 71.95% 14.24% 3.40E401% GUCUAUAAUUAAAAAAUGGCUCAGCCCUACUCUGCUGAGCUAUUUUUUAU 413.3% 4% 752263% +% phrH+11nt% 66.91% 34.68% 32.23% 1.40E403% CCUUACAAACUUAGUGAUCAGAAGAAAGCCCUUAGCUAGGGCUUUUUCUU 47.3% 4% 753164% +% yeeI+33nt% 92.61% 78.45% 14.16% 4.60E402% UUGAUUUAGGUGAGUAAGGAGUGAGCAGGCUGUUAUGGCCUGCUUUUUUU 411.5% 4% 754431% +% yezE+30nt% 88.76% 89.05% 40.29% 8.10E401% GUUUAUCAGUGCUUGAUUAACAUGUGGUAAAGGAUUCUUUGCCCAUGUAU 411.1% 1x0% 757681% +% yesJ+28nt% 80.12% 56.13% 23.99% 2.20E404% GAAAGAGAUUACGGCAGAAUAAGCGUCCUUUGCAGGGGGCUUUUUUGUCU 45.8% 1x1% 785084% 4% yetG+29nt% 74.25% 80.28% 46.03% 1.44E403% CAAGGGACAUACAAUCAAUAAAAAGCUUGCGCCUUGCUGCAAGCUUUUUU 48.2% 0x1% 785502% 4% yetH+41nt% 19.90% 43.54% 423.64% 4.08E403% AAAGAAUAAACUGUUGCGCACGGCGGUUCGAUUCCGCCCUGCGCUUUCUU 418.2% 1x1% 787613% +% yetI+53nt% 99.36% 96.64% 2.72% 7.00E402% GUUUCCAGGCAUAUGAUUGUCCGUCACCGGGUGAUCAUAUGCCUUUUUGA 423% 4% 788674% +% yetJ+38nt% 88.24% 59.08% 29.16% 4.50E406% AGUGAUGAUUAAUGAAAAAGCGUCUGUCAUUGGAUAGGCGCUUUUUGCCA 412.5% 4% 789580% 4% yetL+72nt% 80.81% 67.62% 13.19% 7.17E402% GCUAUAGCGUCUUUUCUUCUGCAGCCGGAUACGCAUCCGGCUGUUUUUUC 414.8% 4% 789654% +% yetK+26nt% 83.76% 75.95% 7.81% 5.50E402% GCUGCAGAAGAAAAGACGCUAUAGCCUGUCCGGAUCGGACGGGUUUUUUA 411.4% 4% 796225% +% yetO+358% 18.58% 24.03% 45.45% 2.30E401% UAUUCCGGCUUGCCGCGGUGUAUUUAUUGUUGUGUGAUGCCUUGAUUUUG 48.3% 0x1,%0x1,%0x1% 798285% +% ltaSA+52nt% 98.53% 97.10% 1.43% 8.00E401% UGAAAAAGAGCCUUGAGCGGGCGCAUUGCCUUCGCUCAAGGCUCUUUUUU 411.4% 0x2% 803283% 4% yfnC+34nt% 97.52% 94.29% 3.23% 9.08E403% AGAAUGGCAUAGCUGAAAAAACCCCUGCCAGGCGGCAGGGGGUUUUUUAA 418% 0x1% 803319% +% yfnD+33nt% 87.93% 84.93% 3.00% 3.90E401% UUAUCCAGCUGGAUUAAAAAACCCCCUGCCGCCUGGCAGGGGUUUUUUCA 416.3% 1x0% 804637% 4% yfnB+20nt% 95.66% 71.13% 24.53% 2.99E406% UUGAAUAUCGAAAAUACCGUCAGCUGCUAAUCAGGCUGACGGUAUUUCUU 418.2% 4% 805415% 4% yfnA+41nt% 97.69% 70.40% 27.29% 2.71E404% AACAAAUAAUCUCUUUUCAGCCGGCGGUGCCUCACCCGCCGGCUUUUUCC 416.9% 4% 809455% +% yfmS+33nt% 95.42% 89.75% 5.67% 4.70E404% CGCUUGAGGAAGAGUAAGAGACCGGGGACAAACAUCCCCGGUCUUUUUCU 417.3% 4% 811480% +% yfmR+34nt% 84.52% 77.48% 7.04% 8.80E402% AGAACUGGAAAGCUAAAAAGCGUGGCCGCAGCAGGCCGCGCUUUUUUUCA 416.5% 4% 812061% +% yfmQ+46nt% 99.74% 96.12% 3.62% 2.50E402% UUAAACAGGAAAGUGAAAGACGGGUGCUGUAUGCUGCUCGUCUUUUUUAU 410.5% 0x1% 814343% 4% yfmM+41nt% 100.00% 100.00% 0.00% NA% GUGCUUUAAUUUAUAAAAAAACCCGCCUGCUAAAGGGCGGGUUUUUUACU 413.2% 4% 817270% +% yfmL+27nt% 94.17% 88.89% 5.28% 1.80E401% GCGGAAAACUGAAGACGAAAUAAAAAGAAGGGCGAAGAGCCCUUUUUUUG 46.6% 4% 817770% 4% yfmJ+40nt% 95.80% 94.49% 1.31% 2.37E401% UCCGAGCUGAAUGAAGAUGAAAACGGGAGGGCUUUUUGCCCUCCUUUUGU 414.2% 4% 817802% +% yfmK+45nt% 61.81% 46.98% 14.83% 1.20E401% ACUGAUCUCAUCGAAACACAAAAGGAGGGCAAAAAGCCCUCCCGUUUUCA 413.7% 4% 820837% +% yfmK+3080nt% 73.65% 80.47% 46.82% 9.10E404% UGAAAAAUGGUAAACACUUAGGGAAUAGCAUUUAAUGCUAUUCCUUAUUU 411.5% 4% 822423% +% yfmG+93nt% 51.36% 60.00% 48.64% 4.50E401% UAGUAAUGUUCAGCUUGUAGAAAAAACAAUGUUUUUUCUACAAGAUUUUA 414.1% 4% 822853% 4% yfmF+50nt% 68.31% 54.77% 13.54% 3.12E403% AAAGGAGAGGAAUUCCCUAGGGCUGUCGAGAAACGUGACAGCCUUCAUUU 411.3% 4% 825748% 4% yfmC+39nt% 80.47% 29.88% 50.59% 4.42E408% AUAAUAAAUAGGACAAAUGAGAAGCGAGGGGAAUCCUUGCUUCUUCGUUU 414.4% 4% 829299% +% pel+44nt% 96.45% 59.06% 37.39% 8.70E405% AAUUAAGAAAGUGAAAAACACAAAGGGUGCUAACCUUUGUGUUUUUUAAU 410.1% 4% 830853% +% yflS+35nt% 100.00% 98.81% 1.19% 6.20E402% CUAGGAAUAUGGUAGAAAGAAAAAGGCAGACGCGGUCUGCCUUUUUUUAU 49.8% 4% 836560% +% yflN+26nt% 93.98% 86.90% 7.08% 2.60E401% GCAAAUCGGUUAUCGUCUAUUUGACACCCGCACCACGCGGGUGUUUUUUA 412.6% 4% 838742% 4% yflJ+41nt% 95.71% 98.06% 42.35% 2.77E401% CAAUCUUAAAUAUGGCAAAGCCGCGCACGUUGAUAUGCGCGGCUUUUUUC 414.9% 4% 838781% +% yflK+39nt% 80.34% 34.53% 45.81% 7.10E404% CGGUUGAAUAGAAAAAAGCCGCGCAUAUCAACGUGCGCGGCUUUGCCAUA 416.7% 4%

! 104! 839305% 4% yflH+34nt% 74.22% 40.30% 33.92% 3.31E406% GGUUGAUAAACAAUAAAACAUGAGCCGGGCGAUAUGCGCCCGGCUUUCUU 417.2% 4% 839339% +% yflK+597nt% 86.82% 77.43% 9.39% 1.10E401% GGCUGUGACAAUAUCAAGAAAGCCGGGCGCAUAUCGCCCGGCUCAUGUUU 416.1% 4% 842011% 4% yflE+36nt% 99.40% 97.74% 1.66% 8.49E402% ACGAAGAUAAAUAAGAAAAAGCGGAGAGGUUGCCCUCUCCGCUUUUUUAU 416.8% 4% 842048% +% nagP+34nt% 99.32% 99.20% 0.12% 8.20E401% GGCUGCUGUCAAAUAAAAAAGCGGAGAGGGCAACCUCUCCGCUUUUUCUU 420.7% 4% 844692% +% yflB+47nt% 86.98% 36.43% 50.55% 1.90E404% UGAUUUGUCUUGUCUGCAGGAUGGCGAUUGAUAAAAGCCAUCCUUUUUAU 411.2% 4% 854306% +% treR+34nt% 76.18% 85.00% 48.82% 7.20E402% GCGGCGGGGGAAAUGAGAGAGGCGCCUGCCUGCGGCAGCGCGCUUUUUUG 413.9% 0x1% 855080% 4% yfkN+34nt% 95.79% 78.95% 16.84% 1.01E401% AGCGAAUCAGGCAUAAAAAAGAGCUGCUCGCUAUGCGAGCAGCUUUCUUC 415.6% 4% 855115% +% yfkO+38nt% 97.11% 99.03% 41.92% 1.20E401% AAGUGGGUUUAAAAGAAGAAAGCUGCUCGCAUAGCGAGCAGCUCUUUUUU 415.6% 4% 860263% 4% yfkL+40nt% 96.49% 88.44% 8.05% 3.99E403% UCAAGCCUAAGCAACAAAAAAACGGACGCCCAAGAGCGUCCGUUUUUUCU 411.7% 4% 861551% 4% yfkK+35nt% 48.69% 28.84% 19.85% 4.72E405% UCGCUUCGUAAAUAAUGGAGACUGGCCGGAAACUCGGCGAGUCUUUUUUA 413.2% 1x1% 863822% 4% yfkF+40nt% 75.00% 86.93% 411.93% 1.90E401% AUCUUCUUAAUCAAAAAGCCUCCCGACAUCAUGUCAGGAGGCUUUUAUGC 414.9% 1x1% 863862% +% yfkH+199nt% 100.00% 93.45% 6.55% 1.50E402% CUACCAUUAGCAUAAAAGCCUCCUGACAUGAUGUCGGGAGGCUUUUUGAU 418.5% 4% 867126% 4% yfkC+38nt% 98.02% 93.39% 4.63% 8.26E402% AGAACCCAAUAAACAAAAAAACUGAUUCCGAGUUGGAAUCAGUUUUUUAU 49.8% 4% 869486% +% yfjT+28nt% 93.38% 81.48% 11.90% 2.90E402% UUUUAAAAAAGAUUGGGAAUAAAACCGCGUGCCCGCCGCGGUUUUUUUAU 46.6% 4% 870352% 4% yfjR+36nt% 95.26% 67.22% 28.04% 7.03E403% AAUGUAUAAAAUAAAGAAAAGCCUCUCCGUUUAAGGAGAGGUCUUUCUCU 412.4% 4% 874890% +% yfjO+88nt% 99.35% 97.62% 1.73% 2.40E401% AGACCUGGAUUUCGGUAAAAUAAACAAUUCCGAUUUCCGGGUCUUUUUCG 419.2% 2x2% 875796% +% yfzA+102nt% 81.71% 17.46% 64.25% 2.60E405% UAAUUAUCUUAUGAGUGAAGACUGCGACACUUAGUCAGCAGUCUAUUUUA 411.3% 0x1% 877503% +% dusC+100nt% 74.15% 58.82% 15.33% 1.60E401% AAUUCUUGACUAAAAUAAACCUGGAUUUUCGGUAAAUCCGGGUCUUUUUU 410.6% 4% 878837% +% yfjL+67nt% 100.00% 85.42% 14.58% 4.20E403% UAAAUACGUCGAUCAUUGUCAAAGGCCGGGUGAUAUCCGGUCUUUUUUUU 411.4% 4% 885809% 4% yfjF+35nt% 76.39% 84.04% 47.65% 3.37E401% GCGCCGCGCGGAUAACAAAAUGGCCUGCUUAUGAAGCGGGCCAUUUUUGU 415.3% 4% 898908% +% catE+41nt% 100.00% 99.74% 0.26% 3.40E401% GUGAUUUAACUGCAAUCCCCUUGCCGAAAUAACGGCAGGGGGAUUUUUUA 421.4% 4% 905730% +% yfiK+58nt% 100.00% 94.24% 5.76% 1.70E403% GUUUUGCAUAUACGCUUCUCUGAAAAGGCCUUUUACAGGCCUUUUUUUCA 46.6% 4% 909121% 4% padR+77nt% 94.39% 69.96% 24.43% 3.38E405% UGUACCCACAUGCAAAAAAACAUCUGCCUAAACGGCAGAUGUUUUUUAGG 412.3% 4% 910698% +% estB+47nt% 93.77% 63.14% 30.63% 1.80E404% UAAUAUCUUCAAAAAACAACCUGCUGUCUCCGUUACAGUGGGUUUUUUCG 48.2% 4% 911929% 4% yfiR+35nt% 69.20% 80.74% 411.54% 3.01E401% GCGGAUGAGAAGUAAAGAAACGCGGCAGGAGCCCUCCUGCCGCUUGUUUU 418% 4% 916078% 4% yfiV+46nt% 100.00% 97.64% 2.36% 1.53E401% AUAAAUCAGUAAGUCUGUCAUCCGCAAACUGCGGGAGCAGGCUUUUUUUA 413.9% 2x1% 919329% 4% yfiY+37nt% 99.64% 99.84% 40.20% 6.58E401% AAAAACGAAAUAAAAAAAGACUCCGUCUUAUUAGACGGAGUCUUUUUUGC 416.7% 4% 919366% +% mprF+18nt% 100.00% 100.00% 0.00% NA% UGAUUGGCAAAAGCAAAAAAGACUCCGUCUAAUAAGACGGAGUCUUUUUU 416.4% 4% 922543% +% yfhA+40nt% 87.63% 80.27% 7.36% 5.10E402% AAAUUCUUAAUCGUUACACCCAUUUUCUUAAAAAAGAAAAUGGGUUUUUU 412.8% 4% 924210% +% yfhC+39nt% 97.51% 94.89% 2.62% 1.20E404% CUGAAAUGUAAAAAACCCCUUGUCUCAAACGGAGACAAGGGGUUUUUCAU 419.9% 4% 926778% +% yfhH+35nt% 96.33% 84.38% 11.95% 4.10E403% CAAGAAAAAGAAUAAAGCGUAACAGGAGGCUGAUGAUCAGCCUCUUUUUG 411.6% 4% 928690% +% yfhJ+32nt% 94.88% 95.15% 40.27% 7.60E401% AGAGGCCUUUUGCAUUAAAAACCUGCCGUUAACGACCGGCAGGUUUUUUC 412% 4% 930630% +% yfhM+45nt% 96.02% 69.01% 27.01% 3.50E404% AAUAAGCUAAAAUUUCUCUCCAUCCGUCUGUCAUAAUGGCAGACUUUUUC 48.7% 4% 931842% +% csbB+35nt% 45.49% 17.15% 28.34% 1.90E404% ACAAAAAUGCACUGAAAAUACCAAGCGCCAUUGGCAGUGCUUUUUUUGCG 49.5% 6x0% 934441% 4% yfhP+16nt% 97.13% 98.20% 41.07% 6.66E401% ACUUCAGAAAAAAUUAAAGCUCGGCUCUAUAUAGAGCCGGGCUUUUUACG 417.6% 4% 938205% +% sspE+51nt% 100.00% 93.15% 6.85% 4.50E402% CACUGAAACAGAAAAAAGCACUUCAUCUUCGGGUGGAAGUGCUUUUUUCU 413.5% 0x1% 939306% +% ygaC+45nt% 72.01% 13.48% 58.53% 8.30E407% AAUAAUGGUUACGUAAAAACCUGUUGCGGGGUACAACAGGUUUUUCACAU 47.9% 4% 941136% +% ygaD+45nt% 97.12% 94.45% 2.67% 6.00E402% ACUAAAACAUCAAUCUUAUAUCCUUUUAACGAAGGAUAUAAGAUUUUUUU 414.2% 4% 941143% 4% ygaE+25nt% 97.46% 98.03% 40.57% 9.94E401% CUGCGAAAUAGAAACAGAAGAGUAACCCGGUUAAACAGCCGGGUUUUUUU 410.1% 4% 942407% 4% gsaB+42nt% 98.42% 98.32% 0.10% 9.91E401% AAAACUAGAAUCAAAUACCUUGAACAGGAGCUUUGAGCUCCUGUUUUUUU 411.5% 4% 944921% 4% ygzB+38nt% 79.26% 84.62% 45.36% 2.94E401% AUGUCGAAAUAAAAUAAGCUGACCGUUUCGUGCGGUCAGCUUAUUUUUAA 419.4% 4% 944962% +% perR+38nt% 99.05% 98.23% 0.82% 2.00E401% GAAAAUCAUUAAAAAUAAGCUGACCGCACGAAACGGUCAGCUUAUUUUAU 413.1% 4% 953040% +% trnD4Leu1+93nt% 98.78% 95.94% 2.84% 9.60E403% AUUAUAACUAAUCAUAUUAAUGAUCUACAUAAGUAGAUCAUUUUUUUAAU 49% 4% 953335% +% trnD4Leu2+41nt% 98.67% 98.57% 0.10% 7.50E401% CCACCGGUAUACUGAAAAACCCGUUUCUUAACAGAAACGGGUUUUUAUUU 412% 4% 953343% 4% spo0M+30nt% 51.29% 35.75% 15.54% 4.80E403% UAGACCAAUACGCUGAGUAAGUAUAAAAAGGAGCCGAGGCUCCUUUUCUU 48.5% 4% 953372% +% trnD4Leu2+78nt% 56.41% 23.92% 32.49% 7.00E403% CGGGUUUUUAUUUUUUAUUAAAGAAAAGGAGCCUCGGCUCCUUUUUAUAC 48.5% 4% 955838% +% ygaJ+253nt% 37.60% 52.04% 414.44% 3.70E403% UGUUUCUUUCUGACUGUAACCGGGUUCAUUUAUAUGAAUCCGGUUUUUUG 413.6% 4%

! 105! 957703% +% thiC+36nt% 79.03% 31.81% 47.22% 1.20E406% AUUUAUAUCAAUAAAAAAAAUGAAGAUGGAGAAUGCUCCAUCUUCAUUUU 49.1% 4% 958641% +% thiC+974% 29.60% 26.20% 3.40% 8.00E401% UCUCAAGCUGCACGAGGCUGUCGCAAGUAAGACCGGCAGCCCUUGUUAAA 412.3% 0x1% 959288% +% thiC+1621nt% 94.02% 96.93% 42.91% 4.30E401% GCUGAUCGGAACACCGAAGGCUCUUAUCGUUUAGAUAAGGGCCUUUUUUG 414.7% 4% 959492% 4% katA+43nt% 99.72% 99.15% 0.57% 2.18E401% UUCUUAAUGGAGAAAUGCAAAAACCCGUUGUAGUCAGCGGGUUUUUUUAU 410.1% 4% 966178% 4% ygaO+18nt% 81.93% 82.82% 40.89% 8.97E401% AGAAAAACGAAAAAAACUCCGGCGCGCUGUAAUCGGCCGGAGUUUUUUCU 413.4% 1x0% 967198% +% trnSL4Gly1+60nt% 96.64% 57.36% 39.28% 4.10E404% AUUAACGCAGUGUUUCGUUUCUCAGAUAAACGAAGUAUUGCGUUUUUUUA 414% 4% 970655% +% cspR+38nt% 99.61% 99.08% 0.53% 2.20E401% GAUUUAAAAUAGUGAAAAACCCGCUCAUCGAUGAUGGGCGGGUUUUUUUG 415.9% 4% 972822% 4% cspB+11440nt% 92.97% 83.46% 9.51% 8.33E405% GCCUGGAAAAGAAUAAAAAAGGGUGCUCCUGAAAGAGCACCCUUUUUGUA 414.4% 4% 980358% +% yhcC+45nt% 100.00% 100.00% 0.00% NA% AGUAAUGAAAAAGGCAAAUCCGUUUACUCAUGCGGGUUUGCCUUUUUUGC 416.9% 4% 984170% 4% cspB+92nt% 97.40% 99.53% 42.13% 4.90E401% UUUAUUUUGACAAAAAAGCUGUUUUGCAUAAGCAAAACAGCUUUUUUUAU 413.9% 4% 984210% +% yhcI+40nt% 39.02% 49.56% 410.54% 2.20E401% UGCAAACUAAUAAAAAAAGCUGUUUUGCUUAUGCAAAACAGCUUUUUUGU 414.4% 4% 984213% 4% cspB+49nt% 99.77% 98.82% 0.95% 7.86E406% AGCAUAAAUUGAUAUGAAAAACUGCAGGUGCAAACCUGCAGUUUUUAUUU 413.1% 4% 985747% +% yhcJ+16nt% 94.37% 78.61% 15.76% 1.30E401% UCUUUCAGAUUGGAAGAAUGAAUUCGAACAUUGAAUUCAUUCUUUUUUUU 410.7% 4% 988420% +% tcyP+43nt% 97.68% 94.66% 3.02% 4.10E402% AGCGUAACAUAUGAAAACGUGUAAUCCAAGAGGAUUACACGUUUUUUUAA 413.8% 4% 989627% +% yhcN+36nt% 98.02% 98.01% 0.01% 6.70E401% CUAACGCUGAAUAAAUGAAAGAAGCCGCACAAUUUGUGCGGCUUUUUCUU 412.7% 4% 995589% 4% yhcT+35nt% 64.71% 55.56% 9.15% 8.59E401% ACAUAUUUUUCAUGAAGAAAAGCCGCAGGCACUGCCUCGGCUUUUUAAGU 410.8% 1x0% 1002447% +% glpP+125nt% 70.37% 57.33% 13.04% 1.50E401% UUUACGGCAAAUGUUUAUGCACCCGUAAAGCGGUUUGUUGUGGUUUUUUU 411.5% 1x0,%0x1% 1004943% +% glpK+109nt% 86.99% 86.61% 0.38% 7.30E401% GAGACCACAGCACCAAAGUGUAAGCAUGCACUUUGGCUGUUGUGGUCUCUUUUU 434.2% 0x1% 1006676% +% glpD+34nt% 70.59% 59.12% 11.47% 1.80E401% ACCGCUUGAGCAAUAAAUCAUAACGGGCUGUCUGCAGCCCGUUAUUUCUU 413.2% 4% 1008562% +% pgcA+43nt% 99.47% 97.18% 2.29% 7.20E402% AAAAUAAUUCAAGUAUGAGCUGGGUCAUUGUAAAUGAUCCGGCUUUUUCU 413.4% 4% 1010986% +% yhdA+17nt% 59.01% 33.13% 25.88% 9.40E403% AUGUUCGCAAAAGCAGGAAAUCCCGGCGUCUAAACGCCGGGAUUUGUUUA 416.8% 4% 1011750% 4% lytF+42nt% 96.50% 89.75% 6.75% 6.49E404% AUUUCUAAAAACAGAAACUGUGCGGCCUUAACGGCUGUACAGUUUUUUAU 415.9% 4% 1013389% 4% nsrR+22nt% 97.79% 92.76% 5.03% 6.20E402% CAUGAAGCUUUUAAAAAUGAAGGAAUAGAUUAAGAUUCCUUCUUUUUUUA 48.1% 4% 1020042% +% lytE+40nt% 99.75% 98.03% 1.72% 2.80E402% AAGAUUCUAAUUUUUAGAGAAAACCCGUUCAUUGGAACGGGUUUUUUUCA 410.3% 4% 1023136% +% yhdF+36nt% 100.00% 97.48% 2.52% 2.90E401% UUAUUUCAACGUAAUCAACGAAAAACCAGCUCAAGAGCUGGUUUUUUGUG 48.6% 4% 1024790% +% ctrA+43nt% 95.96% 42.48% 53.48% 1.00E407% UCAAUAACCUUUUGAUAAAGAGAGCGGCCAUACAGGCCGCCUCUUUUCUG 415.7% 1x0% 1026253% +% yhdH+33nt% 92.22% 92.50% 40.28% 5.40E401% GAAUUUUAUCAUUUUAAAAAACAGGCUCCGUUUCCGGGGCCUGUUUUUUA 415.6% 4% 1028203% 4% yhdK+30nt% 98.61% 95.31% 3.30% 3.94E401% AUUUACAGUUUGGCUUUUAAAAAAGACGCCUUUUCAGGCGUCUUUUUUCG 410.3% 4% 1028236% +% yhdJ+34nt% 98.82% 64.89% 33.93% 2.10E404% CCGAAAACCGGUAUAACGAAAAAAGACGCCUGAAAAGGCGUCUUUUUUAA 413.1% 4% 1032029% 4% yhdP+34nt% 97.73% 92.47% 5.26% 1.36E402% CCAGCAGGAAGCAUAAUAAGAAAAGCACCUUGUAUAGGGUGCUUUUCUUA 48.3% 4% 1032063% +% plsC+69nt% 82.67% 40.26% 42.41% 1.80E406% CUGAAACUGUGAAAAUAAGAAAAGCACCCUAUACAAGGUGCUUUUCUUAU 46.4% 4% 1035274% +% yhdR+47nt% 78.95% 29.34% 49.61% 1.00E406% UAAGAAGGCAAAGAAAAGAAAACAGUUUUCAAGGCUGUUUUCUUUUUAUA 48.9% 4% 1036955% +% yhdT+16nt% 96.82% 95.85% 0.97% 3.40E401% GAUGCUGAACAGUGCAACCUUGAGCGAGAAAUAAGCUCAAGGUUUUUUUA 412.1% 4% 1038827% +% yhdX+67nt% 99.49% 94.31% 5.18% 5.30E403% GGCUGAUAGAUGAAUUGAGAAAUGACCCCGGCGUUUCGCCGGGGUUUUGU 415.7% 4% 1040063% +% yhdY+39nt% 90.30% 82.74% 7.56% 1.90E401% AACGGGCUUAAAAGAGAGACUUCGUCUGACAGAGGCGGAGUCUUUUUCAU 413.1% 4% 1040826% 4% yheN+35nt% 88.43% 35.03% 53.40% 7.24E408% CCUGUUCAUGAAUAAAAAAGUGAGGCGCAUAAAGCGGCUCACUUUUUCAU 412.6% 1x1% 1042849% 4% nhaC+36nt% 94.20% 81.33% 12.87% 3.39E401% UUGUUAAAAAAUAAAAAGAGCCCCGCUGUAAAAAGCGGGCUCUUUUCUUC 414.6% 1x0% 1042888% +% dat+46nt% 96.48% 81.90% 14.58% 6.80E404% AUAAAUGAACGAAGAAAAGAGCCCGCUUUUUACAGCGGGGCUCUUUUUAU 413.3% 0x1% 1045186% +% dat+2344nt% 95.20% 94.79% 0.41% 9.90E401% ACAUAUCGGUUAAAAAAGGCAUGGAGCUGACGCUUCAUGCCUUUUUUAUA 416.1% 4% 1049133% +% yheH+40nt% 90.22% 57.59% 32.63% 9.50E406% CAUUGCAUAACGCUCAAAAACCCAAAACAAUCGUGUUUUGGGUUUUUGGU 410.4% 4% 1050416% 4% yheE+27nt% 100.00% 97.33% 2.67% 8.76E402% UGCUUUUUCAUAUUUAUGACUAGCUUAGCCUAAACGGCUAAGCUUUUUUU 412.3% 4% 1055137% +% yheA+38nt% 98.46% 95.10% 3.36% 8.80E403% GUUGAAGGCUAAUAAGCAAAAUCCCUUCUUGGAUAAGAAGGGAUUUUUUA 410.7% 4% 1056619% +% yheA+1520nt% 87.66% 53.92% 33.74% 3.00E407% UAUCCUAUCAACAAGCCAUACAUAAAGUCUGCUGAGCCAGGCUUUUUUUG 43.5% 0x1% 1059205% +% hemZ+20nt% 98.80% 95.86% 2.94% 4.30E401% AUUUUUGAAAAAACGACAAAGCAGCACUGAUUACAGUGCUGCUUUUUUUA 415% 4% 1064777% +% natB+38nt% 95.55% 64.38% 31.17% 1.80E408% GCGAAAAACUGAUUGGAAAACAGCCUGGGGAUUCUCAGGCUGUUUCUUUA 414.3% 4% 1070032% +% yhaM+46nt% 96.43% 88.27% 8.16% 1.60E403% AUAACUUAAAAAGGACUGAUGCUGACAUAUUCAGCUCAGUCCUUUUUGAU 417.4% 1x0% 1070329% 4% prsA+35nt% 81.40% 74.38% 7.02% 5.29E401% AGCAAUUCUAAAUAAUAAAAAAAGCUGUGCGGCUCAUUGAGCCGCACAGC 423.2% 4%

! 106! 1071709% 4% yhaJ+333nt% 78.25% 97.02% 418.77% 3.34E404% AGUGUAAAUACGAAAGAAAGCAUAGCUGCUGAUUAAGCAGCUAUGCUUUU 418.9% 4% 1072942% 4% hpr+164nt% 72.15% 68.07% 4.08% 9.58E401% AAAAAGCGCAAGGAGCUUAUCAAAGGUUACAAAUCCUUGCGCUUUUUGUGU 414.7% 0x6% 1073843% 4% yhaH+52nt% 98.90% 98.83% 0.07% 9.90E401% UCCUAUUCAAAAGAAAAAAAUGCGGGCCAAAAUUGGACCCGUAUUUUUUU 411.7% 0x1% 1074603% 4% trpP+43nt% 91.29% 64.75% 26.54% 5.31E405% UAAAUAAUUGUCACACAAAACCUCUUCCGCUUCCGGGAGAGGUUUUUUUG 413.5% 4% 1076501% 4% hinT+14nt% 95.17% 85.97% 9.20% 6.56E407% UCUUCCUCUAUCGCAAAACGCCUGGCCUCAUCAUAAGAUGAGGUUAUUUU 49.3% 4% 1080112% 4% yhaA+38nt% 87.93% 80.39% 7.54% 8.90E403% CAUCAGCUAUAAAAAAACAGCCGGAGUGUUUAUUCUCCGGCUGUUUCCUU 417% 4% 1080152% +% ecsC+20nt% 94.31% 93.28% 1.03% 7.60E401% AGGAUAUUAAAGGAAACAGCCGGAGAAUAAACACUCCGGCUGUUUUUUUA 416.6% 4% 1083203% 4% yhgC+26nt% 95.61% 90.17% 5.44% 3.95E402% ACCACAUAUUUCGCUGUCGAAUAGCUGCCGGCAUGUCCGGCAGCUUAUUU 414.9% 4% 1088265% +% in%hemY%CDS% 23.43% 7.55% 15.88% 1.20E403% AUGUAGUCAUCAUCGGCGGCGGCAUUACCGGUUUAGCCGCCGCCUUCUAU 419.7% 4% 1089640% +% hemY+31nt% 98.12% 95.78% 2.34% 2.90E401% UACCUAUUUAUUCAGCUAAAACCUCCGCUUUAUCGCGGAGGUUUUUUUGA 412.9% 4% 1092728% 4% fabHB+42nt% 98.02% 88.00% 10.02% 4.13E402% GGAUGUAACAAAAAAAGAACUUGUUUCCAAGGAAACAAGUUCUUUUUCUU 414.3% 4% 1092768% +% yhgE+40nt% 100.00% 98.83% 1.17% 1.70E401% GGCUUCAUAAAGAAAAAGAACUUGUUUCCUUGGAAACAAGUUCUUUUUUU 414.3% 4% 1096520% 4% gltT+40nt% 99.33% 97.12% 2.21% 3.62E402% UUCUGGUUAAUGAAAAGCCUGCGGGGUUCUUGCCCCGCAGGCUUUUUUAA 424.3% 4% 1096561% +% yhfF+38nt% 94.53% 84.41% 10.12% 7.50E403% GUUAAAGAUUAAAAAAGCCUGCGGGGCAAGAACCCCGCAGGCUUUUCAUU 422.3% 4% 1100905% +% yhfK+42nt% 99.14% 97.94% 1.20% 1.90E401% AACUAUGACAGUACUGACACUCAGGGCUUUUUGCUCUUGAGUGUUUUUUU 412.9% 0x1% 1107561% +% yhfP+45nt% 46.75% 54.44% 47.69% 2.20E401% UUUAACAGGAUCAGCUUGCAGAGAAUGUUAUUUUUCUGCAAGCUUUUUUG 417% 4% 1108703% 4% phoE+33nt% 93.74% 86.67% 7.07% 7.18E401% CCGGCUUUAUCAAAUAAGAAAAAGACAGGCGUUUGCCUGUCUUUUCUUUU 411% 4% 1108738% +% yhfQ+34nt% 97.87% 95.32% 2.55% 1.40E402% GGCUGCUAAGAAAUAAAAGAAAAGACAGGCAAACGCCUGUCUUUUUCUUA 411.4% 4% 1112581% 4% hemAT+39nt% 98.99% 97.86% 1.13% 1.62E401% CAGAAGAAUAACCAUCAAAAACCGGUCUGCCAUACGGCCGGUUUUUUUGC 48.8% 4% 1116555% 4% yhzC+28nt% 95.93% 88.35% 7.58% 7.27E403% AGCGCUCAAGCAGAGCGAAUAAGCCAAUCCUUCAAGGAUUGGCUUUUUAU 412.6% 4% 1117732% +% comK+45nt% 51.88% 51.97% 40.09% 7.90E401% AUUAGAAAAAUAGGAAGGAGCUGACCGAACAGGGCAGCUCCUUUCAUAAA 414.5% 1x0% 1119121% 4% yhjB+41nt% 87.12% 92.63% 45.51% 4.65E401% GCGGCCUAAGCAUAAAAAAAGCAAUCUGGACACCAGAUUGCUUUUUCUUA 411.7% 4% 1119159% +% yhjA+40nt% 91.51% 89.55% 1.96% 9.40E401% UGAACGGUAAAUAAGAAAAAGCAAUCUGGUGUCCAGAUUGCUUUUUUUAU 411.7% 4% 1124995% +% yhjH+30nt% 97.97% 91.00% 6.97% 1.30E402% UUCCUAGCAUUUUUAAAUAAAAAACACGCACUGCGGUGCGUGUUUUUCGC 410.6% 4% 1130739% 4% yhjN+179nt% 86.29% 73.14% 13.15% 4.49E402% ACGACUUACGAUUGAAAAAGAGGUUAAAAUGAAUAACCUCUUUUUCUUAU 46.6% 4% 1130780% +% yhjM+76nt% 46.51% 50.00% 43.49% 2.80E401% AUCUUUAUAUAAGAAAAAGAGGUUAUUCAUUUUAACCUCUUUUUCAAUCG 47.4% 4% 1143555% +% addA+50nt% 39.19% 28.78% 10.41% 1.30E401% CGAGAUCCAUAAGCUCCGGAAUUUCAGGCGGAGCGGGUCUCGUUUUCUAU 420.4% 4x0% 1148499% +% yisB+42nt% 97.01% 87.34% 9.67% 2.80E401% AAAAAUGACUAAAAAGCAGCCCUCUCUUUGCAGAGCGGCUGCUUUUAUCC 415.1% 0x1% 1153667% +% yisL+46nt% 98.56% 94.50% 4.06% 1.50E403% UUAAUAGAAAAACCUAUGAACCCGGCUCUUUGAUAGAGCUGGUUUUUUUU 412% 4% 1156507% +% wprA+34nt% 99.41% 99.42% 40.01% 9.00E401% UGUUGUUGAAAAGUAACCAAAAAGCGGUGCUCGAUGCACCGCUUUUUUAU 413.2% 4% 1164185% +% degA+24nt% 93.86% 91.86% 2.00% 3.00E401% AUUCUACAUCACCGCUCAACACAUGAGCCCGCUAAUGAGCGGGUUUUUUC 49.5% 4% 1180638% 4% yitK+271nt% 97.38% 79.02% 18.36% 8.21E405% GAAGAGACAAAAUCACUGACAAAGUCUUCUUCUUAAGAGGACUUUUUUUA 46.5% 4% 1182397% 4% yitM+51nt% 98.43% 98.39% 0.04% 7.50E401% CAUAAAAAAACGGCUCGCUCCGCAGUCUGCUGCAGGCGAGCCGUUUUCAU 423.2% 2x1% 1182444% +% yitL+49nt% 97.36% 97.73% 40.37% 9.00E401% GCAUGAAAACGGCUCGCCUGCAGCAGACUGCGGAGCGAGCCGUUUUUUUA 425.5% 0x1% 1187657% 4% yitS+43% 100.00% 98.02% 1.98% 1.65E401% AAAAUGAGCAAACAAAAACAGUCAGACUCUGUGUCCUGACUGUUUUUGUU 410.2% 0x1% 1190001% 4% yizC+35nt% 92.72% 76.64% 16.08% 1.30E404% GACAAACUGCAAUAAAAAAAGGCUAUGGCGACUCGCCAUAGCCUCUUAUU 416.7% 4% 1190038% +% ipi+33nt% 98.34% 98.70% 40.36% 5.40E401% AGUUUGAAGUCAAAUAAGAGGCUAUGGCGAGUCGCCAUAGCCUUUUUUUA 416.7% 4% 1192605% +% yitW+43nt% 82.35% 84.46% 42.11% 5.60E401% UCAAUAAAACAAAAAAGGACAGCCUGACAUGUGAGGCUGUCCUUUUUUAC 416% 4% 1194501% +% yitY+213nt% 35.58% 26.66% 8.92% 1.20E401% UUACCCGCUCCUCGGACGGCUGUCUGAAAGGUUUGACAGCCGUUAUUUUC 413.4% 4% 1204443% +% argF+23nt% 93.49% 79.94% 13.55% 2.90E402% AAAGGGGAAUCAUCAAAAAACUGCUGAGCCAAACUCAGCAGUUUUUUUGA 411.8% 4% 1204689% 4% yjzD+42nt% 98.89% 94.62% 4.27% 2.97E402% AGCAUUAAAAAGCCAAAAACCCAAAACAUUUAUUGUUUUGGGUUUUUUAG 411.2% 4% 1207822% +% comZ+34nt% 85.71% 80.90% 4.81% 4.70E401% AUCUGAAACAGAAUAAGAAGAAGCCACUUUUUUGAAAGUGGCUUUUCACA 49.8% 4% 1210466% +% fabF+42nt% 99.94% 99.86% 0.08% 6.50E401% AAUCAUAAUCAAGCCAAACCGGCUGCCCUUAAAGGGUAGCCGGUUUUUUU 420.5% 4% 1215212% +% appA+45nt% 48.62% 39.83% 8.79% 2.60E402% AAUAAAUUUCCCUUAAAGGGGAGGGAGAGCGUUUUCUCCCUCUUCUGUUU 413.2% 4% 1217216% +% appC+95% 92.72% 58.82% 33.90% 1.20E404% AGCAGGUCUCCUUUAGUCAGAAAAUAUACAAAGAGAUCUGCUUUUUAUGA 411.5% 1x0,%1x0% 1218076% 4% trpS+37nt% 98.75% 99.47% 40.72% 4.38E401% AAAAAGACGCUAAUCAAAAAACCGCUCUUUGCAAAGAGCGGUUUUUUUCA 411.3% 4% 1219137% 4% yjbE+8998nt% 77.60% 71.87% 5.73% 4.82E401% ACCACGGUUCAUUCGUCCCUUUUUUACAGGGGAAGAAUGAGCCUUUUUUA 420.6% 1x1%

! 107! 1221550% +% oppA+64nt% 66.05% 63.34% 2.71% 7.10E401% AUAAAAGACCUCAAGGUAUAUGGGGAGAAAAGCCCCAUAUACCUUUCUUA 417.7% 4% 1225491% +% oppF+41nt% 99.70% 99.56% 0.14% 3.90E401% UUUUCAUGAUUCAUCAAUCCUUCAAGAGAUUUCUCUUGAAGGAUUUUUUU 416.7% 4% 1228139% +% spxA+47nt% 99.00% 90.57% 8.43% 3.70E405% UAAUAGAUCGUAUCAUCAAAAGAAGGCUGAGUCAUCAGCCUUCUUUUAUU 414.2% 4% 1229759% +% mecA+35nt% 99.92% 98.87% 1.05% 2.50E402% CACUUUGCAUCAUAGCAAACCGAUUUCCUUCCGGAAAUCGGUUUUUUUUA 412.5% 4% 1233136% +% pepF+41nt% 94.79% 85.19% 9.60% 5.80E402% CAGUCUUAAAAAAGUAAGCCUGUGCGGAAAUGACGCACAGGCUUUUUUAA 417.5% 4% 1233544% +% pepF+449nt% 99.69% 99.57% 0.12% 1.40E402% GUUGUCGUUAAGACAUAUGAAACCGCGCUUAUCCCGGCGCGGUUUCUUUA 411.7% 4% 1233580% 4% yjbH+34nt% 95.20% 91.78% 3.42% 3.02E401% AUCAUGUGAAAAAUAGCCGCAGGCGUGCAUAUGCUUGAGGCUGUUUUUUU 415% 1x1% 1235132% 4% yjbJ+31nt% 97.57% 84.71% 12.86% 1.54E406% UUCAGUUUAUUACGCGUAACCAGAGGUGCUCUUUCCCUCUGGUUUUUUUG 49.9% 4% 1.00E+0 1239390% +% yjbO+16nt% 95.88% 94.72% 1.16% 0% CAUGAGCAAACUGAUAAAAGGAGAGAAUCAUUGAUUCUCUCCUUUUUUAU 413.4% 4% 1242419% +% yjbQ+219nt% 35.87% 35.78% 0.09% 9.10E401% UGUUAUUUUACUAUGCCAAUUCCAAACCACUUUUCCUUGCGGGAAAGUGG 413.4% 4% 1246464% +% thiG+653nt% 12.65% 8.77% 3.88% 7.30E403% UGAAACUGCUGACGGGAGAGGAGUGCGAGCCGGUGCUGCGCUCCUUUGAU 414.1% 1x0% 1247680% +% yjbV+28nt% 95.82% 70.84% 24.98% 1.20E408% CAGCUUAAAUACAAGCCGAUGAGAUCACCAGCUGAUGGUGAUCUCUUUUG 47.1% 4% 1248609% +% fabI+45nt% 99.42% 98.69% 0.73% 1.90E401% GCUAAGCAGGAUCUAUAUCAAGCAAUCCCGAAUAGGGAUUGCUUUUUUAU 413.1% 4% 1253683% 4% yjcD+30nt% 94.09% 78.54% 15.55% 1.87E402% GACAGCCCUUGCAUCAUUAACAGCCCGGCAGAUUACUGCCGGGUUUUUAC 415.4% 4% 1256358% 4% yjcF+78nt% 93.20% 82.22% 10.98% 1.14E401% UUUUACUGCAUAUAAAAAAACCGUUCUCUGGUAUGAACGGUUUUUUAUAC 47.6% 4% 1256402% 4% yjcF+34nt% 90.11% 64.74% 25.37% 8.53E406% AAUGAUGAAGGACUGAACGCAUCCGGAUCUUUUGAGAUCCGGAUUUUUAC 413.8% 4% 1258466% +% yjzE+2103nt% 97.79% 96.77% 1.02% 7.60E401% GAUAAGAAGAAGCGUUAAACCCCUUCUUCUUAUGAAGAAGGGGUUUUUAU 417.1% 4% 1260813% +% yjcJ+35nt% 75.32% 70.65% 4.67% 7.50E401% GUUUCGGUUCGUUAAAAAAGAAGCCGGGGAUAGUCCGGCUUCUUUUAUUA 416.2% 4% 1262895% +% trnSL4Val2+34nt% 96.85% 94.69% 2.16% 8.60E402% AGCCCAGUCGGAAUCAUAGCUUAAACCCUUGCGCAGCAAGGGUUUUUUAC 49.4% 4% 1263607% 4% yjcM+95nt% 63.08% 63.50% 40.42% 9.56E401% GCUGUUGGGAAAGCAAUCCCCUGAUCUAGAGUGGUUCAGGGGAUUUUUGU 414.3% 1x1% 1265473% +% yjcN+96% 97.56% 88.06% 9.50% 8.70E405% CGGACACUGAUCGUUUUACAGAGAAAUUUGUGCUUCGAUCGGUGUCCGUUUUUU 429.1% 3x3% 1267441% +% yjcQ+28nt% 99.90% 99.52% 0.38% 1.60E402% GAUUAAAGAUUGGAUUAAAUAAUAAGAGCAUCCUGCGGGGUGCUUUUUUU 47.9% 4% 1269691% +% yjdA+107nt% 92.80% 87.12% 5.68% 2.20E401% UUGAAGCGAAAAUAAGGUCCCUUCUCUUUUUAGAGGGGGACCUUAUUUUA 416.1% 1x0% 1276291% 4% yjdG+46nt% 79.51% 86.23% 46.72% 5.34E402% GUAGAGUCCUUAAUUACAAAAGCAGGCACUGCGCCUGCUUUUGUUUGGAU 417.1% 4% 1276328% +% yjdF+37nt% 82.65% 77.26% 5.39% 1.90E401% CAGAGGUAAAUAAUCCAAACAAAAGCAGGCGCAGUGCCUGCUUUUGUAAU 49.8% 4% 1278180% 4% yjzH+25nt% 45.27% 40.17% 5.10% 4.90E401% UGAAAGGGAUGCGGAAAAAGCUUAAUCGAUAUGACUAAGCUUUUUCGUUC 43.9% 1x1% 1278221% +% yjdI+56nt% 63.15% 41.50% 21.65% 2.90E404% AUAUAGGGGAACGAAAAAGCUUAGUCAUAUCGAUUAAGCUUUUUCCGCAU 48% 4% 1279513% +% yjdI+1348nt% 87.40% 65.83% 21.57% 6.70E402% CUGUUUUUCCAAACAAAAAAGAGUCACAUUAAUGUGUGGCUCUUUUUGCA 411.5% 4% 1282533% 4% yjfA+38nt% 97.74% 98.16% 40.42% 5.90E401% GGCUCUUAUUAAAUAGAAAAAAGGCUGUCCGUACGGACAGCCUUUUCUAA 415.2% 4% 1282569% +% yjeA+38nt% 98.96% 100.00% 41.04% 3.60E401% GAAGCGAAAUAAAUUAGAAAAGGCUGUCCGUACGGACAGCCUUUUUUCUA 415.2% 4% 1283121% 4% yjfB+48nt% 84.69% 86.15% 41.46% 3.20E401% AACCUCAUACCAGAGGCGGCCAAGAACUCCAUCCUCCCGGCCGCCUUUAU 414.1% 2x2% 1290644% 4% yjiA+31nt% 81.82% 55.32% 26.50% 5.13E401% AAAACACAUUACAUUAUAAAAAAGAAAGAGCCCACAGGCUCUUUCUUUUU 46.6% 4% 1293738% 4% yjzI+38nt% 97.88% 88.48% 9.40% 6.13E402% AAAAAUAUUUAAACAGAAAACCGAAAUCAAAUUGAUUUCGGUUUUUAUGU 49.3% 4% 1293776% +% yjiC+41nt% 50.41% 36.71% 13.70% 2.70E401% CCGCAGUAAAAACAUAAAAACCGAAAUCAAUUUGAUUUCGGUUUUCUGUU 49.3% 4% 1294954% 4% yjkA+42nt% 91.84% 82.45% 9.39% 1.71E402% AUGAAUGACAGACAAAAGCCGCUUUCCGAGGGAAAAGCGGCUUUUUGUAC 412.6% 0x1% 1294994% +% hemD+44nt% 92.03% 72.82% 19.21% 4.80E404% GAAUAACAAGUACAAAAAGCCGCUUUUCCCUCGGAAAGCGGCUUUUGUCU 414.5% 4% 1296580% 4% yjlA+40nt% 94.21% 73.06% 21.15% 2.51E405% GACUGCGUAGCAUCUGCAGGAGAAUGGGUGAAAGCCUGUUCUCCUUUAUU 417.3% 4% 1300318% +% ndh+66nt% 96.35% 96.17% 0.18% 3.90E401% GGCAUUGCCAAAAGCAUUCCUUUCCGAGUGCUUUCUGGCAAUGUCUUUUU 425.4% 0x1% 1309831% +% exuR+28% 82.43% 80.80% 1.63% 7.70E401% AGUCAGACGAUUGACGACGUGAUGUCCCGUUUUUCAGCGGGCAUUCUUUA 48.9% 1x0% 1313796% 4% yjoA+44nt% 99.83% 97.86% 1.97% 2.94E401% AUGUAGCGUAAACAAGAAAAAAGAUACCUGUUAAGAGGUAUCUUUUUUUU 47.7% 4% 1315763% +% yjoB+39nt% 97.24% 96.79% 0.45% 6.00E401% GUUUUCACUAAAAGAAAGCACGGGUGUUUGAAAAACCCGUGCUUUUUUGU 413.9% 4% 1318489% 4% yjqA+39nt% 71.94% 83.40% 411.46% 3.72E402% UUUGUAUGUAAGGCGAAAAGACGGAAGCUUCACAGCUUCCGUCUUUUCAU 415.7% 4% 1320567% +% yjqC+41nt% 77.27% 66.03% 11.24% 2.50E401% AAAUGUUAGGUUCUCUUCUGGGCUGAGGAAUAUAUCCUCAGCCCGUAUUU 420% 4% 1321206% 4% xre+123% 76.25% 14.58% 61.67% 1.50E407% AGGGAAAGAUUUCUACACUACCUUCCAGUCCUAUACGGGCUUUUCUUUCU 43.1% 4% 1334299% +% xkdM+52nt% 25.55% 21.14% 4.41% 4.60E401% AAAGCUGAAUCAGCCCAUACGCAGACCUUUCUCAGAAAGGUCUGUUUUUU 412.7% 4% 1348225% +% xlyA+43nt% 67.11% 86.34% 419.23% 1.30E402% AAGCUGAUCAAAGACCAUAAAAAUCCCGGAGCCGCUCCGGGAUUUAUUUU 413.5% 4%

! 108! 1348398% 4% spoIISB+44nt% 85.85% 32.88% 52.97% 5.65E407% GCAUGAUCACACUAAAAGGACAAGGGAAAACAGCUCUUGUCCUUAUUCCU 412% 4% 1349433% 4% pit+35nt% 97.34% 87.21% 10.13% 2.21E405% AAUAUGAUAUUUUAAUGUCACACCGCUUCUGUCAAAGGAGCGGUUUUUUU 411.9% 4% 1351339% 4% ykbA+36nt% 98.55% 95.20% 3.35% 1.65E401% GAAAAGCAAGCUGAUAAAACGGUUCCCUUGUUUAGGGAACCGUUUUUUGG 415.1% 4% 1357419% 4% htrA+517nt% 92.82% 72.80% 20.02% 4.86E405% GUGCUCAGAGCAUAAAAACCCCCUGUCCAUUACGGACAGGGGGUUUGAGG 421.2% 4% 1357893% 4% htrA+43nt% 98.02% 85.58% 12.44% 1.96E404% UUCGUAAGACAUAAUGCCUCAGGCCGUAAAAGCGGUCUGAGGCUUUUUAU 422.5% 4% 1360296% +% proG+24nt% 97.20% 98.00% 40.80% 8.50E401% CAGAACAGGUUGGUAAACAAACAUGAAUCCUUGAAAGAGGAUUCUUUUUU 410.7% 4% 1369836% 4% ykgB+40nt% 98.84% 97.65% 1.19% 5.23E402% UCAAGUAUAAACAAAUGGAGUGGCUCUAGUAAAAAGGAGCCACUCUUUUU 417% 4% 1372592% +% ykhA+39nt% 93.85% 90.17% 3.68% 5.50E401% AGCCUUGGUGAACGUUAAACCCAAAACAUAAGUUGUUUUGGGUUUUUUUG 411.2% 4% 1376476% +% ykkB+181nt% 96.62% 94.98% 1.64% 1.50E401% AAGCCCGGGAGAGUCAAUCUCAUGUGAGACGACUGUCCGGGGUUUUUUUG 420.8% 2x1,%1x1,%1x1% 1378179% +% purU+34nt% 94.49% 69.12% 25.37% 4.20E407% AAUCGUCUUUAACUAGACUGCAAGAGGCCCGCGCAAUGCGGGCUAUUUUU 411% 4% 1378468% +% purU+323nt% 98.04% 99.64% 41.60% 3.20E405% CACGGAAACCCAUUUCGUCCUUAUGAAUCAGGAUGAAAUGGGUUUUUUUA 419.1% 4% 1381405% 4% ohrR+29nt% 99.05% 92.91% 6.14% 9.95E402% ACACUUCAUCAAAAAAAUUGAGGAUGCCUUGUACAGGCAUCCUCUUUUUA 416.7% 4% 1381441% +% ohrA+38nt% 97.78% 94.93% 2.85% 2.10E401% GUUGCUGAAUAAAUAAAAAGAGGAUGCCUGUACAAGGCAUCCUCAAUUUU 418% 4% 1383281% 4% metE+39nt% 98.37% 96.01% 2.36% 2.92E401% AGCUAGUAUAAUUUGAAAAAACCAUCUGCAUUUGGCAGAUGGUUUUUUUC 412.3% 4% 1385680% 4% ispA+1140109nt% 98.52% 97.72% 0.80% 3.30E402% UGUUUUACGUAGAAAAGCCUCUUUCUCUCAUGGGAAAGAGGCUUUUUGUU 417.5% 4% 1388037% 4% thiX+33nt% 97.82% 90.33% 7.49% 9.27E406% UAUGUUUCGCAUCAUAAAAAAUCCGCUAUCACAGAUAGCGGAUUUUUUUA 412.2% 4% 1388073% +% rsbRB+34nt% 95.61% 90.41% 5.20% 2.60E401% AAACUAUCAUCAAUAAAAAAAUCCGCUAUCUGUGAUAGCGGAUUUUUUAU 412.2% 4% 1391672% 4% ykzO+3926nt% 21.07% 33.68% 412.61% 4.53E403% CGCUUAAUCGAUCUAUGACUGCAUAUUCCCUUAGGAUAUGCAGUUUUUUA 411.4% 4% 1395320% +% ykoJ+32nt% 95.58% 71.38% 24.20% 5.00E404% CAGGAGAUAGAUGACUAAUCAAAACCCCCGCUGCAGCGGGGGUUUUUCAU 415.1% 4% 1395834% +% ykzD+326nt% 5.51% 0.51% 5.00% 2.50E401% CGCUUUUUUUGCCGUGCUUCUUUCACCUUCAAUCCCGAAGGCUUUUUUUA 44.8% 4% 1397370% 4% tnrA+41nt% 95.26% 77.36% 17.90% 1.10E402% AACCGUUAAAUAAUAAAAGUCCGGCUCGCAGUUGAGACGGACUUUUUACG 410.4% 1x1% 1397409% +% mgtE+41nt% 94.87% 95.65% 40.78% 5.40E401% UCAUUAUAAACGUAAAAAGUCCGUCUCAACUGCGAGCCGGACUUUUAUUA 410.5% 1x1% 1398997% +% ykoM+37nt% 95.38% 95.95% 40.57% 6.60E401% GCUGUUUCGUUAACUAUUCUACACUCUCUAUUUCAGGAGAGUGUUUUUUU 410.5% 4% 1407312% 4% dgcW+17% 81.77% 75.00% 6.77% 5.77E401% GAACAAUUCAUUAUUGAACAGCCGUCGCAAUAACAGCGCCGGCUUUUUUU 410.1% 1x1% 1410768% +% ykoX+191nt% 94.49% 89.26% 5.23% 8.50E402% AUUCAUGUCUAGCAAGACCUUUGCCUUAUGUCGGCAAAGGUCUUUUUUGC 416.1% 4% 1411664% +% ykoY+36nt% 98.06% 95.77% 2.29% 1.20E401% GUGAACGGGCGUAAUCUGAAAGACUCUGCUUAAAAGCAGAGUCUUUUUGU 413.5% 4% 1414089% 4% ykrK+36nt% 94.33% 92.83% 1.50% 4.89E401% CAGACAUUCUAUAGUCUGCGCCACCCCGGCUCAGAGGCCGGGGUUUUAUU 415.7% 4% 1415938% +% ykrL+45nt% 99.25% 92.02% 7.23% 6.70E404% AAUAAUACAAACACAUUGUUCCUCUGAGAGAAUUCUCAGAGGUUUUUUAU 413.1% 4% 1417449% +% ktrD+33nt% 93.33% 91.33% 2.00% 7.40E401% GAGUGAUUAUCGGAUAGGCAAAACACCGCAUAUUUUGCGGUGUUUUUUGA 411% 4% 1422176% +% ogt+253% 85.45% 92.00% 46.55% 3.30E401% AAAAACCGCUGACUCGGCUCCAAAUGAGCAAAGUCCAGCGGUUUUUUAAU 418.7% 2x2,%0x1% 1424475% 4% mtnU+292nt% 98.84% 93.07% 5.77% 4.29E403% GCGGACAUAGAUGUUAAGCCUCCUUCUCUCUGAGAAGGAGGCUUUUUUAC 418.7% 4% 1427032% +% ykrV+195nt% 92.30% 75.38% 16.92% 8.40E406% GAGAAACGAAACCUCUUUAGACGCGAUUGCAGUUUGAAGAGGUUUUUUGA 414.7% 0x1% 1430123% 4% ykvA+38nt% 73.80% 32.13% 41.67% 1.67E405% CGUUUGCAAUAAAUAUAAAAAGCCCCGUUCGAUGAACGGGGCUAUCUCAC 415.5% 4% 1430158% +% mtnD+38nt% 98.02% 97.45% 0.57% 1.70E401% GUGAAUCAAUAAGCGUGAGAUAGCCCCGUUCAUCGAACGGGGCUUUUUAU 415.5% 4% 1430996% +% spo0E+55nt% 92.50% 65.17% 27.33% 1.40E405% UAUCAGAUGCAUAUAUAAAGAGAGAGCUUUUCGGAAGCGCUCUUUUUUUC 46.1% 1x1% 1431457% 4% kinD+29nt% 93.53% 91.31% 2.22% 1.62E401% CUCCCCGUAUCCGCAUCAUAGCCCCCCUGACCAUGUCAGGAGGGUUUUUU 412.7% 1x1% 1433634% 4% motB+42nt% 98.47% 93.73% 4.74% 1.33E402% AAAAAUAGCAAAAAAGGAAGCCUUGUGACAUAUCAGGCUUCCUUUUUUUA 412% 1x1% 1433676% +% mhqR+40nt% 95.58% 81.58% 14.00% 5.00E402% UAAUAAGUAAAAAAAGGAAGCCUGAUAUGUCACAAGGCUUCCUUUUUUGC 412.3% 4% 1435592% 4% clpE+36nt% 95.79% 93.82% 1.97% 2.56E401% UGCGAGCAAAAUAACAAUCAGCGGUUUCCUUUUAGGAAGCCGCUUUUUUU 414.7% 4% 1439345% +% ykvI+210nt% 78.85% 80.50% 41.65% 4.80E401% CCUCUAUAAAAAACUAAGGACGAGCUGUAUCCUUGGAUACGGCCUUUUUU 411.2% 4% 1439385% +% ykvI+250nt% 49.14% 37.39% 11.75% 1.20E401% GGCCUUUUUUAUGUUUUUCUAGAGCACCUUCCGAAAAAAGGUGUUUUUUU 44.9% 4% 1442069% +% ykvM+281nt% 99.45% 99.14% 0.31% 2.40E401% UUGAUAGUACAGAAGCAGAUUAAGGCGUACAAUUUGUACGUCUUUUCUUU 48% 4% 1447031% 4% ykvS+631nt% 98.50% 96.69% 1.81% 2.13E402% UUCAUUAGAAAGCGGCGAGUGGAAUUCCCCCCGGAUUCGCUCGUCUUUUU 413.7% 2x0% 1447117% +% ykzR+549nt% 77.34% 47.32% 30.02% 2.70E402% GCUUUCUAAUGAAAAGACGGGAUGCUGGAUGGCAGCUCGUCUGUUUUAUU 412.2% 1x1% 1447555% +% ykvR+14nt% 91.60% 37.14% 54.46% 3.20E403% GAAAUAACGGAAAUAGACAAAAACGCCGAUUCAUGAUCGGUGUUUUUUAU 48.2% 4% 1447556% 4% ykvS+106nt% 98.26% 97.05% 1.21% 7.74E401% UACAUAUGAAAUUCGCUUUCUCAAAAGCUGCCGGCCGGCAGCUUUUUUAC 410.7% 4% 1448236% +% ykzS+29nt% 92.62% 61.46% 31.16% 1.10E403% UUAGAACAGCCAAGAAGCUGAAGGUUUCUCAUACGUGAGAAGCCUUUUUA 411.3% 4%

! 109! 1451164% +% stoA+29nt% 99.17% 97.18% 1.99% 2.80E401% AAGGAAUGGACGGAAGAAUAGCUGAGAGCAUAGACUCUCAGCUUUUUUCA 412.3% 4% 1454828% +% ykvY+46nt% 87.11% 63.81% 23.30% 8.40E405% GUAAUAGAAAUAAAAAAGGACUUUGUUCUCGACAUCGUCCUUUUUUAUCU 46.3% 2x2% 1461405% +% ptsI+43nt% 98.55% 95.34% 3.21% 1.80E407% CAAGUAAUGUACAAAAACCAGACGGCCUCCGGCCUGUCUGGUUUUUUUCA 415% 0x1% 1462830% +% splB+32nt% 98.99% 88.42% 10.57% 1.20E402% AUUGAAUAUUUCACUUAAACGGGCUGUUGUGAUCAACAGCUCGCUUUUUU 414.7% 4% 1465638% +% mcpC+43nt% 98.53% 97.46% 1.07% 9.60E401% AUUGUAAUCCAAUUACAUCCCCAAACAUCAUUUGUUUUGGGGAUUUUUUA 411.7% 0x1% 1466637% +% ykwC+38nt% 99.55% 98.45% 1.10% 1.90E401% UGGGUGAAAUAAAAAAAGAUUGCCUGUACGAAACAGGCAAUCUUUUUUUA 414.5% 4% 1469903% +% pbpH+41nt% 94.96% 88.33% 6.63% 1.20E401% AAAAAAUAAAAAACAGGGUGCACAACUAAAAGAUUGUGUGCCCUUUCUUU 413.1% 4% 1471843% 4% patA+14nt% 98.03% 95.70% 2.33% 9.26E403% CGUGAAGCAAUGCAGACGAUAAACAACGGCGUUUAAGCCGUUGUUUUUAU 411.1% 4% 1473165% 4% ykzT+75nt% 72.93% 54.74% 18.19% 1.31E402% UAGAACAUGAUACAAUAAAGACAAUCAAAUCGCUGGUUGUCUUCUUUUUU 47.7% 4% 1474517% 4% ykyB+43nt% 96.69% 95.45% 1.24% 8.40E401% CUUUUAAAAUAAAAACAGCCGUGCCUCUUUCUGGCAACGGCUGUUUUUAU 416.6% 0x1% 1474558% +% cheV+42nt% 96.48% 92.60% 3.88% 7.10E402% UUGAAUAAAUAAAAACAGCCGUUGCCAGAAAGAGGCACGGCUGUUUUUAU 416.1% 1x0% 1475101% 4% ykuC+49nt% 92.19% 84.62% 7.57% 7.09E401% AUGCAGGUUAAAAAUGCGCUUUUUUUCUUAGAAAAAAGCGCAUUUUUACA 413.3% 4% 1476172% 4% in%ykuC%CDS% 42.73% 40.56% 2.17% 9.99E401% GGUGGCAGAAAAUUGUGAUUGGAUCAGAGCAGGCCUGACUGUCGUGCUUU 43.2% 0x1% 1481498% +% ykzU+47nt% 82.76% 90.34% 47.58% 2.60E401% UAAACUGCAAAACAAGCGAACGUUAAAACUGGUCGUUCGCUUGUUUUAUU 413.9% 0x1% 1483493% +% ykuI+22nt% 91.63% 89.19% 2.44% 7.20E401% UUUAUAUGAGCAGGACGGACUGAUUUAACGGCUGAAAGGCCGUUUUUUUU 48.4% 4% 1483643% +% ykuI+172nt% 97.76% 90.66% 7.10% 4.50E403% UCAGAUCAAGAUCCGAAAAAACUUGGCGCUACCCCCGCCAAGUUUUUUAU 49% 4% 1485359% +% ykzF+44nt% 89.30% 58.91% 30.39% 6.00E406% AAUUAAUGGGACACCCUAUAAUUGAUACUCCACAAAGAGUAUCUUUUUUA 47.1% 4% 1486952% +% ccpC+26nt% 99.30% 92.82% 6.48% 1.20E401% CUGGAUCAGGAAAAUCCAUUUUAAAGACAGCGAGGUGCUGUCUUUUUUUU 47.7% 4% 1488909% +% ykuP+41nt% 81.97% 49.45% 32.52% 3.00E407% GCUGUCUGAUCACUCACUGGGAACUGCUAAAACGGCUGUUCCUUUUUUUC 48.6% 1x1% 1489732% +% dapH+49nt% 76.36% 41.10% 35.26% 7.50E405% AGGAAAAGUUUGAUAAAAAAGGCGUGGAUAAUAUAUCCACGCCUUAUUCG 415.3% 4% 1491219% +% ykuS+35nt% 89.31% 72.33% 16.98% 1.80E404% AGCAGAAUUCAGUAAUAAAAAAACCGAAGCAAAAAGCUUCGGUUCUUUUA 410.4% 4% 1492855% +% ykuU+52nt% 3.90% 4.49% 40.59% 7.20E401% CUUUCCAAGAACGAAAAGCGGUCUAGCAUAUUCGUUAGGCCUCUCUUUUA 49.9% 4% 1493374% +% ykuV+53nt% 95.38% 59.32% 36.06% 1.10E405% UCUGACUAAAUAGUAUUUCCUAAAAACCUGACCUCAUCAGGUUUUUUAUU 44.4% 4% 1494406% +% rok+44nt% 99.25% 96.07% 3.18% 1.80E402% GAAUAAAUAUAAAGAAAAACUGCUUGGCAUCGCUCAAGCAGUUUUUUUAU 49.9% 0x1% 1499699% +% moaD+34nt% 92.99% 64.75% 28.24% 1.60E405% GGUCAGCGGGGGAUGAAAACCGGACGGCAUUUCAGCCGUCCGGUUUUUCU 418.8% 4% 1507326% +% yknZ+28nt% 98.00% 97.83% 0.17% 6.80E401% UGAAGCGCUGCGUUAUGAGUAGCCUCAUGCAACAUGCAUGAGGUUUUUUU 412.7% 4% 1511203% +% fruA+40nt% 96.57% 83.47% 13.10% 6.50E404% AGAAAAAUAAGAAAAAAAGCGUCCUUGGUUCGAAAGGACGCUUUUUCUUA 412.2% 4% 1511885% 4% ykoA+38nt% 93.24% 88.30% 4.94% 3.87E401% UUUUCAAAAUAAAAACGCCUGCUGUCCUAGGCCAGCAAGGCGUUUUUAUU 412.5% 0x1,%0x1% 1511927% +% sipT+38nt% 95.82% 95.28% 0.54% 7.90E401% CAAACAAAAUAAAAACGCCUUGCUGGCCUAGGACAGCAGGCGUUUUUAUU 413.9% 1x0% 1514025% +% ykpA+30nt% 76.92% 38.40% 38.52% 9.40E404% CUGAACUAUACGCCGAAUAAAAAAGCAGAGAUUUCUCUGCUUUUUUUGAU 48.6% 4% 1514960% 4% ampS+37nt% 96.19% 95.27% 0.92% 2.39E401% UUGGGCUUUUUAAGUAAAUAAAAGGAGGCUUUUCCGCCUCCUUUUUUUAU 410.5% 4% 1514995% +% ykpB+32nt% 82.56% 80.71% 1.85% 4.90E401% UAUGAAGCAGAAAAAUAAAAAAAGGAGGCGGAAAAGCCUCCUUUUAUUUA 411.3% 4% 1518189% +% abh+46nt% 95.54% 62.24% 33.30% 1.40E405% AUAAAAUUAUGCUAAAAAAGGCGGAGUGAUAUCAUCUCCGCCUUUUUUGC 413.9% 0x1% 1521232% +% ktrC+36nt% 95.27% 79.14% 16.13% 2.40E404% UUCAUACAAAAUAGCAGCCAAAUAAGCCGUCCUCAAAGGGCGGUUUUUCA 48.9% 4% 1523082% 4% rnjA+36nt% 99.89% 99.89% 0.00% 7.78E401% UUAUGGAGGUUUAAAAAAAGAGGCACUCCCUAAGGGAGUGCCUCUUUUUA 420.9% 4% 1526156% 4% def+39nt% 96.54% 96.69% 40.15% 9.38E401% UUGAGCGCUAAAAGAGAAAACGGCUGGCACAAUGCCAGCCGUUUCUUUAU 415.9% 4% 1526193% +% ykrA+34nt% 95.30% 93.67% 1.63% 4.20E401% GGGCCUUUUAAAAUAAAGAAACGGCUGGCAUUGUGCCAGCCGUUUUCUCU 415.9% 4% 1527925% +% ykyA+23nt% 90.24% 44.94% 45.30% 1.00E403% GCAGGCUAUCGUGUGAAAAAGAGCUGACUCGAUCAGCUCUUUUUUUGAAU 49% 4% 1530470% +% pdhB+48% 2.87% 1.87% 1.00% 6.60E401% AAUCAAACUGCAUAAUCGAGAGGGAAGAUGAACGUUUUCCCUCUAUUAUA 413.3% 4% 1533328% +% pdhD+46nt% 99.80% 99.89% 40.09% 1.10E401% AUAAUUUUCAUAUCAAAAACAGCCCCGCUUUGAGCGAGGGCUGUUUUUUU 415.6% 0x1% 1534240% 4% speA+39nt% 87.05% 99.02% 411.97% 3.40E403% CAAUUCAAUAAAAAAUAAAAAGCAUGCGGCUUUAAGCCGCAUGCUUUUUU 417.1% 4% 1536202% 4% yktB+33nt% 93.75% 92.05% 1.70% 6.32E401% AAGUAACACAAGCAUAAAAAAGAGCCGGGAUAUCCCCCGGCUCUUUUUCU 416.3% 4% 1536237% +% yktA+35nt% 93.10% 93.39% 40.29% 6.00E401% AAGAUUAAGAUGUAAGAAAAAGAGCCGGGGGAUAUCCCGGCUCUUUUUUA 419.2% 4% 1538725% 4% yktD+45nt% 88.64% 70.29% 18.35% 5.15E401% AAUAAUUUUCAAAUCAUCAGAAGCCUCUCAAUGUUUGAGAGGCUUUUUAU 412.5% 4% 1545757% 4% ylaF+63nt% 97.82% 92.88% 4.94% 1.69E403% CCGGCGACAUUGUAAUCAAAAAACACCGCAAAGAAAGCGGUGUUUUUCAU 49% 4% 1548328% 4% ylaI+61nt% 99.67% 91.28% 8.39% 3.97E407% AACCAUACAGAACACAAAAAAGACUCAGCUUUCAGCUGAGUCUUUUAUGA 412.6% 4% 1548364% +% ylaH+31nt% 97.86% 95.91% 1.95% 1.80E401% ACAGUCUGCAAAAUCAUAAAAGACUCAGCUGAAAGCUGAGUCUUUUUUGU 412.6% 4%

! 110! 1552734% +% ylaN+41nt% 96.00% 88.24% 7.76% 9.40E403% GCUAAAUAAAUGAUAAAACUCAAACUUAUUAACAGUUUGGGUUUUUUUAU 46% 4% 1557671% +% pycA+40nt% 94.38% 92.14% 2.24% 1.60E401% AAAAGCAUAAAAAACAAAGAGUGUAUAUCAAUGAUAUACACUCUUGUUUU 412.5% 4% 1557993% 4% ctaA+41nt% 98.45% 98.83% 40.38% 8.53E401% CAAUCAUAAGGACUCAAGACCAAAGCCUUAGGCGGCUUUGGUCUUUUUUA 416.6% 4% 1560323% +% ctaB+97nt% 90.61% 72.85% 17.76% 1.90E404% ACUAGUAAAUGCCGCCUUGACCUCUUGUUUAAUCAGGCGGCUUUACUUUU 412% 1x0% 1564473% +% ctaF+78nt% 20.12% 8.26% 11.86% 8.90E403% GAAUCAGUUGGAGAUAUUUGGGUUUCGCGCGAUGUGGAGCCCUUAUCUUU 411.6% 4% 1565311% 4% ylbA+36nt% 91.06% 62.93% 28.13% 3.76E404% CAGUUCAAAUGUAACGAAAAGGUACAGCAUAUUUCGCUGUACCUUUUAUG 412.2% 4% 1565348% +% ctaG+33nt% 86.73% 78.25% 8.48% 2.80E401% AGCAGACGAUAUCAUAAAAGGUACAGCGAAAUAUGCUGUACCUUUUCGUU 412.2% 4% 1567455% +% ylbC+36nt% 93.55% 74.77% 18.78% 2.00E403% UUAAGCGAUGGUAAUGAAAGCCGCGGACGAAUGGUUCCCGGCUUUUUCUA 49.6% 1x1% 1568894% +% ylbF+25nt% 31.21% 23.19% 8.02% 4.50E402% AAGCUGCGGAUGUAAAGUGUCCUGACGAGACUGGCCGUCUCGUCUUUUAC 411.9% 4% 1569202% 4% ylbJ+1372nt% 99.24% 98.84% 0.40% 3.42E401% UAACAUAUUAAGGAAUAGAAGGACCCCGCAGAUGCCUGCGGGGAUUUUUU 415.8% 4% 1569235% +% ylbG+39nt% 69.62% 26.70% 42.92% 3.70E408% UCGGCAUAUAGCUAUAAAAAAAUCCCCGCAGGCAUCUGCGGGGUCCUUCU 415.5% 4% 1570587% +% coaD+24nt% 89.95% 87.09% 2.86% 6.90E402% UUCAGCAAAAAUUCAGACAAGGAUGAGGGUUUUGACUCAUCCUUUUUUUG 410.2% 4% 1573810% +% ylbL+20nt% 97.01% 95.03% 1.98% 4.10E401% UUGAAUAAGCUGAAAGCGAAAAGCACCUGAUUCUCAGGUGCUUUUUCUAU 411.4% 4% 1576020% +% rpmF+37nt% 99.65% 99.71% 40.06% 2.30E401% AAAAAGUAACUAAUGAGAAAAGCGCAGGGUGAAAGCCCUGCGCUUUUUCU 419.7% 4% 1576722% 4% ylbP+45nt% 60.35% 69.43% 49.08% 1.48E401% CAUAGAAAUCAAAACAACCGGCCUAUUCUUACUAUAGGGCCGGUUCAUUU 411.6% ox1% 1580037% +% yllA+42nt% 96.45% 97.06% 40.61% 9.80E401% AACUUUGAAAUAAAGUUUUAAAGAACCCUGACUAGUUCAGGGUUUUUUUU 47.8% 4% 1582025% +% ftsL+75nt% 57.80% 7.57% 50.23% 1.40E403% UAUGAAUAGAGGAGCAGCGAUUCUAAGUAUUUGUUUCGCUCUCUUUUUCU 47.6% 0x1% 1584133% +% pbpB+36nt% 99.08% 97.53% 1.55% 1.10E402% AAAAUCCUGAUUAAAAAGAAAGCCGUCGUUAUGCAGGCUUUCUUUUUUUA 48.7% 4% 1586173% +% spoVD+19nt% 86.11% 77.04% 9.07% 2.20E401% UGAAGAAGAUGAAAAGGAGGCAGCCGAUUGAUUCGGGCUGCCUAUUCUUU 414.1% 0x1% 1591505% +% spoVE+88nt% 73.50% 31.54% 41.96% 4.30E406% GGAAACAAUUGAUGCGAUAACCCUGUCCAACAAAACAGGGUUAUCGUUAU 47.6% 4% 1593654% +% murB+80nt% 28.08% 17.85% 10.23% 1.40E402% UAUACUGUAAGCAAACGACAAACGGCAUCAUAGUAUGCCGUUUGUUUUGG 46.9% 4% 1599020% +% ftsZ+40nt% 99.95% 99.61% 0.34% 3.90E402% ACGCGGCUAAUGUAAAGGACAAAAUCGUUUUCGAUUUUGUCCUUUUUUGU 414.5% 4% 1607528% +% ylmA+174nt% 61.29% 64.01% 42.72% 5.30E401% UCCGUUUGUUUUUAUUAAGCCGUUUCAUCACAUUUGAAACGGCUUUUUUG 412.8% 4% 1611638% +% ylmG+45nt% 63.18% 61.83% 1.35% 8.20E401% UUUAAUGUGACAGUUUGAUAGGGGCUUGGCAGCAGCCAAGCCUCUUUACA 414.4% 4% 1613325% +% divIVA+310nt% 83.28% 94.83% 411.55% 2.10E405% ACCGCGAGAUAAGCUUUCUCGUCCCUUAUGGGAUGAGAGGGCUUUUUUUA 421.7% 4% 1616127% 4% yloA+20004nt% 83.33% 92.65% 49.32% 9.16E401% GGAUGUCACUCUUGGCACAAAAAAAGCCCGGCUUUUACGCCGGGCUCUUU 415.1% 4% 1616159% +% ileS+37nt% 100.00% 97.93% 2.07% 1.70E401% CUAUCAAAAAUAAUGCAAAAGAGCCCGGCGUAAAAGCCGGGCUUUUUUUG 415.9% 4% 1618276% +% rluD+155nt% 62.87% 50.74% 12.13% 2.10E401% CGCACCUUGUCCUAAAACCCCUCUAUGCUCUGGCAGGAGGGGUUUUUUCU 415% 1x0% 1618967% +% pyrR+118nt% 68.79% 63.53% 5.26% 3.00E401% UCGGCAGGUCUUUGUAUGCCUCUUUGCGUAAAAAAGCAAAGAGGUUUUUU 413.8% 4% 1620442% +% pyrP+112nt% 79.15% 72.06% 7.09% 2.00E402% UGCCCUCUAUUUAACCAUACCCCGAGUCUAUCUUAGACCGGGGUUUUUUU 413.6% 1x0% 1630047% +% pyrE+77nt% 96.98% 86.63% 10.35% 1.80E403% CUUCAAAGCCUUGCUGUACUUGAAAACAGGCUGUGAGGCCUGUUUUUUUA 48.2% 4% 1635049% +% sumT+215nt% 8.50% 0.43% 8.07% 2.60E405% CAUGUGUGAAGCAAGGUGCCACUCAUAUCGCAGUGGUGCCUCUGCUUCUU 412.2% 4% 1636084% 4% yloA+47nt% 96.82% 93.81% 3.01% 9.42E402% UGAGCCGCAUAAAGAAAAGCCAGAGCAUUUGUAUGCUCUGGCUUAUUUCU 417.2% 4% 1636123% +% sirC+32nt% 95.92% 94.21% 1.71% 4.60E401% AUGAGAAGAAAGAAAUAAGCCAGAGCAUACAAAUGCUCUGGCUUUUCUUU 416.9% 4% 1640851% +% in%yloC%CDS% 18.86% 15.71% 3.15% 3.50E401% ACUACAGAUUUAAAGAAGUGAACGCUCGUUUGCCAAGGCCUUUGCUAUAU 45% 1x1% 1642812% +% rpoZ+42nt% 84.39% 53.45% 30.94% 2.50E408% GCGAAUAGUAGCACAAGUAGCAACCUAUAUCAUGUAGGUUGUUAUUUUUU 48.1% 4% 1654707% +% rpe+50nt% 80.25% 35.06% 45.19% 8.30E408% GCAGCUUUAGAAAAGAGCUGGGCAUACAAUAGCCUAAGCUCUUUUUCCUG 411.9% 0x1% 1655557% 4% rpmB+42nt% 99.90% 99.65% 0.25% 1.08E403% GUGUAUAACAAAAUGAACGCCUGCCCCGAUAUGUGGCAGGCGUUUUUAUG 415% 1x1% 1655596% +% spoVM+70nt% 65.79% 88.76% 422.97% 3.10E401% UCUUUCACCACAUAAAAACGCCUGCCACAUAUCGGGGCAGGCGUUCAUUU 415% 4% 1658130% +% yloV+27nt% 82.53% 32.48% 50.05% 2.30E405% CGUAUAUAGUUUCAGCAGAAUAGAAGGGCAAUUUGCCCUUCUAUUCUUAU 411.3% 4% 1660027% +% in%recG%CDS% 27.74% 20.33% 7.41% 4.20E401% GAAAGAGUCACAGUCGAAGGGAAGGUUCAUUCAGAGCCUUCUCUUACCUA 410.1% 4% 1665612% +% acpP+42nt% 76.90% 74.32% 2.58% 1.20E401% AGCAAUAAGCUGAUGCUAAAAGUCCCGCCGAAACGCGGGGCUUUAGCCCU 411.9% 4% 1666489% +% rnc+30nt% 87.84% 46.32% 41.52% 1.10E409% AACACCAUACGAAACAAUAAAAUCCCCCUUAUGACUCAGGGGGAUUUCAG 411.7% 4% 1671132% 4% ylqB+34nt% 76.38% 65.69% 10.69% 4.70E402% UCAAGUAAGAAGAUAAAAAAGAAAAAGGCCCCAAGAUGUUGGGGCCUUUU 414.2% 4% 1671161% +% ftsY+32nt% 100.00% 83.56% 16.44% 4.50E403% GAAAAAGCCGACGAUUAAGAAAAAGGCCCCAACAUCUUGGGGCCUUUUUC 414.2% 4% 1674169% +% ylqC+32nt% 96.09% 81.03% 15.06% 5.60E408% UUUGAAAUAUUUGACUAAAAGGGAGAGGGCCGGCACCUCCCCUUUUUUUA 410.4% 1x0% 1676437% +% rplS+48nt% 99.56% 98.54% 1.02% 3.40E403% AAUGAUAACGAACGAAAAGAGCUUGUUACCUGUAACAAGCUCUUUUUUUA 413.3% 4%

! 111! 1677410% +% rbgA+30nt% 87.47% 61.41% 26.06% 3.90E405% UUGAACAGCCGACGAUGUAAAGGCGCGCAGAAAUGCGGGUCUUUAUUUUU 411.1% 1x1% 1680145% +% ylqG+165nt% 48.86% 19.95% 28.91% 4.70E407% AGCGAAAAAAGCAGGGGUCCCGAUUCAAGAAGAUCGGACCCUUGUCGAAU 412.7% 1x0% 1682556% +% sucD+37nt% 88.54% 84.36% 4.18% 2.70E402% UAAAACGCAUUAAUAAAAAAGGGACAGCCGUCAAGGCUGUUCCUGCUUUU 415.8% 4% 1685767% +% topA+31nt% 66.57% 25.28% 41.29% 2.90E406% GGAAGAACCACAGAAGUAGCGGUGAGCAGGGUCUUGCUCACCUUCUUUGU 413.7% 4% 1690934% +% codY+36nt% 100.00% 100.00% 0.00% NA% UAAAAUCUCAUUAAUCACAAAAAGAACCCUUUUUGAGGGUUCUUUUUUUA 49.3% 4% 1704432% +% cheY+236nt% 52.16% 41.00% 11.16% 1.10E402% AAACUGCUGAUGAGACGGAGGGAGCGGCUGCUCCUUCUGUCUCAGCUUUU 426.2% 3x0% 1718722% +% rpsB+49nt% 74.67% 81.19% 46.52% 1.20E402% ACCUAUUCAAAAGGUGAUAAGAGGGACUGCCUUUUAUCACCUUUUUUCAA 416.4% 4% 1719733% +% tsf+77nt% 80.77% 64.26% 16.51% 7.40E403% CGUCUUUUCAGGCAGUAUAGGGGACACAUUUUGUGUUCCCUAUUUUUAAA 414.7% 4% 1721147% +% frr+64nt% 60.22% 38.18% 22.04% 3.70E403% CAAUAGAUAAUAGUGAAAAGACCCUCUCAUGUUUACAGGGGGUUUUUUUG 46% 4% 1727104% +% proS+80nt% 91.04% 44.47% 46.57% 2.20E405% AAAAUAGAAAUAAUAGAAGGUACCUCAUUGCCUGAGGUACCUUCACUUAU 413.6% 4% 1731487% +% polC+41nt% 49.12% 25.23% 23.89% 1.30E402% CUGUUCUAAUAUGGAAAGCAGAAUUUCUCAGAAAUUCUGCUUCUAUGCAU 410.5% 4% 1731652% +% polC+206nt% 22.92% 3.57% 19.35% 6.50E402% AAUGCUAACGAUUACCGAGGCAAAGAGUGGGGAAACCCGCUCUUUUGUAU 414.8% 4% 1731726% +% polC+280nt% 35.02% 18.13% 16.89% 5.30E402% AUGUUCAUCGUUUACUUUUUAGCCCCUGCUCUUUUGAAGCAGGGUUUUUA 411.3% 0x1% 1736335% +% in%ylxP%CDS% 9.95% 4.52% 5.43% 2.60E401% AUCAGGACACCUGGCAAAGAACCAGCUUCGGAAUCGCCGCUGUUUCUUCC 44.4% 2x2% 1736845% +% rbfA+41nt% 94.77% 95.94% 41.17% 1.00E401% UCUGAAUAAAAAAAGAGAGGAUAGGCGUAUAUCGUCUGUCCUCUUUCUUC 417% 4% 1739243% +% rpsO+33nt% 93.13% 82.39% 10.74% 6.90E403% UAGGCUUACGUCGAUAAUCGUAAAAAGCGGGAGGAUUCCCGCUUUUUUAU 49.1% 4% 1741543% +% pnpA+43nt% 92.93% 69.43% 23.50% 2.80E409% AUCUUAAAUGAAAACAUAAAAGGAGCCUGGGAGACCCGGCUUCUUUAUUU 414.3% 1x0% 1743886% +% mlpA+40nt% 95.56% 90.41% 5.15% 1.20E401% GCCGUCUUAAAAAGGAAAGCCUGCCCCAUAAUGGAGCAGGCAUUUUUUAA 413.5% 1x1% 1747097% +% asd+66% 60.71% 30.78% 29.93% 4.00E406% AAGACGAAUAGAAGAGAGUAAGGCGCUAUCAGCCUGCUCUCUUCUGUUAC 413.8% 1x0% 1749304% +% dapA+64nt% 90.63% 77.95% 12.68% 2.10E403% GUGAAACAAACGCGGUCAUUCUCACAUUCAGCUGAGUUUGACCGUUUCUU 413.6% 2x2% 1751124% +% rnjB+39nt% 97.76% 94.36% 3.40% 1.70E403% UGGAAGUAUAAUGACUGACUAAAGACCGGAGCUGCUCCGGUCUUUAUUUU 412.4% 4% 1754660% +% spoIIIE+19nt% 33.26% 36.05% 42.79% 6.20E401% AAAAGAGAAAUAUGAUGAGCUCUCUUCUUAAUGAAGGGAGUUCCGCUUUC 49.9% 4% 1755542% +% ymfC+32nt% 91.00% 48.95% 42.05% 7.80E404% UUGCGUAAACGAUUCUAAAAACGGACGCCUGUAUGUGUCUGUUUUUUUAU 47.4% 4% 1759636% +% ymfH+36nt% 87.72% 45.53% 42.19% 8.80E409% UUCCUAAAUCAUAAACAAAACAUCCCUCCAGUGUGAGGGGUGUUUUUCUG 411.5% 4% 1760751% +% ymfJ+30nt% 98.91% 65.91% 33.00% 7.20E407% AAAAUAACAGCACUCACUAGGAAGAGAGGGGAUUUUUCCUCUCUUUUUUA 411.2% 4% 1762595% +% ymfM+22nt% 60.41% 13.03% 47.38% 3.80E405% AAAUAAAAAGGAAGAAAAGUCAUCUUAAUUACCAGAUGACUUUUCUUCAC 46.8% 4% 1765749% +% recA+58nt% 99.71% 90.95% 8.76% 1.00E406% UAAGUUUCAAAUGAUACAAAAGGCUGAGUGAAAAACUCAGCUUUUUUGUA 410.1% 4% 1768901% +% ymdA+29nt% 94.29% 91.87% 2.42% 1.10E401% GCCGUAGAGUAUGCAAAAUAAAGUGAUGCGCUAAGCAUCACUUUAUUUUU 49.9% 4% 1770249% +% spoVS+54nt% 98.24% 90.58% 7.66% 1.20E403% AAAUAAAGCAUUCUCAACCUGUUUGCGUAAUGCAAACAGGUUGUUUUUCA 413.1% 4% 1774837% +% ymcA+32nt% 99.84% 98.30% 1.54% 1.10E401% AACAGCUGUUCUCUCUAAACACGGUGCCUUUACAGGCCCGUGUUUUUUUA 412.8% 1x0% 1780267% +% mutL+47nt% 80.86% 93.17% 412.31% 2.00E404% UAGCGGGGGUGGUAGGCAUUGAUCCAUUCUCUGAAUGGAUCAAUGCUUUU 419.6% 4% 1780552% +% mutL+332nt% 89.37% 79.10% 10.27% 6.70E402% AAUUACAACAUUGUGUUUUGCUCCCUGUUCGUGUGAACAGGGAGAUUUUU 416.3% 4% 1782582% +% pksA+59nt% 89.10% 86.32% 2.78% 6.00E401% GUGAAAAGCGAUUCUUGUUGGGCAUGCGUCCAAAAGAGUCGCUUUUUUAU 418.9% 1x0% 1858526% 4% pksS+40nt% 93.33% 85.26% 8.07% 2.62E401% UUCAAAAUAACAUUCAAAACGCCCCCUUUUAAAAGAGGGGGCGUUUGUGU 417.7% 4% 1858564% +% pksR+43nt% 92.06% 86.57% 5.49% 4.80E401% GCGCUGAGAAAACACAAACGCCCCCUCUUUUAAAAGGGGGCGUUUUGAAU 415.7% 4% 1859949% 4% ymzB+65nt% 93.35% 78.13% 15.22% 2.02E401% AAAUAAUACAGCGUAGCGCCUUUGAGCUUUCGUUCAAAGGCGCUGCUUUA 425.4% 4% 1864676% 4% ebrB+15nt% 89.87% 63.64% 26.23% 7.06E404% ACGCUGAAGAUAAAAAACAGACGGCCUGUGAGUGACCGUCUGUUUUCUUU 49% 4% 1867658% +% hfq+64nt% 70.63% 47.99% 22.64% 2.40E407% UGUCAAGACAUGAGGAAAGGCUGUCGGGGGUUCCCGGCGGCCAUUUUUAA 418.8% 4% 1867724% +% hfq+130nt% 68.06% 54.91% 13.15% 1.20E402% CUCCAAGCUUUUUGUGUAAGCUGACCAUGCCAAGGCACGGUCUUUUUUUA 49.6% 1x1% 1868461% +% ymzA+87nt% 51.65% 23.71% 27.94% 8.90E404% AACGACACCCCGAGUAGGACGAGAGAUGAUUCUCGUUCUGCUCUCUUUUU 414.7% 4% 1872096% +% nrdF+18nt% 60.87% 4.94% 55.93% 2.80E407% UUUAUUUUGAAGAUGAAAAAGAGCAGAUAUAAUAUCUGCUCUUUUCGGCU 410.7% 4% 1872788% +% ymaB+40nt% 89.19% 43.75% 45.44% 1.90E404% UCUUGAAUAAAAAAACCCGGUUUCUCGCGAUGAGGAGCCGGGUUUUUUUA 418.2% 4% 1879801% +% glnA+42nt% 99.51% 99.35% 0.16% 7.40E401% AGUAUUAAUAUCUCAAUCCCUUGGCACUAAAAGUGUCAGGGGAUUUUUUA 417.5% 4% 1882884% +% ynaC+53nt% 91.81% 82.71% 9.10% 9.10E402% AUCUUGUUGGUAACAAACAUCCUCUUACUUAUUGUAAGAGGAUGUUUGUU 416.3% 4% 1893342% +% xylA+97% 75.00% 56.69% 18.31% 4.60E401% UUACCCGUCAUGAUUCCUUUCCUAUUGCUUGUUGUUAUGACGGGUAACUUCUAU 419.1% 4% 1895189% 4% yncB+189nt% 97.39% 79.82% 17.57% 8.15E403% AUAGUAACAAUAAAAAACACCCCUUCACGUCAAUGUGAGGGGUUAUUUGU 412.4% 1x0% 1903072% +% thyA+14nt% 86.27% 28.10% 58.17% 3.70E406% CAUGGGGACAAGCUUUUAUUUGAGGUAGCGGUUUAAUGCUGCCUUUUUAU 49.2% 4%

! 112! 1903468% 4% yncM+43nt% 77.73% 61.62% 16.11% 4.84E402% UAAAUAAACGAAGCAGCAAAAAGCCGCCAGCAUUGUCUGGCGGUUUUCCU 411.7% 4% 1905331% 4% tatAC+39nt% 88.57% 37.15% 51.42% 8.33E405% AACAAAUGUAGGAUAAAUCGUUUGGGCCGAUGAAAAAUCGGCUCUUUAUU 48.4% 4% 1906243% 4% yndB+29nt% 82.42% 68.07% 14.35% 1.02E404% CGUAAGGCUGUCGAAGAAUAAAAAAGAGAGAGGUAUCUCUCUUUUUUGUU 46.9% 4% 1914993% 4% yndM+1013nt% 89.61% 82.43% 7.18% 4.53E401% UUUCCAUACAAAACAAAAAUGCACCUGCCCUUUGGCCUGUGCACUUUUUA 49.8% 2x2% 1915031% +% yndK+36nt% 100.00% 84.30% 15.70% 2.10E402% UGAAGAGAAAAUAAAAAGUGCACAGGCCAAAGGGCAGGUGCAUUUUUGUU 412.5% 2x2% 1917571% +% yndN+474nt% 33.38% 19.35% 14.03% 7.70E402% UUUCCUCCUAUUCGGGCUCGCACCCAAAAGUCAGGGCGAGCCUGCUUUUU 417.9% 4% 1917577% 4% lexA+62nt% 97.49% 90.49% 7.00% 3.98E402% UCAGAUGCAUAAAAUAACCCCCUCUUCCUUUACGGAGAGGGGGUUUGUUG 418.1% 4% 1917616% +% yndN+519nt% 98.73% 97.21% 1.52% 1.90E403% UUUUUUUGAACAACAAACCCCCUCUCCGUAAAGGAAGAGGGGGUUAUUUU 418.3% 0x1% 1919732% +% ynzC+40nt% 84.89% 57.93% 26.96% 1.10E402% ACUUCACUAAUAUAAGAGGAAUACGGCAAUAUCGUAUUCCUCUUUUGCAU 414.1% 4% 1921904% +% tkt+40nt% 99.56% 95.88% 3.68% 4.60E405% CAAUAAGUAAGCUUUUGAAAGAGGAUGAGUCAAAUCAUCCUCUUUUUCUU 411.5% 4% 1922804% 4% ynzD+37nt% 78.81% 59.38% 19.43% 2.34E402% GGGUGAUGAAUGAUUGCAAAAUAAAAAACCCGUAUAAGGGUUUUUUAUUU 43.4% 4% 1922835% +% yneF+68nt% 98.43% 91.15% 7.28% 2.50E402% UAGAGAAACAUGGUUAUAAAAUAAAAAACCCUUAUACGGGUUUUUUAUUU 44.2% 4% 1924959% 4% yneK+34nt% 96.10% 95.88% 0.22% 8.62E401% GACCCUUCUCAAAUAAAAAACCUUUCCUGACAAGAGGAAAGGUUUUUUAA 410.3% 4% 1924996% +% yneJ+34nt% 98.09% 94.14% 3.95% 1.80E402% UAUUCAAAUGAAUUAAAAAACCUUUCCUCUUGUCAGGAAAGGUUUUUUAU 49.7% 4% 1925652% +% yneJ+690nt% 92.48% 74.21% 18.27% 2.00E402% GGACGGAAAAAAAGUCACUUUCAUAAUAGGGGAUGAAAGUGACUUUUUAU 413.4% 4% 1929454% +% citB+45nt% 76.65% 55.54% 21.11% 3.80E404% CCUGAUGAAUCAAUAGGAAGAGAAGGCAUUUCGCUUUCUCUUCUUUUUAU 49.8% 4% 1930008% +% yneN+15nt% 99.43% 93.39% 6.04% 1.60E403% AAAAAGAAAUGGAACAAAAACUGGAUCUUGAUUAGAUUCAGUUUUUUUUA 47.8% 4% 1931515% 4% yneR+30nt% 60.81% 56.93% 3.88% 6.10E401% CGGUUUUUGAAUACCAAUAAAAAAGAACGCACUUCAUGUGCGUUCUUUUU 412% 4% 1933123% +% yneT+45nt% 92.88% 81.47% 11.41% 5.70E403% AAUAGGUGCAGAACUGCAAAAAUCCUUGUAAAUUCAAGGAUUUUUGCUUU 46.4% 4% 1937868% 4% ynfC+198nt% 99.56% 98.69% 0.87% 1.07E401% UGAUAAAAAACAAACGAAACCCGCUCAUAUAGUAUGAGCGGGUUUUUUAU 415.2% 4% 1937906% +% parC+38nt% 100.00% 96.49% 3.51% 3.20E403% ACAGAACAAUAAUAAAAAACCCGCUCAUACUAUAUGAGCGGGUUUCGUUU 415.2% 4% 1940372% +% alsT+50nt% 99.65% 98.04% 1.61% 9.60E402% UAUAAAUAUAAAACAAAGCUGCAUUCAAUAGUUGAAUGCAGCUUUUUCAU 414.3% 4% 1942644% 4% xynC+70nt% 97.89% 92.67% 5.22% 1.07E401% AUAAUAGAGUGUCUGAAUUGGCGAUUUUCCGAUUGGGAAAUCGCUUUUUU 412.7% 4% 1948313% +% yngC+49nt% 74.85% 68.79% 6.06% 7.90E402% GCUAGCGGAUAUGCAUAGGGGUGACUGACGCUCCCCUAUGCAUAUUUUUU 417.2% 4% 2000918% 4% yoeA+42nt% 98.91% 99.60% 40.69% 4.78E401% UCCAAUAGCCUCCGAAUCACACCGUUCAUAAGUUUGAACGGUGUUUUUUU 413.3% 4% 2003216% +% iseA+34nt% 99.46% 98.89% 0.57% 8.70E401% UGACGCAGUUAUAUAAGAAAAACGCCCGGUAUAAGCGGGCGUUUUUUAUU 410.3% 4% 2003228% 4% trnSL4Arg1+48nt% 100.00% 89.33% 10.67% 8.00E402% CGUUAUAUUCACAAAAAGACAACAGGCACUUUUCGCCUGUUGUCUUUCUU 416.3% 4% 2004234% 4% yoeD+28nt% 99.28% 89.31% 9.97% 4.92E403% UGAUGUAAAGGAUGAGGAUUAGGACACAAUUUGAAAUUGUGUCUUUUUUU 47.7% 4% 2008515% 4% gltD+57nt% 88.52% 85.92% 2.60% 6.64E401% GGAUUAUCAUAUAAGAGAAACCGGUCUGGCUGCCAGCCGGUUUCUUUUUU 410.4% 1x0% 2015684% 4% proJ+49nt% 87.50% 93.55% 46.05% 5.53E401% AUUUGCAGAAAAAAACCCGAAGCUUCUAUAUAGAAGCUCGGGUUCAUUUU 415.5% 1x0% 2018520% 4% fabG+34nt% 98.73% 97.20% 1.53% 3.77E401% GUCAACAAAUCCUUAAAAAUGAAAACCUGUCUUUCGACAGGUUUUUUUAU 47.9% 4% 2021188% 4% yoaB+35nt% 100.00% 92.54% 7.46% 5.61E401% CAAUAUGCAUCUUAAUUAGAAAGCGCCCUGUUUGAGGGGCGCUUUUUAUC 413.3% 4% 2021223% +% yoaA+79nt% 78.01% 77.70% 0.31% 3.80E401% UUUUCCUUUAAAAAGAUAAAAAGCGCCCCUCAAACAGGGCGCUUUCUAAU 411.2% 4% 2025078% 4% yoaG+3097nt% 95.15% 92.40% 2.75% 9.39E403% GAGCGCGCCUAUAUAUGAAUCUCUUUCCAUCUUCGGAAAGAGAUUUUUUU 412.1% 4% 2027850% +% yoaF+48nt% 88.06% 77.70% 10.36% 7.50E402% AAAACAAAUCUGAGGAGAGCGAGAUUCAUUGUCACGCUCUCCUCUGUUUA 421.2% 1x1% 2029379% 4% yoaH+50nt% 89.64% 63.69% 25.95% 2.81E406% ACAGGCUACUUACGUGCAACCCCCAUCUUAUUCGGUGGGGGUUGGCUACU 414.2% 4% 2032888% 4% exlX+39nt% 70.18% 57.88% 12.30% 2.43E402% UUCCUGAAUAAAAAAUACGAAACAGCGGAUCUUUUCCCGCUGUUUUUUCA 49.2% 4% 2049534% +% penP+81nt% 90.00% 86.36% 3.64% 4.30E401% CAUUACUUUUUUAACUUCUACCGUUCAUUUUUUGAUGAACGGUUCUUUCA 410.9% 4% 2054110% +% yobB+3158nt% 94.78% 76.87% 17.91% 2.50E402% UUGUGCAAUAUAAAAAGAACCUGGGAAAUUUCACCAGGUUCUUUUCUUAA 412.9% 0x1% 2055833% 4% yozV+35nt% 59.67% 36.19% 23.48% 3.49E402% CAAUCUAAAGCUUAAUUUUAAAGAGGGAUAUACAGUCCCUCUUUAAAUAA 49.8% 4% 2057583% 4% yobF+1132nt% 45.33% 44.89% 0.44% 9.12E401% UCUGAUAGACUGUACAAUAAUAAGAACGCCCCCAUAUGGGGGCUUGGAUC 412.8% 4% 2057613% +% yozI+34nt% 82.89% 78.78% 4.11% 6.10E401% AUUUAAUGGUUAUUAAGCAGAUCCAAGCCCCCAUAUGGGGGCGUUCUUAU 412.8% 4% 2058532% +% yobE+72nt% 98.88% 95.17% 3.71% 1.50E401% UAUACCACCUCCUCUUAGCUAAUAUGUUCUAAGUAGGAGGUGGUAUUUUG 422.8% 0x1% 2061109% +% yozY+32nt% 92.13% 96.36% 44.23% 2.50E401% UAUACAAAAGUUGUUUAAACUUAUAGGGAGCUUUUUUAGCUCCUUUUUCA 48.5% 4% 2063437% +% phrK+53nt% 93.96% 94.50% 40.54% 6.80E401% AGGUUGAUUAAUUAAUUUAGCCCUACUCAAACAUUUGAGUGGGCUUUUAU 412.7% 1x0% 2065373% 4% yobI+51nt% 79.79% 83.39% 43.60% 4.00E401% GAAUAACUAAUGUUUUUUAACGUCCAGUUUUAAUUGCUGGGCGUUUUACU 411.3% 4% 2069956% 4% yobJ+288% 70.96% 62.12% 8.84% 3.45E402% AGGUAGGCCUAUCCCUUCAGGUUCUGAGGCUCAAGGGAGGUCUAUUUUUU 415.3% 1x1,%1x1,%2x0%

! 113! 2070082% +% yozM+4705nt% 96.49% 98.11% 41.62% 9.90E401% GGGCAACUUUUUGUACAGAGCCGGGGUGUUGGUAGCACCUCGGUCUUUUU 414.4% 4% 2071197% 4% yobK+89nt% 88.26% 91.90% 43.64% 1.83E401% CACAUCCUCAAUCUAAAUAAAAUAAGCUCUCGCAAUGAGAGCUUAUUUUA 47.9% 4% 2073617% 4% yobM+41nt% 97.59% 84.19% 13.40% 1.18E401% ACAAGAUAGUGUGUGAUGUAUAAGACAGUCAUUUUGGCUGUCUUUUUCUG 48.7% 4% 2079174% 4% csaA+40nt% 35.07% 42.98% 47.91% 2.32E401% AAUCGGAUAACGCAAAAAAAGACGUUUGCCUAAGGCAAACGUCUUUGCGU 414.1% 4% 2079209% +% yobO+583nt% 99.79% 99.59% 0.20% 5.10E404% UGCAUCGCCUCAAUACGCAAAGACGUUUGCCUUAGGCAAACGUCUUUUUU 414.1% 4% 2083043% 4% yobV+24nt% 97.10% 76.65% 20.45% 2.35E403% ACAUGCAAAAAAUAUAUGAAACCUGACACACUGCUGUCAGGUUUCUUUGU 49% 4% 2084735% 4% czrA+51nt% 90.12% 92.18% 42.06% 7.36E401% AAAAAGACAUCCUUGCUUAACUCGCUGUUAGCGGGCAAGGAUGUCUUUUUCU 421.5% 5x0% 2086033% +% yocA+53nt% 95.56% 76.19% 19.37% 5.40E404% UCUAUCAAUUUACUGACAAAAGCCCAAAAAUGAAUUUGGGCUUUUGCCAU 48.8% 4% 2086043% 4% yozB+27nt% 95.61% 91.17% 4.44% 2.87E401% UGAUGAUUUCACCGUAUUAUUAAAAGCCAUACUCAGUAUGGCUUUUUUUA 47.7% 4% 2086704% 4% yocB+39% 69.79% 47.46% 22.33% 3.11E402% AAGAGGCGUAAACCUAACAGGCCGGGGCUAAUAGCCUCCGGCCUUUGAAG 417.8% 0x1% 2088609% +% in%yocD%CDS% 19.88% 8.61% 11.27% 7.40E403% CGACAUCCAAAAAUUCUGUGCGGUUAUUCCGAUAUAACCGCUCUUUGCAA 410% 4% 2089267% +% yocD+33nt% 90.21% 44.16% 46.05% 3.40E405% GGAUUGAUAAACAUUAAUCAGCUUGUAAAUUUUUUUACAAGCUUUUUUAG 49.3% 4% 2090498% +% des+44nt% 88.62% 89.49% 40.87% 7.70E401% GCCUGAUGAUAAAGGAGGUCUUCUAAUAUACUAGAAGGCUUCCUUUUUAU 416.3% 4% 2092339% +% desR+35nt% 80.22% 96.63% 416.41% 5.30E402% GGCUGGUUUAAAUAAAAAAGGAUCUUGGCAUCUGCCAGGAUCCUUUUUGU 416.9% 4% 2092848% 4% yocH+51nt% 99.84% 97.80% 2.04% 1.73E405% AAUAUAGAUUGUGAUAAAAGACAUAAGCUUUUGGCUUGUGUCUUUUUUUG 411.4% 4% 2095898% 4% yocJ+452nt% 99.93% 99.94% 40.01% 4.58E401% ACGGCAAGACGUAGCGAAAGCCAUUUCCUUUUCGGAAAUGGCUUUUUAUU 413.2% 4% 2096309% 4% yocJ+41nt% 97.95% 94.82% 3.13% 5.21E403% AAAUUCUAAUAAAGCCAAGACUCCUAUCGUUACAAAUAGGAGUCUUUUUG 411.5% 4% 2099402% 4% yozO+44nt% 72.82% 47.35% 25.47% 2.53E404% AGCUGAAUAUUUGAUGAGCCAGCCGUUCAAAAAAUGGUUAGGCUUUUUUU 43.8% 2x3% 2100070% 4% yozC+77nt% 100.00% 99.53% 0.47% 2.69E401% UGUUAAAAGCAGUCGAUACAUAAAACCGCAGCUCAGCUGCGGUUUUUUUG 411% 4% 2102110% +% dhaS+43nt% 96.27% 89.48% 6.79% 1.20E401% AGACUAACAUGUAUGUUUAAAAAACUGCUGCCUGCCAGCAGUUUUUUUCU 46.9% 4% 2104900% 4% yocR+34nt% 62.29% 70.97% 48.68% 2.02E401% GAUAGGUAUUUUUUAACACACGAAGCCCCCGAGGAAAGGGGGCUUUUUUU 412.9% 4% 2107462% 4% odhB+43nt% 99.57% 98.47% 1.10% 4.66E402% AGGAUAAUAAAAAAGGGUACAUCACGAUAAAGUGAUGUACCCUUUUUGAU 419% 4% 2107504% +% yocS+49nt% 94.67% 87.18% 7.49% 7.90E401% AAUAUGCAUCAAAAAGGGUACAUCACUUUAUCGUGAUGUACCCUUUUUUA 418.2% 4% 2111813% 4% yojO+24nt% 92.78% 88.97% 3.81% 3.36E401% AACUGCUUCAUAAAAGCAUAGGAUAGCCCUUAAUCCUAUGCUUUUUGGCG 411.7% 4% 2114699% 4% sodC+43nt% 84.00% 32.66% 51.34% 1.40E405% GCAGUAAUAUCAUCCAGGCCCUUUUGUAUUGAGCAUACAGGGGCUUUUUU 49.5% 2x0% 2115385% 4% cwlS+40nt% 72.89% 36.47% 36.42% 9.91E407% UUAUUUUUAAAAAUGAGUAUGACAAAAAGCCUUUUAUAGGCUUUUUUGUU 44% 4% 2117010% 4% yojK+41nt% 100.00% 90.91% 9.09% 1.24E401% AAUGCAUAGUGUAAAAGCCUGUUCUUAUCGAAAGAACAGGCUUUUUGCCA 414.3% 4% 2121601% 4% yojG+40nt% 99.59% 96.45% 3.14% 2.99E402% GAAUGAUUAAUCAAAAAGGUAUAAGGCCUUAAGCCUUAUACCUUUUUUAA 414.3% 4% 2121641% +% rsbRC+26nt% 77.60% 77.81% 40.21% 6.20E401% GACUUAAAAUUAAAAAAGGUAUAAGGCUUAAGGCCUUAUACCUUUUUGAU 415.1% 4% 2127262% 4% yodB+83nt% 57.76% 22.48% 35.28% 1.58E404% CAUGGUGAGUCAUGUAAGUACGGUUCACACCCGUUUACAUGACUUUUUAU 413.5% 2x0% 2128467% +% yodC+46nt% 99.58% 97.66% 1.92% 7.80E402% GUAAGGAUAUGAAAAACCUUAGUCCGAAAUCCGGACUAAGGUUUUUUUAU 415.9% 4% 2131865% 4% ctpA+37nt% 98.40% 99.05% 40.65% 5.19E401% AAAAGAAAUGUAAAAAAAACCAUACGCGGCUGCCGCGUAUGGUUUUUUUA 415.8% 4% 2131904% +% yodF+37nt% 97.91% 97.27% 0.64% 8.10E401% AAAGGGCGCAUAAAAAAACCAUACGCGGCAGCCGCGUAUGGUUUUUUUUA 415.8% 4% 2134525% 4% yodJ+41nt% 100.00% 84.73% 15.27% 1.50E406% AAAAUUUAAAAUGAAAAGCCCGCUUACACUAGAUAAGCGGGCUUCAUUGU 414.3% 4% 2135427% 4% deoD+43nt% 71.41% 34.49% 36.92% 3.80E406% ACAAUAAAAUAUAUCAAGAGGCGUGCUGGGUGCCGGCAGCCUCUUCUUUA 411.6% 1x0% 2136501% 4% yodL+37nt% 96.24% 68.24% 28.00% 1.34E403% ACAAACGACAUAAUGAAAAGAAAACUGCGGAAACCCGCAGUUUUCUGCAG 49.2% 4% 2138833% 4% yozE+35nt% 92.45% 86.06% 6.39% 5.58E402% GUGCACGGCAGAUAAUAGCUGUUUCAUCCGCAGAUCACUGCGGAUUUUUU 410.7% 4% 2186958% 4% yorD+27nt% 96.01% 93.38% 2.63% 9.62E402% GUAAGGUUGAAGGAACAAACUAACAAGAGUCCCUUAUUGGGGCUUUUAAA 47% 4% 2187779% 4% yorB+40% 56.92% 80.89% 423.97% 1.78E403% AUAUUUAUAAGGCAAUGCUGGGCUAGUCUCUAAGAUUAGCCUAGUUAUCA 415.6% 4% 2192373% +% yoqW+73nt% 94.38% 80.16% 14.22% 6.40E401% AUAUCACCUUCGCUUAGCUAAUAUGUUCUAAGUAGGAGGUGAUAUUUUGU 417.8% 0x1% 2195566% +% yoqO+19nt% 97.29% 89.85% 7.44% 1.70E402% AAAAAAGAAACCUAACGGUAAAGAGUGUUAAUUCCUCUUUGCCUUUUUUA 49.8% 4% 2196295% +% yoqM+31nt% 89.73% 92.57% 42.84% 4.60E401% GUACCAAGCAAAUUAUUGAUUUAUCGAGGGGGUGUUCCCCCCUCUUUCAU 413.1% 4% 2204149% 4% yopR+43nt% 99.34% 95.85% 3.49% 3.14E404% CAUUUAAAUAUGAAAUCCAUUUGACUAUUUUGGUUAAAUGGAUUUUUCUU 411.6% 4% 2208754% 4% yopL+101nt% 99.35% 98.51% 0.84% 7.56E402% AACAGAGAAAAGGAAGACGUUUGGCUCUUUUGAGCUAAGCGUCUUUUGUA 418.4% 4% 2210279% 4% yopJ+52nt% 56.00% 64.07% 48.07% 1.01E401% CCUUUUGCUUUAGAAGAACACAAUGAGGUUUAGUCCUCAUUGUGUCUAGU 410.1% 4% 2212728% 4% yopD+355nt% 29.21% 18.30% 10.91% 1.01E401% AAGAAGUGUUUUAAACAAAAAGAGCAUUACACUAAAUGCUCUUUUUCAUG 47.1% 4% 2212765% +% yoyH+19nt% 71.06% 52.00% 19.06% 2.80E402% CAGAAGGUGUGGCAUGAAAAAGAGCAUUUAGUGUAAUGCUCUUUUUGUUU 47.4% 4%

! 114! 2219231% 4% yonU+50nt% 91.88% 87.95% 3.93% 8.03E401% AUAUGCGUUAUAAAUAAGGGAGCGGUAAGGCAAUUAUCGUUCCUUAUUUU 411.8% 4% 2219843% +% yoyI+6765% 99.64% 99.70% 40.06% 1.90E401% GCGUAUACGUUGGCGUUGUCUCUUUGGUCGGAGCCGCUUGCGUAUACGCUUUUU 423.1% 1x1,%4x1% 2220307% 4% yonS+28nt% 89.13% 92.66% 43.53% 1.95E402% AAAAAUUAACUUAGAGCAUUAAAAACAAGCCCUAUUUUGGGGCUUUUCUU 46.9% 4% 2246611% 4% yomL+45nt% 91.94% 73.96% 17.98% 2.44E402% GCUAAUUUUAAAAUCACUUUGUCUUUAUCGGGGGACAAAGUGAUUCUUUG 414.9% 4% 2249117% +% yomJ+17nt% 99.82% 99.78% 0.04% 7.60E401% AUUAUUAAGAAAGCAAACAAAGUCGCUCAAUAACUGAGUGGCUUUUUUCU 49.4% 4% 2265129% 4% bdbB+96nt% 95.87% 68.03% 27.84% 4.44E407% CGAAAAAAGCUAUUUAAACAAGUUCUCUUUUUUUAGAACUUGUUUUUGUU 47.1% 4% 2269480% 4% sunA+41% 92.11% 90.01% 2.10% 4.19E403% UGCAGAUAAAACAUUUGUAGAGGGAAUAUUUUAAAUAUUCCCUCAUAUUU 412.6% 4% 2269947% 4% sunI+41nt% 99.58% 92.11% 7.47% 1.86E405% AGUGUUUGAACAUAAAAAAGUACCUUCUUACAAUAGAAGGUACUUUUUUG 411.9% 4% 2272488% 4% yolB+46nt% 99.25% 96.14% 3.11% 3.16E402% UUAAAUAAUGAAAACAAUGCCCAGCUUAAAUAAAGAGCUGGGCAUUUUAC 417.2% 4% 2273702% 4% yokL+287% 91.55% 83.72% 7.83% 9.90E403% CGUAGGCCUAACCCUUCAGGUGUCCAAACUCAAGGGAAGGUCUAUUUUUU 415.3% 2x1,%2x1% 2273829% +% yolC+1338nt% 98.54% 98.64% 40.10% 6.30E401% UGGGCAGCUUUUGUACAGAGCCAGGGUGCUACCAACACCCUGGUCUUUUU 413.6% 4% 2277482% 4% yokH+39nt% 98.74% 91.84% 6.90% 5.23E403% GAACAAGAUAGUGUGAUGUAUAAGACAGUCAGUUCUGGCUGUCUUUUUCU 410.5% 4% 2281389% +% yokE+26nt% 94.12% 92.08% 2.04% 5.00E401% AUACUAAGAGAGCAAACAAAAUAAAAAGCCCGUUUUUGGGCUUUUCUUUU 46.9% 4% 2283686% 4% yokB+172nt% 88.03% 74.84% 13.19% 3.12E402% AUCAACCACUAUAGGCCAGAGAGUUCCCUCACAUACUCUCUGGCUUCUUU 416.4% 4% 2287050% 4% yppQ+47nt% 93.13% 67.21% 25.92% 1.75E402% UAAACUGUUAAAAACAGGCCUGCCUAAUGGAUAGACAGGCUUGUUUUUAU 413.4% 1x1% 2287095% +% ypqP+42nt% 83.00% 75.30% 7.70% 8.60E401% AGGCAUAAAAACAAGCCUGUCUAUCCAUUAGGCAGGCCUGUUUUUAACAG 414.8% 1x1% 2288660% +% ypoP+41nt% 87.60% 89.37% 41.77% 9.00E401% AAACGGUGAAAAAAAGCACAUACCGAUAUAUAGGUAUGUGCUUUUCGCAG 414.3% 4% 2290045% 4% ypmT+33nt% 89.58% 14.46% 75.12% 2.54E408% AAACCGAUAAGUCAUGAAAAAAGAGACAUGAAACAACGUCUCUUUUUUCG 44.1% 4% 2292366% 4% ypmP+66% 72.15% 73.04% 40.89% 8.67E401% CCUGCAUGCCCUCCUUUGUAAUCGUUAAUGGGGAGGCAUGCAGGAUUUUUUU 425.3% 1x1,%1x0% 2295949% 4% ypkP+33nt% 97.18% 80.66% 16.52% 9.80E405% AACAAUUACGUGCAUAAAAAAGCGCAGUCGUGAAGACUGCGCUUUUCUGU 414.6% 4% 2295985% +% yplQ+42nt% 92.31% 86.67% 5.64% 5.90E401% UUUCGUAACAGUAACAGAAAAGCGCAGUCUUCACGACUGCGCUUUUUUAU 413.8% 4% 2297942% 4% ypjQ+42nt% 77.06% 47.20% 29.86% 3.65E405% UCAGCUGACUAUAAAAAAAUCAUUUCUGGGUUCAGAAAUGAUUUUUUAUU 49.1% 4% 2299385% 4% ypiP+21nt% 52.00% 54.60% 42.60% 6.21E401% AUUAUGGCGUCAUUCAAACAAGCCCGUGAUUCAUAUCACGGGCUUUCUGU 415.4% 4% 2299419% +% yplQ+3476nt% 79.36% 80.87% 41.51% 6.10E401% GGAGGUCACCGAUUAACAGAAAGCCCGUGAUAUGAAUCACGGGCUUGUUU 415.1% 4% 2300195% 4% yphP+26nt% 89.01% 43.55% 45.46% 5.91E409% GCUGCCUUCGAUGCGCACUGCUAAAUGCCCGUUCUCCGGGCAUUUUCUUU 49.4% 4% 2300657% 4% ilvD+105nt% 31.82% 54.67% 422.85% 1.71E404% GCCCUCUCUAUAGUAUCCUUUACUUCAGAUGAAGGAUACUAGAGGGGGCUUUUUU 428.3% 2x0% 2302692% 4% ypgR+35nt% 98.38% 87.93% 10.45% 6.07E404% AAAAAAGGCGAAUAAAGAUAAAAAAGGUGCAGAUCAUGCACCUUUUUUAU 48.6% 4% 2307704% +% ugtP+42nt% 94.01% 81.81% 12.20% 8.20E405% UAUCGUAAUGGCGUACUUGAGAGCAUACGAAAAUCGUGUGCUCUUUUUAU 413.2% 4% 2308131% 4% degR+26nt% 80.94% 83.42% 42.48% 4.21E401% GAAAUCCAGAUGAAAAUCAAAUAGGAGAGGCGAAUGCCUCUCCUCUAUUU 414.5% 4% 2308164% +% cspD+59nt% 97.55% 94.43% 3.12% 2.10E406% AUGAUGAUGAGAUGACAAAUAGAGGAGAGGCAUUCGCCUCUCCUAUUUGA 414.9% 4% 2308758% 4% ypeQ+34nt% 82.52% 49.54% 32.98% 1.94E402% CUUAACCAAUCACUAAAAAUAAAAACCGCAGAAGCUGCGGUUUUUAUUCU 47.6% 4% 2310974% 4% exoA+21nt% 96.19% 78.71% 17.48% 1.19E404% AAAAGCUGAACGCUAGAGAGAUCGUUUAGAUCCUCUCUAGCGUUUUGUAU 419% 0x1% 2311024% +% sspL+37% 23.57% 23.16% 0.41% 7.10E401% UACAAAACGCUAGAGAGGAUCUAAACGAUCUCUCUAGCGUUCAGCUUUUC 418.2% 1x0% 2311940% 4% ypzF+46nt% 99.64% 99.29% 0.35% 5.44E401% UUGAUAAAUAUUCAAACAGUAUCUCUAAUUAAAGAGAUACUGUUUUUUAU 412.9% 4% 2316219% 4% ypbQ+227nt% 97.67% 93.47% 4.20% 1.43E403% AAAGUUGCAGAUUUUCUUUUAUAGAAGCUGCCGUAAUGGCGGCUUUUUUC 49.1% 4% 2316250% 4% ypbQ+196nt% 39.87% 8.91% 30.96% 8.21E408% AUAAAUCUGUUUGAUGAAUCUGGAACUUGUAAAAGUUGCAGAUUUUCUUU 49% 1x1% 2318103% 4% pbuX+24nt% 97.92% 90.36% 7.56% 2.78E403% UCGCUGAACAAAAAACAGCAGUCUAACUCCGCCGCGGCGGAGUUUUUUUU 410.9% 4% 2320050% 4% ypwA+305nt% 46.94% 46.89% 0.05% 9.33E401% UUGUGAUAUCAGCAUUGCUUGCUCUUUAUUUGAGCGGGCAAUGCUUUUUU 421% 4% 2327451% 4% ypvA+37nt% 98.78% 98.24% 0.54% 3.40E401% GCACAUGAUGUAAUGGAAAAAAGCUGACGAUCGUUCGUCAGCUUUUUUAU 412.5% 4% 2327487% +% kduD+40nt% 97.74% 88.10% 9.64% 9.50E402% AUCCCGCUGACAAAUAAAAAAGCUGACGAACGAUCGUCAGCUUUUUUCCA 411.7% 4% 2330042% 4% ypsC+33nt% 63.06% 21.27% 41.79% 1.08E406% AAACAGAAAACGCAUAAAAAGAAGACGCUCUGCAUGCGUCUUCUUUCAUC 411.9% 4% 2331269% 4% rnpB+61nt% 93.96% 59.71% 34.25% 5.75E407% CAUUUAAAAUGAUGAAAACAAGCUCUCCCGUAUAAGGAGAGCUUUUAUCU 410.8% 4% 2332710% 4% cotD+74nt% 63.96% 25.81% 38.15% 1.69E409% UGUAAACAAUGCAGCACAACAAAUGGGGCCCACGGGAGCCCCAUUUUUUA 412% 0x1% 2336908% 4% ypqE+25nt% 95.81% 95.52% 0.29% 8.39E401% GCUCUUUACAAUAAAAGCGAAAUAAGCAGGGCGUAUGCCUUGCUUUUUUU 410.4% 4% 2338791% 4% yppE+18nt% 91.94% 95.58% 43.64% 4.89E401% AGGAUGAAAUUGCAAGAGAAGACAGCCGGUAAAAGGCUGUCUUCUUUUCG 417.2% 4% 2338829% +% yppF+59nt% 67.69% 70.95% 43.26% 1.10E401% CCCUAUAAAAACGAAAAGAAGACAGCCUUUUACCGGCUGUCUUCUCUUGC 411% 4% 2344227% +% ponA+39nt% 98.51% 97.42% 1.09% 7.20E401% AAACAAAUUAAACAAAAAAGCCGUCACCUUUGGGGUGAUGGCUUUUUUGG 415.4% 4%

! 115! 2344234% 4% ypoC+30nt% 98.73% 94.21% 4.52% 2.87E403% AUCAUGCGAUGAAUCGAUAAAACCUCCUGUUAAAACGGGAGGUUUUUUAU 411.5% 4% 2346174% 4% asnC+50nt% 93.68% 64.09% 29.59% 4.85E408% UACAUUCAAAUGAAACAAAAAAGAGUCUCCUGCAAGGGAGACUUUUUACA 49.7% 4% 2347620% 4% aspB+40nt% 71.12% 16.75% 54.37% 4.00E406% ACAUAGCUAACAGAUCAAAAAGCGGCUGACAGAAAAGCCGCUUUUUAUCU 410.4% 4% 2352560% 4% panD+32nt% 44.01% 35.57% 8.44% 8.17E402% GCCCGUACAAUUUUGUAGAAGAAAAGCCCCCUUUAUCGGGGGUUUUCUUU 49.2% 4% 2361511% 4% ypjB+33nt% 87.94% 79.98% 7.96% 2.02E402% GGGACUACCCUAAAUAAGGAUGAGGGGCGGCGGUCAGCCGCCUUUUUUCU 412.4% 4% 2363040% 4% qcrC+71nt% 89.42% 71.50% 17.92% 1.30E403% GAAGGAUAUACUUUUAUUAUCAAAAGCUGACCCGGCGUCAGCUUUUUUAU 47.5% 4% 2365697% 4% ypiB+39% 65.22% 20.52% 44.70% 2.10E403% AGCUCACAUAAUAUGACCAGCCUUGCAGUGAAUUGCAAGGCUUGUUGCCG 412.6% 4% 2367790% 4% aroE+164nt% 53.29% 7.00% 46.29% 2.58E404% CAGGUCAAAGAGCUGCUUUACUGUACAGAGGGCGAUCUUCCUUUUUUCAU 41.8% 4% 2367931% 4% aroE+23nt% 94.86% 46.44% 48.42% 6.71E407% UUAAAUAAGCUUUCGAAAAAAUCCUGAAGUUUUACUUCAGGAUUUUUUAU 410.8% 4% 2369649% 4% in%tyrA%CDS% 45.61% 48.50% 42.89% 5.47E401% AGAUAUUACAAGGAUUGCAUCAAGCAGCCCGGCAAUGUGGCGGGAUAUUU 47% 1x1% 2370387% 4% hisC+28nt% 22.85% 29.91% 47.06% 2.48E401% CAUUUUAGCUGAAAUUUUAUAAGAGGUGAUCAAAUAUCACCUCUUUAGUC 410% 4% 2377481% 4% aroH+151nt% 91.03% 87.32% 3.71% 1.36E401% AGACAUUAUGUUUAUUCUACCCAAAAGAAGUCUUUCUUUUGGGUUUAUUU 411% 4% 2381190% 4% ndk+164nt% 93.55% 70.04% 23.51% 1.97E405% CCUCUGCCUUUCCCAACGAUCUAAAAUCAGCUGAAAAGCUGAUUUUUUUA 48.9% 4% 2381222% 4% ndk+132nt% 22.96% 18.93% 4.03% 1.69E401% GAAUAAAGGGUUGAAUGGCAGUGUGCAUCAGACCUCUGCCUUUCCCAACG 46.7% 1x2% 2382726% 4% ubiE+181nt% 13.70% 10.05% 3.65% 9.50E402% GUCUUCACCUGCUGCAGGCCGGAGGGAAACGUAUUCGGCCUGUUUUCGUG 414% 4% 2385458% 4% hbs+85nt% 98.33% 86.37% 11.96% 2.13E407% UACACUUUAUUUCUUCACAGAAAAGCCCCUUUCUAAGGGGCUUUUCAUAU 410.1% 4% 2386155% 4% spoIVA+40nt% 98.31% 98.80% 40.49% 9.80E401% CAUCCUGUAAUACCGGUAGACCUCUUUAUAGAAUGGGAGGUCUUUUUUCU 410.2% 4% 2387812% 4% yphF+42nt% 96.35% 92.38% 3.97% 2.04E401% AGGAAUGAACCUUUCUCCCUUGCAUACAAAUAGGGAGAAAGGUUUUUUUA 417% 4% 2388914% 4% gpsA+237nt% 96.71% 80.68% 16.03% 3.26E405% AUAGUCAAGUUGACUGAAGCGAAGGUCCCCCUCUUUGCUUCAGUUUUUUU 415.1% 4% 2393559% 4% fni+43nt% 95.46% 92.13% 3.33% 8.15E402% GCGAUAAAUGAUAAAAGCCCAAAACCAUAUGUGGUUUGGGCUUUUUGUAU 412.7% 1x0% 2394473% 4% rpsA+191nt% 75.70% 34.17% 41.53% 1.76E409% GAUAUUUCCACAAAAAUCGGCGAACUUUCAAGCAGUUCGCCGAUUUUUAU 415.2% 4% 2400178% 4% prsW+30nt% 99.15% 99.15% 0.00% 9.75E401% UUAAUAUGAUGCAAGUAUAGAAGCCGCACAGCAACCGUGCGGCUUUUUUG 412.4% 4% 2400946% 4% ypdA+38nt% 95.74% 83.92% 11.82% 6.08E404% GAAAACCAUUAAAGAUGAGGAGCAUAUGAUGCAUUCGUAUGCUCUUUUUG 413.1% 4% 2402009% 4% gudB+58nt% 53.34% 51.93% 1.41% 7.21E401% UUUGCAUAAAAAUAAAAAAUCUCCUAUGAUAAAAUAGGAGAUUUUUUUAU 410.2% 4% 2403466% 4% ypbH+40nt% 99.92% 90.33% 9.59% 4.37E405% UUUUUCAUAAGAAUGCAACGGAAAACUGCUGAUUUCAGCAGUUUUUUUUC 48.3% 4% 2405074% 4% ypbF+40nt% 81.08% 43.40% 37.68% 1.85E403% AAGUAAAUAAAAUGGGGCGUUUUCUCAAACGAUAGAAACGUCUUUUUUUA 45.5% 1x0% 2405839% 4% ypbD+454nt% 51.95% 25.71% 26.24% 8.01E404% ACUCGCCAAAUAAGGAGGAAGCAACCGCCGCGGCUGCUUCCUCUUCCCAA 413.1% 1x1% 2409984% 4% fmnP+33nt% 89.09% 98.53% 49.44% 9.66E402% GUGCACAUAUCCAUUAAAUAAAAAAGCUCCCGUUCGGGAGCUUUUUUUAG 410.9% 4% 2410016% +% fer+39nt% 99.18% 97.42% 1.76% 1.60E403% AAUUUGAAUAGAAGUAACUAAAAAAAGCUCCCGAACGGGAGCUUUUUUAU 410.9% 4% 2410651% 4% ypzE+44nt% 46.35% 16.40% 29.95% 7.66E404% GCCUAGCCUAAUUUUCGAAACCCCGCUUUUAUAUAUGAAGCGGUUUUUUU 48.3% 4% 2412664% 4% aroD+42nt% 99.44% 97.60% 1.84% 4.19E401% GGGGAUAGAACAAUAAAAAAACUCAAGCUAUAUAGCUUGAGUUUUUUUAA 410% 4% 2412701% +% serA+38nt% 94.13% 97.15% 43.02% 1.50E401% GAUCUGCCAUAAUUAAAAAAACUCAAGCUAUAUAGCUUGAGUUUUUUUAU 410% 4% 2413557% 4% rsiX+28nt% 96.58% 91.45% 5.13% 5.58E403% AAAUCCGAUUUCCUUAAACUAAAAAGAGCCCUUUAAGGCUCUUUUUUAGU 46.8% 4% 2415343% 4% resE+72nt% 98.37% 98.45% 40.08% 8.72E401% GAAUCUUGUUCCAUAAGAAACACCCGCUGACUGAGCGGGUGUUUUUUUAA 413.9% 4% 2424620% 4% ypuI+34nt% 96.04% 93.81% 2.23% 4.08E401% GGCGCCAAUCAGAUAACGUUUACUCUCCCUUUUUCAGGGAGAGUUUUUUU 412.2% 4% 2427374% 4% ypzK+31nt% 97.05% 96.41% 0.64% 1.60E401% CAUUUCAUACAAUAAUUAAGCAGAGGCUGUGAUCAGUCUCUGCUUUUUUU 416.2% 4% 2427411% +% ypuF+20nt% 88.89% 72.32% 16.57% 2.10E402% AUAGAACGCAGAAAAAAAAGCAGAGACUGAUCACAGCCUCUGCUUAAUUA 411.4% 1x1% 2432281% 4% sipS+35nt% 98.93% 93.59% 5.34% 3.81E403% CGCAAAACAAAUUAGGAUCAAGCAGCUUCCCAUUGGGGCUGCUUUUUUUA 410.3% 4% 2435318% 4% ppiB+42nt% 99.05% 98.58% 0.47% 2.95E401% AAGGCUAAUCGGCAGGCAAAAGGCUUCCUCUUAGAGAGGAAGCUUUUUUU 412.5% 4% 2436914% 4% lysA+33nt% 95.61% 96.82% 41.21% 1.09E401% CGGGUGUAAAGCAAUAAAAGAAAGCGCCGAUUUUUCGGCGCUUUUCUUAU 412.8% 4% 2436949% +% ypuA+32nt% 92.86% 87.18% 5.68% 7.20E401% GUAUCUAUAUUCAAAUAAGAAAAGCGCCGAAAAAUCGGCGCUUUCUUUUA 412% 4% 2446357% 4% pupG+61nt% 98.89% 100.00% 41.11% 6.71E402% UGCAGGACCAAAAGACAGCUGUGUCUGAUAUCACACAGCUGUCUUUUUUU 417.4% 4% 2448567% 4% xerD+24nt% 25.11% 16.55% 8.56% 9.61E402% ACAAGCAGUUUCAUCCGCGAGCAUAGCCGCAGGUGGCUGCGGCUUUUUUG 412.5% 4% 2449510% 4% in%yqzK%CDS% 23.24% 11.45% 11.79% 2.39E403% UUGAAAUGGAUCAGGAUGAAAAAGGCGGAUGGUUCGACCGGUUGAUCUUU 45.9% 0x1,%3x2% 2449794% 4% fur+47nt% 95.76% 42.73% 53.03% 1.06E408% UAGACGGUGCCGAGCGCGAACCUUUUCUCAUGGGGAAAGGGUUUUUUGCU 49.5% 4% 2451421% 4% mleA+42nt% 97.48% 97.74% 40.26% 9.23E401% UGAAAUAAAUGUAGCUAAACAGCACCUGUCGUAGCAGGUGCUGUUUUUUU 416.5% 4% 2454287% 4% aspA+60% 49.49% 43.95% 5.54% 5.57E401% AAAUACAGCUUAUUCAUCUCCGAAUAGUCGGAUGAAUAAGCUGUUUACAA 419.8% 2x0%

! 116! 2457185% 4% yqxK+164nt% 46.15% 36.99% 9.16% 3.24E401% AGGCUGCUCCACGUGGCCAAUUCUAUGGCCUGAGGAGCAGUCUGCUUUUG 425.7% 1x0,%1x1% 2460248% 4% yqkE+30nt% 83.93% 65.80% 18.13% 1.39E401% AUUGGCAUCAAUAUAAAUAAACCAGCACCCGUACAGGUGCUGGUUUUUCU 414.1% 4% 2461577% 4% yqkC+44nt% 94.33% 85.75% 8.58% 9.32E404% CUGUAACAUAAAAAAGCGAAAGAGCCGAAGAGGCCUUUCGCUUUUUUAUU 414.9% 1x0% 2461620% +% yqkD+39nt% 79.17% 91.43% 412.26% 5.30E401% CAACAGAAUAAAAAAGCGAAAGGCCUCUUCGGCUCUUUCGCUUUUUUAUG 414.1% 0x1% 2467956% 4% yqjT+203nt% 90.06% 70.32% 19.74% 2.00E402% AUGUUCUUCACCUCAUGUUUGCGGGAGAGAUUCAUUCUCUUCCGUUUUUU 413% 4% 2473125% +% yqjU+4963nt% 87.23% 72.84% 14.39% 3.30E403% GGGUGGUACCGCGAACCUUUUCGUCCUUUACGUGAUGAAAAGGUUUUUUG 410.9% 4% 2474031% +% proI+44nt% 92.86% 90.68% 2.18% 6.40E401% UCUUAGAUGUAAGGACAAAAACAGAAGGCACAGUGCCUUCUGUUUUUUAU 412.2% 4% 2476899% +% yqjM+40nt% 98.09% 99.21% 41.12% 5.60E401% AGGCUGGUAAUGCCCAUAAGAGAUAUCCUGUAGAGGAUAUCUCUUUUUUU 413.3% 4% 2477733% 4% yqjK+273nt% 95.83% 91.24% 4.59% 3.62E401% ACAAAAUAAUAUAAAAGACCGGGAAUCCCUUACGGCCCGGUCUUUUUUUA 412.3% 3x0% 2477773% +% yqjL+43nt% 89.66% 80.70% 8.96% 1.80E401% CAAUUAACGUAAAAAAAGACCGGGCCGUAAGGGAUUCCCGGUCUUUUAUA 415.2% 0x4% 2480706% 4% yqjI+44nt% 99.00% 96.04% 2.96% 1.36E403% AAGUAAUCAAUAGAAACCCCCGAAGCUCUUAAGCUUUGGGGGUUUUGUUA 419% 4% 2484730% 4% yqjE+950nt% 96.74% 94.16% 2.58% 2.07E401% UUGCAAGUAACAAAAAACAACCCCGGCUUUUUGCACGGGGUUGCUUUUUU 416.8% 0x1% 2484769% +% yqjG+38nt% 96.18% 87.62% 8.56% 2.30E402% UCGGUGAAAUAAAAAAGCAACCCCGUGCAAAAAGCCGGGGUUGUUUUUUG 416.3% 1x0% 2485636% 4% yqjE+44nt% 91.68% 74.24% 17.44% 6.29E403% AAAUAAAAAAAGAAAACCCGAGUGCGAUUUCCCGCAUCGGGUUUUUUUAG 412.7% 1x0% CGCAUGAGCUCUUCCUUCAUUGGUCAACCUAAUGAAAAAGGAGGAGCUUAUGCGUUU 2489472% 4% in%yqjB%CDS% 89.80% 80.82% 8.98% 1.14E402% UUUC 432.6% 0x3% 2490533% 4% artR+41nt% 82.04% 30.33% 51.71% 2.09E405% AUAUUAUAGAAUAUAAAAAAGAAGAAGGCUGGCCGCCUCUUCUUUUUUAU 48.6% 1x0% 2491992% 4% artP+37nt% 51.33% 36.83% 14.50% 4.54E403% UGGCGAGAAGUAAAAAAAAGCGGCUCAACUUUUUCGUUGAGCCUUUUUAU 412.4% 4% 1.00E+0 2493024% 4% yqiW+40nt% 99.05% 99.12% 40.07% 0% AGAAGUAUAAGACGAACAACCCGGAUGCUCAAAGCAGCCCGGGUUUUUUU 412.3% 1x2% 2495870% +% bmr+45nt% 93.09% 83.93% 9.16% 8.50E402% CGUGAUAAGAAGCGCAUUCUUUGUGUACUGCAAAGAAUGCGCUUCUUCUU 419.3% 4% 2496743% 4% bkdB+53nt% 98.54% 96.62% 1.92% 3.40E401% AGCAAAAAGAGCAUUUUUUGAAGUUUUGUUUCAAAAAAUGCUCUUUUUCU 416.4% 4% 2496792% +% bmrR+58nt% 98.44% 85.53% 12.91% 7.10E401% AGAAAAAGAGCAUUUUUUGAAACAAAACUUCAAAAAAUGCUCUUUUUGCU 415.6% 4% 2507292% +% yqzF+36nt% 94.63% 88.55% 6.08% 4.10E402% UCAGAAAACGAUAGCUGAAAAAAAGCCGGAGAAUGCUCCGGCUUUUUUUG 412.6% 4% 2514130% 4% yqiK+39nt% 100.00% 91.00% 9.00% 4.07E402% AAAAUGAAUAGUUGUUAGAAGGAGGCUGUUUGACGCAGCCUUCUUUUUUC 412.8% 4% 2517559% 4% spo0A+464nt% 60.66% 41.69% 18.97% 1.81E401% UUAUAUAAAGGGAAAAAAGACUGCCGAAUCGUUUCGGCAGUCUUUGCACA 416.7% 4% 2517598% +% yqiG+40nt% 99.20% 100.00% 40.80% 3.40E401% UAAAGAUUAAUGUGCAAAGACUGCCGAAACGAUUCGGCAGUCUUUUUUCC 415.9% 4% 2517943% 4% spo0A+80nt% 93.14% 84.87% 8.27% 8.39E402% AAACGUCUUUUAUUUAUUAGUUUGCGCUGAUAAAUAGGAGGCGUUUUGUUU 418.9% 4% 2520529% 4% recN+28nt% 97.62% 97.18% 0.44% 9.36E401% UCAAGUCAAAACAACUGGGUAAGCUGCGCGAGAAGCGCAGCUUAUUUUUU 413.4% 4% 2522847% 4% yqxC+24nt% 81.24% 10.72% 70.52% 2.18E409% AAAAAAAAGCAGAUGUACCGGAAUAAUAGGGCGCUAUUAUUCCUUUUUUC 410.2% 4% 2528308% 4% folD+96nt% 79.24% 74.02% 5.22% 1.15E401% GAGCACGAUACCCGCUUCUUCAGGCUCCUAAAGCCAGGGCGGGUUUUCUU 45.7% 1x1,%1x1% 2529821% 4% yqhY+105nt% 9.77% 7.37% 2.40% 7.79E401% CCUUUAUUUCAAAGCAUGAAGAAAGCCGGCUUACAUAGCCGAGUUUCUUC 46.4% 4% 2529879% 4% yqhY+47nt% 69.37% 44.31% 25.06% 7.76E406% UAAAUGGCUUAACACGAAACCAAGGGGAGGGCGGCCCUUUGGUUUUUUUA 411% 4% 2538069% 4% efp+46nt% 99.94% 99.94% 0.00% 7.18E401% AUAGAAAGAAAAAAAGAAGUCUGUUCCCAAAUGGGAGCAGGCUUUUUUUG 416.5% 4% 2542509% +% yqhP+67nt% 87.41% 45.10% 42.31% 1.70E403% AAACAGCUCUGUCCGUCUUUUACCUAGCUCAAUCAGGGCUAGUUUUUUUU 48.4% 4% 2543407% 4% mntR+33nt% 98.58% 87.34% 11.24% 7.44E406% AACAUCAUAAUCAGUAAAAAGGCGGUCUCGAAGGAGGCCGUCUUUUUUGA 416.7% 4% 2545374% 4% gcvPB+36nt% 69.07% 32.64% 36.43% 1.76E403% CGGAAGAAAGAUAAAUAAAAACAGCUGUCUACCAGACAGCUGUUUGCUUU 412.3% 4% 2545409% +% yqhL+34nt% 95.93% 87.13% 8.80% 2.70E402% UAAAGCGAAGAAAUAAAGCAAACAGCUGUCUGGUAGACAGCUGUUUUUAU 412.3% 4% BSU_misc_RNA_ 2549376% 4% 38+129nt% 48.14% 70.17% 422.03% 5.47E404% CCAGGACAGAGAACCUUCAUUUUACAUGAGGUGUUUCUCUGUCCUUUUUU 420.6% 0x1,%0x1% 2553021% +% sinR+33nt% 72.09% 43.72% 28.37% 1.50E406% CCCAAAAAGAGGAGUAGUGCCUGAGCAGAGGCACUAACUCCUCUUUUGUC 422.5% 0x1% 2553068% +% sinR+80nt% 90.08% 94.85% 44.77% 6.10E401% GUCAAUAACCAUCGAGACGGCCCAGUAUAUGAAUACUGGGCCGUCUCUUU 428.5% 4% 2564886% 4% yqgX+37nt% 98.97% 91.55% 7.42% 3.22E402% GUUUUCAUUGUAAAAAAAGAGACAAACCGAUAAGGUUUGUCUCUUUCUGC 415.1% 4% 2564924% +% yqgY+41nt% 98.91% 87.08% 11.83% 1.40E404% GGCCAUUAAAUGCAGAAAGAGACAAACCUUAUCGGUUUGUCUCUUUUUUU 414.3% 4% 2565883% 4% yqgV+37nt% 96.52% 82.53% 13.99% 6.87E402% UUUACAGCCAUAAAAAUAAACCUGUAUCCGAUCGGAUACAGGUUUUAAUG 414.2% 4% 2565919% +% yqgW+31nt% 82.30% 83.96% 41.66% 2.30E401% GUAUCCAACCGCACAUUAAAACCUGUAUCCGAUCGGAUACAGGUUUAUUU 414.2% 4% 2568530% 4% yqgS+43nt% 71.83% 52.57% 19.26% 7.45E403% AUCAUAAUCACAAUGUCUCCCGCAUCGAAGUGAGCGGGAGGCUUUCUUUU 417.1% 1x0%

! 117! 2573493% 4% yqgO+27nt% 100.00% 87.18% 12.82% 7.24E404% AGUUUAUACAGCAAGCUUUCUAAAAUCCCGUGAAAAACGGGAUUUUUUGC 48.9% 4% 2574343% 4% rpmG+65nt% 97.75% 94.67% 3.08% 9.01E404% AGGUGUAAGAAAAAAGCCAGAGCUUUGAAAAAGGUUCUGGCUUUUUUUCU 417.3% 4% 2577212% +% yqzC+31nt% 97.09% 84.54% 12.55% 2.20E404% AAAAACGUUAACACGAUAAAAAAACAGGCUGACUCAGCCUGUUUUUUUCA 49.4% 4% 2581737% 4% pbpA+34nt% 97.71% 99.09% 41.38% 2.33E401% GUCUUCUGAUAACUAAAAAAAAACGCUCACAUGAUGUGGGCGUUUUUUUU 49.6% 4% 2585395% 4% sodA+39nt% 98.68% 98.13% 0.55% 1.27E402% AAGCAAAAUAAUGGCACAAACAAGGUCCUCAUUAUGGGACCUUGUUUUUU 413% 4% 2587898% 4% yqgA+98nt% 98.68% 89.99% 8.69% 5.64E403% AUGAUUUAAUUCUGAAAGCUAGGUGCCCUAUUGGUACCUGGCUUUUUAAA 416.1% 4% 2588018% 4% in%yqgA%CDS% 50.31% 43.72% 6.59% 5.07E401% GUAGGUUUAUCAGUAUAUAAGGGGAAAGCUAAGGGAGCUGCAUUUGUAUA 44.4% 3x3% 2590280% +% ispG+24nt% 99.80% 98.05% 1.75% 1.10E402% UAAAAGAAGAAACACAAAAAGCUUGACGGGAACCCGUCAAGCUUUUUUGU 416.1% 4% 2591382% 4% zur+46nt% 92.44% 84.84% 7.60% 6.65E402% GUAAAAUGCGUAUAUAUGAAAAAGGGGCCCGGUUUGGGCUCCUUUUUCAG 412.4% 4% 2591417% +% yqfW+32nt% 78.35% 45.55% 32.80% 6.70E405% AUACGCGUCAAUAACUGAAAAAGGAGCCCAAACCGGGCCCCUUUUUCAUA 49.5% 1x1% 2593250% 4% yqfS+31nt% 84.32% 73.03% 11.29% 4.47E403% AAAGAUUUUACAGCAAUAAAAAAUGGGGGAUAACACCCCCAUUUUUUAGC 410.5% 4% 2597467% 4% yqfO+35nt% 99.55% 90.49% 9.06% 4.38E406% UUUACAUUUCUAUAAAAAAACUGAGGCUUUUACAGCCUCAGUUUUUUGCU 412% 4% 2597504% +% ispH+25nt% 95.91% 93.32% 2.59% 4.80E401% UCCAAAAGUAAAAGCAAAAAACUGAGGCUGUAAAAGCCUCAGUUUUUUUA 413.3% 4% 2600181% 4% sigA+33nt% 95.85% 91.83% 4.02% 3.72E402% AAGAUUUCCUUGAAUAAGAUGGAACGGGUCUUGAAGAUCCGUUCUUCUUU 412.4% 4% 2604092% 4% yqfL+29nt% 36.30% 21.24% 15.06% 3.05E402% CUCAAAACAAAAAACAUAUAACUCAGGACGCUCUAUCCUGGGUUUUUGGC 47.7% 4% 2605682% 4% glyS+48nt% 78.80% 65.58% 13.22% 8.75E403% AAAGAGAGAAAAGGCGGUUGCUGUGUGAUCGGUAAUCGUCUUUUCCCCAU 413.3% 4% GGGAGAACUCUCGUCCCUAUGUUUGCGGCUGGCAAGCAUAGAGACGGGAGUUUUUUG 2608695% 4% recO+251nt% 83.38% 86.24% 42.86% 1.76E401% G 426.9% 1x1% AACAGCGCGGACGGAGCGGAAUUUCCAAUUUCAUGCCGCAGCCGCCUGCGCUGUUCU 2611690% 4% in%dgkA%CDS% 29.39% 9.13% 20.26% 3.16E404% CAUU 423.5% 1x2,%1x1% 2614456% 4% phoH+40nt% 75.56% 53.31% 22.25% 1.83E405% GCAAAAUUAAUGCUGAAUGACCCGAUCGCGCGUUAUCGGGUCAUUUUUAU 413.1% 4% 2616950% 4% yqfB+55nt% 95.20% 95.25% 40.05% 7.44E401% UAGAACCUCCUUUCAAAUCAUACAUAUGAGAUGAAAGGGGGUUCUUUUUG 417.6% 2x2% 2619865% 4% yqeY+45nt% 99.84% 99.43% 0.41% 4.16E402% CUUAAAUGGCAAAGAAAAGGACAUCUUUCUAAGAGAGAUGUCUUUUUUUA 410.9% 4% 2621637% 4% rimO+40nt% 97.99% 94.55% 3.44% 2.34E403% GUCUUCUUAACCUAAAAAAUCGGUGCAUUAAAAUGUACCGAUUUUUUUAU 411.2% 4% 2625997% 4% dnaK+115nt% 86.23% 94.65% 48.42% 4.49E405% AAUGAUUAGAAAGUCAAAGUCAGGCAUCUCUUGGCUUUGACUUUUUUUCU 414.3% 4% 2630876% 4% lepA+34nt% 82.29% 36.02% 46.27% 1.95E407% UCCGAAAAAACAAUAGAAGCCGCCGCAGUCUUGUACUGCGGCUUCUUUCU 413.3% 4% 2636082% 4% holA+14nt% 82.15% 79.19% 2.96% 8.85E401% UUAAAAAGAAAUGAAAAAAACGAUCCCCAUUAUUGAGGAUCGUUUUUAUA 48.9% 1x1% 2636120% +% rpsT+39nt% 99.95% 99.90% 0.05% 3.60E401% UUUCUGCAUAAUAUAAAAACGAUCCUCAAUAAUGGGGAUCGUUUUUUUCA 412% 4% 2637199% 4% comEC+344nt% 73.50% 59.09% 14.41% 2.68E401% ACAGGCGUUUAAUAUAAAUGGGGAAGCAGCAGUCAGGCUUCCUCUUUACU 410.7% 4% 2637544% +% yqzM+41nt% 95.80% 96.03% 40.23% 4.60E401% GGUUCAUAACAGCGACUGCCCGGGCUGCUGAUUUCUCGGCAGUCUUUUUU 412.2% 4% 2642084% 4% yqeM+17nt% 76.49% 79.86% 43.37% 4.01E402% AAGGCGCAGAAAUCAAAAACCAUCGUUUCCUAAAACGAUGGUUUUUUAAA 49.9% 4% 2647710% 4% yqeF+210nt% 93.92% 79.43% 14.49% 8.15E402% AGCAUAAUAACCGGCCCUUUAAAACACCUCUUUUUAGGGGUGUUUUUUGC 48.5% 4% 2652386% +% yqeB+32nt% 61.37% 50.79% 10.58% 2.90E402% CUCGGCGAAGGAUUGUAACAACAGAGGCUCAAGAAAGAGCCUCUUCUUUA 411.8% 4% 1.00E+0 2653692% +% spoIVCB+229nt% 96.36% 87.65% 8.71% 0% CGUCAUCGCUUAGGCUGAUUAGCGUUAAAAGACGCUUGCGGCCUUUUUUU 415.3% 3x2% 2660520% +% phrE+56nt% 97.43% 88.37% 9.06% 2.60E406% AAACAACAUUAGUUCUGAUUCCCUUUAGCCGUUUCAUAACGGCUUUUUCU 47.4% 4% 2663350% +% yqcF+60nt% 94.48% 91.72% 2.76% 2.80E401% AAAGAAGAGUCACUUUAUAAGCCCCUCUCAAUGAGAAGGGCUUAUUUUAU 410.1% 1x1% 2663514% 4% yqxJ+37nt% 84.12% 72.60% 11.52% 1.58E401% UUUCUUUAAUUAAAGAUAAGGACCAGCCACAUAAUAAGCUGGUCUUUCUU 410% 4% 2678344% 4% yqbM+798% 97.56% 93.36% 4.20% 4.65E407% GUAGACACUUUUCCUUUACAGUAAUGUAAAUAGGAUGAGUGUCUUUUUUU 418.1% 0x2,%1x1% 2678426% +% yqdB+7nt% 32.98% 24.58% 8.40% 1.20E401% AAAGGAAAAGUGUCUACACGAGGACCCUCCUAUUAAAGGGUAGUUUCUUU 44.9% 4% 2678878% 4% yqbM+264nt% 69.33% 24.58% 44.75% 5.24E406% GGAUAGACUUUACCCUUUUACUUUGCCGAGCUCAAGGGGUGGGUCUAUUUCUUCU 414.6% 2x3,%1x0% 2679014% +% yqdB+595nt% 98.22% 96.49% 1.73% 6.40E402% UCUUGAUGGGCCAACAUUUAUACUGACCCGGCGGCAACCGGGUCUCUUUU 412.6% 4% 2685150% 4% yqbC+12nt% 89.43% 73.31% 16.12% 6.39E403% AUGUUGCUGAGAAUACAGCUGGUGAGACUUCUAAUUAGAAGUCUUUUCUU 47% 4% 2690357% 4% yqaR+24nt% 68.34% 12.02% 56.32% 3.54E403% CUAAUUUAAUAAAAAAACAUAUUUAAGCUUCUUUUGAGGAGCUUUUUUAU 45.3% 4% 2691467% 4% yqaO+1178nt% 99.75% 99.13% 0.62% 1.81E401% GCGGACACUGAACUUACAGUAUUACGCUGUAUGUUUGGUGUCCGUUUUUA 425% 1x1% 2692616% +% yqaP+45nt% 77.53% 84.42% 46.89% 1.10E404% AAUAACCUGCACAUCCAAGCCGAAGGAGGAGAUAUCCUCCUUCUUGUUUA 414.4% 4% 2692930% +% yqaP+359nt% 86.09% 63.11% 22.98% 5.20E402% UACCAGUUCAUAUCAAGAACACUGAGGCUAAGCGCUUCGGUGUUUUUUAU 412.1% 4%

! 118! 2713919% 4% yrkD+30nt% 58.62% 62.14% 43.52% 6.36E401% UAUUGGUAAAGAGCCGAUAAAAAUUCAUCAACCUAAGGUUGACGAAUUUU 46.9% 1x1% 2714764% 4% yrkC+169nt% 77.12% 72.12% 5.00% 6.07E401% UUAAGUAAUUGAUAAAUAAAGCCGAUUUAAAAUUAAAUCGGCUUAUUGCU 410.4% 4% 2732919% 4% yrdC+61nt% 94.74% 76.30% 18.44% 3.89E405% UUGGCACAGUAAAACGGCAGGCGCCUUUCCAAUAGGAAGGGCGCUUUAAU 417.7% 4% 2734869% 4% yrdA+84nt% 92.57% 85.14% 7.43% 2.19E401% AUAUAAGAAGAUGUUUUGAUCAAUCUUUUUUCAAAACAUGUUCUUUUUUU 410.8% 1x1% 2738015% +% yrpB+57nt% 94.12% 76.29% 17.83% 7.70E402% UCAUUGAUAGAGCAAAAAGCAAACUUUGACAGGCAGUUUGCUUUUUUUUU 45.3% 4% 2739179% +% yrpC+74nt% 73.30% 66.92% 6.38% 2.70E401% UGAAGAGAAACAUGAACUAAGAAGCGGGCUUAAAAAGCCCACUUUUUUUC 48.8% 1x1% 2740273% +% yrpD+80nt% 73.92% 49.45% 24.47% 1.20E403% UUGAGAAGCUCUCGAUAGUCUUAAAGGGGGCUUAACAUGCCCCUUUUUUC 49.4% 4% 2740906% +% yrpD+713nt% 62.11% 67.22% 45.11% 2.90E401% UACCUCAUAUCCAUCAGACGCCAUAAGAAAUCUUUAUGGCGUCUGUUUUU 410% 4% 2747792% +% yraM+81% 92.79% 94.72% 41.93% 2.30E401% AUCGUUAAUAGAUGGAUUGAAUGCGCCUUCUUGCACAGAUCCAUUGUAAU 49.9% 3x2% 2747913% 4% csn+71nt% 98.03% 87.06% 10.97% 7.24E402% UGCAGAUGAACUCAAUCUAAAAGAUACCAAUGAUGUUGGUAUCUUUUUAU 48.5% 4% 2749565% +% yraL+42nt% 91.45% 80.65% 10.80% 3.20E401% CUAAAUAAACAAAACGGAAGCACUGAUAAAAAAUAAUCAGUGCUUUUUAU 410.3% 4% 2750798% 4% yraJ+85nt% 86.84% 60.00% 26.84% 3.14E402% GCCUAUCUAGGACGAACCAUACCAACAACAAUAGUUGGUAUGGUUUUUGC 414.1% 4% 2758041% +% yraA+40nt% 95.91% 98.89% 42.98% 5.70E402% GUUAAAAUAACAAGAAGGCACAGACUGUUCGGGUCUGUGCCUUUUUUAAA 416.6% 4% 2762964% 4% levR+61nt% 98.21% 94.00% 4.21% 3.12E401% UCAUAUGAACCUGUAUUAAAUGGAACACCAUUUUAAUACAGGUUUAUUUU 414.3% 0x1% 2767985% +% aapA+39nt% 94.87% 94.96% 40.09% 4.10E401% AGGUGAAAUAAAAAAAAGACAAGGGAUACUCACUCCCUUGUCUUUUUAUA 413.1% 4% 2769712% +% yrhO+58nt% 100.00% 98.33% 1.67% 1.80E401% AUCUCUUACCCCAAAAACAAGGCUUGUACAAAACAAGCCUUGUUUUUUUA 414% 4% 2773885% +% yrhK+239nt% 94.30% 91.07% 3.23% 6.20E402% GGUUUUCUCAUAUGCAAAGCAAUCCCGCCAAUCAGAUUGGCGGGAUUUUA 415.5% 4% 2778571% 4% yrzI+352nt% 98.87% 97.62% 1.25% 9.25E402% UCAUUGGCAUUAGAAAGAGGGCAGAAAACAUUAUGUUUUCUGCUUUUUUU 410.8% 4% 2779106% 4% yrhG+356nt% 14.08% 26.90% 412.82% 1.00E402% CUGCGGUUUUUAUUUGCCCGCGGCAGAAGGGUUGUGCCGCGGGUUAUUUC 418.7% 1x1% 2779143% 4% yrhG+319nt% 41.60% 34.88% 6.72% 4.19E402% CCCCGCAGGCAGUAGAGGCAUUGGUGUCUUCUUUUGUCUGCGGUUUUUAU 422.2% 0x1,%1x1% 2780316% 4% yrhF+209% 95.42% 80.76% 14.66% 1.89E402% AGGCAGCAUUCAAACGCCUGGUUUGACACAGGUUAUUUGAGUGCUGCCUUUUUUA 427.5% 1x2% GCCAUGUGUGUUUACACCUUCUUAGAAUUAAGGGCAGGUGUAUCUAUACAUGGCUUU yrhK+7526% 2781172% +% 94.18% 76.72% 17.46% 4.90E403% UUU 425.8% 2x1% 2784653% 4% yrhC+35nt% 99.01% 86.57% 12.44% 3.06E406% GAAGCCGACGAAUAAAAAAACAGCCAUCAUCAGAGAUGGCUGUUUUUCUG 412.6% 4% 2787099% 4% mtn+31nt% 37.24% 44.08% 46.84% 3.72E402% GAUCAAACGAAUUCAUUAAAACGGGGAGAACGUUCUCCUCCGUUUUUCUC 410.1% 0x1% 2788885% 4% yrrS+35nt% 99.37% 81.78% 17.59% 1.02E402% GAAAAGCUAAAAUAAACAAAAGCAGCCGGGUUAAAACCGGCUGCUUUUGU 416.5% 4% 2788919% +% yrzA+36nt% 77.27% 71.83% 5.44% 7.70E401% CAGCUGAAGCCUAAAACAAAAGCAGCCGGUUUUAACCCGGCUGCUUUUGU 415.1% 4% 2791440% 4% greA+54nt% 97.06% 96.55% 0.51% 4.77E401% UGUUUAGCAGCGAAACACCUCGUCCACAAUGUGGGUGAGGUGUUUUUUUA 415.6% 4% 2795858% 4% yrrL+29nt% 93.35% 53.98% 39.37% 3.36E407% UCCUCAAAAAAUGAGAAAUAAAAGGAGAGCAAAAAGCUCUCCUUUUGUUC 411.6% 4% 2797051% 4% yrzB+49nt% 99.41% 99.10% 0.31% 2.42E401% AAACAUCGCGCCAAACCAAAGCCGGAGCUAUACUGCUCCGGCUUUUUUCU 416.9% 4% 2800854% 4% yrrI+287nt% 88.57% 88.20% 0.37% 8.80E401% AGCUCUCGUCCCUGUGUAAACGUUGGUUUGCAUAGGGGGAGGGCUUUUUUGC 428% 1x0% 2806258% 4% yrrC+28nt% 97.06% 91.45% 5.61% 4.85E402% UAUGAAAGAAGAACAGCAAUAAAAUGCUCCCGUGCAAGCGGGAGUUUUUU 411.2% 4% 2809374% 4% mnmA+39nt% 69.93% 48.08% 21.85% 3.39E403% GGUACGUAUAAAAGAUGAAAAACCUCAACACUGAGUUGGGGUUUUUUAAU 48% 4% 2813604% 4% yrvM+39nt% 99.50% 98.94% 0.56% 2.52E401% AGGAUAAAUAAUGCAUAAAAACAGCCUUGAUGAUCAAGGCUGUUUUUUUG 412.2% 4% BSU_misc_RNA_ 2814484% 4% 41+6% 99.81% 99.50% 0.31% 7.41E402% GGUUCAAAACAAAGGAAAGCUGCAACGGCACUAUUGGGACUUUAUUUUUU 43.3% 3x1,%1x1,%4x0% 2817868% 4% yrzK+323nt% 85.00% 93.37% 48.37% 2.57E403% UAUAACUCUCGUCCCUACUAUCAUGUAUAGUAGGGGCGGGAGUUUUUUUC 425.6% 4% 2820047% 4% yrvI+30nt% 93.22% 93.59% 40.37% 6.80E401% UCAUUAUGGAUUCAAAAUAAAAAAAGCUGCCAAAAGGCAGCUUUUUUUAU 410.2% 4% 2820079% +% yrvJ+29nt% 98.95% 99.60% 40.65% 3.30E401% UUAGAGAAAUACUUCCAAUAAAAAAAGCUGCCUUUUGGCAGCUUUUUUUA 410.7% 4% 2822851% 4% apt+50nt% 93.77% 71.76% 22.01% 4.90E405% GGAUAACCGCAUAACGAAAAAGCACUCCAUGUCAGGGUGCUUUUUUCCUA 46.6% 1x0% 2825779% 4% in%recJ%CDS% 45.58% 32.34% 13.24% 3.09E401% AAACCCCUCAGCCUGCUCUAGUAUAAUAGGGUGGUUGAGGGGUGAAUUUA 425.7% 1x0% 2826861% 4% secDF+39nt% 86.37% 65.55% 20.82% 1.37E404% CGGCGCAAUAAAAAAUAUCAGGCUGUCCUCUGCAGGGCAGCCUGUUUUUU 419% 4% 2832367% 4% yajC+57nt% 79.42% 88.19% 48.77% 4.73E402% AGCUAUACAUAGCAAACAAAAAAGAGCGGGCAAGUGAGCCCGCUCUUUUU 416.4% 4% 2838642% 4% yrbE+205nt% 35.12% 36.41% 41.29% 8.58E401% UCUUUAUGGUUGGAGACGGCCUCGAACAAGGCUGGCUGUCUCCUUUUCUC 417.9% 4% 2841484% +% yrzT+37nt% 99.76% 92.28% 7.48% 1.80E403% UUUGCCUCUGUAGAAAAACGCAGCGUAGUCGAUACGCCGCGUUUUUUCUU 410.2% 1x1% 2842941% +% in%yrbD%CDS% 41.67% 20.00% 21.67% 1.60E401% CUGAACGUCAUUGCCAUUGUGCUGCUUGCCAAGCCGGCGCUCCUUGCUUU 47.2% 0x1% 2843070% 4% yrbC+36nt% 95.45% 77.25% 18.20% 8.08E403% ACUAUCGUUCAUAAAAAACCGGCACGAGGUCAUAUCGGGCCGGUUUUAGU 412% 1x1%

! 119! 2843888% 4% coxA+43nt% 92.25% 51.70% 40.55% 4.69E407% CCGCUAGGAAGGAAGGGCUGCCGGAAGUGAUAUUCGGCAGCCUUUUUCUU 417.2% 4% 2844642% 4% safA+33nt% 80.49% 61.87% 18.62% 2.31E406% AAGAAGAAAAUGAGUGAUCGUUCGGAACGAUGUAAAUCGUUCCUUUUUUU 410.5% 4% 2851255% 4% pheA+28nt% 92.99% 90.78% 2.21% 2.95E402% AUACCAGUCUUACCAAUUAUAAAAAAAGCCCACUAGAGGGCUUUUUUUAG 46.1% 4% 2851288% +% nadR+30nt% 88.04% 75.52% 12.52% 3.80E405% GCAUUUUAAUUAAAGACUAAAAAAAGCCCUCUAGUGGGCUUUUUUUAUAA 46.6% 4% 2852614% 4% obgE+47nt% 27.83% 24.53% 3.30% 3.60E401% UAAUCAAUGUUGGCUGAAAAGAGAGCCUGGUGCCAGGCUCUCUAUUUUAA 417.2% 4% 2854838% 4% rpmA+42nt% 93.33% 82.39% 10.94% 2.42E406% CUCAAUAAUGAUUCAAAAAACUCCGGUCGAUGAUGACUGGAGUUUUUUUU 411.6% 4% 2857718% 4% minD+58nt% 99.13% 96.16% 2.97% 3.11E402% AAUCAAAGAGAAGAAUCUGACAAAGCAUAUGCUGUGUCAGGUUUUUUUUG 411.9% 1x1% 2865265% 4% folC+47nt% 91.36% 87.46% 3.90% 8.70E401% UAAAAGCAUCCGGCUCCGGCAGAAUCAAAAAAAGAUUCUGCCGUUUUUUU 415.7% 4% 2866622% 4% valS+42nt% 42.39% 23.85% 18.54% 1.17E403% AGGGUUAAUGAAAAGCCGGGGCGGUUUCUAGAGAAACCGCCUUGUCUUAU 414.9% 4% 2869343% 4% ysxE+621nt% 91.63% 96.47% 44.84% 1.39E403% ACCGCGAAAGAGCUUUUCGUCCUUUUACAGGGAUGAAGAGCUCUUUUUUC 421% 4% 2872836% 4% hemL+44nt% 99.78% 97.15% 2.63% 7.63E407% AGAUAAGAGUGAAAACCGGUAUCAAGGACUCCUUGUGCCGGUUUUUUCGU 413.6% 1x0% 2877626% 4% hemA+140nt% 55.23% 17.32% 37.91% 1.28E406% UCUUCAACACAACCGGAAGGCUGGAAAAAUGGCCUUCUGGUUGCUUUCUA 421.4% 4% 2879860% 4% engB+22nt% 95.88% 86.38% 9.50% 1.29E403% AGCGAUCAAAAAAAUGAUAAACCGGUAGAGGAUCCUCUACCGGUUUUAUU 416.4% 4% 2879896% +% ysxD+36nt% 90.29% 78.57% 11.72% 1.20E401% AAUCUAUACGAUAAAUAAAACCGGUAGAGGAUCCUCUACCGGUUUAUCAU 416.4% 4% 2884735% 4% clpX+46nt% 97.43% 97.41% 0.02% 8.08E401% AUAAAGAUAAGCACAAACCUCCUGAGUGGUAACACUCAGGAGGUUUUUUU 420.9% 4% 2886254% 4% tig+61nt% 60.62% 51.80% 8.82% 4.16E402% AUAAUAGUACUAAUAAAACAGGGCGCGAAUCAUUCGUGCCUUGUUUUGUA 410.1% 4% 2888904% 4% leuD+36nt% 91.46% 66.32% 25.14% 2.00E405% GGCUUCAAGCCUGAAAAAGCGGCCGGUAUUUGUCCGGCGGCUUUUUUUGC 412.8% 1x1% BSU_misc_RNA_ CCCUUUUAGCUAUCGCAGUUACUGCGCGGCUGAUUGUGGGCGGAAGGGCUUUUUUUA 2897043% 4% 45+51% 85.67% 92.14% 46.47% 2.51E403% U 417.6% 0x1,%2x0,%1x0% 2899769% 4% trnSL4Arg2+47nt% 99.65% 99.74% 40.09% 9.21E401% ACGUACCAAAAGAAAAACCUCAAAUCCAUUUAGGAUUUGAGGUUUUUUGU 414.4% 4% 2903183% 4% racE+34nt% 99.38% 98.37% 1.01% 3.28E401% ACCGAUUAAAAGAUAGUUUUCCCCGCAACGGUAUGUUGCGGGUUUUUUUC 413.1% 4% 2904686% 4% gerE+41% 64.41% 34.45% 29.96% 2.88E405% GAGCUUUAAUCCUUGCCGGUAUUCCUUCUUUUGGAAGGAGCCGGUUAUUG 414.7% 2x0% 2905531% 4% sdhB+40nt% 93.65% 86.76% 6.89% 3.23E403% CAGAGUAUAAGAAGAAAAAACCUCUUCCGCAUGGGAGAGGUUUUUUUAAA 411.5% 4% 2908714% 4% in%sdhC%CDS% 25.95% 20.40% 5.55% 2.28E401% GCACUUAUCAAACAGGGGGUAAAGUAAUGUCUGGGAACAGAGAGUUUUAU 44.4% 4% 2909476% 4% lysC+44nt% 89.33% 64.62% 24.71% 1.44E405% GUGUAAUGACAAUCAAAAAGGCGGGACUAUGCAGUCACCGCCUUUUUGAU 413.3% 0x1% 2909514% +% yslB+38nt% 72.86% 79.34% 46.48% 9.70E401% GACCCAGUGUAAUCAAAAAGGCGGUGACUGCAUAGUCCCGCCUUUUUGAU 413.2% 1x0% 2910809% 4% uvrC+307nt% 93.63% 91.91% 1.72% 1.03E401% AUGAUGAUUAAUUGAUAAGCAAUGAGAGUAUUCCUCUCAUUGCUUUUUUU 414% 4% 2912973% 4% trxA+51nt% 98.16% 97.83% 0.33% 8.05E401% UUUCCGCUGCUUACAUGCCAGAGCGAUUCCGAUUGAGGGAUCGCUUUUUU 412.2% 4% 2915329% 4% etfA+36nt% 100.00% 96.92% 3.08% 1.50E401% AUAUACACUCAUAAAGGAAAUCCCGGACUUUAAAAGUCCGGGUUUUUUCA 413.7% 4% 2920387% 4% yshE+130nt% 90.55% 77.84% 12.71% 1.18E401% UCUGUUCAUAUUAUGAGAAAAAGAAAGAUUUACCUUUCUUUUUCUUUUUU 410.5% 4% 2925067% 4% yshB+33nt% 70.17% 39.76% 30.41% 4.34E404% CACAGUACGGGGCAUAAAAAAACUUCUCUUGUCCGGAGAAGUUUUUUUCA 46.5% 4% 2926970% 4% pheT+38nt% 98.32% 99.47% 41.15% 5.36E402% UUAAGAGGCUGAUAAAAAAGCUUGCAGAGAAAUCUGCAAGCUUUUUUCUA 416% 4% 2927009% +% rnhC+37nt% 97.04% 85.88% 11.16% 1.30E401% AAAACGUUCAUAGAAAAAAGCUUGCAGAUUUCUCUGCAAGCUUUUUUAUC 413.2% 4% 2930522% 4% ysgA+305nt% 78.35% 86.61% 48.26% 2.19E403% GUGGUACCGCGGCCACAACUCGUCCCUUGUACAAGGGACGGGUUUUUUUU 415.8% 4% 2935925% 4% ysfE+42nt% 75.08% 51.05% 24.03% 9.58E405% UGGAAUAACGCACAAAAGCCCAAAACAAUGUCUGUUUUGGGCUUUCUCAU 414% 4% 2950181% 4% ysdC+40nt% 99.67% 96.06% 3.61% 1.45E402% GUACCAAUAAAGAUACGGAAGAAUCCGCCUAUUGAGGUGGAUUCUAUUUU 414.4% 4%% 2951859% 4% ysdA+39nt% 96.70% 91.51% 5.19% 4.48E401% UUGAUUUAUAAAAAGCAGAAAAGCGUUUAACGCUCUUCUGCUUUUUUUGC 413.1% 1x1% 2951901% +% ysdB+19nt% 69.38% 60.67% 8.71% 1.90E401% UAAACUCGCAAAAAAAGCAGAAGAGCGUUAAACGCUUUUCUGCUUUUUAU 416.7% 4% 2952188% 4% rplT+36nt% 93.34% 88.62% 4.72% 8.01E404% AAUUAAACAAGUAAUCAUAUAGAGCCGCUCUCCAGCAGAGCGGCUUUUUC 413.6% 4% 2953413% 4% ysbB+1079nt% 16.38% 16.62% 40.24% 9.76E401% UGAUACAGAUGUUCGUAGUGUGGGUGUUUUAUAAUGCCCACACUUUUUGU 414.9% 4% 2954463% 4% ysbB+29nt% 93.61% 97.34% 43.73% 4.86E401% GUGCAGCUGAUCGGAGGAUAAGCCAAGGCUGAAUGCCUUGGCUUUUUUUA 414.9% 4% 2954499% +% yscB+39nt% 74.33% 79.27% 44.94% 7.00E402% ACGCACCAUAAAAUAAAAAAAGCCAAGGCAUUCAGCCUUGGCUUAUCCUC 414.4% 4% 2955767% 4% lytT+16nt% 95.52% 78.05% 17.47% 3.33E403% UGCGAAGGAAUUGAAAAAGCUGCUCCAUAUUUGAUGGGCGGCUUUUUGCA 411.3% 1x0% 2959214% 4% thrS+43nt% 100.00% 97.76% 2.24% 1.64E401% AAAAUAAAAUAAAAAAGCAUGAUCUCAUUGAAGAGAUCAUGCUUUUUUUA 415.2% 4% 2959255% +% ysaA+39nt% 99.55% 99.82% 40.27% 3.60E401% UAGAGAAAUAAAAAAAGCAUGAUCUCUUCAAUGAGAUCAUGCUUUUUUAU 415.7% 4% 2961212% 4% ytxC+374nt% 48.15% 85.40% 437.25% 2.53E406% CGAUUCCGUUUAUUCAACCUCGUCCCUUUCAUAGGGGGCGGGGUUUUUAU 417.8% 4% 2965646% 4% nrdR+35nt% 93.69% 30.59% 63.10% 2.58E406% AAGAAAGAGCGUUAAAAGAGCUAAGAGGAUUCUUCUAGCUCUUUUCUCAU 49% 1x0%

! 120! 2966340% 4% speD+73nt% 98.54% 95.27% 3.27% 3.17E404% AAAGGGAGCUGAAGCUAGAAAGCCAUUAUGCGCUUUUUAGCUUAUGCUCCUUUUAUU 424% 0x1,%2x2% 2968220% 4% ytcD+40nt% 85.71% 80.72% 4.99% 2.48E401% GGAAUCAUAAAGCAUGAGGGCAGUCAGUGCGGAGCGCUGGCUGCUUUUUG 417.4% 4% 2970884% 4% coaE+38nt% 88.84% 81.42% 7.42% 2.56E401% AGCUGGGCAUAAUACAAAAAACACCGUUCAUAUUGAACGGUGUUUUUUGG 411.4% 4% 2975942% 4% phoR+126nt% 98.45% 96.76% 1.69% 7.42E403% AAGGAGCCAAUUUUGACGGCGGGAACCUAUUUGUGUUCCCGUCCUUUUUU 413.7% 4% 2978692% 4% mdh+42nt% 99.27% 98.71% 0.56% 8.26E403% UAUCCUAAUAAAAAGAGAGAAAGGCUUGCUUAAUACAGCCUUUCUCUUUU 48.7% 1x0% 2981104% 4% citZ+47% 20.81% 20.11% 0.70% 8.29E401% UAAAGAACCAUUGGAGGCUGGCUUGCGUCAAUGAGGUUAGCCUCUUGUUC 410.2% 1x0% 2984275% 4% fxsA+37nt% 76.50% 50.71% 25.79% 2.01E403% CAUCAUCAAAUAAAAAACGGCAGCCAUGAAAAAACGGCUGCCGUUUUAUU 415% 4% 2984747% 4% pyk+41nt% 54.18% 30.69% 23.49% 9.42E407% GUUCUUUAAUUACAGGUGAAAAUGGAAGGGGAAUCCCUUCCUUUUCUCUU 410.9% 4% 2987696% 4% accA+35nt% 96.75% 94.16% 2.59% 1.79E401% AUCGGGGUAAACUAAAUAAACGUGAAGCCUUUGGCUCACGUUUAUUUUUU 48.4% 1x0% 2989780% 4% ytsJ+120nt% 67.96% 59.42% 8.54% 1.96E401% CGGCUGAAAUUUUUUUAGGGGGUUAGCCUUAAAAAAAUUUCAGCCGGGUUUAA 427.3% 4% 2995880% 4% nrnA+28nt% 68.01% 69.96% 41.95% 6.59E401% AUUAUGUAAAGAACACGAGUAGAGGGGAGACCCUCUCUCUUAGUGUUCAU 417.2% 1x0,%0x3% 2995921% +% ytzJ+31nt% 38.50% 34.56% 3.94% 7.60E402% CGUCACAGAUGAACACUAAGAGAGAGGGUCUCCCCUCUACUCGUGUUCUU 411.7% 0x1% 2997314% +% ytpI+32nt% 32.59% 37.94% 45.35% 1.60E401% GAAAGAGAUCACGCGUAAGGGGCGCCUGAACGUCCCUUAGCUUCUUUCCA 414.7% 1x0% 3009872% 4% ytkL+43nt% 99.77% 96.67% 3.10% 3.45E403% GCUUUAAACCGUGAAACCAUCUCCUGAUGAAUCAGGAGGUGGUUUUUAUU 417.4% 4% 3011529% 4% ytzD+26nt% 94.50% 89.01% 5.49% 1.48E403% GAGUCUUCAUCUCCUGCAGAAUAAGCUGUCUGUACAGGCAGCUUUUUUUG 49.3% 4% 3015072% 4% ackA+39nt% 88.99% 48.40% 40.59% 4.26E407% UAGCAAAAUAAAUCGCAUGAAAGCACAUUCUCUUGAAUGUGCUUUUUUGU 410.6% 4% 3016589% 4% ytxK+57nt% 86.49% 74.88% 11.61% 1.12E401% AAAAGCAGCUUAGACAGCCGUAUGAGGUCGAUGCCUAAGCUGCUUUUAUU 417.5% 0x3,%1x1% 3017654% 4% tpx+42nt% 75.83% 77.02% 41.19% 7.24E401% UAAAGUAAGCAGGGAAAAAAGCUCCAGGCUGCCGCCGGAGCUUUUUUCAU 412.3% 1x0% 3019500% 4% yteJ+33nt% 99.41% 97.71% 1.70% 5.55E402% AAUUAUACCGCAAAUAACCGAUAACCCGGACUUCCGUCCGGGUUUAUUUU 412.7% 4% 3022039% 4% ytcJ+29nt% 98.86% 93.62% 5.24% 1.05E401% AUUGUAUAUGAGAAAUCAUAAAAGGACAGGCAGCAGCCUGUCCUUUUAUU 414.7% 4% 3022074% +% ppnK+38nt% 95.95% 84.48% 11.47% 6.70E402% ACUUUUUUAUAGAAAAUAAAAGGACAGGCUGCUGCCUGUCCUUUUAUGAU 415.2% 4% 3025393% 4% sspA+52nt% 97.19% 92.50% 4.69% 2.02E402% UACAAUUUCACAUAAUGGCUUAGGAGUGGGGGUAUCCCCACUCUUUUUCA 414.3% 4% 3029674% +% braB+40nt% 92.05% 47.50% 44.55% 1.50E406% AAUAAGUUAAUGUCACAGAACGCCUGCGUUAUUGCGCAGGCGUUUUGUAA 416.8% 4% 3029674% 4% ezrA+55nt% 93.81% 89.77% 4.04% 1.09E401% CACGACCAUGAAAAAGAGCCCGCAGUGUAAUGAGCAGGCUCUUUUUUUAU 49.2% 1x1% 3033658% 4% dgcP+38nt% 95.86% 83.22% 12.64% 1.77E401% UCAAUAAAAUAAAAAAAGCCCAAAACGAUAUCAGUUUUGGGCUUUUAUAU 413.3% 4% 3033698% +% ytsP+40nt% 99.19% 99.17% 0.02% 8.50E401% AGCGCAGUAAUAUAAAAGCCCAAAACUGAUAUCGUUUUGGGCUUUUUUUA 412.5% 4% 3036375% +% rpsD+43nt% 96.01% 93.82% 2.19% 9.30E403% UCGUUAAUCGUUUUAAAAACCCCUGCCGCUAUGCGGUCGGGGUUUUUUUA 414.7% 1x1% 3036562% 4% tyrS+41nt% 98.41% 93.73% 4.68% 4.31E402% UAUAAAUAAGAAAAAGAUCCUUUGCCACUGAAGGCAAAGGAUCUUUUUGU 418% 4% 3036603% +% rpsD+271nt% 98.00% 97.02% 0.98% 4.60E401% UGCGGUAAACAAAAAGAUCCUUUGCCUUCAGUGGCAAAGGAUCUUUUUCU 418.5% 4% 3037899% 4% ytzK+161nt% 85.93% 91.40% 45.47% 1.41E402% GUACCGCGAUAAUCAAUCGUCCCUUCGUGUAAACGAAGGGGCGUUUUUUA 418.8% 4% 3038023% 4% ytzK+37% 40.80% 5.95% 34.85% 7.88E406% AAUACACUCAUGAACCGCUUUUGCAAACAAAGCCGGCCAGGCUUUCAGUA 43.3% 4% 3042587% +% acuC+32nt% 98.88% 82.28% 16.60% 1.80E402% CAGCAAAGAACAAAGUAAAAAACGACCUUUACGAAGAGGUCGUUUUUGAU 49.2% 4% 3044115% 4% ccpA+50nt% 86.39% 57.86% 28.53% 2.08E405% GAAAAACAAAGAGCAAGCUUCACCUUUAUGGUGAAUUCUUGCUUUUUUCA 412.8% 1x2% 3045406% 4% aroA+39nt% 99.12% 98.85% 0.27% 3.25E401% UCAACGCUUAAUUGAACAAUCCAAAAGGCCGCGCCUGCGGCCUUUUUUUA 411.3% 4% 3046721% 4% ytxJ+36nt% 98.38% 93.77% 4.61% 1.32E404% AGCAUUUGUCAUAGAAAAAAGCGUCCAGAUAUCAUCUGGCGCUUUUUUUU 410.2% 1x0% 3048145% 4% murC+32nt% 90.31% 51.40% 38.91% 1.35E405% GAAAACGUCAUGGCAUAAUAAAAAGCAGUGAUCUCACUGCUUUUUAUUUA 48.4% 4% 3052671% 4% ytpR+72nt% 97.36% 77.87% 19.49% 8.13E405% AAACGAAUCAUGUGAAAAGCCGCUAAGCCCUUGUUUAGCGGCUUUGUUUC 415.1% 4% 3055192% 4% ytoP+55nt% 87.76% 80.64% 7.12% 4.84E401% AUAAAAGCUUGUUGAACGAGCAGUAAGCCCGGAUCGACAAGCUUUUUUCU 415.4% 1x1,%1x2% 3055245% +% ytoQ+53% 67.69% 74.59% 46.90% 6.70E401% AAAAGCUUGUCGAUCCGGGCUUACUGCUCGUUCAACAAGCUUUUAUGAAA 415.3% 2x1,%1x1% 3056814% 4% malS+35nt% 95.51% 86.08% 9.43% 3.65E404% AUUCGCGCGAUAUAAUAAAAAAGAGCCGCUGCAUAGGCAGCGGCUUCUAU 415.9% 4% 3056848% +% ytzB+52nt% 93.76% 96.73% 42.97% 5.70E402% CCGGACAAGCAAAAAAUAGAAGCCGCUGCCUAUGCAGCGGCUCUUUUUUA 415.3% 4% 3059517% 4% trmB+30nt% 97.80% 95.81% 1.99% 6.56E403% AGGUUGAAUGGAGAACGUAAAGACAGACUCUGACAGGAGUCUGUUUUUUU 410.6% 4% 3060290% 4% ytmP+384nt% 83.63% 33.83% 49.80% 1.35E408% UUUAUACAUGGGAAAGGAGUGUUCCAGCAGACGGGACCCUCUUUUUUUAU 47.9% 1x1% 3061571% 4% amyX+80nt% 1.10% 20.40% 419.30% 3.17E402% AAAGGACGGCUAUUGAUUAGCAUAUGAGACUCUCAAUAGCUGUCUUUUUUAU 414.7% 4% 3067385% 4% ytjP+35nt% 70.03% 71.88% 41.85% 8.54E401% GAGCUUGCAAAAUAAAAGGACCGGCUUCUGCUGAAGCCAGUCCUUUUUUU 416% 1x1% 3067424% +% ytkP+38nt% 98.81% 86.32% 12.49% 2.10E401% UCAUUUAUUUAAAAAAAGGACUGGCUUCAGCAGAAGCCGGUCCUUUUAUU 419.4% 4% 3070213% 4% ythQ+33nt% 91.44% 80.36% 11.08% 3.22E401% CUUUAUUGUUUACAUAAAAAACCCAAACGGCGACGUUUGGGUUUUUUGGU 413.4% 4%

! 121! 3070250% +% pbuO+44nt% 97.37% 90.13% 7.24% 2.50E402% UUAUAAGGAUAGACCAAAAAACCCAAACGUCGCCGUUUGGGUUUUUUAUG 410.5% 4% 3072700% +% ytzE+78nt% 86.07% 22.37% 63.70% 1.60E407% GCGGUCCGAUAGAUAACAGGGCGAAGAAACUACUGAGCCUUGUUUUUGUG 49.3% 2x2% 3072708% 4% ytzG+35nt% 96.96% 95.35% 1.61% 2.96E401% GAGCCGCAAGCAUGACAAAAACCCCGCAUACCGAAUGCGGGGUUUUAUUU 413.8% 4% 3072745% +% ytzE+123nt% 96.15% 95.57% 0.58% 5.00E401% UUGUGUGCUUAUAAAUAAAACCCCGCAUUCGGUAUGCGGGGUUUUUGUCA 414.1% 4% 3073480% 4% ytgP+51nt% 62.47% 11.58% 50.89% 1.60E408% GAACUAGAUAUGAUGAAACUGAGGGCUCGCAUGCUGCGGGCUUUCUUUUA 48.7% 4% 3078396% +% opuD+40nt% 100.00% 98.31% 1.69% 9.70E402% AGCAUAUUAACAAAAAAGAUCUUUCCGCGCCUGCGGAAAGAUCUUUUUAU 416.8% 4% 3088360% 4% ytbQ+28nt% 94.87% 88.70% 6.17% 3.37E404% CGAGGAGGAGAACGGAGCAUAAUCAUUUUCUAAGAUUAUGCUCUUUUUCU 411.9% 4% 3090436% 4% bioB+46nt% 63.33% 32.29% 31.04% 3.10E405% CUGAAAGAAUCAAUAAAAGCAAUCGGUAUGAUGUCGAUUGUUUUUAUUUU 44.9% 4% 3090786% 4% in%bioB%CDS% 6.73% 2.82% 3.91% 1.41E402% GCCAAAAGCUUGAAGGCUCUUGACGCGGAUUCCAUUCCUGUGAAUUUUUU 43.9% 0x1% 3102175% 4% ytwF+26nt% 98.21% 94.25% 3.96% 1.06E402% GGCGAAACAAAACCAAAAAACUAGGGGAGAGCGGUCCCCUAGUUUUUAUU 412.6% 4% 3102212% +% melA+33nt% 71.33% 63.50% 7.83% 4.30E401% UUCCGGAAUACAAAUAAAAACUAGGGGACCGCUCUCCCCUAGUUUUUUGG 412.6% 4% 3102588% 4% leuS+41nt% 97.19% 73.20% 23.99% 2.26E403% GCAAACUAAGCCUAGAAAAAAUCCCCUUUGCCAAAAGGGGAUUUUUUUUC 412% 4% 3105133% 4% ytvB+337nt% 70.59% 74.00% 43.41% 3.05E401% GCGGGAAAACGAAAGUCUCUCGUCCCUUUUUGGGAUGAGGGAGUUUUUUU 418.2% 4% 3109395% +% yttA+35nt% 97.07% 95.40% 1.67% 5.40E401% GCGCCAAAACGAUAAACAAAAAGCUCCAGAAUGUCUGGAGCUUUUUCUGU 411.6% 4% 3112166% 4% bceS+24nt% 95.77% 91.61% 4.16% 6.53E402% AAUUUGAACAUGUCAUAAGCGUGUGACGAAAAUGUCACAUGCUUUUCUUU 412.8% 4% 3113944% 4% ytrF+35nt% 93.29% 74.83% 18.46% 4.61E406% AGAAGAGAAUUAUAAUGCGAACGAGCCGGCUGAGACAGCCGGCUUUUUCU 414.3% 4% 3119532% 4% ytzC+33nt% 99.31% 96.52% 2.79% 9.44E402% ACCCUCUUGAUGUGUAGGAAAACGGACCCUUUUAAAAGGGUCCGUUUUUU 414.6% 4% 3121522% 4% ytpB+16nt% 86.02% 58.76% 27.26% 3.16E403% AAAUUCAAAGAAAAAAGCUCAAAUCAUUUGCUGAUCUGAGCUUUUUUUUC 48.6% 1x1% 3121564% +% ytqB+16nt% 90.94% 89.81% 1.13% 5.90E401% CGCCAUCGAAAAAAAAGCUCAGAUCAGCAAAUGAUUUGAGCUUUUUUCUU 413% 4% 3124098% +% ytoA+93nt% 81.41% 67.15% 14.26% 6.10E402% AAGCAAUAACCAUCGUUAACCCGGACGUCAUACAGUUCGGGUUUCGAUUU 410.6% 4% 3124219% 4% ytnA+31nt% 94.72% 68.01% 26.71% 3.53E404% CGAACGAAAUAUCAGCUGACAAAAAGAGCUCCCAGUGGGCUCUUUUUGUG 46.7% 4% 3125734% 4% asnB+43nt% 58.03% 35.32% 22.71% 3.38E404% UGUGUAACAGACAACAAGGCUUUCGAGUAGUCGAAAGCCUUGUUGUUAUC 417.5% 4% 3127789% 4% metK+36nt% 77.53% 66.15% 11.38% 6.30E402% CGUUAGGAGAAUAAUUUUAUAGCCGCUUACUGGUUAAGCGGCUUUCCCUU 411.4% 4% 3129146% 4% ytmB+2006nt% 37.93% 39.50% 41.57% 6.83E401% GUGAAAGGCACAAAGACCAAACCCUUUCCUCGAUGGAAAAGGUUUUUUUA 45.5% 0x1% 3131115% 4% ytmB+37nt% 98.90% 98.64% 0.26% 9.05E401% UUCCGUCAAUUAAAACAAGCCAAGAGCAUAAUUGCUCUUGGCUUUUGUUU 417.3% 4% 3131156% +% pckA+43nt% 99.34% 98.16% 1.18% 6.90E401% CGUAUAAAAAACAAAAGCCAAGAGCAAUUAUGCUCUUGGCUUGUUUUAAU 416.5% 4% 3134953% 4% ytkD+30nt% 97.57% 97.54% 0.03% 7.62E401% AAUCUGGAUGGAUUGAAUAAAAAACCCGGCACAUGUGCCGGGUUUUUUAU 413.7% 4% 3136186% 4% dps+52nt% 99.23% 97.84% 1.39% 4.95E402% UCAAAAAUAGAACGGCCGGAUGUCUUAAAAAAGACGUCCGGCUUUUCUUU 420.1% 4% 3137034% +% ytzI+90nt% 84.67% 71.87% 12.80% 1.70E403% CAGCAUCGGCGUCUCCGACUUGGACUUUUAAGGUCGGCAUGCUAUGCUGUUUUUUU 421.3% 2x1,%1x0% 3137451% 4% luxS+44nt% 98.72% 97.13% 1.59% 1.54E402% GGCUAAAAUAGAAAGGACCUUUUUGCGCUUAAGCAAAAAGGUCUUUUUUG 415.9% 4% 3138951% 4% rpmE2+27nt% 93.08% 87.57% 5.51% 3.13E401% AACGCUAUAACAUGGGGAAAUAAGGCAGGCCUGAGGGUUUGUCUUUUUUU 49.2% 4% 3142059% 4% mntD+18nt% 90.52% 69.67% 20.85% 3.33E405% CACUCAACAUGCAAAAAGAAAGAGCUGGCUGAUGCAGCUCUUUCUUUUAA 414.4% 4% 3146127% 4% menC+111nt% 93.82% 94.32% 40.50% 7.83E401% UGAAUACAUCCCUUCUCGUUUGGACCGGCUGCUGACCCAGCCGGUUUUUU 411.9% 4% 3148845% 4% menB+56nt% 89.61% 57.58% 32.03% 1.94E408% AUAUCUAGUAAACCAACAGCUUGAGACUUUGCGGUCCAAGCUGUUUUCUU 413.4% 1x0% 3171843% 4% trnB4Glu+36nt% 99.12% 99.05% 0.07% 8.54E401% UCCCGUACGGGUCAUCCAGAAGCCUUGCAUAUCCUGCAAGGUUUUUUUGU 48.6% 4% 3179267% +% ytaB+15563nt% 20.68% 47.24% 426.56% 1.90E404% GUAAAGCAGUGCGUGGAACUUUUCUCAUCCUUCCGCGUGCUGCUUUUUUG 418.9% 4% 3179887% 4% yuaI+39nt% 93.30% 91.96% 1.34% 6.87E401% UUAACAGAUAACGAAAAAUCCCCCAGCGGAAUUCGCUGGGGGAUUGUUAC 420.4% 4% 3179925% +% thiT+41nt% 98.99% 98.16% 0.83% 3.50E401% AAAGCGUAAAAGUAACAAUCCCCCAGCGAAUUCCGCUGGGGGAUUUUUCG 421% 4% 3183179% 4% yuaD+22nt% 90.22% 61.87% 28.35% 2.64E405% AGUCAAACGAAAAGCAGAAAGGGUCUGAUUAAAUCAGGCCCUUUCUAUCU 412.1% 4% 3183216% +% yuaE+21nt% 85.15% 74.77% 10.38% 3.00E402% AAAUUAAAGAAAAGAUAGAAAGGGCCUGAUUUAAUCAGACCCUUUCUGCU 47.7% 1x1% 3187341% +% yuaC+36nt% 98.75% 86.88% 11.87% 8.90E403% UCGAAACAAAGUAAAGCAGAAAACGCCUGGGAAACUAGGCGUUUUUUUGA 414.1% 4% 3188081% +% yuaB+33nt% 98.13% 99.25% 41.12% 2.60E401% CUUGCGGUUGCAACUAAUGUAAAAGACCGGUUAACGCCGGUCUUUUUUGC 410.6% 4% 3188374% +% yuaB+326nt% 87.91% 75.42% 12.49% 1.20E404% GUAUACAGAGAGGAGGUCUAUUAUCGGCCAUUCUUUGCAAUGGUCUUUUU 46.1% 4% 3190433% 4% yubF+29nt% 76.44% 64.96% 11.48% 1.33E403% CAAUCUCAUAUCGAAUCAUAAAAAAUCCGGCGACUGCACGCCGGAUUUUU 412.9% 4% 3190465% +% ktrB+39nt% 48.65% 42.39% 6.26% 8.40E401% UUACAGGGUGAUAUCAAAAAAAUCCGGCGUGCAGUCGCCGGAUUUUUUAU 413.3% 4% 3194419% 4% trnSL4Ala1+36nt% 92.74% 87.99% 4.75% 4.70E401% CCCCCUUGGCUCCAUACCUUUAAACCCUUAUUCGAUAAGGGUUUUUUUGU 45.8% 4% 3194596% 4% yubB+39nt% 83.19% 53.83% 29.36% 1.73E401% UCAUGAUGUAAGUCGAAAAAUAAGGCUCUUUUCCGAGCCUUAUUUUUUCU 411% 4%

! 122! 3197933% +% yulF+41nt% 94.96% 93.24% 1.72% 3.40E401% CAAGCUUAAAAAAAUCCGCCCGCGUGCAAAUGCCGCGGCGGAUUUUUUAU 418.3% 1x0,%1x0% 3204029% 4% tlpB+38nt% 100.00% 99.80% 0.20% 3.41E401% AUAGAAUCAUAAUGAAACGAGAAAGCGGCAUAUCUGCUGCUUUCUUUUUU 413.4% 4% 3206127% 4% mcpA+42nt% 99.72% 98.43% 1.29% 9.11E402% UUGAAUAAUAAGCCUUAACACCCAAGCUUGUUGCGCUUGGGUGUUUUUUU 414.9% 4% 3210407% 4% mcpB+38nt% 96.38% 96.15% 0.23% 8.83E401% AAAAUCGAGUAAAAACCGAAAAACAGCGCUAUCAAAGCGCUGUUUUUUUA 410.4% 4% 3213326% 4% yuzH+16nt% 97.87% 91.88% 5.99% 1.41E401% AAAGGCAUUUGAAACCCCAUCGUCCGGAAAAUAGGCGAUGGGGCUUUUUA 417.4% 1x0% 3217452% 4% yugP+44nt% 95.04% 90.35% 4.69% 1.73E402% AAUUAACGUUAAGGAGGUGGCCCCUUACCAUUUAUGGUAAGGGCUUUUUU 414.4% 1x0% 3219764% 4% yugN+73nt% 87.43% 64.71% 22.72% 6.87E403% GAGCACCUUGUAUGUAAGAGGAGGGGAAAGCAUCGGCCCCUCCUUUUUUU 412.8% 4% 3220691% 4% pgi+40nt% 55.80% 53.87% 1.93% 7.14E401% GGAAGAUUAAUGUGAGAAAGCUGACUGGCAUUUGCCGGUCGGCUUUUUAU 417.9% 4% 3222156% 4% yugK+39nt% 96.31% 80.77% 15.54% 1.15E407% CGUCUCUAUAAACCCAAAGGGCGGAAUCCAGUCAUUCCGCCCUUUCUUCU 414.8% 4% 3223431% 4% yugJ+40nt% 91.01% 82.18% 8.83% 1.02E402% AUCACUAUAAAAAAAGGGGAAAUAGCCGUUUGGCUGCUUCCCUUUUUCUU 413.5% 1x1% 3225136% 4% yugI+42nt% 98.44% 70.28% 28.16% 2.37E411% AAAAAUAAGCAUGAAAAAAGCACCGGACAGGAAUGUUCGGUGCUUUUGAU 416% 4% 3225683% 4% alaT+89% 67.51% 28.11% 39.40% 1.24E405% GGGGGAAUACUAGAAAGCCUUUGGUAUUUUCAGUUUACCCCCUUUUUGCUGU 414.3% 0x2,%1x0,%3x3% 3228403% 4% yugE+28nt% 79.88% 79.96% 40.08% 8.61E401% CAGCAGCUCCUGCACGCCUUAAAAAAACCGGUUCAGCACCGGUUUUUUUG 45.7% 4% 3229990% +% patB+49% 95.97% 95.37% 0.60% 8.50E401% AAUAUAGCUGUAAACGCCUUUACGUCUUCAUUUGUAAAGGCGUUCUUAAU 413.4% 4% 3231811% +% kapB+26nt% 60.78% 60.20% 0.58% 8.40E401% AAAGAAUAUUUUAACCGGCCAUAACCCAGUCUGACAAAAGAUUGGGUUUU 411.2% 4% 3236255% 4% yufK+167nt% 38.46% 53.63% 415.17% 6.09E403% UGAAUAGAUGACAAAAUCCUAAAACGAAGCCGUUUUAGGAUUUUGUCAAC 412.3% 4% 3236297% +% yuxK+78nt% 77.44% 6.97% 70.47% 2.10E405% ACAGAUUGUUGACAAAAUCCUAAAACGGCUUCGUUUUAGGAUUUUGUCAU 411.5% 4% 3236407% 4% yufK+15% 50.15% 21.90% 28.25% 1.96E401% UUUAUAAUAGCAUAAUGGCUAGCUUACCUGUGUAAGCUAGCCAUUUCAGC 418.9% 4% 3236448% +% yuxK+229% 90.67% 73.20% 17.47% 2.70E403% CACCAAACGCUGAAAUGGCUAGCUUACACAGGUAAGCUAGCCAUUAUGCU 419.5% 4% 3239496% +% yufM+38nt% 98.55% 95.79% 2.76% 1.80E401% CAAUAUCUAUAAGAAAACGCACUGCUUGCUUUGAGCAGUGCGUUUUUCUG 416.2% 4% 3252368% 4% yuxO+37nt% 77.84% 83.08% 45.24% 6.02E402% CAUCAAGAAAUAAAAAAACAGCCGGAACUCUGCCUGUCCGGCUGCUUAUU 413.5% 1x0% 3252406% +% mrpG+40nt% 97.82% 91.54% 6.28% 1.30E402% UUAUUUAUAAAAAUAAGCAGCCGGACAGGCAGAGUUCCGGCUGUUUUUUU 413% 0x1% 3253485% 4% comP+44nt% 63.67% 39.06% 24.61% 3.63E404% UUGUAAUGGAUUUAUAACGGAAACGACUUGGCACAGGCCAAGUCUUUUUU 412.2% 4% 3257063% 4% degQ+29nt% 100.00% 95.92% 4.08% 2.24E401% UAUGCAAUGAAAAUUUCGUGAAAAAGACUUGGAAACAAGUCUUUUUUUUC 49.5% 4% 3257589% 4% pdeH+448nt% 89.27% 35.49% 53.78% 9.23E408% AUAUGACAAAGCGAAAAGGCCACAACUUUAGCGUUGCGGUCUUUUUCGGU 48.9% 1x1% 3259363% 4% yueK+40nt% 89.37% 87.59% 1.78% 3.76E401% GGAAGAAUAAAGAAAAACUGGCCUUUCAUUCGCGAAGGGCCAGUUUUCUU 416.3% 4% 3262299% 4% yueG+31nt% 77.04% 38.55% 38.49% 1.64E405% AGUUUCGUUUAACGGGUAACAGCCUUUUCACAAGAGGCUGUUGCUUUUUU 416.2% 4% 3265382% 4% yueD+24nt% 88.86% 92.73% 43.87% 2.21E401% UUUAUGAUAUUAAAGAGUUUUUGUAGAGCAGAUAUUUUCUGCUCUUUUUU 410% 4% 3266637% 4% yueB+50nt% 30.63% 18.61% 12.02% 2.14E402% UCGCAGCAUGGAAAAGGGGAUCAUGAUUUGUAUGCUCUCCUUUUCCCUUU 47.1% 1x1% 3276088% 4% yukE+53nt% 83.40% 71.98% 11.42% 7.45E404% UAUGAAAGGGAAGGAGCGCCUGAUUCAAAAGAAGACGGCGCUCUUUCUAU 414.6% 3x3% 3278246% +% yukF+23nt% 95.56% 90.70% 4.86% 1.60E401% AUCAAACUUCGGCACAUGGAUUUGUGAAAUUUCACAAAUCCAUGUUUUUU 417.4% 4% 3279502% +% ald+41nt% 95.39% 94.67% 0.72% 5.60E401% GGUGCUUAAUUCACAAUAAGCUUGCAGAAAGAUUUCUGCAGGCUUUUUUA 413.8% 4% 3280254% 4% ybdZ+40nt% 99.19% 95.23% 3.96% 2.14E404% AAAUGUGUAAUCUUAUCAAAAAGAGACUGCUUGCCGCAGUCUCUUUUUCU 412.5% 4% 3280289% +% yukJ+39nt% 91.22% 86.79% 4.43% 5.60E401% CGUCUGCGUAAGAUAGAAAAAGAGACUGCGGCAAGCAGUCUCUUUUUGAU 413.3% 4% 3292470% 4% besA+20% 52.46% 56.43% 43.97% 2.69E401% CCUGACGGACCGCAUCUAUCAAUGGGCUGAGACAUACUCAGCCUUGCCUU 410.9% 4% 3294900% +% bioYB+28nt% 83.13% 27.44% 55.69% 9.30E412% AAAUCACAUAUCAUCUACGUAAAAACCGUUCUAUUGGACGGUUUUUUUAU 47.1% 4% 3294944% +% bioYB+72nt% 98.47% 94.22% 4.25% 4.80E403% UUUUAUCAUAACGAGAAAAGGCUCCCCAGUAAAGGGGAGCCUUUUUCCUA 417.2% 4% 3296377% 4% yuiE+40nt% 95.18% 89.58% 5.60% 2.55E402% AAACGAGUAAUGAAAAAUCCCUGCUGUAUGAUGCGGCAGGGAUUUUUUCU 416.9% 4% 3298590% +% yuiD+37nt% 93.36% 82.54% 10.82% 3.10E401% CUUUUUCAUGUAAAAAAAACGCUCCUGCUUUCGCUGGAGCGUUUUAUUCU 412.4% 1x1% 3302585% 4% yuzG+38nt% 96.97% 98.93% 41.96% 3.16E401% AUCUUCAAAUAAAAAAGGAGCUGUGUCGCAGACACAAGCUCCUUUUUUUA 414.8% 0x1% 3302625% +% yumC+41nt% 99.14% 98.36% 0.78% 3.80E401% AAUAAAUAAUAAAAAAAGGAGCUUGUGUCUGCGACACAGCUCCUUUUUUA 414.8% 1x0% 3304074% +% guaC+52nt% 98.78% 94.96% 3.82% 2.40E401% AUAAAAAAACGCCAAGUCAGCGGUUCUCCGCUUGAGUUGGCGUUUUCUGC 420.3% 0x1,%1x1% 3305525% 4% yutM+74nt% 99.34% 96.52% 2.82% 1.39E404% UACUGACGCUUUUCUUAGCGAUAAAUCAUCGUUAAGGGAGGCGUUUUUAU 420% 4% 3306976% 4% yutK+41nt% 96.65% 59.17% 37.48% 7.02E404% UUUAUAUAAACGAUAAAAGCUCCUUGCGUCAGUGCAAGGAGCUUUUAUGU 415.9% 4% 3308337% 4% yuzB+31nt% 99.42% 100.00% 40.58% 3.41E401% AGAAAAUCCAAUGUUUUAAAGAAAAGGGCCUGGACAGGCCCUUUUUUAUU 411% 4% 3309939% 4% yuzD+21nt% 50.22% 21.58% 28.64% 2.68E404% AGAAGCAUGGGUAUACAGAAAACCGCUGACUUGAUCAGCGGUUCUUCUCU 410.2% 4% 3309974% +% yutJ+40nt% 72.03% 52.50% 19.53% 2.70E403% UAACGGUUAAUGAUAGAGAAGAACCGCUGAUCAAGUCAGCGGUUUUCUGU 410.9% 4%

! 123! 3310762% +% yutI+41nt% 97.91% 96.17% 1.74% 1.10E402% GUCUUUUAAUAAAGCAGCCAGGCUGAUAUUUGAUCAGCCUGGCUUUUUUA 420.3% 4% 3312800% 4% thrB+44nt% 98.88% 96.07% 2.81% 1.10E406% GUAUAGAUCAUGCCAAGCGUUCCUCAGCGUCAGCGGAGGGCGCUUUUUUU 413.4% 1x1,%1x0% 3317995% 4% yutF+34nt% 97.03% 57.21% 39.82% 1.60E407% GAUUCCAUACAUUUGAAAAAAGGGCGCCCUAAAAGGGUGCCCUUAUUCUG 416.4% 4% 3320289% 4% lipA+35nt% 93.98% 51.15% 42.83% 1.80E410% CAAGCACAAGCAUAAUGCCAAAACGCCAGAUCAUCUGGCGUUUUUGUCAU 49.5% 4% 3322435% 4% yunB+28nt% 99.21% 82.96% 16.25% 7.90E403% AAAAGAAAAAAGCAGCAAAUAAGCCGCCUGUUGAAGAGGCGGCUUUUUGU 412.7% 4% 3323227% 4% yunC+73nt% 77.42% 55.09% 22.33% 8.03E404% UAUGUCCCCUCUUACAAGCAUACAUUGUGAUAUGUAAGGGGGGAUUUUCU 420.5% 2x3% 3352251% 4% yurQ+61nt% 99.04% 97.29% 1.75% 1.36E401% GCGGAUUGAACAGCGAAGCCAGAGCUUAAGUCAAGUUCUGGCUUUUGAUU 414.1% 4% 3354483% 4% yurT+68nt% 82.36% 54.71% 27.65% 7.63E407% UUUUGUAUGCAGAAGAAAAACCGCUGGCCGAGGGGCCGCGGUUUUUUACU 413.7% 1x0% 3355479% 4% sufB+114nt% 99.64% 99.10% 0.54% 4.34E401% UGCCGAAUUUGAUUGUAGAAGACGAACUUUUGAAGUUCGUCUUCUUUUAU 414.7% 4% 3360928% 4% yuzK+46nt% 95.58% 90.54% 5.04% 4.40E402% UUGAGAAAAUCAAUCUUUUAAAAAAGGGUGGGAAUCCACUCUUUUUCUUU 46.8% 4% 3361730% 4% metN+37nt% 99.68% 98.56% 1.12% 6.06E402% UGUAUCUGAAUAAGACUGAAACCCCGGAUGAGAAUUCCGGGGUUUUUUUC 413.2% 4% 3364345% 4% yusD+273nt% 97.56% 96.91% 0.65% 3.87E401% AGGCAUUUUAUAUAAGCCUUUCUGCUCAAGUGUGCAGAAAGGCUUUUCUU 417% 4% 3365801% 4% yusG+30nt% 63.63% 65.83% 42.20% 4.76E401% ACGAAAACGGCUGGUGUUAAUGUUGGCGGUGAAUUUCACUGCCUUCUUUU 410.7% 4% 3376620% +% yusP+39nt% 97.55% 96.52% 1.03% 4.10E401% CUUCCCAUUAAUAGAGCACCCCGCGGGUAUCAAUCCGCGGGGUUUUUUAU 419.2% 4% 3378759% 4% yusU+41nt% 92.36% 90.59% 1.77% 9.45E401% AAACAAUAGCCAAAAAGCAGUCUGUUCAUUAUAGCAGACUGCUUUUUUGU 414.1% 4% 3379067% 4% yusV+45nt% 76.69% 7.23% 69.46% 1.26E410% GAUAAAUAACGCAGCGAAGGAGCUUUCAAUUGAGAAAGCUCCUUGCUGUU 413.6% 4% 3380665% 4% yusY+39nt% 93.01% 76.92% 16.09% 7.82E404% CCGAAUCUUAAAGAAAAAGCCGUGGCGUUAAAUGCCCCGGCUUUUUCAAU 411.9% 1x1% 3384025% 4% htrB+45nt% 91.53% 88.39% 3.14% 2.22E401% GCUAAGAAAAAACAAAAAGCUGAACCCGAUUAAGGUUCAGCUUUUUUGUU 411.5% 4% 3384064% +% mrgA+38nt% 98.16% 98.45% 40.29% 4.30E401% UAUUUAGGGUAACAAAAAAGCUGAACCUUAAUCGGGUUCAGCUUUUUGUU 413% 4% 3387783% +% cssS+30nt% 95.27% 91.07% 4.20% 2.50E401% GCAUAGCAGUGCCAAAAUAGACUGUAGAUGUUUUGCAGUCUAUUUUUUUA 410.9% 4% 3388983% 4% fumC+41% 92.41% 88.54% 3.87% 1.61E401% AAGGCGUAAUAGGAAGAACGGCUGCUUUUUAAGCAGCCGUUCUUCUAAAU 413.5% 4% 3389023% +% yuxN+35% 89.80% 61.29% 28.51% 9.80E401% CAGCAACAUAUUUAGAAGAACGGCUGCUUAAAAAGCAGCCGUUCUUCCUA 413.5% 4% 3397801% 4% liaH+45% 75.74% 63.65% 12.09% 1.51E401% AAUAAGCGGAACGGGGAAGGAUUUGCGGUCAAGUCCUUCCCUUCCGCACG 417.6% 4% 3399051% 4% yvqJ+41nt% 100.00% 99.31% 0.69% 2.94E401% CAUCUGUAAAGGGUUUUAAAACGCCAUGCCUCGUGCAUGGCGUUUUUUUG 413% 4% 3400488% 4% yvqK+49nt% 98.15% 98.98% 40.83% 5.05E401% AAAAGUGAAAAGGAAAGCCGGCGUGUUCAAAUACAUGCCGGCUUUUUUUG 418.3% 4% 3403268% 4% yvrC+225nt% 63.74% 44.51% 19.23% 2.44E402% AUCAGACUGCCGAGAGUUGUGCUGGCCGCCCUUGUGGGGGCGGCUCUUUC 412.8% 4% 3405666% +% yvrD+40nt% 94.69% 98.82% 44.13% 3.50E401% UUCUCUGUAGUAUAAAAAAACGCAUCCGUGUUUCGGAUGCGUUUUUUUUA 413% 4% 3412093% 4% yvrN+35nt% 97.95% 86.83% 11.12% 9.53E402% CUUCGCUAUGAAUAAAAAGAACGCAUCCAAUUGGAAUGCGUUCUUUUUUU 412.6% 4% 3415354% 4% fhuC+33nt% 99.76% 97.33% 2.43% 2.69E401% AGCUAGUUACUGUAUGAAAAAAUCCCGGUUUGAAGCCGGGAUUUUUUUUA 411.1% 4% 3419455% +% fhuD+34nt% 90.47% 48.47% 42.00% 1.30E407% AAGCUUGACUAAAUAAACAAAAGAGCCGCCUGCCCGCGGCUCUUUUGCUU 412.5% 4% 3419656% +% fhuD+235nt% 93.04% 89.18% 3.86% 1.70E401% AAUUGUGAUUUUAUAAAAAAGACACCUGAGCAAAUCAGGUGUCUUUUCAU 414.3% 4% BSU_misc_RNA_ 3421119% 4% 54+50% 72.78% 14.25% 58.53% 4.12E407% UCAAGGGUGUGUGUUUCUUUAAGCAUGGACUUUUGUUCAGGCUUUUUUUG 45.8% 1x1% 3424205% 4% yvgK+30nt% 91.43% 44.44% 46.99% 1.30E403% AGGUGAUAUUGGAAACGUAAAAAAUCCCUCUUGAUAGAGGGAUUUUUUCA 410.3% 4% 3424238% +% yvgJ+31nt% 99.35% 84.42% 14.93% 2.60E402% GCUCAGGUUUUCCGAAUGAAAAAAUCCCUCUAUCAAGAGGGAUUUUUUAC 410% 4% 3426716% 4% yvgN+33nt% 99.76% 99.60% 0.16% 6.48E401% AUGAGCUUCUGUUUUAAUCAAAAAACUCCCCGUUAUGGGGAGUUUUUUUA 49.9% 4% 3426748% +% yvgM+30nt% 95.05% 93.71% 1.34% 8.20E401% AACAGAAAAAAACGCACUAAAAAAACUCCCCAUAACGGGGAGUUUUUUGA 410.3% 4% 3428289% 4% nhaK+42nt% 97.99% 96.43% 1.56% 3.00E401% GCGAAUAAAUGCAGAAAAAAAGCUGGCGUUAGAGCGCCAGCUUUUUUUAU 414.2% 4% 3430553% 4% yvgQ+45nt% 98.66% 92.70% 5.96% 5.29E403% AUUGAGAAAGAAAGACGAGAGACAGGGAGUAGCUUCCUGUCUCUUUUUUC 415.8% 4% 3434300% 4% helD+27nt% 93.19% 55.85% 37.34% 2.42E403% ACUUAUAUCAGAUUGCUGAAUGAAGAGAAGGGAGUCCUUCUCUUUUUUCU 48.8% 4% 3436801% +% yvgO+8514nt% 67.46% 12.21% 55.25% 7.80E404% UUUAUAAUAGCACAUUCACCCAAUACCAAUCAAGGUUUGGGUUAUUUAUA 48.3% 1x0% 3436808% 4% yvgT+41nt% 98.53% 85.49% 13.04% 2.09E402% GAUAAUUAAUAGCAAAAAAACCGAUUUCGAAGUGAAAUCGGUUUUUUUCU 48.9% 4% 3436847% +% yvgO+8560nt% 78.95% 57.05% 21.90% 4.70E401% UAUAUUAUGCAGAAAAAAACCGAUUUCACUUCGAAAUCGGUUUUUUUGCU 49.3% 4% 3437607% 4% bdbC+37nt% 97.67% 98.21% 40.54% 6.03E401% AAAAUCUGAAUAACAAAAAAAGCGCCCGCGUAUGCCGGGCGCUUUUUUAA 413.3% 0x1% 3441093% 4% copA+28nt% 96.72% 96.67% 0.05% 4.35E401% UCGUCUGCAAAAAGUAAAAUGAAAAACCGGCUAUAUGCCGGUUUUUGUUU 48.8% 4% 3443574% 4% copZ+39nt% 51.57% 39.29% 12.28% 1.74E401% UAGCCAAGUGAUUCAAGGUAUCGCGCCUUUAGGGAGGCGCGAUAUUUCUU 417.6% 4% 3445405% 4% yvaB+37nt% 98.36% 95.36% 3.00% 5.24E401% AAAAACAUUCUAAUGAAAAAGCCUCCCCUUAUUUGGGGAGGCUUUUGUUU 417.7% 4%

! 124! 3445442% +% yvaA+37nt% 97.63% 97.73% 40.10% 9.60E401% GCUGGAGCACUAAAACAAAAGCCUCCCCAAAUAAGGGGAGGCUUUUUCAU 417.2% 4% 3448231% 4% yvaD+64nt% 96.00% 59.21% 36.79% 2.03E404% AUAAUAAACUGAUGUAAUGAAGCAGAGACGGUAUAAGUCUCUGUUUUUUU 49.6% 4% 3450665% 4% ssrA+45nt% 96.42% 77.50% 18.92% 4.67E403% CCAUACAUACUGACAAUAAAGCAGAACCUCUUAAGAGGUUCUGCUUUAUU 417% 4% 3451817% 4% rnr+46nt% 44.40% 19.35% 25.05% 6.62E404% AUAGCAGCUCAACCAGCAAAUAGGGCCGCAGCGCUCUAUUUGCUUUCUUU 414.3% 4% 3455048% 4% secG+45nt% 92.55% 85.53% 7.02% 9.68E404% UAUAGGGCAAUGUUUGUAUAAGGUCUGAUGUGAAGUCAGGCCUUUUUCAC 410.5% 4% 3457990% +% yvaP+49nt% 93.43% 75.90% 17.53% 2.30E404% AUUGCUAAAAUGGUUCUGAUCUCAAAGACGAGAAAAGAACCGUUUUUUAU 414.2% 2x2% 3459768% 4% opuBD+38nt% 89.89% 78.95% 10.94% 6.16E402% UCAGCUGCAUAGAAUAGAAAAAGAGGCUGGAGUCCAGCCUCUUUUUUCUC 413% 4% 3459804% +% yvaQ+38nt% 91.00% 85.04% 5.96% 1.30E401% UUUACGAUUUAAAGAGAAAAAAGAGGCUGGACUCCAGCCUCUUUUUCUAU 413% 4% 3464098% +% yvaV+31nt% 65.40% 63.33% 2.07% 2.50E401% AUAUGUGCCGAAGCCGUAAAAAGUUCCCAAAUUCAAUUCUGGGAACUUUU 48.2% 4% 3466395% 4% sdpI+39nt% 79.04% 78.21% 0.83% 5.48E401% GUUCACGUUGAAAAAGUGUCUUGCGGAGCAAUCCGCAAGACACUCAAUUA 422.5% 4% 3466437% +% spbC+50nt% 99.06% 98.35% 0.71% 8.00E402% UCCAUUAUAAUUGAGUGUCUUGCGGAUUGCUCCGCAAGACACUUUUUCAA 420.2% 4% 3467529% 4% opuCD+17nt% 65.02% 68.59% 43.57% 4.88E401% AUUAUAGCUGAUAGAAAAACCACCUCUAUUUAAAUACAACAGAGGUGGUU 411% 4% 3471839% +% yvbF+16nt% 13.81% 11.82% 1.99% 7.60E401% GCCGAAAACAAAAGAAUGCAGCUCUCUAAAAUAAGAGAGCUGCUUUUUGC 417.2% 4% 3473284% +% yvbH+44nt% 95.61% 90.91% 4.70% 6.30E403% AACUAGAUAAAAAAAGACACAGCUGCUAUCGUGCUCGUGUCUUUUUUUGU 48.6% 1x0,%0x1% 3474070% 4% yvbJ+36nt% 55.98% 84.95% 428.97% 2.08E405% CGUCUAUUCAAUAAAACAACCCCAUCACCAGCAGGUGAUGGGGUUGUUUU 419% 4% 3474108% +% yvbI+38nt% 100.00% 97.81% 2.19% 2.40E401% AUGCUCUUUUAAAAACAACCCCAUCACCUGCUGGUGAUGGGGUUGUUUUA 419.5% 4% 3476516% 4% eno+39nt% 99.76% 99.09% 0.67% 1.37E403% UAAACAAGUAAUAAAAAGACCGCCGGGAUUUUCUCUCGGCGGCUUUUUUA 415.5% 4% 3476555% +% yvbK+45nt% 81.25% 79.67% 1.58% 8.60E401% UCUGAAAGCAUAAAAAAGCCGCCGAGAGAAAAUCCCGGCGGUCUUUUUAU 412.4% 1x1% 3481599% 4% gapA+99nt% 49.49% 55.57% 46.08% 6.47E403% UAAUGAAAGCGGACAAGGGAAGGGGACGGACUCCCUUUCCCUUUUUCCAU 416.2% 4% 3483525% 4% in%cggR%CDS% 20.26% 7.65% 12.61% 8.48E403% GACAAACGGCAUGACAUUGACAGAAGAGGGCUAUGAACUGCUUUCUGUUU 45.4% 4% 3486800% +% araR+42nt% 93.10% 64.74% 28.36% 5.40E403% AUGAAUAAAAAAAGCAAUGUAUGGGUCUCCCCGCUACAUUGCUUUUUUUA 414.1% 0x1% 3489868% 4% yvbW+42nt% 97.26% 83.16% 14.10% 1.54E402% AUCAGUAAAUAAGAAACCCUCUUGCCGCAUCCGGCAAGAGGGUUUUUAUU 420.4% 4% 3489909% +% cyeB+40nt% 98.50% 96.74% 1.76% 4.10E401% UGCACAAUAAUAAAAACCCUCUUGCCGGAUGCGGCAAGAGGGUUUCUUAU 421.1% 4% 3491285% 4% yvbX+370nt% 85.07% 93.35% 48.28% 1.07E404% AAGGCUCGUCGUCUCUUUAUCUAUUAGAUUAGGUAGGAGACGGCGGGCUUUUUUGU 427.1% 1x0% 3492758% 4% yvbY+39nt% 88.71% 78.15% 10.56% 1.42E404% CUGACCGCUGAACUCAGGAAGCCCGGCAGGCAUAUGCCGGGCUUUUUGCU 416.9% 4% 3501647% +% rsbP+50nt% 96.30% 92.90% 3.40% 6.40E401% AAUGAUCCAUGAGACAUAACAAUGAUUUGUUACAUCUCAUGGAUUUUUUU 418% 2x2% 3509749% 4% yvfI+82nt% 84.07% 73.06% 11.01% 3.71E403% CGAAUGAUACGAACAACUGAGACUGAGCCGCAAAUGGUUCAGUCUUUUUA 413.5% 4% 3512503% +% yvfH+32nt% 74.25% 34.89% 39.36% 3.40E402% AGCUGGAUGAUUCCUUAAAAAAAUCCUCCCGUCUAGGGAGGAUUUUAUUU 412.9% 4% 3514141% +% yvfG+36nt% 71.82% 54.50% 17.32% 6.90E403% GAGAAUCAAAAUAAACCUUCCGCUCACAUGUGAGCAGGAAGGUUUUCCUU 416.5% 0x1% 3532320% +% pnbA+216nt% 100.00% 100.00% 0.00% NA% AAAAAGAAAACCCGGAAAAGAGAAGUAAUUCUCUUUUCCGGGUUUUUAUG 424.3% 4% 3533380% 4% racX+39nt% 100.00% 95.87% 4.13% 3.51E402% AUCAAAGCUAGCUUCAGACAAGGACUGUCUUCAAACAGUCCUUGUUUUUU 414.2% 4% GACCUAAAAUGUGUAAAGGGCAAAGUGUAUACUUUGGCGUCACCCCUUACAUAUUUU pnbA+3820% 3535924% +% 60.44% 93.15% 432.71% 1.10E403% AGGUCUUUUUUUA 427.9% 0x6,%1x1% 3545830% 4% trnQ4Arg+59nt% 99.33% 97.05% 2.28% 2.79E402% ACAACAGGAAAGACAAGGGUUUGGCGAUUUGCCGCUCUUGUCUUUUUUUG 414.7% 2x0% 3546868% +% clpP+41nt% 99.01% 98.86% 0.15% 1.80E401% AAAAAGUAAUAACACAACCUGCAAGAGCUGCGUCUCUUGCAGGUUUUUUU 415.6% 4% 3558825% 4% yvdD+115nt% 98.93% 91.83% 7.10% 1.21E403% AUCGAGUGUUUUUAACAAAGUGAGGUUUCCUUAAGGGAAAUCUCUUUUUU 410.8% 4% 3559982% +% yvdC+30nt% 90.36% 88.64% 1.72% 7.60E401% AACGAUUUGAGCAUGCAUAAAAAAGCGGCCGCGAUGGCCGCUUUUUUUAA 411.3% 4% 3563544% 4% yvcS+37nt% 100.00% 79.33% 20.67% 2.12E402% UCAGCGUAUGUAAUAUGAAAUCCGGUCUGUUAUCAGACCGGAUUUUUGAU 415.6% 4% 3563580% +% yvcT+37nt% 98.54% 92.35% 6.19% 2.90E402% AGAAUUUCAAUAAAUCAAAAAUCCGGUCUGAUAACAGACCGGAUUUCAUA 415.2% 4% 3568489% 4% yvcN+38nt% 93.17% 96.73% 43.56% 1.90E401% CAUUUUUUGUAACGUGAAAAGCUUGCAGGUUAUCUGCAAGCUUUUUCUUA 411.7% 4% 3568526% +% yvzJ+35nt% 95.45% 84.24% 11.21% 1.20E401% UACACUUGUUCAUAAGAAAAAGCUUGCAGAUAACCUGCAAGCUUUUCACG 412% 4% 3573046% 4% trxB+161nt% 92.36% 78.76% 13.60% 1.44E405% AUGAAUACACUUUUUUGGCACGGAUUCUCCAGUUAUCCGUGUCCUUUUUU 411.9% 4% 3574319% 4% cwlO+44nt% 93.53% 63.28% 30.25% 1.34E405% CAAUAAUAAAUAUGACAAGGGCCUUCUAUAAACAGAAGGCUCUUUCUUUA 412.7% 4% 3576123% 4% yvcD+42nt% 95.62% 91.71% 3.91% 4.38E402% UAGAAUAGUAAAUUUUAAAGAGUUGAUUUAUUUAAUCGACUCUUUUUUUG 49% 4% 3577685% 4% bmrA+60nt% 15.05% 6.89% 8.16% 3.22E402% AAUCAGCCAAUAAAAAAGAGGAGGGAUUUUCCCAAUCCUUCCUUUUGAAC 410.6% 4% 3579636% 4% yvzA+43nt% 98.61% 87.15% 11.46% 2.45E402% UGUCUAACACAAAAAUCUCCUAUUCAAACAAUGAGUGGGAGAUUUUUAUU 414.5% 4% 3582908% 4% hisI+28nt% 100.00% 86.17% 13.83% 3.80E403% CCAUUCUGAGAUUGAAGAGUAAAGAGCCGGAUGAUACGGCUCUUUUUGUU 410.1% 4%

! 125! 3591269% 4% yvoF+19nt% 98.25% 95.92% 2.33% 2.72E401% GCAAGAAAGAUUGAAAAAGUCCGCUGAAUAACAUCAGCGGACUUUUUUUG 415.2% 4% 3591308% +% pelC+40nt% 90.43% 91.23% 40.80% 2.70E401% UCAAUUUUAACAAAAAAAGUCCGCUGAUGUUAUUCAGCGGACUUUUUCAA 416% 4% 3598020% 4% yvnB+20nt% 95.88% 88.72% 7.16% 3.06E401% UUUGAUUUUCGCCAUGUCUCCAAUCCUUAAAAAGGGUUGGAGGCUUUUUU 417.8% 4% 3602547% 4% cypX+41nt% 91.28% 87.30% 3.98% 3.28E401% GGGGCAUAAUAGAAUUCCAAAGGUCUCUCCCAUGCGGGUGAGACUCUUUU 411.9% 1x1% 3606730% 4% yvlD+32nt% 96.41% 89.45% 6.96% 3.71E405% CCGCUUAGAAAAAAAUAAAAAAAGCUGCCCGCAAAGGCAGCUUUUUUACA 49.9% 4% 3606764% +% yvmA+30nt% 97.01% 100.00% 42.99% 3.00E401% AAAAAAAGCACCACAUGUAAAAAAGCUGCCUUUGCGGGCAGCUUUUUUUA 410.9% 4% 3609996% 4% uvrA+68% 88.41% 81.80% 6.61% 1.29E403% GACAGCUUGUCGGCAAGUCCAUCCUUGGGCUUAGCAGGCAAGCUUUUUCU 421.7% 0x1,%1x1% 3615054% 4% csbA+62nt% 91.70% 40.20% 51.50% 4.29E406% GAAUAUAAAGACUGAAUACCUGCUUUUACGUUUUAAAAGCAGGUUUUUUA 411.6% 4% 3620300% 4% minJ+46nt% 96.80% 95.70% 1.10% 3.01E401% AUAAAAGGCAGCCCGGCACCGCAGGAUGAUGCGAUGCCGGGCUGUUUUGU 427.9% 1x1% 3623899% 4% ftsX+39nt% 99.53% 98.96% 0.57% 3.33E402% UGCGAGUAUAAAGUGAAAAAGCCGUUCCGUUUUCGGGACGGCUUUUCAUU 415.7% 4% 3625699% 4% cccB+42nt% 98.14% 84.91% 13.23% 6.28E404% AAAAGUAAGAUAAAAACAUCCUUGCCGAGUGCUGGCAAGGAUGUUUUUAU 417% 4% 3627098% 4% prfB+41nt% 99.44% 97.85% 1.59% 1.03E404% CUUUCAUAAGCUGAAAAACACACCUGAUGCAUACGGGUGUGUUUUUUUAU 410.6% 4% 3628256% 4% secA+54nt% 20.19% 11.89% 8.30% 6.22E404% CCCCGGCAAGUUUACUGACCGCGGCGCCUGCAGGCGCCUGCGGAUCUUUU 419.6% 0x1% 3630962% 4% yvyD+41nt% 94.33% 82.47% 11.86% 3.39E404% ACUGAAUAAUGAAGAGAAGCCUUCCGUGAUGUCCGCGGAAGGUUUUUGUU 414.2% 4% 3631989% 4% fliT+161nt% 11.29% 12.28% 40.99% 5.04E401% UCAAAAACAGAAGGGGAUCGGAUCUACCAAGAUCUGAUCCAAGCCUUUUU 417.6% 3x0% 3634948% 4% hag+39nt% 98.44% 99.55% 41.11% 4.65E406% UAUUACGUUAAUUUUAAAAAAGACCUUGGCGUUGCCAGGGUCUUUUAAUU 413.7% 4% 3636037% 4% csrA+9nt% 88.52% 67.48% 21.04% 5.64E404% CCAGCGAUGUGAUCUCCGCAUUAUCCUCACAAAAAAAGUGAGGAUUUUUU 410.1% 4% 3637312% 4% flgL+26nt% 86.19% 55.52% 30.67% 5.68E407% ACAUUGAUUGACUUUUUAAAGUAAGCGGCUCUUAGGAGUUCGCUUUUUUU 46.7% 0x1% 3639891% 4% flgM+394nt% 15.69% 6.74% 8.95% 4.37E403% GAGAUGAAUAGGCAGCUGACAAGAGACGCGCUGCAAUUCAUCUCUAUUUCGU 418.3% 2x1% 3643629% 4% yviA+35nt% 97.24% 86.38% 10.86% 5.11E404% UGGUGUUUUAAAUAAGGCCAAAUCUCCGUUUUUAGAGCGGAGAUUUUUUU 410.3% 4% 3644566% 4% degU+41nt% 83.20% 84.94% 41.74% 3.20E401% AUGAGAUAGUAUAAUAGGAGACUUGCCUUUUACUAGGCAGGUCUUUUUUU 413.6% 4% 3648619% +% yvhJ+38nt% 99.17% 96.22% 2.95% 4.60E402% UCAUCCUAUUAAAAAAUGCCCGGUCCUUUUAGAGGAUCGGGCAUUUUUGC 419.8% 4% 3648622% 4% tagO+32nt% 98.96% 93.76% 5.20% 2.23E401% CUGGUGAAAAGGAAUUAAAAACUCCGGCUUAUGUGCCGGAGUUUUUUUCU 413.5% 4% 3659078% 4% lytC+41nt% 94.27% 94.61% 40.34% 5.33E401% UACAGAUAAUCGAAAGAGACAAAUCUAAUCACAGAUUUGUCUCUUUUUUA 413.5% 4% 3664204% 4% mnaA+37nt% 99.66% 98.87% 0.79% 3.03E401% UACAGGCAAAUAAAAAAGAAGCUUUGCACAUUGUGCGAAGCUUCUUUUUG 416.5% 4% 3664243% +% lytR+42nt% 99.80% 99.73% 0.07% 5.80E401% AAAAGUAAAACAAAAAGAAGCUUCGCACAAUGUGCAAAGCUUCUUUUUUA 412.7% 1x1% 3666507% 4% yvzH+426nt% 98.90% 97.17% 1.73% 4.49E402% UGUUGAAAUAAAAAAAGGCUAUUGGAUGAAUGUCCAAUAGCCUUUUUGUU 416.4% 4% 3666548% +% gtaB+41nt% 99.91% 99.65% 0.26% 7.40E401% GAAAUCUAAACAAAAAGGCUAUUGGACAUUCAUCCAAUAGCCUUUUUUUA 414.6% 4% 3672150% 4% tagH+1414nt% 86.94% 56.00% 30.94% 7.41E406% AGCACUAACUAAAAGAGGCUUGAAGUAAAUUCAGUUGCUUCUUUUUUUCU 46.7% 0x2% 3673525% 4% tagH+39nt% 97.16% 96.13% 1.03% 3.30E401% UGUUGAAAUAAAAAAAGGCUAUUGGAUGAAUGUCCAAUAGCCUUUUUGUU 416.4% 4% 3673566% +% yvzE+41nt% 99.67% 100.00% 40.33% 3.40E401% GAAAUCUAAACAAAAAGGCUAUUGGACAUUCAUCCAAUAGCCUUUUUUUA 414.6% 4% 3676108% 4% tagF+51nt% 82.06% 40.14% 41.92% 7.69E407% UUAGGUUAUUUUAUAAAAUGUAUAGCUGUCGAUUUUUCGGCAGCUUUUUA 411.9% 4% 3680508% 4% tagD+73nt% 88.67% 45.97% 42.70% 1.04E405% UCAAUAUCUAAUUAAAGUACUUCUUAUUGAAAUAAGAAGUACUUUUUGAU 411.2% 4% 3683356% +% tagB+38nt% 99.11% 93.61% 5.50% 2.90E403% UUAAUAAGCUAAAUGAUGACACUUGUUCAAAACAGAACAAGUGUUCUUUU 411% 4% 3684769% 4% lytD+57nt% 90.73% 85.63% 5.10% 9.13E402% AGAAAGUUGCAAAUAGGCUGUAGCUAUUAAAUAGCUACAGCCUAUUUGAU 421.1% 4% 3687565% 4% yvyI+32nt% 93.20% 75.31% 17.89% 4.16E403% AUCGUGUCUCAUAUUUAAACUUAAUCUCACUUCGAGGUUAAGUUUUUUUA 48.5% 4% 3695242% +% ywtF+35nt% 95.94% 72.52% 23.42% 2.80E403% GAUUUAGGUGUAUAAUGAACGGGAUGGCGAUUACGCCAUCCCGUUUUACA 419.2% 4% 3696221% 4% pgdS+36nt% 98.98% 79.55% 19.43% 8.37E410% UACGGGUGCAAUAAAAGAAAAAGACUCCAAUCUCUGGAGUCUUUUCUUUA 49.4% 4% 3696256% +% ywtE+33nt% 94.55% 92.32% 2.23% 8.20E401% CGGGGCAAUAUGCAUAAAGAAAAGACUCCAGAGAUUGGAGUCUUUUUCUU 48.9% 4% 3703426% +% in%rbsD%CDS% 50.00% 34.42% 15.58% 4.50E403% GCGUUUUGAAAAUUGAUCUUUCACUGAAGCCGGGCCUUCCGGCUUUCCAA 49.9% 4% 3707681% 4% ywrO+491nt% 92.93% 73.97% 18.96% 4.15E401% AAUCAAUUCAUAAUAAAAGGGAUUCCGCAUUUAUGCGGAAUCCCUCUCAG 419.3% 4% 3707719% +% ywsB+39nt% 98.51% 94.37% 4.14% 1.90E401% UGACAAAAUAACUGAGAGGGAUUCCGCAUAAAUGCGGAAUCCCUUUUAUU 419.3% 4% 3708133% 4% ywrO+39nt% 79.41% 70.36% 9.05% 1.04E401% CUUUUGUUUAAAAUACAGCCCUGUCCAACAUACGGCAGGGCUGUAUUUGU 420.7% 4% 3708758% 4% alsD+41nt% 99.22% 88.98% 10.24% 1.19E402% CCUGAAUAAAAGAAAAAAAGAAAGCCCCUUUUAGCAGGGCUUUCUUUUUA 410.9% 4% 3718743% +% ywrF+127nt% 80.16% 73.74% 6.42% 4.40E401% AAAAUAUCAAAAAAAAGAACACCCAGAGCAAGCUCGGGGUGUUCUUUUAU 417.3% 1x1% 3724386% 4% ywqL+34nt% 86.41% 62.57% 23.84% 1.03E402% GAAAAAUCACGUGUAACACUUGGGGCUCUAAGUCAUCAAGUGUUUUUUUU 49.1% 0x1% 3724735% 4% ywqK+411nt% 4.09% 1.95% 2.14% 6.67E401% ACGGAUAUCUGCAUUACAAUCAUAUGGGCGUUGCCACCCAUGCGGCUUUU 46.2% 1x1%

! 126! 3728362% 4% ywqG+149% 85.44% 32.01% 53.43% 1.59E407% UAAGCUCAGCGCCGAAAGAGGCAGAUCAACAACAUCUGCCUCUUUCAAGU 413.1% 4% 3729448% 4% ywqF+40nt% 95.57% 80.46% 15.11% 2.68E402% AAUUCAAUAGAUGAAAAAGAAAGGCUGGUUGCGCACCAGUCUUUUUUUCA 48.2% 4% 3731791% 4% ptkA+31nt% 80.54% 35.19% 45.35% 5.82E407% CAAUUUCAUGCAAAAAUAAAUAACGUGCAUCGUGCCCGUUAUUUAUUUUU 45.1% 1x1% 3733473% 4% ywzD+32nt% 93.10% 68.17% 24.93% 1.06E402% AAUGGAUAUGCAACAUAAAAAUCCCGCACGCCUUUAGCGGGAUUUUUUUA 49.9% 4% 3738224% 4% ywpJ+119nt% 94.38% 95.71% 41.33% 1.77E401% GACGGCUAUGAACGGAAAAAAGCUGGCUCUUUUAGAGCCAGCUUUUUUAG 414.7% 4% 3738261% +% ywqA+44nt% 100.00% 96.73% 3.27% 6.80E403% CAAUAAUCAUGACUAAAAAAGCUGGCUCUAAAAGAGCCAGCUUUUUUCCG 414.7% 4% 3740112% 4% ssbB+94nt% 96.27% 91.53% 4.74% 3.63E402% UCUUCGCAUCAUCCCCUCAAAAUUGACCAGUCGACCAGACUGGUUCUUUC 48.7% 4% 3741710% +% ywpF+118nt% 92.51% 56.72% 35.79% 2.10E405% AUAUGUUCUGCAUGAAAAAAGCUGCCGUUUUGAACGGCAGCUUUUCUCUU 413.6% 4% 3743234% 4% mscL+33nt% 93.52% 80.58% 12.94% 2.42E402% CAAAGUCGCCGGAAUAAAAAAGAUGCCGUUAGAAACGGCGUCUUUUUUUA 411.2% 4% 3743688% 4% fabZ+44nt% 67.54% 50.65% 16.89% 3.74E404% GAAUAAUUGAAAAAAGGCAGAUGGCCAGCGGCACAUUUGUCUUUUUUUCU 411.7% 0x1% GGGCGUUUUUCAAUCAGCCGCGCAUGAUAAAAAAAGCGGCUUUUUCGAAAUCGUCCU 3745363% 4% flhP+73nt% 90.02% 84.63% 5.39% 3.38E402% UUUUUUU 419.3% 2x2,%0x1,%2x1% 3747214% 4% mbl+40nt% 97.13% 93.52% 3.61% 1.22E402% ACUAAGCUGAUUUCACAAACCUCAUUCUGAAAAAGAAUGAGGUUUUUUUA 412.2% 4% 3750714% +% ywoG+37nt% 78.67% 43.58% 35.09% 2.70E403% UAUUGCAGAAUAACUUGUCAGACUGCCGGGAAAUCCCGGCAGUCUUUUUU 421% 4% 3750718% 4% ywoF+50nt% 86.33% 32.92% 53.41% 8.72E406% UUGCUAUAAGCGGCGUUCUCUCGUUCAACCGAGAGGGCGCCGUGUUUUAA 423% 4% 3753897% 4% ywoD+36nt% 98.41% 89.41% 9.00% 1.34E401% AAACUGCAUCUUAAGAAAGAGACGGGCUCUGAGGUCUGUCUCUUUUUCUU 413.3% 4% 3758405% +% glnK+39nt% 100.00% 100.00% 0.00% NA% AAGCACUUUAAUAUCGGUACGAGAUUCGGACACUCCGGAUCUCUUUUUUU 412.7% 4% 3759175% +% bcrC+47nt% 93.26% 87.70% 5.56% 1.50E401% UAAGAAAGACAAAAGCCGGCGUCUGAAAUCAAGACAGCCGGCUUUAAUAU 416.6% 0x1% 3761753% +% ywnG+53nt% 88.76% 76.39% 12.37% 1.10E402% UGAGACAGGACAGGGCAUGAGUUCCAUAUAAACGGAACCAUGCCUAUUUU 416.2% 1x0% 3761933% 4% ywnF+54nt% 93.26% 91.26% 2.00% 8.67E401% GAUCUGCACCCGGAUUGUUGAGAUUUUCCAGACGAUCCGGGUGUGUUUUU 421.9% 2x2% 3764153% +% clsA+41nt% 92.00% 75.19% 16.81% 8.70E404% AUCUUAUAAGAUGCGUAAACCCCCGGCCUUUACGGCCGGGGGUUUUCCUG 421.4% 4% 3765435% 4% ywnB+34nt% 99.09% 96.47% 2.62% 2.95E402% AAGCGAAGCGGAAUAAUAAAAAACCCGGAGCCAGCUCCGGGUUUUUCUCA 413.6% 4% 3765470% +% ywnC+36nt% 98.65% 97.24% 1.41% 2.80E401% ACAGCACUUAUUAAUGAGAAAAACCCGGAGCUGGCUCCGGGUUUUUUAUU 413.6% 5%(4%A4U,%G4U% 3766159% 4% ywnA+19% 85.42% 52.36% 33.06% 3.74E406% AUUAAAAGAUGUUAUGAAUCAUCUCUUUUAAUCAAAAGGGAUGACUUCUC 410.6% 4% 3770967% 4% rapB+33nt% 98.14% 98.97% 40.83% 4.07E401% GUUUAUAUGAAGUAUGAGACAAAACCAUCUGCUGGCAGAUGGUUUUUUUU 49.9% 4% 3772280% 4% moaA+45nt% 95.98% 89.73% 6.25% 6.60E402% GUUAAUUUGAAGUCAAAAGCUUAUCGGCACUGUCCGGUAAGCUUUUUUAU 411.4% 4% 3772909% 4% in%moaA%CDS% 37.87% 17.52% 20.35% 4.95E402% UCAGCCUUGAUUCUUUAGAAGACGAGCGUUUUAAGAAGAUAAACGGGCGCGGUGUUU 413.5% 2x2,%4x5,%1x2% 3774231% 4% ywmE+169nt% 88.07% 85.06% 3.01% 9.36E401% CACCGCCGUCAUCACAUCCUGUAAAAGCCCUUUAUAUAGAGGGCUCUUUU 48.9% 4% 3774617% 4% ywmD+38nt% 72.53% 67.57% 4.96% 5.10E401% UUUACUGAGUAAGGAACCUAAAGAUCAGGCGCUCCCCCAGGCGCCUUUUU 49.4% 4% 3777903% 4% murAA+46nt% 99.38% 98.23% 1.15% 1.01E403% AUAAACUUACUUGAAAAUCAGUAUGUCACUCUGGCAUACUGGUUUUUUAU 412.1% 4% 3781033% 4% atpC+36nt% 95.74% 93.85% 1.89% 1.87E401% UAGCAGGGAAAUAAGAAAAAAUCCUUCUCUUUAUGAGAAGGAUUUUUUUA 411.5% 4% 3783831% 4% atpA+47nt% 12.59% 3.81% 8.78% 1.47E403% UAACUCGAAUGCUGAUGAGAGAAAAAGGUUCUCUUUUUCUCUCUUUUUAC 412.4% 4% 3788393% 4% upp+33nt% 83.44% 85.90% 42.46% 2.59E401% UGUUUGGAACAAAAUAAAAAAUGAAAUCCCCAAAAGGGGGUUUCAUUUUU 414.5% 4% 3789146% 4% glyA+44nt% 98.69% 96.59% 2.10% 1.20E402% UAUUAAGAUCCUAAAACCCGCUUGGGCUUAUGCCCGGCGGGUUUUUUGAC 418.5% 1x0% 3790615% 4% ywlG+29nt% 51.80% 17.85% 33.95% 1.89E404% GCGGUUUAUGAGUGCGAAUGAAAGGACUGCAUAGCCAGUCUUUUCUUUUA 44.1% 4% 3792893% 4% ywlC+76% 53.41% 34.21% 19.20% 1.70E403% CCUUUUUGGACACGCAUAGGCUAAAAAAGCGGGGCGUGUCCAAGGGGGUUAUUUAU 426.8% 4x3% 3795836% 4% ywkF+34nt% 100.00% 86.35% 13.65% 1.12E402% GACGAUUUUGUUUUAAUAAAAAAGGAAGCCUCUUAGGCUUCCUUUUUUUG 411.3% 4% 3797044% 4% prfA+41nt% 84.99% 42.70% 42.29% 6.39E409% GAAGGUUAAGAUGAAGACGAUAUUCGAAGCCCUGAAAUGGGCUUCUUCUU 412% 4% 3799376% +% racA+33nt% 100.00% 96.72% 3.28% 3.40E401% UCAAAUUUCAAACCUAAAGCAAAAAGCUCCCUUAAAGGGAGCUUUUUUUG 410.4% 4% 3802350% 4% tdk+55nt% 87.83% 85.22% 2.61% 2.98E401% AACAUGGGUAUAAAGAUAGAAUGCACCGGCUAAAAACACCGGUGUUUUUU 48% 4% 3803035% 4% rpmE+46nt% 99.61% 97.14% 2.47% 7.52E405% GUAAUAAUAGAUUUCUCAACAGGCAAGCAGCAGUCUUGCCUGUUUUUUAU 411.5% 0x1% 3805054% 4% glpX+36nt% 78.19% 62.18% 16.01% 6.22E404% UAAUCCGUCCAUAACAAACAGAAAAAGCGGGUGUGAGCCCGCUUUAACUU 410.1% 4% 3807705% 4% ywjH+49nt% 47.12% 56.86% 49.74% 5.04E403% AUGAAAGGGGCGGCAAACAGCUUUAUGCCUGUUUGCCGCGGCCUUUGUAU 419.9% 0x1,%1x2% 3808461% 4% fbaA+51nt% 52.77% 24.52% 28.25% 9.66E407% UCAAUUGGAACUUUUUAUAGCCGCCUGACAGCUUGACAGGCGGUUUUCCG 411.7% 1x1% 3810648% 4% pyrG+45nt% 99.66% 97.95% 1.71% 9.93E403% AGUAAUAAAAAAGACUUGCCGUUUGUCAAAAGCGGGCAAGUCUUUUUUAU 414.8% 0x1% 3810693% +% ywjG+82nt% 98.39% 94.01% 4.38% 5.60E402% ACAAAUAAAAAAGACUUGCCCGCUUUUGACAAACGGCAAGUCUUUUUUAU 410.4% 4% 3812408% 4% rpoE+134nt% 85.54% 88.80% 43.26% 1.14E401% GAACAUAGUACGUUAUGCUCCCUUUCAAGAAAUUGAAAGGGAGCUUUCUU 421.3% 4%

! 127! 3819185% 4% ywjB+35nt% 99.39% 95.86% 3.53% 8.14E403% UAUGUAAGAGCAUAAGAAAAAGGAUAGACAGAUGUCUAUCCUUUUUUGUA 411% 4% 3833606% 4% argS+44nt% 92.40% 91.24% 1.16% 3.94E401% AUGUAAUCACGAUCAAAAGGACAAAGUCUUCGGGCUUUGUCCUUUUUUUA 417.1% 4% 3836234% +% sboA+45nt% 69.43% 79.38% 49.95% 6.00E401% GGUAAGGAUCUCCCAAAAGGGCAUAGUCAUUCUACUAUGCCCUUUUUAAG 413.4% 4% 3847274% +% phrF+25nt% 94.04% 75.04% 19.00% 5.10E409% AGUUGCACAACGAGGAAUGAUUUAACCGCCGUCCAUCGGCGGUUUUUUCG 410.7% 4% 3847819% 4% speB+34nt% 99.40% 98.84% 0.56% 4.29E401% UGGGUUUGUGAAAUAAGUAAACAUCCAGACGAUGUCUGGAUGUUUUUUUA 412% 4% 3847855% +% ywhH+34nt% 78.99% 61.12% 17.87% 4.30E402% UAAAGACUGGGAAUAAAAAAACAUCCAGACAUCGUCUGGAUGUUUACUUA 412% 4% 3848748% 4% speE+38nt% 47.14% 7.27% 39.87% 7.39E407% CUGAUUAAAUAAUGAAGGUAUGGCGCAGGAGCGAAUCUUGCGCUUUUUUA 411.9% 4% 3851890% 4% ywhD+296nt% 79.51% 53.62% 25.89% 2.77E404% GAAGGAACCAUACGAAUAACCCGGCCUCCGAGGAGCCGGGUUAUUUUCAA 418.1% 1x0% 3852063% 4% ywhD+123nt% 57.83% 12.58% 45.25% 1.68E406% AAAUAGGACAUGGAAAAUCCCGAGCCGAAACAAGACUCGGGGUUUUUCAU 49% 4% 3853712% +% ywhB+38nt% 93.94% 94.71% 40.77% 3.80E401% GAUAUGGAAUAAUCUCUAUAAAGCCGGCGCUUCGCGCACCGGCUUUUAUU 412% 1x1% BSU_misc_RNA_ 3856205% 4% 58+274nt% 80.41% 71.37% 9.04% 3.57E401% CACGGGUUAAUCACACACUCGUCCCUAUCUGCGGGACGGGUGUGUUUUUU 421.3% 4% 3856458% 4% mmr+559nt% 82.78% 66.95% 15.83% 2.83E403% CACGGGUUAAUCACACACUCGUCCCUAUCUGUGGGACGGGUGUGUUUUUU 421.9% 4% 3856711% 4% mmr+306nt% 84.07% 87.09% 43.02% 3.02E402% CGGAUGAUCAACACAUUCGUCCCUUUUAGAGGGAUGGGUGUGUUUUUUUA 418.8% 4% 3858955% 4% ywgA+44nt% 98.28% 94.55% 3.73% 1.10E401% UGUUAACCAUACCAAGCAAAAGAAAUGAUCCGUUUCUUUUGCUUUUUUUA 411.6% 4% 3863373% 4% ywfL+42nt% 94.50% 92.75% 1.75% 1.57E401% UUGGGUGAACGUUCUUCGCAUGCCGGCUGUAUAUGCCGGCAUGCAUUUUU 422.6% 1x0% 3865309% 4% eutD+46nt% 99.54% 98.62% 0.92% 5.36E403% GUAAUAAAAUUGAAGACAAUGGCAGCUCUCGACCGAGGGCUGCCUUUUUU 418.8% 4% 3867396% +% ywfI+36nt% 100.00% 70.53% 29.47% 2.60E409% UCUUAUAUGUAUAAUAUCCCCUCCCGCCCUAUCCGGCGGGAGUUUUUCAA 415.7% 4% 3868269% 4% ywfG+18nt% 96.47% 75.23% 21.24% 5.65E403% CGUUCGGGUCAUUACAAGAAACAUCCCGCUAAAAAGCGGGAUGUUUUUAU 415% 4% 3868304% +% ywfH+32nt% 71.01% 60.47% 10.54% 3.10E402% AGCAUGAAAAGCAUAUAAAAACAUCCCGCUUUUUAGCGGGAUGUUUCUUG 415.3% 4% 3878915% 4% rocA+51nt% 78.65% 79.31% 40.66% 7.97E401% UUGAGAGAAAUAAAAUCGUGCGAUUCUUUAGCGGAUCGCACGAUUUCAAC 417.2% 4% 3882143% 4% yweA+48nt% 84.28% 89.39% 45.11% 5.53E402% AAUCGAUAGAUUUGUAGUCAGAGACUGAGAUGUUUUCAGUCUCUUUUUUU 411.4% 4% 3893986% 4% ywdK+44nt% 99.78% 97.38% 2.40% 1.83E402% CUAUAAACAAAAAAGCCAAUCCUCAUCAUAUGAGUGAUUGGCUUUUUUCU 414.2% 0x1% 3897656% 4% ung+29nt% 86.50% 87.50% 41.00% 6.09E401% UGGUGUAUUAAGGAUUUGUAAAAAGCGCAGGUGAUCUGCGCUUUUUUAUU 48.7% 4% 3901778% 4% ywdA+90nt% 93.67% 95.08% 41.41% 5.81E401% UCUUCGGUGAUUUAAAAAGGGCUGCCUCUCUGUAAGGCAGCCCCUUUUUU 418.1% 0x1% 3901818% +% thiD+40nt% 92.12% 90.32% 1.80% 6.60E401% ACAAUCAUAAAAAAAGGGGCUGCCUUACAGAGAGGCAGCCCUUUUUAAAU 419.2% 4% 3906102% 4% sacT+40nt% 78.48% 26.04% 52.44% 1.12E404% CUCGGAAUAACCGCUUUGACUUGCAGGGAGUGAUCUCUGGAAGUUUUUUU 411.2% 1x1% 3911446% 4% nfrA+31nt% 93.63% 78.88% 14.75% 3.53E403% GGGCUUUAAUAAAAACUAAAGCAAACCUCUCCGUCUGGAGGGGUUUUUAU 410.2% 4% 3912297% 4% rodA+35nt% 98.24% 97.76% 0.48% 9.18E401% CUUUUUAAUUCUUGAUAUGCAGACAGCCUUUACAGAGGCUGUCUUUUUUU 413.9% 4% 3914278% 4% qoxD+37nt% 99.88% 99.74% 0.14% 2.17E401% CCAUAACGAAUAAUACAAAAAACCCUCUUCAGUGGAAGAGGGUUUUUUGC 412.3% 4% 3914314% +% ywcE+42nt% 85.93% 88.82% 42.89% 9.00E401% GCAGCUGAAGACAGCAAAAAACCCUCUUCCACUGAAGAGGGUUUUUUGUA 411.7% 4% 3919076% 4% galT+17nt% 94.68% 88.73% 5.95% 4.44E401% GGCGCCAAACCAGUCAAAAGCCUCAACCGCUAGGGUUGAGGCUUUUUCGA 415.7% 4% 3925763% 4% ywbO+34nt% 81.44% 84.51% 43.07% 4.71E401% GCAGAAGAAAAAGUAAGGAAAAAGCUCUCGAUAAAGAGAGCUUUUUUUAU 49.2% 4% 3926464% 4% efeN+218nt% 37.97% 49.78% 411.81% 7.34E402% UUUUAGGAUUUUGUCAUCAAUCUGAAAGAAGCCUAAAUCGGCUUCUUUAU 44.6% 4% 3926654% 4% efeN+28nt% 41.91% 3.38% 38.53% 1.68E407% CCAGCGUUUGCUGGAAUCAUAAAAGAAGCCUUUACAGGCUUCUUUCAGCG 48.7% 4% 3930657% 4% thiE+50nt% 97.94% 91.88% 6.06% 1.19E401% UCGUUCAUUUUCCUUCAAAGGGCUGUUCUGUAAAAGGACAGCUUUUUUGC 410.5% 4% 3934285% +% lrgB+31nt% 98.50% 98.72% 40.22% 4.40E401% UUUGCUUUCAUUUAUGUAAAAAACUGUCCUCUCGAGGGCAGUUUUUUUUA 49.2% 4% 3935787% 4% ywbD+37nt% 98.74% 100.00% 41.26% 1.67E401% GCAGAAAAAAUAAAUGAAAAAGCUGCCCUGUUCAGGGGCAGCUUUUUUUU 414.9% 4% 3935823% +% ywbE+35nt% 84.00% 44.59% 39.41% 3.80E402% AUCGUUUCUACAUAAAAAAAAGCUGCCCCUGAACAGGGCAGCUUUUUCAU 412.7% 4% 3937556% +% ywbC+41nt% 92.04% 95.56% 43.52% 4.60E402% CAGCGGUAAAAAUAAAGAACGUACAUUUUGUGAUGUACGUUCUUUUUUAU 413.3% 4% 3941853% +% epr+47nt% 99.04% 97.96% 1.08% 3.90E401% UAACCAAAAACCUUUAAGAUUUGCAUUCCAAGUCUUAAAGGUUUUUUUCA 414% 4% 3942129% +% epr+323nt% 81.33% 28.46% 52.87% 3.30E406% CUUGGACAACCCCCUAUUCUCAUGCUCCGUCGUCGACGCGGGCAUUUUUG 49.4% 0x1% 3944514% 4% gspA+46nt% 100.00% 99.31% 0.69% 3.41E401% AUAAAUCAGAUAAAAAAACGCUUUUGAGAUGAUCAAAAGCGUUUUUUGUU 410.6% 4% 3944554% +% sacY+45nt% 79.35% 86.57% 47.22% 3.50E401% GCUGAGACAAACAAAAAACGCUUUUGAUCAUCUCAAAAGCGUUUUUUUAU 49.8% 4% 3947135% +% ywaE+226nt% 93.03% 96.23% 43.20% 2.30E401% GGUACCGCGUGCAUUGAGCCACGUCCCUUAUUGGGAUGGGCUCUUUUUUG 418.9% 1x0% 3950690% 4% menA+36nt% 78.29% 58.54% 19.75% 3.95E401% GCUAUUUCCGAUAAUAAAAAAGACCGCUCGUUUCAUGCGGUCUUUUUUUG 49.3% 4% 3954067% +% in%dltB%CDS% 12.43% 5.14% 7.29% 3.20E402% GGCAGAAAGCGAACAGCGGCUUUGUCUUUUGCGGAGCUGUUAUCGCGUCUAUUCUGC 426.2% 2x1,%1x5%

! 128! CUUUAUUU 3957267% +% dltE+17nt% 92.11% 86.80% 5.31% 5.50E402% UUAUUCGAGCAAAUGAACACGCAGGAGAAUUAAUUUCUCCUGCUUUUUUC 414.2% 4% 3958519% +% ywaA+37nt% 100.00% 99.30% 0.70% 3.70E403% UGAAAGCAAGUAAGAAAAAAGCCGGCCCAUUACAGGCCGGCUUUUUUUAC 414.2% 4% 3972449% +% yxlA+16nt% 98.31% 96.25% 2.06% 6.20E401% GGCGGGGUAUCAAGAAAAGCUGUCUUCUCUCUGAAGACAGCUUUUUUAUC 414% 4% 3983047% 4% yxkH+140nt% 59.22% 37.12% 22.10% 4.02E405% UAUGAUCUGAAUAACCGAAAUACCCGCUGUCCGCCUGCUGGCGGCUUUUG 48.8% 4% 3983188% +% yxzE+15nt% 82.44% 81.38% 1.06% 8.80E401% AUUCCGGCUGUGGCGGCGGAGGGGGCGGCGAUUAAACGCCGCCUUUUUUU 413.9% 4% 3984092% 4% msmX+41nt% 96.15% 94.30% 1.85% 2.65E401% AUCCGAUAAGAUCAAAAAAACCGGACAUGGAGACAUGUCCGGUUUUUUGC 418.7% 4% 3987886% 4% yxkD+41nt% 96.55% 79.82% 16.73% 5.99E402% UCUAAAUAAAGAAAAAUCCCUCUGUACUUGAAACAGAGGGAUUUUUUCAU 414% 4% 3988802% 4% galE+1146nt% 96.74% 96.36% 0.38% 8.17E401% AGCCCAGGAGUUUCUGCUCUUUUUCGAGAGCGUUCUCCUGGGUUUUUUUA 422.8% 4x2% 3989911% +% yxkC+38nt% 65.68% 31.17% 34.51% 8.80E410% AAAAUCAAAUAACAGCUAACAAGGGUGCCUGUUUAGGCACCCUUGUUCUU 414.3% 4% 3989912% 4% galE+36nt% 93.69% 79.33% 14.36% 1.68E403% AGAGUGCGGAAUAAGAAUGGAGGCCUUCUCAAUUGAGAAGGCCUUUUUUA 416.1% 4% 3989947% +% yxkC+74nt% 90.25% 88.07% 2.18% 5.70E401% GCACCCUUGUUCUUUAAAAAAGGCCUUCUCAAUUGAGAAGGCCUCCAUUC 416.1% 4% 3993219% +% in%yxjM%CDS% 47.22% 38.94% 8.28% 1.20E401% ACAAACUCCGGCUCGGCACUACUACAAGAAGCUUGUGCCGAGCCUUAUUC 420.2% 2x3% 3996345% +% pepT+38nt% 99.64% 99.79% 40.15% 5.90E401% GCGCAAGCAUAACGCCAAAAGCCAGUCCAAAAAAGGACUGGCUUUUUUGU 414.9% 4% 3997141% +% yxjJ+49nt% 94.17% 41.57% 52.60% 2.20E409% AUUCUAUAUUUCAAACGAAAAGGCUGCUGAAUCACGCAGCCUUUUAAAAU 410.1% 4% 3997932% +% yxjI+223nt% 95.71% 77.62% 18.09% 8.90E405% GAGAUUUGAUCGUUCAAGCUCUUCCUUACACAAAGGAAGAGCUUUUUACA 414.5% 4% 3999320% +% yxjH+223nt% 83.91% 57.08% 26.83% 8.60E405% GUUGAGAUUGUCACGCAAGCUCUUCCUUAUCCAAAGGAAGAGCUUUUUUA 414.5% 4% 4000537% +% yxjG+51nt% 99.10% 95.11% 3.99% 4.80E405% CAAAGAAAAAAACACACUUGAUUCCCUAGCGGAGCAAGUGUGUUUUUUAU 414% 1x0% 4004248% 4% yxjB+40nt% 66.94% 61.46% 5.48% 9.85E401% AAUGAAAUGAAUGGUAGAGGAAAGCUCCGAAAAAAGGAGCUUUCCUUUUU 47.5% 4% BSU_misc_RNA_ GCUCUUAUUUUUCACACUUUCUGCACUUCCAGAAUUUGUGAAGGAUAAGAGCUUUUU 4005718% +% 63+93% 65.85% 64.78% 1.07% 2.80E401% UU 426.8% 2x2% 4006947% 4% yxiT+40nt% 89.74% 46.56% 43.18% 2.75E405% UUAUCAAUAAUGAAAAGAGCCAUAUCCGAAAAGGGAUAUGGCUCAAUGUU 414.2% 4% 4006987% +% yxjA+42nt% 96.56% 91.98% 4.58% 6.50E402% UGUGGUAGAAACAUUGAGCCAUAUCCCUUUUCGGAUAUGGCUCUUUUCAU 418% 4% 4007774% 4% yxiS+29nt% 92.83% 87.16% 5.67% 8.78E402% AUUUCUGGGCGCAAACAGUAAAAAAAGAGACAUCCUGUGUCUCUUUUUUU 46.4% 4% CCUAAAUUGCAAUGAGUGCGGAUCAUCUCUGUCUGUGCUGAUGGUAAUUUAGGUUUU licT+154% 4012712% 4% 76.30% 69.39% 6.91% 8.07E401% UAUUU 422.8% 1x1% 4015946% 4% deaD+41nt% 99.68% 83.17% 16.51% 9.20E404% AAUAAAUGAUGAAUGACCUGCUCCCAGUUAAAGGGGCAGGUCAUUUUGCU 420.5% 4% 4015989% +% yxiO+21nt% 84.26% 65.74% 18.52% 1.60E402% GCCAGCAGCAAAAUGACCUGCCCCUUUAACUGGGAGCAGGUCAUUCAUCA 419.4% 0x1% 4018776% 4% yxzI+10nt% 6.46% 10.38% 43.92% 7.30E401% AGGUUGGGAUGUGAUCAAGUGUGACAAGAAGUCACACUGAUUUUCCCCUU 411.4% 1x0% 4022822% 4% yxxG+232nt% 63.53% 59.25% 4.28% 2.48E401% UAAGCAGUUGAAGAUAAAGCUUGUAUCGAUAAGCGAUACAAGCUUUUUUA 413.6% 4% 4030676% 4% yxxF+34nt% 99.76% 97.02% 2.74% 4.16E402% UGAACAAAUACAAUAAAAAAUGUAAAAAGGCCUAUGCGGCCUUUUUUUGU 45.8% 4% 4031761% 4% yxiE+36nt% 98.79% 99.45% 40.66% 4.19E401% UGAUUGUUCGAUAGAUUUGUAAAAAAAGCGCCCUUGGGCGCUUUUUUUUA 49.8% 4% CCUAAAUGGUGCAGGUGCAGGAGGAGACUCUCGCAAUCUGUGUCAUUUAGGUUUUUU yxxE+284% 4035706% 4% 95.73% 87.24% 8.49% 1.45E403% UAU 430.9% 1x1,%0x1% 4035944% 4% yxxE+46nt% 93.16% 67.96% 25.20% 1.74E402% GUAACGAUUCAUAACCUUGAUUGGAAAAAAUGCCUUUCAAGGUUUUUAAU 49.7% 2x2% 4042011% +% hutP+73nt% 98.40% 80.00% 18.40% 8.00E403% UAGGGGGCUAUGCGUGAAAACAGAAGUUCACAGCAUAGCUCCUUUUUGUA 421.2% 0x1% 4048966% 4% pdp+43nt% 98.91% 98.52% 0.39% 5.47E401% AGAAUAAAAAAUAAAGCACAUCCCAUGCUGAGCGGGGUGUGCUUUUUUAA 414.2% 2x0% 4051567% 4% deoC+35nt% 33.27% 24.37% 8.90% 3.91E402% GGAGACAACUAUUAAGAGCUGACGGAAGGCAGACUGCUUUCCGUUUUCUG 411% 4% 4054197% 4% yxeR+157nt% 72.28% 28.93% 43.35% 2.88E405% ACAGGAAACCAAGCCUUGGAUCAAACGAUUCGGGAGGCUUGGUUAUUUUG 417.4% 0x2% 4063648% 4% yxeH+36nt% 99.14% 99.16% 40.02% 9.23E401% UUUUGGCUAAAUAAUAAAAAAUCCAGCCUUCUAAAGGCUGGAUUUUUUCG 412.9% 4% 4065972% 4% yxeC+635nt% 4.22% 0.98% 3.24% 5.38E401% UGCGGAAAACGAAACCCUGAGAUGGGAGAAUCGUAUUCCGCUUUUUUUCU 417.2% 2x4,%1x1% 4066566% 4% yxeC+41nt% 97.20% 72.37% 24.83% 3.63E402% GAACAGUAAGAAAAAAAGCUCAACACUCGCAUUGUGUUGAGCUUUUUAUA 413.5% 4% 4068185% +% yxeB+37nt% 97.34% 87.52% 9.82% 1.20E406% AAAUAAAAAAUAAAAAAACGGCACAGUCAUGACGCUGUGCCGUUUUUUAU 414.8% 4% 4086580% +% iolS+40nt% 100.00% 98.98% 1.02% 3.40E401% GUUCGCAUAAGAAGAAAACAGCCUUCUCCAAUGGAGAAGGCUGUUUUUUU 418.4% 4% 4087811% +% yxcD+47nt% 99.63% 97.73% 1.90% 9.90E402% UAAAAAUGUCUUAAUCAAACCUUACUCCGCGCGGGUAAGGUUUUUUUAAU 48.7% 4% 4089390% 4% htpG+39nt% 79.28% 79.25% 0.03% 7.17E401% UCAUGGUGUAAACAGAAAAAGGAAUCGUCUCAUAAGGAGACGAUUCCUUU 49.2% 4% 4091459% 4% yxcA+18nt% 78.70% 61.56% 17.14% 8.34E402% GUUGGAAUGACACAGAAAAAAAGAGAGGAUGAUGAAGCCUCUCUUUUUUA 47.2% 4%

! 129! 4095857% 4% yxbC+58nt% 42.70% 45.58% 42.88% 5.86E401% AGAUAAGGGGAUUAAUGACAUAAAAUAGGUUGUUAAUUCUCUUAUUUUUG 410.3% 4% 4102380% 4% yxaL+49nt% 97.61% 74.49% 23.12% 1.20E403% ACUGAAUAGAAUAGCAGAAGACCUUCUUUUAAUAAGAAGGUCUUCUUACU 411.5% 4% 4104942% +% yxaI+43nt% 94.48% 88.37% 6.11% 9.40E404% UAAAUAAUAGAAAAAAGUCUAGACGCCAAUAGGCAUCUAGACUUUUGUUU 414% 1x1% 4107334% 4% yxaF+18% 94.12% 96.10% 41.98% 9.57E401% AAAUACCAGUGCUGGUGAGAAAAAAAGGGUAGCAUUUUGUUAUCCUUUCU 46.5% 4% 4118532% +% gntZ+46nt% 99.11% 97.60% 1.51% 8.00E402% AUAACCUGUAUUAAAAACACGGUCAGUUUCAACUGAACCGUGUUUUUUUC 411.9% 0x1% 4121106% +% ahpF+50nt% 99.89% 99.91% 40.02% 8.20E401% UAUAAGAAAUCCGCUAUAUUGCCAGAUUGGCAGGAUAGCGGAUUUUUCUU 419.4% 1x1% 4124184% 4% yydJ+36nt% 96.82% 85.82% 11.00% 1.73E403% AAAUGGGCCUUUAAUAAAGGGAGCUACUUCACAAUGAAGUAGCUUUUUAU 410.3% 4% 4124220% +% yyzN+131nt% 77.67% 72.82% 4.85% 6.30E401% UAUAUAGGUGCACAUAAAAAGCUACUUCAUUGUGAAGUAGCUCCCUUUAU 410.3% 4% 4127457% 4% yydF+41nt% 87.20% 86.16% 1.04% 9.99E401% GGUCAUUAAUUAGAGGGGUACAAAGGAGAGUCUAACUCUCCUUUACCAUU 48.3% 4% 4130386% +% fbp+342nt% 72.93% 85.58% 412.65% 1.70E402% CAAAAAAAGUCCAUUCUAUAUAACUCUCGCUAGGGUGGACCUUUUUCAAC 410.4% 0x1% 4130531% 4% yydD+47nt% 90.72% 83.17% 7.55% 2.97E401% UGACCAAAUAAUAUUAAACUAGGGAGUUCUUAUAGAACUUCCUUUUAACC 49.6% 4% 4141476% 4% argI+235nt% 94.00% 99.37% 45.37% 1.67E401% UUAGGAUUCUUUCGUUAAAUUGAACCCCCGCAUCCCGCGGGGGUUUUUCA 414.9% 4% 4141511% 4% argI+200% 21.89% 7.54% 14.35% 4.19E403% GAAAAGAUGAAAGAAUCCUAAAACUACAAACCGUUUUAGGAUUCUUUCGU 49.3% 4% 4141554% +% phrG+80nt% 60.52% 30.39% 30.13% 5.10E408% AAUUUAACGAAAGAAUCCUAAAACGGUUUGUAGUUUUAGGAUUCUUUCAU 410.1% 4% 4141676% 4% argI+35nt% 74.62% 16.96% 57.66% 1.39E410% AAGAAGCUGCUGUAAUAAGAAAACCCCCGCACCCGCGGGGGUUUCAGCGU 414.9% 4% 4141710% +% phrG+236nt% 87.65% 83.91% 3.74% 2.00E401% CGAGGGUUUGUCGACACGCUGAAACCCCCGCGGGUGCGGGGGUUUUCUUA 414.5% 4% 4147530% 4% htrC+37nt% 95.65% 50.24% 45.41% 7.57E406% AUUAGGCAGUUAAUAAAAGCAGUCUGGCAUCGUUGCCAGGCUGUUUUGAU 416.7% 4% 4154747% 4% trnY4Phe+40nt% 98.26% 96.00% 2.26% 1.90E404% UCCCGAGCCACUUACCAAACGCAUCUGCAAUCGUAGGUGCGUUUUUUCUU 412.3% 4% 4155391% 4% purA+42nt% 99.95% 96.74% 3.21% 1.17E404% CGAACUAAAUAGAAUAUGUCUGCAAGCCCCUAUUUAAGGGGCUUGUUUUU 410.3% 4% 4157441% 4% dnaC+30nt% 98.79% 93.09% 5.70% 8.08E403% GCGUUCCGCCCGGCGCAUAAGCCCCAAGAGCUGCUCUUGGGGUUUUUUUC 413.8% 4% 4158761% 4% in%dnaC%CDS% 5.07% 3.22% 1.85% 6.18E401% UUCCUCCGCAAAAUAUAGAAGCCGAACAAGCCGUGUUAGGCGCUAUUUUU 46.7% 1x1,%2x1% 4161026% +% yycB+28nt% 90.92% 90.84% 0.08% 9.90E401% AAAACAAAGAAAUUCAGCAUAAAGCGGGGAAGAUAUCUCCGCUUUUUUCU 49.8% 4% 4163159% 4% rplI+38nt% 97.67% 98.48% 40.81% 2.91E401% GAAGAAGCUUAAUAGAAAAGAGGCUUGGAUUCAUCCAAGCCUCUUUUUUU 416.7% 4% 4163196% +% yycA+36nt% 96.95% 96.84% 0.11% 5.90E401% AUCUCGUGGAAUAAAAAAAGAGGCUUGGAUGAAUCCAAGCCUCUUUUCUA 416.7% 4% 4166620% 4% yyzH+195nt% 41.80% 12.69% 29.11% 4.67E402% AUGUUGCAGCGAUGAACAAAAGAGCAGUCGUUUAUGCUGCUCUUUUCUAU 48.7% 4% 4169168% +% ppaC+35nt% 98.21% 97.49% 0.72% 1.80E401% GCAAUGGCUGAAUAAGCAAAAAGCAUCCCGCGUCGGGAUGCUUUUUCUUA 412.3% 4% 4169800% 4% yyzI+1596nt% 88.71% 69.30% 19.41% 1.36E403% CAUUGUUAGCGAGACCUUUGCCAAAUCUGAUUUGGUGAAGGUCUUUUUGU 416.9% 4% 4173637% +% yybN+86nt% 91.84% 75.45% 16.39% 3.80E407% ACGCGAAAAAAUUUAGAAUGAUAAUCUUUUUAUAAGAUUAUCAUUUUUAU 49% 4% 4176887% +% yybJ+362nt% 86.57% 47.41% 39.16% 1.40E405% GAAUUAAACUGGAAUAAAGAGUGCUUGCUGAAAAGCACUCUUUUUCUGCA 411.2% 4% 4179127% 4% yybF+36nt% 88.91% 69.51% 19.40% 3.12E403% AAGGAUUGAAUUGAUCAGUAAAAAAGGACCGUUAGCGGGUCCUUUUUUAU 46.9% 4% 4179160% +% yybG+30nt% 84.69% 84.32% 0.37% 9.30E401% CCCCUGCCCAUUGGAAAUAAAAAAGGACCCGCUAACGGUCCUUUUUUACU 46.2% 1x0% 4182462% 4% yybB+174nt% 76.13% 76.80% 40.67% 8.11E401% AUUCGAUUCAUGAGCAAAAGGAGUGAGUGUCAGGCUCACUCCUUUUCUAU 413.8% 4% 4187629% 4% tetB+52nt% 49.61% 38.06% 11.55% 1.39E401% GAGUGAAAGGAUCAAUCUUGUGAAAGUAAUUCAAGGUUGAUCCUUUUUUG 415.1% 4% 4193246% 4% yyaK+18nt% 89.98% 61.29% 28.69% 9.36E406% AGAAAUCAAAAAGUAAGCAGCAAGGGUCUUAAUCCCUGCUGCUUAUUAAU 413.6% 1x0% 4193288% +% yyaL+21nt% 97.18% 87.34% 9.84% 6.60E402% UCCACACAUUAAUAAGCAGCAGGGAUUAAGACCCUUGCUGCUUACUUUUU 415% 4% 4198559% 4% rpsR+44nt% 95.54% 96.16% 40.62% 5.06E402% GAGUAAGCUGAUAUGUAAAGAGCAAGGACCUUCGGGUUCUUGCUCUUUUU 420.5% 4% 4203099% 4% yyzM+25% 74.40% 14.04% 60.36% 8.05E406% CAAGCAUGAGGAGCCUACUUCAUAAAUAGGCCGACACUCAUGCUUUUUCA 414.4% 2x5% 4205517% 4% parB+39nt% 70.76% 53.87% 16.89% 1.71E401% GAGAAUCAUAAAUGAAAAAACCAUCUUUCAAACGAAGAUGGUUUUUAUUU 47.7% 4% 4207866% 4% noc+31nt% 96.43% 94.87% 1.56% 4.19E401% GAUUCGCAUACCAAAAUAGAAGCUCUCCUGAAAAGCAGGAGAGCUUUUUA 415.6% 4% 4213157% 4% jag+43nt% 98.85% 99.41% 40.56% 3.89E401% AAGAUAGCAUAAAACCGAAGUCCGAUAAAAAUUGGAUUUCGGUUUUUUUG 415.4% 4% 4215226% 4% rpmH+29nt% 76.36% 79.66% 43.30% 3.42E402% AGAAAAGUAUUAUCAGCUUAGGCCACUGAAUAAUGUCAGUGGUCUUUUUU 413.1% 4%

! 130! Table 5. Genes that are differentially expressed twofold or more upon NusA depletion

Genes% +NusA% –NusA% Change% p0adj% Genes% +NusA% –NusA% Change% p0adj% abrB% 634.5& 1462.4& 1.2& 5.75E+03& ctaC% 532.2& 1501.0& 1.5& 1.22E+16& acoA% 10.2& 27.7& 1.4& 5.28E+04& ctaD% 899.1& 3131.0& 1.8& 2.12E+24& acpK% 46.5& 11.5& +2.0& 2.51E+07& ctaE% 410.0& 1316.0& 1.7& 2.88E+20& adcB% 245.7& 834.7& 1.8& 2.21E+21& ctaF% 189.3& 597.3& 1.7& 3.98E+18& adcC% 154.5& 515.9& 1.7& 2.10E+16& ctaG% 398.2& 1652.8& 2.1& 9.52E+30& ahrC*% 324.4& 1414.1& 2.1& 1.47E+31& cwlC% 107.9& 243.9& 1.2& 3.51E+08& alrB% 50.4& 22.8& +1.1& 2.07E+03& cwlD*% 63.1& 140.3& 1.2& 2.05E+06& amhX% 166.0& 425.3& 1.4& 1.34E+11& cwlJ% 223.2& 40.2& +2.5& 2.01E+13& appB% 1163.4& 2726.0& 1.2& 3.98E+12& cypA% 70.5& 427.5& 2.6& 1.99E+36& appC% 1153.8& 2653.5& 1.2& 1.30E+11& cypB% 869.8& 2206.6& 1.3& 8.12E+14& araQ% 29.4& 13.7& +1.1& 7.95E+03& cysK% 12154.8& 6031.5& +1.0& 1.47E+08& argI% 1637.6& 4731.2& 1.5& 4.94E+06& cysL% 726.6& 342.4& +1.1& 8.77E+09& asnH% 1531.2& 654.8& +1.2& 2.32E+06& dapL% 1880.4& 9528.4& 2.3& 5.06E+40& aspS% 7982.4& 2911.1& +1.5& 1.41E+16& degQ% 33.7& 71.3& 1.1& 4.25E+02& bcsA% 78.9& 202.9& 1.4& 3.98E+10& des% 281.1& 572.3& 1.0& 1.14E+05& bdbA% 837.7& 218.9& +1.9& 2.96E+05& dfrA% 635.3& 1343.7& 1.1& 2.00E+09& bdbB% 1891.2& 534.7& +1.8& 3.33E+13& dinF*% 290.4& 2141.3& 2.9& 3.23E+54& bglA% 177.3& 566.5& 1.7& 2.42E+18& divIB*% 441.7& 1219.9& 1.5& 1.08E+07& bglC% 1187.5& 487.6& +1.3& 1.01E+04& dnaB*% 590.2& 2651.3& 2.2& 1.14E+30& bhlA% 24.0& 49.4& 1.0& 1.80E+02& dnaD*% 757.4& 4906.0& 2.7& 3.56E+50& blyA% 167.2& 355.1& 1.1& 5.97E+04& dnaI*% 611.2& 2464.7& 2.0& 1.01E+29& bofA% 45.1& 100.6& 1.2& 6.37E+06& eag*% 128.0& 455.1& 1.8& 8.37E+21& BSU_misc_RNA_17% 3659.4& 8359.1& 1.2& 1.95E+03& epsA% 107.7& 41.6& +1.4& 1.53E+07& BSU_misc_RNA_21% 932.9& 1959.0& 1.1& 1.61E+03& epsB% 121.0& 36.4& +1.7& 1.32E+06& BSU_misc_RNA_35% 201600.0& 77250.7& +1.4& 3.97E+11& epsG% 90.5& 38.0& +1.3& 8.08E+07& BSU_misc_RNA_45% 11254.3& 4147.9& +1.4& 5.90E+06& epsH% 65.1& 22.4& +1.5& 3.82E+07& BSU_misc_RNA_51% 838.0& 316.6& +1.4& 5.39E+13& epsJ% 105.1& 34.6& +1.6& 4.77E+10& BSU_misc_RNA_52% 330.8& 161.8& +1.0& 3.56E+03& epsK% 111.3& 43.2& +1.4& 1.01E+08& BSU_tRNA_1% 1162.9& 2594.9& 1.2& 1.04E+02& epsL% 66.0& 18.3& +1.8& 3.80E+09& catD% 62.1& 194.7& 1.6& 5.98E+14& epsM% 77.7& 35.8& +1.1& 4.74E+05& catE% 253.5& 743.6& 1.6& 1.04E+16& exoAA% 126.3& 930.8& 2.9& 1.40E+50& cbiO% 1039.3& 2475.4& 1.3& 1.66E+12& exuT% 57.7& 25.0& +1.2& 2.30E+04& cbiO% 923.9& 2120.2& 1.2& 2.31E+11& fabG% 1826.5& 775.3& +1.2& 9.09E+12& ccdA% 127.7& 421.4& 1.7& 3.51E+18& fabG*% 137.5& 538.8& 2.0& 1.64E+24& cdsA% 1504.4& 3118.8& 1.1& 3.92E+09& feuA% 9041.7& 4328.5& +1.1& 5.04E+09& cinA% 2042.2& 4399.5& 1.1& 4.12E+10& fmnP% 617.2& 1295.3& 1.1& 4.82E+09& clpE% 874.3& 2010.9& 1.2& 1.59E+11& fni*% 4516.1& 9055.7& 1.0& 1.53E+08& coaBC*% 579.6& 2029.5& 1.8& 5.42E+24& folE% 2356.8& 7885.1& 1.7& 3.39E+23& coiA% 108.0& 42.9& +1.3& 8.93E+08& frlB% 115.7& 2653.1& 4.5& 1.71E+112& comC% 260.2& 26.6& +3.3& 8.29E+17& frlM% 13.4& 130.5& 3.3& 7.50E+33& comEA% 150.4& 16.0& +3.2& 7.38E+17& frlN% 21.0& 237.5& 3.5& 6.87E+42& comER% 182.1& 35.4& +2.4& 1.51E+14& frlO% 46.0& 694.0& 3.9& 6.98E+77& comFA% 962.2& 243.9& +2.0& 3.12E+13& ftsW% 1646.2& 3448.7& 1.1& 1.65E+09& comFB% 228.8& 111.6& +1.0& 1.72E+06& ftsY*% 1627.9& 6598.7& 2.0& 1.43E+30& comGA% 1354.6& 37.3& +5.2& 1.63E+27& garD% 139.2& 303.3& 1.1& 1.77E+08& comGB% 803.5& 25.5& +5.0& 6.77E+19& gcp*% 548.5& 5086.8& 3.2& 2.07E+68& comGC% 248.9& 6.6& +5.2& 1.33E+16& gcvPA% 2704.2& 655.7& +2.0& 2.53E+29& comGD% 308.1& 6.8& +5.5& 1.91E+18& gcvPB% 3650.6& 965.5& +1.9& 8.33E+27& comGE% 299.2& 6.5& +5.5& 3.90E+46& gcvT% 1954.0& 500.6& +2.0& 7.17E+27& comGF% 295.1& 8.5& +5.1& 2.04E+14& gerE% 190.1& 384.7& 1.0& 4.08E+07& comGG% 288.3& 8.0& +5.2& 1.68E+20& ggaA*% 417.3& 998.4& 1.3& 4.70E+03& comK% 1175.1& 467.3& +1.3& 3.17E+13& ggaB*% 2160.1& 5304.6& 1.3& 1.28E+05& cotB% 44.5& 21.2& +1.1& 1.22E+03& gid% 1257.9& 2726.8& 1.1& 3.78E+10& cotC*% 14.0& 76.5& 2.4& 3.51E+08& glcD% 403.9& 947.0& 1.2& 1.27E+11& crh% 713.5& 1619.9& 1.2& 2.40E+11& glgA% 74.3& 219.3& 1.6& 2.06E+13& csfB% 14.3& 52.0& 1.9& 2.44E+04& glgB% 48.7& 222.5& 2.2& 1.30E+22& csgA% 3.0& 10.8& 1.8& 1.28E+02& glgC% 35.8& 151.7& 2.1& 3.14E+18& cspD% 30442.5& 62088.7& 1.0& 5.11E+03& glgD% 33.0& 160.2& 2.3& 2.74E+20& csrA*% 389.5& 1543.0& 2.0& 2.57E+27& ! ! ! 131! Genes% +NusA% –NusA% Change% p0adj% Genes% +NusA% –NusA% Change% p0adj% glgP% 157.0& 413.3& 1.4& 6.27E+13& mtnX% 840.1& 5636.6& 2.7& 6.66E+53& glnM% 8.8& 20.9& 1.2& 1.22E+02& mtrB% 1385.4& 4110.5& 1.6& 1.87E+18& glpD% 276.6& 910.6& 1.7& 4.83E+21& murF*% 765.0& 2648.5& 1.8& 4.05E+24& glpF% 366.6& 810.2& 1.1& 9.03E+09& mutT% 14.6& 67.3& 2.2& 3.48E+09& glpT% 123.2& 252.3& 1.0& 8.08E+07& nap% 4073.2& 1915.3& +1.1& 1.27E+09& gmuA% 7.0& 17.8& 1.3& 8.79E+03& natA% 1016.5& 499.5& +1.0& 2.33E+08& gpr% 62.2& 160.2& 1.4& 3.79E+09& natB% 3214.0& 1576.6& +1.0& 1.11E+08& gsiB% 33.5& 83.5& 1.3& 1.43E+02& ndhF% 316.5& 83.5& +1.9& 3.82E+10& hag% 331991.5& 670143.4& 1.0& 1.76E+08& nhaX% 66.4& 178.2& 1.4& 6.44E+03& hemB*% 1145.4& 2641.3& 1.2& 9.64E+12& nth*% 816.6& 4811.7& 2.6& 2.30E+46& hemC*% 613.9& 1494.5& 1.3& 8.84E+13& nucA% 1752.2& 850.4& +1.0& 9.87E+09& hemD*% 546.9& 1334.8& 1.3& 8.52E+13& nusG*% 1820.1& 4612.8& 1.3& 3.81E+14& hemL*% 3357.0& 7326.5& 1.1& 1.04E+10& ohrA% 75.0& 413.5& 2.5& 1.41E+33& hemN*% 697.2& 1688.6& 1.3& 1.60E+12& ohrB% 50.6& 102.1& 1.0& 1.17E+02& hemX% 433.9& 940.6& 1.1& 1.27E+09& oxdC% 102.3& 226.3& 1.1& 9.18E+08& hisS% 3735.9& 1233.2& +1.6& 3.42E+19& padC% 36.5& 116.9& 1.7& 2.95E+09& hutG% 75.9& 171.1& 1.2& 1.44E+07& pbpB*% 3403.6& 6934.6& 1.0& 4.94E+09& hutH% 28.5& 94.7& 1.7& 8.99E+11& pbpG% 90.6& 653.1& 2.9& 8.95E+30& hutI% 76.2& 169.3& 1.2& 4.09E+07& pbpX% 396.9& 1511.0& 1.9& 5.65E+26& hutU% 62.8& 186.8& 1.6& 1.22E+12& pdaA% 91.7& 277.3& 1.6& 1.09E+14& hxlR% 194.7& 40.6& +2.3& 2.58E+22& pel% 24481.6& 8110.0& +1.6& 1.85E+19& ileS% 10676.2& 3565.5& +1.6& 5.26E+19& pepT% 3522.8& 1546.9& +1.2& 4.51E+11& ilvB% 9590.5& 1612.7& +2.6& 3.20E+23& pgsA% 582.8& 1370.2& 1.2& 4.56E+12& ilvC% 7454.1& 1402.9& +2.4& 1.20E+40& pheS% 1285.9& 626.8& +1.0& 6.87E+06& ilvD% 3333.5& 7061.9& 1.1& 1.34E+09& pheT% 4287.5& 2042.7& +1.1& 4.31E+09& ilvH% 2623.3& 433.1& +2.6& 3.62E+21& phrA% 777.4& 314.4& +1.3& 5.05E+12& infB% 6081.2& 57727.7& 3.2& 1.20E+71& phrH% 347.5& 136.3& +1.3& 2.17E+08& ispA% 84.1& 39.5& +1.1& 7.14E+03& phy% 60.1& 26.1& +1.2& 9.48E+05& ispF*% 167.2& 420.1& 1.3& 1.24E+11& pksD% 525.6& 213.3& +1.3& 5.06E+12& katA% 1802.4& 5511.8& 1.6& 5.92E+20& pksE% 760.1& 307.0& +1.3& 1.35E+09& kbl% 516.8& 221.9& +1.2& 2.03E+10& pksF% 208.1& 83.2& +1.3& 8.77E+10& ksgA% 753.6& 2283.8& 1.6& 4.55E+19& pksG% 175.8& 60.9& +1.5& 6.94E+12& leuA% 7010.8& 1545.8& +2.2& 3.12E+34& pksH% 110.1& 32.3& +1.8& 3.43E+12& leuB% 5046.7& 804.5& +2.6& 1.11E+47& pksI% 83.0& 30.4& +1.4& 9.40E+08& leuC% 7581.0& 1302.6& +2.5& 7.04E+45& pksJ% 1392.7& 530.3& +1.4& 6.98E+15& leuD% 2909.8& 477.1& +2.6& 2.90E+25& pksL% 3211.7& 1486.6& +1.1& 2.47E+04& levD% 491.0& 20.7& +4.6& 3.82E+19& pksM% 1377.1& 612.0& +1.2& 9.57E+11& levE% 620.4& 20.4& +4.9& 9.66E+28& polC*% 3843.6& 21798.8& 2.5& 1.98E+45& levF% 796.6& 30.4& +4.7& 2.74E+19& ppsA% 1722.7& 770.5& +1.2& 1.12E+10& levG% 907.7& 30.3& +4.9& 5.78E+21& ppsB% 1184.0& 520.6& +1.2& 9.37E+11& liaH% 276.4& 923.0& 1.7& 5.76E+06& ppsC% 1291.7& 552.3& +1.2& 1.62E+11& liaI% 129.6& 484.0& 1.9& 8.99E+08& ppsD% 1936.3& 909.8& +1.1& 9.97E+10& licC% 75.0& 37.0& +1.0& 1.42E+04& ppsE% 628.5& 300.6& +1.1& 1.27E+08& licR% 643.8& 280.0& +1.2& 2.00E+10& priA*% 1074.2& 3734.4& 1.8& 1.20E+24& ligD% 149.3& 332.6& 1.2& 8.87E+09& prmC*% 802.2& 1904.6& 1.2& 1.27E+12& lonB% 92.5& 470.3& 2.3& 6.28E+32& proA% 551.1& 261.3& +1.1& 2.81E+08& lysP*% 276.5& 2370.8& 3.1& 5.32E+62& proB% 318.1& 147.1& +1.1& 8.99E+08& maeN% 165.3& 477.7& 1.5& 2.82E+15& proI% 532.7& 1902.4& 1.8& 1.45E+24& mdxR% 22.5& 52.5& 1.2& 1.24E+03& pstBB% 33.5& 75.4& 1.2& 7.88E+05& menC*% 614.9& 2300.9& 1.9& 1.54E+26& pucK% 63.9& 31.3& +1.0& 1.05E+04& menE*% 941.3& 3010.9& 1.7& 2.24E+21& pucL% 116.2& 55.6& +1.1& 1.45E+05& mlpA*% 850.4& 7915.9& 3.2& 2.51E+69& qodI% 101.5& 265.0& 1.4& 2.62E+11& moaB*% 245.9& 1430.6& 2.5& 3.73E+43& radA*% 562.0& 1415.4& 1.3& 1.17E+13& mtnA% 330.4& 1482.2& 2.2& 2.88E+32& rapA% 8253.0& 3863.2& +1.1& 5.32E+10& mtnB% 951.6& 6447.4& 2.8& 4.74E+53& rapH% 3176.0& 945.2& +1.7& 1.79E+21& mtnD% 1120.7& 7695.0& 2.8& 9.42E+54& rbfA% 1387.8& 13858.8& 3.3& 1.81E+73& mtnK% 294.7& 1520.3& 2.4& 2.43E+26& rbfK% 15.0& 4.6& +1.7& 2.74E+03& mtnU% 753.7& 2067.4& 1.5& 3.28E+16& recG*% 1014.1& 2823.7& 1.5& 5.20E+17& mtnW% 1024.6& 7047.1& 2.8& 1.53E+52& recN*% 1627.6& 6958.4& 2.1& 7.05E+33& ! ! !

! 132! Genes% +NusA% –NusA% Change% p0adj% Genes% +NusA% –NusA% Change% p0adj% rimI*% 260.6& 2061.6& 3.0& 6.84E+58& tagG*% 815.8& 3346.4& 2.0& 2.68E+19& rimM% 1219.1& 5378.8& 2.1& 3.78E+34& tagH*% 3047.4& 12146.7& 2.0& 7.98E+30& rnmV% 331.8& 889.5& 1.4& 8.21E+12& tasA% 329.4& 94.4& +1.8& 1.15E+18& rocA% 1394.8& 6935.7& 2.3& 7.50E+08& tcyJ% 20.6& 8.5& +1.3& 5.81E+03& rocB% 163.7& 711.1& 2.1& 3.01E+03& tcyK% 39.4& 14.0& +1.5& 2.03E+05& rocC% 142.7& 579.4& 2.0& 8.75E+06& tcyP% 3208.5& 1121.0& +1.5& 1.58E+17& rocD% 342.9& 4556.6& 3.7& 7.12E+11& tdk% 607.8& 1690.2& 1.5& 2.69E+16& rocE% 1125.1& 4413.3& 2.0& 2.24E+06& tepA% 139.7& 310.7& 1.2& 9.03E+09& rpmE% 48963.8& 22031.2& +1.2& 4.14E+05& thiC% 34181.9& 17058.8& +1.0& 3.98E+08& rsbRD*% 57.2& 155.5& 1.4& 1.55E+02& thiL*% 685.8& 3907.8& 2.5& 2.28E+44& rtpA% 25.4& 9.0& +1.5& 8.22E+04& thiN*% 329.5& 1277.7& 2.0& 1.20E+26& sacB% 196.5& 27.1& +2.9& 2.92E+33& thiT% 3807.3& 941.4& +2.0& 1.11E+29& sacC% 1294.5& 122.7& +3.4& 1.41E+16& thiU% 7535.6& 3601.9& +1.1& 4.23E+09& sboX% 27.3& 10.3& +1.4& 4.74E+02& thiV% 6999.1& 3378.9& +1.1& 1.22E+08& sdaAA*% 928.5& 2100.1& 1.2& 2.65E+11& thiW% 20175.9& 9591.8& +1.1& 3.09E+09& sdaAB*% 530.9& 1251.2& 1.2& 8.76E+12& thiX% 9893.0& 4900.0& +1.0& 2.64E+08& sdpA% 1944.1& 607.8& +1.7& 1.47E+03& thrS% 4772.4& 1784.9& +1.4& 2.01E+15& sdpB% 2248.5& 706.8& +1.7& 3.06E+03& thrZ% 93.1& 268.5& 1.5& 7.65E+14& seaA% 60.6& 273.0& 2.2& 3.08E+24& thyA% 725.0& 1585.8& 1.1& 4.47E+10& senS% 11.5& 25.5& 1.1& 7.68E+03& tlp% 9.9& 51.3& 2.4& 1.02E+04& sigG% 240.0& 85.1& +1.5& 2.76E+12& tmk% 450.1& 966.5& 1.1& 1.75E+09& sipW% 52.1& 16.5& +1.7& 1.07E+07& trmD% 1783.7& 7656.8& 2.1& 2.57E+33& skfA% 1825.0& 781.5& +1.2& 7.42E+04& trpB% 3667.2& 1448.0& +1.3& 2.61E+05& skfB% 1010.5& 288.4& +1.8& 6.41E+07& trpC% 857.9& 378.0& +1.2& 6.24E+04& skfC% 934.3& 306.4& +1.6& 6.07E+06& trpD% 2190.6& 930.8& +1.2& 3.51E+05& skfE% 557.6& 214.3& +1.4& 1.95E+09& trpE% 3607.9& 1541.7& +1.2& 3.79E+04& skfF% 456.5& 211.0& +1.1& 2.13E+03& trpF% 386.6& 161.8& +1.3& 2.45E+05& skfG% 187.5& 79.3& +1.2& 2.10E+08& truA% 2957.6& 8534.0& 1.5& 2.76E+18& skfH% 180.3& 89.1& +1.0& 7.64E+05& truB% 536.7& 2243.5& 2.1& 2.16E+30& slrR% 16.8& 4.6& +1.9& 1.56E+03& trxB*% 1695.3& 7719.5& 2.2& 4.55E+35& smc*% 3474.7& 13760.5& 2.0& 2.82E+30& tyrS% 1911.8& 910.8& +1.1& 5.81E+09& spbC% 16288.7& 7261.5& +1.2& 3.12E+02& uppS% 1781.3& 3731.8& 1.1& 2.63E+09& splA% 85.9& 176.3& 1.0& 5.44E+06& uvrA% 4148.5& 9399.8& 1.2& 1.05E+11& spoIIB% 85.9& 31.5& +1.4& 1.01E+07& uvrB% 1584.4& 3178.1& 1.0& 1.80E+08& spoIID% 92.1& 241.3& 1.4& 8.51E+11& uvrX% 39.1& 107.3& 1.5& 8.53E+09& spoIIP% 57.6& 172.3& 1.6& 3.72E+12& valS% 4035.8& 1431.1& +1.5& 6.03E+17& spoIIR*% 28.5& 114.3& 2.0& 4.67E+15& vmlR*% 931.5& 2853.4& 1.6& 7.23E+20& spoIVA% 217.8& 444.1& 1.0& 1.21E+07& walH% 802.0& 1667.7& 1.1& 8.06E+09& spoIVB% 25.9& 156.8& 2.6& 1.35E+25& whiA% 1874.8& 4288.7& 1.2& 7.88E+12& spoIVFA% 43.5& 104.2& 1.3& 9.08E+07& xkdA*% 145.0& 799.3& 2.5& 3.62E+37& spoVD% 101.7& 249.6& 1.3& 3.39E+10& xkdO% 1263.1& 626.6& +1.0& 1.11E+07& spoVID% 55.8& 231.5& 2.1& 3.93E+21& xkdP% 219.5& 100.2& +1.1& 6.66E+07& spoVIF*% 3.6& 12.6& 1.8& 3.81E+02& xkdT% 264.7& 121.6& +1.1& 9.30E+08& spoVK*% 61.0& 283.2& 2.2& 1.33E+25& xkdU% 187.0& 90.4& +1.0& 4.51E+06& spoVM*% 39.6& 175.6& 2.1& 6.70E+20& xkdV% 504.4& 215.6& +1.2& 1.11E+09& srfAA% 387244.7& 151650.4& +1.4& 2.99E+14& xkdW% 120.9& 53.5& +1.2& 1.04E+05& srfAB% 140894.9& 52026.1& +1.4& 6.08E+16& xkdX% 52.2& 21.7& +1.3& 2.26E+04& srfAC% 192282.9& 70969.7& +1.4& 5.14E+16& xkzA% 87.1& 37.9& +1.2& 5.64E+06& srfAD% 58144.6& 22938.2& +1.3& 3.48E+14& yaaH% 75.4& 163.2& 1.1& 7.20E+07& ssbB% 2416.6& 303.0& +3.0& 1.95E+17& yaaO% 887.4& 1886.7& 1.1& 1.42E+09& sspB% 34.2& 85.1& 1.3& 4.18E+06& yabB*% 433.6& 1735.7& 2.0& 1.46E+28& sspF% 81.0& 187.6& 1.2& 2.99E+06& yabC*% 742.9& 2794.7& 1.9& 7.47E+27& sspG% 45.4& 124.1& 1.5& 5.27E+09& yabD*% 448.3& 1708.4& 1.9& 1.38E+26& sspK% 11.3& 36.0& 1.7& 1.81E+05& yabG% 39.6& 185.2& 2.2& 8.15E+20& sspN% 3.8& 44.6& 3.6& 4.17E+17& yacK*% 351.0& 861.5& 1.3& 1.94E+12& sunT% 5911.6& 1851.9& +1.7& 1.87E+07& yazA*% 203.5& 729.2& 1.8& 5.71E+23& tagB% 727.5& 1627.2& 1.2& 5.15E+06& ybaF% 940.0& 2414.0& 1.4& 9.92E+15& tagE*% 1858.6& 6019.1& 1.7& 5.56E+09& ybaK*% 17.5& 71.3& 2.0& 1.29E+06& tagF*% 3355.0& 10467.3& 1.6& 1.57E+08& ybbE% 87.8& 43.2& +1.0& 1.98E+04& ! ! ! ! 133! !

Genes% +NusA% –NusA% Change% p0adj% Genes% +NusA% –NusA% Change% p0adj% ybcC% 779.2& 185.2& +2.1& 2.84E+09& yfhO*% 740.3& 1731.1& 1.2& 7.68E+12& ybcF% 208.4& 44.1& +2.2& 1.33E+04& yfiL% 18.5& 38.6& 1.1& 1.67E+03& ybcH% 80.0& 19.2& +2.1& 1.29E+02& yfiN% 102.5& 272.5& 1.4& 1.61E+11& ybcI% 214.0& 64.6& +1.7& 1.99E+03& yfkL% 765.6& 1715.4& 1.2& 1.15E+10& ybdN% 2983.7& 1103.8& +1.4& 6.63E+07& yflA*% 126.5& 328.3& 1.4& 4.27E+10& ybfI% 292.3& 125.3& +1.2& 3.10E+09& yflE% 6604.4& 13736.2& 1.1& 2.95E+09& ybxB% 669.2& 1882.4& 1.5& 1.25E+16& yflS*% 502.9& 2409.4& 2.3& 4.25E+36& ybxH% 5.0& 16.0& 1.7& 2.86E+03& yfmD*% 1328.9& 5542.1& 2.1& 1.31E+31& ycbC% 36.6& 91.1& 1.3& 3.39E+07& yfmE*% 1746.8& 5743.8& 1.7& 5.34E+23& ycbD% 60.6& 176.3& 1.5& 1.31E+07& yfmF*% 2411.1& 6026.6& 1.3& 4.13E+14& ycbP% 241.5& 85.1& +1.5& 7.71E+09& yfmG% 3623.0& 1617.4& +1.2& 2.35E+04& ycbR% 279.5& 115.9& +1.3& 1.13E+09& yfmI% 302.5& 121.9& +1.3& 1.72E+04& ycdA% 3513.4& 1431.7& +1.3& 4.66E+10& yfmN% 1.4& 7.7& 2.5& 6.17E+03& yceG*% 2924.0& 6704.7& 1.2& 8.16E+12& yfmO*% 127.3& 951.2& 2.9& 1.66E+47& yceH*% 2517.7& 5919.2& 1.2& 1.81E+12& yfnH% 13.7& 27.9& 1.0& 1.09E+02& yceJ% 163.1& 818.8& 2.3& 3.69E+34& yfzA% 124.0& 56.1& +1.1& 1.86E+03& ycgM% 8578.7& 23625.8& 1.5& 3.97E+17& ygaD*% 987.1& 2970.2& 1.6& 1.72E+19& ycgN% 20959.0& 54745.0& 1.4& 1.21E+15& yhaH% 751.3& 1611.2& 1.1& 1.40E+09& ycgO% 11626.2& 40085.1& 1.8& 8.13E+25& yhaL% 17.4& 56.0& 1.7& 3.01E+04& ycgP% 910.4& 4136.4& 2.2& 1.36E+34& yhaX*% 274.8& 1409.1& 2.4& 6.12E+38& yckA% 1155.9& 356.8& +1.7& 3.32E+20& yhbA*% 231.1& 1551.8& 2.7& 2.43E+49& yckB% 1526.8& 403.1& +1.9& 2.74E+24& yhbB% 57.1& 914.1& 4.0& 3.33E+84& yckD% 125.3& 24.9& +2.3& 8.61E+08& yhcQ% 48.2& 20.2& +1.3& 7.01E+05& ydaB% 279.1& 722.9& 1.4& 2.61E+13& yhdB% 40.1& 104.7& 1.4& 6.62E+08& ydaL% 86.5& 274.0& 1.7& 7.20E+16& yhdC*% 82.1& 224.8& 1.5& 4.05E+11& ydaM% 56.6& 156.8& 1.5& 1.34E+10& yhdZ% 558.0& 1169.1& 1.1& 9.68E+09& ydaN% 199.8& 452.6& 1.2& 1.42E+09& yheF% 6.4& 66.4& 3.4& 2.43E+22& ydaO*% 493.1& 1347.1& 1.5& 8.11E+16& yhfH% 19.2& 42.9& 1.2& 5.72E+04& ydaP% 202.8& 684.5& 1.8& 6.64E+21& yhfM% 37.4& 13.2& +1.5& 1.05E+04& ydbN% 3382.5& 1250.2& +1.4& 7.57E+04& yhfS% 4512.1& 2228.8& +1.0& 2.01E+08& ydcO% 32.2& 14.1& +1.2& 1.95E+02& yhxC% 89.6& 219.2& 1.3& 1.70E+09& ydcQ% 48.0& 21.1& +1.2& 1.23E+04& yhxD% 565.2& 249.8& +1.2& 9.32E+10& ydcR% 40.0& 15.5& +1.4& 9.73E+05& yhzB% 348.1& 1290.4& 1.9& 9.14E+25& ydcT% 9.2& 3.1& +1.6& 4.02E+02& yhzF% 101.9& 421.1& 2.0& 1.42E+24& ydeA*% 44.5& 325.7& 2.9& 8.88E+15& yisS% 92.1& 224.6& 1.3& 1.37E+09& ydeD% 120.9& 57.9& +1.1& 2.76E+05& yitC% 18.5& 9.2& +1.0& 2.29E+02& ydeR% 53.5& 157.8& 1.6& 2.33E+11& yitF*% 62.2& 317.3& 2.4& 1.18E+28& ydfN% 10.2& 34.9& 1.8& 3.23E+06& yitG*% 51.0& 309.3& 2.6& 2.57E+33& ydfO% 23.2& 81.1& 1.8& 6.71E+11& yitJ% 419.5& 1818.4& 2.1& 2.25E+31& ydhF% 25.4& 51.5& 1.0& 1.24E+03& yjbA% 94.2& 754.0& 3.0& 7.37E+52& ydiB*% 334.9& 2006.9& 2.6& 9.50E+45& yjbE% 126.0& 531.8& 2.1& 4.72E+26& ydiC*% 409.9& 2974.2& 2.9& 3.45E+55& yjcI% 805.9& 2195.7& 1.4& 5.63E+16& ydiM% 68.2& 235.4& 1.8& 5.85E+17& yjcJ% 1059.6& 2838.8& 1.4& 5.82E+16& ydjJ% 75.8& 222.2& 1.6& 6.23E+13& yjcO% 88.6& 472.8& 2.4& 2.62E+33& ydjN*% 599.1& 3813.9& 2.7& 1.75E+48& yjeA% 942.3& 304.8& +1.6& 1.06E+07& ydzU% 32.0& 125.4& 2.0& 1.58E+14& yjgB% 14.7& 6.5& +1.2& 2.01E+02& yebD% 138.7& 41.3& +1.7& 1.24E+02& yjkA% 307.4& 698.4& 1.2& 2.67E+10& yecA% 110.3& 1389.1& 3.7& 2.29E+77& yjkB% 250.2& 543.9& 1.1& 4.39E+09& yeeA% 326.4& 1057.2& 1.7& 2.35E+09& yjnA% 308.0& 119.6& +1.4& 2.23E+11& yeeB% 396.5& 837.2& 1.1& 9.66E+03& yjoA% 1246.4& 492.7& +1.3& 9.51E+07& yeeF% 1320.0& 574.0& +1.2& 5.07E+11& yjzC% 39.3& 191.2& 2.3& 2.59E+18& yeeG% 22.2& 9.3& +1.3& 5.56E+03& yjzF% 13.7& 100.0& 2.9& 6.56E+15& yeeK% 37.9& 86.3& 1.2& 8.07E+06& yjzG% 32.0& 151.1& 2.2& 7.40E+16& yefA% 981.0& 2950.0& 1.6& 3.06E+19& ykcC% 60.8& 174.7& 1.5& 2.50E+11& yefB% 94.1& 275.9& 1.6& 3.00E+05& ykkC% 55.9& 117.5& 1.1& 1.27E+05& yefC% 42.2& 152.5& 1.9& 2.39E+15& ykoV% 59.4& 141.4& 1.3& 1.44E+07& yetK*% 834.7& 2924.1& 1.8& 4.63E+24& ykpB*% 708.3& 2140.5& 1.6& 4.09E+19& yezC% 279.8& 684.7& 1.3& 3.98E+12& ykrV% 884.9& 2682.8& 1.6& 2.21E+19& yezF% 5.3& 36.0& 2.8& 9.08E+11& yktD% 426.9& 924.6& 1.1& 3.17E+09& ! ! ! 134! ! ! Genes% +NusA% –NusA% Change% p0adj% Genes% +NusA% –NusA% Change% p0adj% ykuL*% 213.7& 765.1& 1.8& 2.15E+22& yozL% 4.7& 27.0& 2.5& 1.04E+07& ykuS% 496.6& 2596.2& 2.4& 3.19E+29& yozP% 14.0& 34.2& 1.3& 6.07E+04& ykuT% 205.3& 1372.2& 2.7& 1.95E+48& yozQ% 48.3& 135.0& 1.5& 2.69E+04& ykvT*% 25.2& 83.6& 1.7& 1.16E+08& yozY% 195.6& 70.9& +1.5& 5.96E+03& ykvZ*% 154.7& 524.3& 1.8& 5.69E+20& ypbG*% 126.6& 423.6& 1.7& 1.14E+18& ykzD*% 12.1& 42.8& 1.8& 3.22E+07& ypbQ% 38.1& 77.3& 1.0& 2.28E+04& ykzE% 5.1& 20.2& 2.0& 1.06E+04& ypbR% 1170.9& 3696.1& 1.7& 3.93E+21& ykzN% 6.2& 17.0& 1.4& 5.52E+03& yphA% 32.6& 168.2& 2.4& 2.44E+12& ykzP% 4.1& 14.4& 1.8& 2.97E+03& ypiA% 1390.4& 3193.0& 1.2& 9.24E+12& ylbD% 47.8& 111.5& 1.2& 8.92E+07& ypiF% 92.5& 531.0& 2.5& 6.20E+20& ylbE% 15.5& 55.0& 1.8& 8.80E+09& ypiP*% 343.9& 1866.4& 2.4& 1.78E+40& ylqD% 929.4& 3122.3& 1.7& 2.32E+23& ypjA% 219.9& 709.3& 1.7& 2.53E+16& ylxP% 990.5& 9406.9& 3.2& 1.40E+70& ypjB% 619.0& 1558.1& 1.3& 2.36E+13& ylxQ% 674.6& 6151.4& 3.2& 7.19E+68& ypkP% 1313.9& 2782.9& 1.1& 1.47E+09& ylxR% 637.9& 5079.8& 3.0& 2.93E+48& ypoC*% 753.1& 5490.6& 2.9& 3.38E+56& ylxS% 961.6& 8315.0& 3.1& 1.08E+65& ypsC*% 1665.2& 13075.0& 3.0& 4.63E+61& ylxW*% 488.7& 1260.1& 1.4& 4.01E+14& yptA*% 68.9& 1383.2& 4.3& 7.53E+100& ylxY*% 533.6& 5114.3& 3.3& 9.62E+70& ypvA*% 1420.4& 13250.4& 3.2& 8.83E+70& ymaB*% 505.6& 1928.7& 1.9& 8.23E+27& ypzA% 129.9& 272.7& 1.1& 2.67E+03& ymfD*% 250.7& 1427.0& 2.5& 9.62E+42& ypzG% 69.8& 929.5& 3.7& 2.04E+23& ymfJ*% 95.2& 279.7& 1.6& 1.62E+13& ypzH% 19.9& 50.1& 1.3& 2.04E+05& ymxH% 34.9& 289.7& 3.1& 2.77E+41& ypzI% 25.7& 67.3& 1.4& 2.95E+06& ynaD% 26.4& 59.4& 1.2& 1.99E+02& yqaJ% 25.3& 11.8& +1.1& 4.97E+02& yncM% 3390.7& 1693.4& +1.0& 2.10E+08& yqaO% 188.1& 70.6& +1.4& 1.57E+06& yndL% 727.8& 278.9& +1.4& 7.57E+03& yqaS*% 134.9& 483.1& 1.8& 2.09E+21& yndM% 11.8& 25.8& 1.1& 7.94E+03& yqaT*% 96.1& 643.1& 2.7& 1.03E+43& yneN*% 399.2& 1335.1& 1.7& 8.55E+22& yqbA*% 39.2& 515.7& 3.7& 9.75E+27& ynfC% 1838.2& 3695.2& 1.0& 2.51E+07& yqbB*% 44.7& 393.2& 3.1& 2.33E+48& ynfE*% 4.4& 11.9& 1.4& 2.84E+02& yqbD% 31.3& 232.0& 2.9& 4.44E+36& ynzL% 4.2& 15.5& 1.9& 1.07E+03& yqbE% 22.8& 225.6& 3.3& 8.78E+43& yoaB% 143.2& 1505.7& 3.4& 1.55E+68& yqbF% 47.4& 98.5& 1.1& 3.02E+03& yoaC% 112.1& 997.0& 3.2& 2.25E+58& yqbG% 120.1& 247.5& 1.0& 5.56E+07& yoaD% 153.8& 592.6& 1.9& 3.86E+24& yqbH% 41.7& 214.5& 2.4& 1.26E+25& yoaM% 209.7& 78.3& +1.4& 2.33E+06& yqbI% 34.8& 184.2& 2.4& 4.37E+25& yobB% 57.1& 26.1& +1.1& 3.82E+03& yqbJ% 17.9& 119.2& 2.7& 2.34E+24& yocJ% 945.1& 2943.7& 1.6& 5.19E+20& yqbK% 38.9& 126.6& 1.7& 1.16E+11& yocN% 70.8& 146.8& 1.1& 2.53E+05& yqbM% 55.6& 123.7& 1.2& 7.48E+06& yodD% 71.4& 151.9& 1.1& 3.40E+06& yqeB% 1770.5& 731.2& +1.3& 9.19E+13& yodE% 61.1& 155.5& 1.3& 6.26E+09& yqfQ% 21.5& 68.8& 1.7& 1.16E+08& yodH% 27.9& 59.6& 1.1& 3.57E+04& yqfX% 45.5& 132.3& 1.5& 5.78E+10& yodI% 13.2& 36.5& 1.5& 1.13E+04& yqgB% 1359.0& 5091.6& 1.9& 1.18E+18& yodL% 122.4& 412.5& 1.8& 9.95E+19& yqgC% 858.5& 3806.2& 2.1& 3.54E+33& yodM% 87.8& 429.0& 2.3& 1.14E+29& yqgE% 33.7& 81.5& 1.3& 1.68E+06& yokU% 29.8& 12.9& +1.2& 1.12E+03& yqgN% 526.8& 1210.5& 1.2& 6.28E+11& yolD% 11.3& 40.0& 1.8& 5.84E+07& yqgO% 181.4& 426.1& 1.2& 1.63E+06& yolJ% 3276.1& 947.2& +1.8& 3.62E+04& yqhH% 36.5& 15.8& +1.2& 6.58E+04& yomV% 16.2& 6.6& +1.3& 1.22E+02& yqhO% 128.8& 474.0& 1.9& 1.33E+21& yonP% 9.8& 1.8& +2.4& 2.96E+02& yqjC% 14.4& 56.6& 2.0& 2.34E+07& yopB% 7.2& 24.8& 1.8& 1.97E+04& yqjF% 167.0& 409.9& 1.3& 3.51E+11& yopX% 10.2& 3.3& +1.6& 2.49E+02& yqjL% 162.0& 346.9& 1.1& 8.08E+08& yoqH% 18.4& 8.9& +1.1& 4.14E+02& yqxA% 23.3& 59.0& 1.3& 9.92E+06& yoqJ% 12.7& 5.0& +1.3& 3.73E+02& yqxI% 2170.8& 1031.6& +1.1& 6.17E+03& yoqY% 105.2& 52.0& +1.0& 8.76E+04& yqxJ% 229.4& 106.6& +1.1& 8.92E+03& yotK% 11.8& 4.5& +1.4& 3.76E+02& yqxM% 51.7& 16.4& +1.7& 5.49E+07& yotL% 28.4& 10.2& +1.5& 3.33E+02& yqzE% 157.8& 13.0& +3.6& 7.86E+17& yoyE% 2.9& 25.4& 3.1& 8.80E+09& yqzG% 45.2& 11.7& +1.9& 2.60E+04& yozD% 12.1& 24.4& 1.0& 1.95E+02& yqzI% 25.4& 103.1& 2.0& 1.92E+05& yozF% 16.2& 5.7& +1.5& 3.43E+03& yqzK% 241.9& 550.5& 1.2& 7.77E+10& yozK% 4.4& 22.8& 2.4& 2.03E+06& yqzN% 9.8& 21.6& 1.1& 1.29E+02& ! ! 135! ! !

Genes% +NusA% –NusA% Change% p0adj% ! yviE*% 873.8& 3704.0& 2.1& 1.99E+31& ! yviF*% 658.0& 2729.5& 2.1& 1.94E+12& ! yvqJ% 836.8& 314.6& +1.4& 3.19E+14& yvzA% 774.9& 228.8& +1.8& 1.86E+20& ! yvzB% 60.9& 253.1& 2.1& 3.31E+21& ! ywbO*% 515.7& 2496.4& 2.3& 3.30E+36& ! ywcA% 201.4& 539.8& 1.4& 4.97E+14& ywcI% 17.3& 6.8& +1.4& 4.06E+03& ! ywfM% 918.1& 211.0& +2.1& 3.50E+20& ! ywhH% 272.2& 1204.4& 2.1& 4.90E+31& ! ywjH% 9816.8& 20716.0& 1.1& 1.27E+09& ywkF*% 207.4& 737.5& 1.8& 2.87E+22& ! ywlB*% 18.4& 91.2& 2.3& 2.19E+16& ! ywmC% 32.3& 66.8& 1.0& 3.82E+04& ywmF% 16.7& 6.2& +1.4& 6.17E+03& ! ywnB*% 147.3& 383.7& 1.4& 3.66E+12& ! ywpD% 117.4& 245.7& 1.1& 4.62E+07& ! ywpE% 34.5& 124.4& 1.9& 1.39E+13& yxaH% 179.6& 421.7& 1.2& 6.22E+10& ! yxbB% 1200.8& 510.0& +1.2& 4.14E+05& ! yxbC% 2096.6& 869.7& +1.3& 6.03E+06& ! yxbD% 394.9& 189.2& +1.1& 2.27E+07& yxbG% 44.2& 94.0& 1.1& 2.98E+05& ! yxdL*% 68.2& 179.3& 1.4& 4.29E+10& ! yxdM*% 355.3& 1044.4& 1.6& 2.05E+17& yxeA*% 184.6& 477.2& 1.4& 3.17E+12& ! yxeD% 23.5& 84.6& 1.8& 4.18E+11& ! yxeK% 646.0& 193.9& +1.7& 4.23E+09& ! yxeL% 327.6& 72.5& +2.2& 6.77E+12& yxeM% 651.0& 159.2& +2.0& 1.24E+24& ! yxeN% 581.8& 116.4& +2.3& 5.25E+32& ! yxeO% 741.8& 145.3& +2.4& 2.57E+34& ! yxeP% 1414.3& 282.7& +2.3& 3.99E+35& yxeQ% 1175.0& 321.5& +1.9& 1.82E+23& ! yxeR% 1115.8& 526.8& +1.1& 1.28E+08& ! yxiB% 163.0& 54.5& +1.6& 9.17E+12& yxiC% 130.5& 40.7& +1.7& 1.01E+11& ! yxiD% 844.2& 391.4& +1.1& 4.47E+09& ! yxjF% 73.4& 322.8& 2.1& 3.10E+25& ! yxjG% 1976.1& 11621.7& 2.6& 9.09E+47& yxjH% 706.4& 5615.3& 3.0& 5.70E+61& ! yxjI*% 314.5& 926.8& 1.6& 2.41E+17& ! yxkA% 52.0& 167.7& 1.7& 1.09E+06& ! yxnB% 408.7& 171.7& +1.3& 1.17E+02& yxzK% 41.0& 82.8& 1.0& 2.22E+04& ! yyaD*% 34.7& 188.0& 2.4& 4.67E+26& ! yyaE*% 413.3& 1875.0& 2.2& 1.87E+33& ! yyaR% 54.2& 25.6& +1.1& 3.84E+03& yybH% 71.7& 147.0& 1.0& 9.69E+06& ! yybI% 217.8& 884.9& 2.0& 3.71E+27& ! yybL% 238.9& 531.8& 1.2& 2.09E+02& yybM% 838.2& 1844.6& 1.1& 1.63E+04& ! yyzE% 12.2& 44.8& 1.9& 1.83E+07& ! zosA% 209.7& 1134.5& 2.4& 3.66E+39& !

! 136! Chapter 3

Characterization of the NusG-stimulated U107 Pause Signal in the B. subtilis trp

Leader and its Role in Attenuation Control of the trpEDCFBA Operon

137 3.1 Abstract

Hairpin dependent pause sites frequently occur in the 5’ untranslated leader of amino acid biosynthetic operons in E. coli and B. subtilis. Our previous studies identified two hairpin- dependent pause sites at positions U107 and U144 in the B. subtilis trp leader. NusA and NusG stimulates RNAP pausing at these two sites; a synergistic effect is observed when both NusA and

NusG are added together. NusG stimulates pausing at U144 by recognizing a T-rich motif in the non-template DNA strand within the paused transcription bubble. Pausing at U144 participates in

TRAP-dependent repression of trpE translation. Here we characterize the U107 pause signal and show that disruption of the conserved T-rich NusG recognition motif eliminates NusG-stimulated pausing without affecting NusA-stimulated pausing. We also show that elimination of NusG- dependent pausing reduces termination at the B. subtilis trp leader attenuator under high TRAP concentration, albeit to a small extent. These studies provide evidence for a model in which

NusG-dependent pausing at U107 provides additional time for tryptophan-activated TRAP to bind to the nascent transcript and enhance the termination efficiency by preventing antiterminator formation.

138 3.2 Introduction

The B. subtilis tryptophan biosynthetic trpEDCFBA operon is regulated by transcription attenuation (Chapter 1) and translation repression mechanisms in response to tryptophan availability (reviewed in Babitzke and Gollnick, 2001; Gollnick et al., 2005). Unlike the E. coli tryptophan attenuator that is regulated by ribosome stalling in a Trp codon-rich leader transcript, the B. subtilis tryptophan attenuator is regulated by a tryptophan sensory protein known as TRAP

(trp RNA binding attenuation protein) (Babitzke et al., 1994). TRAP is a ring-shaped protein consisting of 11 identical subunits. Tryptophan can bind between each adjacent TRAP subunit when the concentration of this amino acid is high (Antson et al., 1995). Binding of tryptophan activates TRAP by inducing a conformational change, which allows TRAP to bind RNA containing GAG or UAG sequences through its conserved KKR (Lys-37, Lys-56 and Arg-58) motif (Elliott et al., 1999).

The B. subtilis trp leader is a 238 nt long untranslated transcript that is capable of forming mutually exclusive terminator and antiterminator structures, which constitute the attenuator (Figure 3-1) (Shimotsu et al., 1986). TRAP also interacts with an RNA structure that forms at the 5' end of the trp leader transcript; interaction with the 5’ stem-loop increases the efficiency of transcription termination (Sudershana et al., 1999; McGraw et al., 2007; McGraw et al., 2009). Tryptophan-activated TRAP binds to a region of the trp leader containing 7 GAG and

4 UAG repeats (Babitzke et al., 1994; Antson et al., 1995). The TRAP binding region overlaps with the antitermination hairpin, thus binding of TRAP prevents antiterminator formation. As a consequence, the terminator hairpin folds and transcription is terminated upstream of the trp genes. When the concentration of tryptophan is limiting, TRAP remains inactive and cannot bind to the antiterminator region. In this situation, formation of the antiterminator prevents folding of the terminator hairpin, allowing RNAP to transcribe the downstream genes.

139

Figure 3-1. Regulation of trp operon expression in B. subtilis. The transcription attenuation model is shown on the top and the translation repression model is shown in the bottom. The 11

(G/U)AG repeats that are necessary for TRAP binding are shown in bold and the terminator hairpin is shown in green. The SD-sequestering hairpin is shown in orange. The U107 and U144 pause sites are indicated. The mechanism and regulation of attenuation and translational repression of trpE is described in the text.

140 In addition to the attenuation mechanism described above, TRAP regulates translation of the gene encoding anthranilate synthase (trpE) (Yakhnin et al., 2006; Yakhnin et al., 2008).

Bonding of tryptophan-activated TRAP yo transcripts that escape terminator results in the sequestration of the trpE Shine-Dalgarno (SD) equence in a hairpin (Figure 3-1). Thus, TRAP prevents translation of trpE by blocking the access of ribosomes to the trpE SD sequence. In tryptophan limiting conditions, the trp leader transcript adopts an alternative structure in which the trpE SD is not sequestered and accessible to ribosomes. Thus, translation of trpE can readily occur in the absence of tryptophan.

RNAP pauses at positions U107 and U144 while transcribing the B. subtilis trp leader transcript (Figure 3-1 and 3-2) (Yakhnin and Babitzke, 2002; Yakhnin et al., 2006, Yakhnin et al., 2008; Yakhnin and Babitzke, 2010). The U107 pause site is just upstream of the critical 4-nt overlap between the antiterminator and terminator structures, while the U144 pause site is located immediately downstream of the termination window. Although basal pausing is weak, the general transcription elongation factors NusA and NusG have been shown to synergistically increase the pause half-life at these sites in vitro. Pausing at U144 is stronger than at U107 and has been shown to participate in the translation control mechanism of trpE (Yakhnin et al., 2006). RNAP pausing at U144 provides a second opportunity for TRAP to bind the readthrough transcripts in the presence of tryptophan and repress translation of trpE.

B. subtilis NusA stimulates pausing at U107 and U144 ~ 5-fold in vitro. Our lab found that B. subtilis NusG is also stimulates pausing ~ 4-fold and ~ 75-fold at U107 and U144, respectively, which is opposite to the pause-inhibitory effect of E. coli NusG. Moreover, addition of both NusA and NusG synergistically enhance pausing ~25-fold and ~300-fold at U107 and

U144, respectively (Yakhnin et al., 2008; Yakhnin and Babitzke, 2010). While deletion

141

Figure 3-2. The U107 and U144 pause sites and their sequence determinants. a, Comparison of the U107 and the U144 pause sites. The U144 pause hairpin contains 11 contiguous base pairs and is more stable. The putative U107 pause hairpin is interrupted and weaker. b, The U144 paused transcription bubble. Residues T135 and T137-T139 of the ntDNA strand within the U144 paused transcription bubble function as a NusG recognition motif (Yakhnin and Babitzke, 2016).

142 or mutation of the pause U144 pause hairpin reduces both NusA- and NusG-stimulated pausing, disruption of a region between the pause site and the hairpin selectively eliminates NusG- stimulated pausing. B. subtilis NusG was shown to interact with this region of the non-template

DNA strand to stabilize the paused RNAP complex. In particular, biochemical assays indicate that the T135 and T137-T139 residues are recognized by NusG and are essential for NusG- stimulated pausing. E. coli NusG is unable to stimulate pausing at U144 because it lacks the critical amino acids required for interaction with these nucleotides.

The sequence elements that are important for NusA- and NusG-stimulated pausing at

U144 are conserved at the U107 pause site (Figure 3-2). However, unlike the strong U144 pause hairpin, the putative U107 pause hairpin (+72 to +95) is weaker because it is interrupted.

Interestingly, the T135 and T137-T139 residues that are recognized by NusG for pausing at U144 are conserved at the U107 pause site (T98 and T100-T102). Thus, it is possible that these conserved T residues constitute a NusG recognition motif for pause stimulation. Since the U107 pause site just precedes the critical 4-nt overlap between the antiterminator and terminator structures, pausing at U107 might provide additional time for TRAP to bind the nascent RNA before nucleation of antiterminator hairpin begins. If this were true, then elimination of pausing at

U107 should also decrease termination because TRAP would have less time to bind to the nascent

RNA. However, the major challenge for studying the role of U107 pausing in regulation of trp attenuation is that the pause site is a part of the antiterminator hairpin and substitution of U107 destabilizes the antiterminator by disrupting the A64-U107 and G65-C106 base pairs.

Fortunately, residues U98 and U100-U102 of the trp leader transcript are predicted to be part of an internal loop within the antiterminator hairpin and not a part of the TRAP binding site. Thus, pause-defective mutations in these residues may allow us to determine if pausing at U107 affects expression of the trp operon.

143 3.3 Results

3.3.1 T98 and T100-T102 are components of the U107 pause signal

Previous studies with the U144 pause signal established that T135 and T137-T139 are critical residues for NusG-stimulated pausing; substitution of these bases resulted in moderate to severe reductions in the pause half-life. Since these T residues are also conserved at the U107 pause site (T98 and T100-T102), we tested whether substitution of these residues affected the pause half-life in the presence of the NusA and/or NusG. A single-round in vitro transcription assay was used to monitor pausing at U107 for wild-type (WT) or mutant (T98A, T100A, T101A,

T102A and T100A:T101A:T102A) trp leader regions. Nascent transcripts were labeled at their 5’ ends during the first step in which a 29 nt halted TEC was formed by omission of CTP. In the second step, elongation of halted complexes was resumed by the addition of CTP together with heparin to prevent further RNAP initiation events. Since the U107 pause half-life is much shorter than the U144 pause-signal, limiting NTP concentrations (10 µM) were used to increase the dwell time of RNAP at the U107 pause site. Transcription elongation was stopped at 30”, 1’, 2’ and 4’ for the WT and 15”, 30”, 1’, and 3’ for the mutant templates. NusA and NusG were included in the second step of the reaction.

In the presence of NusA and NusG, T98A, T100A, T101A and T102A substitutions resulted in a 2- to 4-fold reduction of the pause half-life (Figure 3-3). However, the T101A substitution was also associated with a 10-fold reduction of pause efficiency. When the T100A,

T101A and T102A substitutions were combined to make a triple-mutant (T100A:T101A:T102A), the reduction of pause half-life and pause-efficiencies were comparable to T101A. Although single T100A, T101A and T102A substitutions reduce RNAP pausing at U107, the finding that combining these mutations did not result in a further decrease of the pause half-life or pause- efficiency compared to T101A alone suggests that the effect of these substitutions are not

144

Figure 3-3. T98 and T100-T102 participate in U107 pausing. Single-round in vitro transcription experiments were performed with WT and mutant trp leader templates in the presence of saturating concentration of NusA and NusG. Reactions were incubated at 25°C and stopped at the times shown above each lane. Chase reactions (Ch) were extended for an additional

10 min at 37°C with 500 µM NTPs. Positions of paused (U107) and read through (RT) transcripts are indicated. The calculated pause half-life (T1/2) and pause efficiencies (%) are indicated at the bottom; standard errors are also indicated. This is a representative gel of an experiment that was performed three times.

145 cumulative. Taken together, this experiment confirmed that T98, T100, T101 and T102 residues participate in RNAP pausing at U107.

3.3.2 T100-T102 is required for NusG-stimulated pausing at U107

T198 and T100-T102 are present within the paused transcription bubble upstream of the

U107 pause site. As the T100A:T101A:T102A triple mutant resulted in a substantial pausing defect in the presence of both NusA and NusG, we next tested the effect of the triple mutant on

NusA- and NusG-stimulated pausing. Basal pausing using the WT template without NusA and

NusG was poor; however, while pausing was enhanced by both NusG and NusA (Figure 3-4).

Although pause stimulation by NusA was higher than NusG alone, when both NusA and NusG were present in the reaction, we observed a synergistic effect on pause stimulation (note the 240 second time points). This synergistic effect of NusA and NusG at the U107 pause site is analogous to the pause stimulation observed at the U144 pause site (Yakhnin et al., 2008;

Yakhnin and Babitzke, 2010). Substitution of T100-T102 with A did not greatly affect basal pausing at U107, suggesting that these residues are not critical for basal pausing. However, the substitutions completely eliminated NusG-stimulated pausing, indicating that these residues might constitute a NusG-recognition motif. In contrast, NusA-stimulated pausing was unaffected by the substitutions, indicating that the T100-T102 residues in the DNA or U100-U102 in the

RNA do not serve as a recognition motif for NusA. Moreover, the synergistic effect of NusA and

NusG was also eliminated in the triple mutant template, although NusA was still able to enhance pausing to a similar extent as NusA alone. Taken together, these results establish that the conserved T residues may be a part of NusG recognition motif.

146

Figure 3-4. T100-102 is required for NusG stimulated pausing at U107. NusG and NusA individually and synergistically enhance pausing at U107 (WT). Substitution of T100-102 with A residues eliminates NusG-stimulated pausing and the synergistic effect of NusG and NusA, but preserves NusA-stimulated pausing. The positions of the paused and read-through transcripts are indicated on the left (arrows). This is a representative gel of an experiment that was performed twice.

147 3.3.3 Pausing at U107 participates in the attenuation mechanism in vitro

Since pausing at U107 is thought to provide additional time for TRAP to bind to the nascent transcript in vitro, pausing is predicted to increase the termination efficiency. The major problem for studying the role of U107 pausing in the attenuation control mechanism is that U107 is a part of the antiterminator hairpin. However, the residues T98 and T100-T102, which are part of the NusG-recognition motif, correspond to part of a predicted internal loop within the antiterminator structure and are not part of the TRAP binding site. Hence, we tested whether termination is affected in the T101A and T100A:T101A:T102A pause-deficient mutants in the presence of NusA, NusG and/or TRAP. Termination was poor in the absence of bound TRAP because this situation favors formation of the antiterminator. However, the T101A and

T100A:T101A:T102A mutations increased the basal termination efficiency approximately twofold, suggesting that substitution of the critical NusG-recognition residues affected RNA folding in the absence of bound TRAP (Figure 3-5 a). NusA or NusG, when present alone, did not significantly alter the termination efficiency of the mutant templates. Despite the twofold increase in the basal termination efficiency observed in the pause-deficient mutants, the termination efficiency was reduced ~10% in the presence of both NusA and NusG. As the basal termination efficiency was increased > twofold in the triple mutant, the 10% value underrepresents the impact of these mutations on NusA- and NusG-dependent termination; the change in termination caused by NusA and NusG (Δ%T) in the WT template is 57 (61-4) compared to 42 (52-10) for the triple mutant. This small difference in termination efficiency affects downstream gene expression by fine-tuning attenuation. Further in vivo analysis with the pause-deficient mutants will be required to understand the effect that RNAP pausing at U107 has on the attenuation mechanism.

148

Figure 3-5. Pausing at U107 participates in attenuation mechanism. a, In vitro termination assay of WT, T101A and T100A:T101A:T102A mutant templates in the presence or absence of

TRAP, NusA and NusG. Position of the terminated (T) and readthrough (RT) transcripts are

149 indicated. Termination efficiencies are shown at the bottom of the gel. SE, standard error of the mean. b, c, In vitro termination assay with varying TRAP concentrations in the absence (b) or presence (c) of NusA and NusG. In the graphs, termination efficiency (%T) is plotted as a function of TRAP concentration. These are representative gels of experiments that were performed at least twice.

Since pausing at U107 is predicted to provide additional time for TRAP to bind to the nascent transcript, we also compared the termination efficiency of the WT and T100A:T101A:T102A mutant templates at various TRAP concentration in the absence or presence of NusA and NusG

(Figure 3-5 b, c). The termination efficiency with the WT template was ~10% higher than for the mutant template at the higher TRAP concentrations. The finding that the termination efficiency at the higher TRAP concetrations was similar in the WT and pause-defective mutant in the absence of NusA and NusG, suggests that these Nus factors participate in the attenuation mechanism by modulating pausing at U107.

3.4 Discussion and future directions

Our results demonstrate that the T100-T102 residues constitute a conserved motif for

NusG-stimulated pausing at U107. As for the U144 pause site, these T residues would be part of the ntDNA strand within the paused transcription bubble (Figure 3-2). Our results also suggest that NusA- and NusG-stimulated pausing at U107 participates in the attenuation mechanism by fine-tuning the termination efficiency. However, a more detailed analysis will be required to fully understand the mechanism of pausing at U107 and its involvement in attenuation. 150 RNA hairpins are components of the U107 and U144 pause signals; however, the U144 hairpin contains 11 contiguous base pairs, while the U107 pause hairpin is interrupted (Figure 3-

2). As the U144 pause hairpin was shown to be dispensable for pause site selection (Yakhnin and

Babitzke, 2010), we will determine the effect of deleting the U107 pause hairpin on NusA- and

NusG-stimulated pausing (Figure 3-2). If deleting the hairpin reduces pausing, point mutations in the hairpin will also be tested. For example, the U73A and A94U point mutations might reduce pausing by disrupting all three base pairs at the bottom of the structure, while the compensatory

U73A:A94U double mutation should restore base pairing and perhaps pausing.

Since the residues U100-U102 are part of an internal loop within the antiterminator and are not part of the overlapping terminator or TRAP binding site, pause-defective mutations in these residues will allow us to determine if pausing at U107 affects expression of the trp operon in vivo using a lacZ reporter construct. Our in vitro results demonstrated that substitution of T98 and T100-T102 with A residues eliminates NusG-stimulated pausing. These mutations will be useful to determine it pausing at U107 regulates the trp operon. I have engineered a trpE-lacZ transcriptional fusion and confirmed that it responds to the availability of tryptophan in the medium. A pilot experiment using WT and mutant U107 pause signals did not show a significant difference of lacZ expression in the presence or absence of tryptophan. Additional expression assays can be performed using WT, ΔmtrB (TRAP-deficient) and mtrB overexpression strains to determine whether pausing at U107 participates in the attenuation mechanism in vivo. The effects of overexpressing and deleting nusG on WT and mutant trp leader-lacZ fusion expression can also be examined. If pausing at U107 participates in attenuation, the ΔnusG strain should exhibit increased lacZ expression, whereas overexpression of NusG should decrease expression of the fusion.

151 3.5 Materials and methods

3.5.1 DNA templates and proteins

The untranslated leader of the B. subtilis trp operon contains a cryptic promoter (Yakhnin et al., 2006). To avoid problems associated with transcription initiation from two promoters, all templates for U107 pausing and termination assays were obtained by PCR amplification of the trp leader in which the cryptic promoter was converted into a consensus promoter along with an extended –10 region. This synthetic promoter directed transcription initiation from residue +37 of the trp leader region. Mutations in the B. subtilis trp leader were generated according to the

Quickchange protocol (Stratagene). 175 nt PCR fragments for WT and mutant templates were purified with the QIAquick PCR purification kit (Qiagen) and used as templates for in vitro pausing assays. For termination assays, 185 nt PCR fragments (-1 to +184) containing WT or mutant pause signals were used. B. subtilis TRAP (Yakhnin et al., 2000), His-tagged NusA

(Yakhnin and Babitzke, 2002) and His-tagged NusG (Yakhnin et al., 2006) proteins were overproduced and purified as described previously. His-tagged B. subtilis RNAP was purified as described (Qi and Hulett, 1998; Yakhnin et al., 2006).

3.5.2 In vitro pausing assays

Pausing assays and data analysis were performed as described previously (Yakhnin and

Babitzke, 2002; Yakhnin et al., 2006; 2008). Stable TECs containing a 29 nt transcript were formed in a reaction containing ATP and GTP (8 µM each), 2 µM UTP and 1 mCi ml-1[α-

32P]UTP at 37°C. Transcription elongation was halted at position 65 of the trp leader due to the absence of CTP. Elongation of halted transcription complexes was resumed by the addition of all four NTPs (150 µM GTP, CTP and UTP; 10 µM ATP), together with heparin at room temperature (23-25°C). NusA, NusG and TRAP were added at 1 µM in the second step of the reaction; tryptophan was added at 1 mM in conjunction with TRAP. Aliquots of the elongation

152 reaction were removed at various times and the last aliquot was chased for an additional 10 min at

37°C in the presence of 500 µM NTPs. Reactions were stopped by mixing with gel loading solution and samples were fractionated through standard 6% sequencing gels. Pause half- and efficiencies were calculated by plotting relative intensities of the U144 pause band against the incubation time and fitting the data with a single exponential equation as described previously

(Landick et al., 1996; Yakhnin and Babitzke, 2002).

3.5.3 In vitro termination assays

In vitro termination assays were performed as described previously (Yakhnin and Babitzke, 2002;

Yakhnin et al., 2006; 2008. Stable TECs containing a 29 nt transcript were formed in a reaction containing ATP and GTP (8 µM each), 2 µM UTP and 1 mCi ml-1[α-32P]-UTP at 37°C, and elongation of halted complexes were resumed by the addition of 150 µM of all four NTPs for 5 minutes at 37°C. Unless mentioned, NusA, NusG and TRAP were added at 1 µM in the second step of the reaction; tryptophan was added at 1 mM in conjunction with TRAP. Termination assays were also performed with a TRAP concentration gradient. In this case TRAP concetrations were 0 nM, 7.5 nM, 15.6nM, 31 nM, 62 nM, 125 nM, 250 nM, 500 nM and 1 µM. Reactions were stopped by mixing with gel-loading solution and samples were fractionated through standard 6% sequencing gels. The efficiency of termination was calculated as the fraction of a terminated transcript relative to the sum of all terminated and readthrough transcripts.

153 3.6 References

Antson AA, Otridge J, Brzozowski AM, Dodson EJ, Dodson GG, Wilson KS, Smith TM, Yang

M, Kurecki T, Gollnick P. (1995) The structure of trp RNA-binding attenuation protein. Nature.

374(6524):693-700.

Babitzke P, Stults JT, Shire SJ, Yanofsky C. (1994) TRAP, the trp RNA-binding attenuation protein of Bacillus subtilis, is a multisubunit complex that appears to recognize G/UAG repeats in the trpEDCFBA and trpG transcripts. J Biol Chem. 269(24):16597-16604.

Babitzke P, Gollnick P. (2001) Posttranscription initiation control of tryptophan metabolism in

Bacillus subtilis by the trp RNA-binding attenuation protein (TRAP), anti-TRAP, and RNA structure. J Bacteriol. 183(20):5795-5802.

Babitzke P, Yanofsky C. (1995) Structural features of L-tryptophan required for activation of

TRAP, the trp RNA-binding attenuation protein of Bacillus subtilis. J Biol Chem. 270(21):12452-

12456.

Elliott MB, Gottlieb PA, Gollnick P. (1999) Probing the TRAP-RNA interaction with nucleoside analogs. RNA. 5(10):1277-1289.

Gollnick P, Babitzke P, Antson A, Yanofsky C. (2005) Complexity in regulation of tryptophan biosynthesis in Bacillus subtilis. Annu Rev Genet. 39:47-68.

154 Landick R, Wang D, Chan CL. (1996) Quantitative analysis of transcriptional pausing by

Escherichia coli RNA polymerase: his leader pause site as paradigm. Methods Enzymol.

274:334-353.

McGraw AP, Bevilacqua PC, Babitzke P. (2007) TRAP-5' stem loop interaction increases the efficiency of transcription termination in the Bacillus subtilis trpEDCFBA operon leader region.

RNA. 13(11):2020-2033.

Qi Y, Hulett FM. (1998) PhoP-P and RNA polymerase sigmaA holoenzyme are sufficient for transcription of Pho regulon promoters in Bacillus subtilis: PhoP-P activator sites within the coding region stimulate transcription in vitro. Mol Microbiol. 28(6):1187-1197.

Shimotsu H, Kuroda MI, Yanofsky C, Henner DJ. (1986) Novel form of transcription attenuation regulates expression the Bacillus subtilis tryptophan operon. J Bacteriol. 166(2):461-471.

Sudershana S, Du H, Mahalanabis M, Babitzke P. (1999) A 5' RNA stem-loop participates in the transcription attenuation mechanism that controls expression of the Bacillus subtilis trpEDCFBA operon. J Bacteriol. 181(18):5742-5749.

Yakhnin AV, Babitzke P. (2010) Mechanism of NusG-stimulated pausing, hairpin-dependent pause site selection and intrinsic termination at overlapping pause and termination sites in the

Bacillus subtilis trp leader. Mol Microbiol. 76(3):690-705.

Yakhnin AV, Yakhnin H, Babitzke P. (2006) RNA polymerase pausing regulates translation initiation by providing additional time for TRAP-RNA interaction. Mol Cell. 24(4):547-557.

155

Yakhnin AV, Yakhnin H, Babitzke P. (2008) Function of the Bacillus subtilis transcription elongation factor NusG in hairpin-dependent RNA polymerase pausing in the trp leader. Proc

Natl Acad Sci U S A. 105(42):16131-16136.

Yakhnin AV, Babitzke P. (2002) NusA-stimulated RNA polymerase pausing and termination participates in the Bacillus subtilis trp operon attenuation mechanism in vitro. Proc Natl Acad Sci

U S A. 99(17):11067-11072.

156 Chapter 4

Summary and Future Perspectives

157 4.1 Introduction

Transcription is the first step of gene expression and is tightly regulated in all living organisms to maintain homeostasis, control growth, and cope with changes in the environment. Transcription is regulated at the level of initiation, elongation and termination.

The rate of elongation and the length of the transcripts are controlled by pausing and termination mechanisms, respectively. My research focused on understanding the mechanism, regulation, and physiological relevance of these two mechanisms using genetic, biochemical and computational methods.

The regulation of termination in bacteria is critical because bacterial genes are densely packed in a relatively small chromosome. Termination failure leads to overexpression of the downstream genes and the synthesis of antisense RNA, both of which disrupt proper gene regulation. The stimulatory effect of NusA on intrinsic terminators was first demonstrated in

1980 (Greenblatt et al., 1980) and a number of studies by several groups have suggested mechanisms by which NusA might function in vitro. Genomic studies confirmed that NusA associates with RNAP as it translocates away from the promoter during productive elongation

(Mooney et al., 2009). However, despite the advancement of high-throughput sequencing technology, a genome-wide analysis to study the global effect of NusA on termination and gene expression had never been done. I developed a high-throughput strategy to map intrinsic terminators in the B. subtilis genome using 3’ end-mapping, which also helped me to monitor the efficiency of termination at individual terminators. My study with the B. subtilis NusA depletion strain revealed that the weak, non-canonical terminators are the principal targets of

NusA, some of which are entirely dependent of NusA for termination in vivo. My study also revealed that terminators that are highly dependent on NusA generally feature weak hairpins

158 and/or interruption in the distal portion of the U-tract. I also found a relationship between

NusA-dependent terminators and genes regulating replication and DNA metabolism.

Hairpin-dependent RNAP pause sites have also been characterized in E. coli and other organisms. Previous studies from our lab identified two hairpin-dependent pause sites in the B. subtilis trp leader. NusA stimulates pausing at both of these sites as was previously observed for the E. coli his pause site (Chan and Landick, 1993). NusG was also found to enhance pausing at the two B. subtilis trp sites, which is an opposite effect to its identified role in E. coli. In the ntDNA, the sequence corresponding to the region between the pause hairpin and

U144 pause site has been shown to interact with NusG in a sequence-specific manner to stimulate pausing (Yakhnin et al., 2008; Yakhnin et al., 2016). My study with the U107 pause site confirmed that NusG-stimulated pausing is dependent on specific T residues that are positioned similarly for both U107 and U144 pause signal. My study also suggests that NusG- stimulated pausing at U107 might participate in the B. subtilis attenuation mechanism.

Apart from the discovery of NusA-dependent termination and its significance that is reported in Chapter 2, our mRNA profiling and 3’ end-mapping of the B. subtilis transcriptome opened up many interesting avenues for further investigation. I will discuss a few significant implications in the following sections.

4.2 High resolution mapping of intrinsic terminators

Detection of transcription termination sites in bacteria is critical to understand the operon structure of bacterial genomes. Until now, genome-wide detection of intrinsic terminators depended on computational methods, most of which scan the genome for potential hairpins followed by a U-rich sequence (Unniraman et al., 2002; Kingsford et al., 2007).

These computational methods often reports large number of false positives that do not

159 function as terminators in vivo. These algorithms also fail to identify sites that function as terminators in vivo but have poor hairpin and U-tracts. Our method of identifying terminators using a combination of 3’ end-mapping and computational analysis is much more reliable because it is dependent on in vivo expression profiling. We identified a total of 2130 intrinsic terminators in the B. subtilis genome, several of which are parts of attenuators or riboswitches

(Table 2, Chapter 2). We also compared the locations of the terminators to the results obtained by transtermHP (Kingsford et al., 2007); approximately 60% of the terminators that we identified were also predicted by transtermHP (data not shown). While similar methods were used to identify promoters and terminators in E. coli (Conway et al., 2014), this technique can be used in other organisms for which high-resolution operon structures are unexplored.

4.3 Identification of stable degradation products

Our 3’ end-mapping identified a number of strong peaks that were not associated with intrinsic terminator-like structures. While some peaks corresponded to tRNA and rRNA ends, many peaks were located in the coding region of genes (Table 2, Chapter 2). We predict that some of these 3’ ends correspond to stable degradation products generated by endonucleolytic cleavage events that are refractory to 3’à5’ exoribonuclease digestion due to RNA secondary structure. For example, our 3’ end-mapping identified two strong peaks in the rapA coding sequence, which are two known decay intermediates of the rapA gene (David Bechoffer, personal communication) (Figure 4-1). Hence, our 3’ end-mapping method can be used to identify RNA decay intermediates on a global scale and to determine substrate specificity of

3’à5’ exonucleases.

In bacteria, mRNA decay is usually initiated by an edonucleolytic cleavage of the primary transcript, followed by 3’à5’ exonucleolytic degradation of the upstream fragment.

160 The downstream fragment may undergo further endonucleolytic cleavage or may be degraded by 5’à3’ degradation. In an alternative mechanism, the protective 5' triphospate end is converted to a monophosphate, which makes RNA susceptible to 5' end-dependent endonucleases or 5’à3’ exonucleases. Four 3’à5’ exoribonucleases exist in B. subtilis, polynucleotide phosphorylase (PNPase), RNaseR, RNase PH and YhaM (Craven et al., 1992;

Mitra et al., 1996; Luttinger et al., 1996; Oussenko and Bechhofer, 2000). Among these,

PNPase, the pnpA gene product, is the major RNA turnover enzyme in B. subtilis. Deletion of pnpA leads to slower growth and several other growth-related phenotypes. It was shown that the absence of PNPase results in an accumulation of decay intermediates for several small, monocistronic mRNAs (Bechhofer and Wang, 1998; Oussenkoet al., 2005).

Figure 4-1. Stable decay intermediates of the rapA gene identified by 3’ end-mapping. The two peaks shown here do not correspond to intrinsic terminators.

In a collaborative project with David Bechhofer (Mt. Sinai Hospital, NY), we plan to identify the degradation intermediates that accumulate in the absence of PNPase. This project

161 involves 3’ end-mapping of wild type (WT) and pnpA knock-out strains. The ΔpnpA and it’s corresponding WT strains were kindly provided by David Bechhofer. The strains were grown until mid-log phase in LB medium in triplicate and RNA was isolated using the method described in Chapter 2. After depletion of ribosomal RNAs (Ribo-Pure Gram Positive

Bacteria, Illumina Inc.), a small unique RNA oligo was ligated to the 3’ end of the RNA.

These samples will be used for strand-specific illumina library preparation as described in

Chapter 2. We expect that the ΔpnpA strain will exhibit unique 3’ ends that will be absent in the WT strain, which should represent the targets of PNPase.

4.4 Characterization of new small RNAs

In addition to identifying 3’ ends corresponding to terminators and stable decay intermediates, our mRNA profiling identified several unannotated transcripts with high expression levels. Most of these transcripts are short (200-500 nt), lack significant open reading frames, and are terminated by canonical intrinsic terminators. We predict that some of these RNA may function as small regulatory RNAs (sRNA) that target specific mRNAs to control their level. Examples of two such unidentified small transcripts are shown in figure 4-

2.

sRNAs play key roles in the regulation of a wide variety of cellular processes in bacteria, including stress responses, environmental signaling and virulence (Storz et al., 2011;

Caldelari et al., 2013). sRNAs generally regulate at the post-transcriptional level by altering mRNA translation or stability by base pairing with the 5’ UTR of target transcripts. In E. coli and other proteobacteria, many of these sRNA-mRNA interactions are facilitated by the RNA chaperone Hfq (reviewed in Rochat et al., 2015). B. subtilis and related firmicutes have a homolog of Hfq, but its role is less evident in sRNA-target interactions (Heidrich et al., 2006;

162 Gaballa et al., 2008). Because of this reason, only a few sRNAs have been characterized in B. subtilis.

We plan to test whether these unannotated highly abundant short transcripts function as sRNAs and identify their targets. A preliminary in silico analysis using the TargetRNA tool identified several genes for some of the putative sRNAs (Tjaden, 2008). More extensive in silico analysis using other sRNA target prediction softwares (e.g., CopraRNA, IntaRNA, etc) will be done and the predicted targets will be compared. We will also determine whether these unannotated short transcripts are conserved in other species of bacilli, since sRNAs are often phylogenetically conserved. The candidate sRNAs will then be knocked out

Figure 4-2. Examples of possible small RNAs identified by RNA-seq. The highly abundant short unannotated transcripts are shown as red arrows.

or overproduced and their effect on gene expression will be examined by RNA-seq or tiling microarrays. Successful completion of this project might lead to discovery and characterization of several new sRNAs in B. subtilis.

163 4.5 Identification of new attenuators

Apart from the novel NusA-dependent attenuation mechanism that was identified for the nusA operon, we identified unannotated intrinsic terminators in the 5’ UTR of several transcriptional units (Table 2-2). While many of these terminators are parts of previously characterized attenuators or were predicted as attenuators in a previous in silico analysis

(Merino and Yanofsky, 2002), many do not belong to previously identified attenuators. Many or all of these terminators might be parts of attenuators or riboswitches that are not yet characterized. For example, our 3’ end-mapping identified an unannotated intrinsic terminator in the 5’ UTR of the yxjB gene. Upon further investigation, we found possible anti- antiterminator (AAT), antiterminator (AT) and terminator hairpin structures, in which the terminator hairpin sequesters the SD sequence when formed. This gives us reason to believe that the gene is regulated both by transcriptional attenuation and translational repression mechanisms. Since termination is not always 100% effective, the sequestered SD sequence would prevent translation of the transcripts that fail to terminate. Kyle Mihalka, an undergraduate student in the lab, is working on verifying the overlapping secondary structures to characterize this attenuation mechanism.

4.6 Understanding the indispensability of NusA

It has been suggested that NusA is essential in E. coli because it participates in Rho- dependent termination suppressing toxic foreign genes, but the fact that the rho is dispensable in B. subtilis and related species without substantial growth defect implies that the role of

NusA for viability is not completely understood. Although our study indicated that NusA depletion causes genome wide misregulation of gene expression by enhancing readthrough at

NusA-dependent and NusA-stimulated terminators, the precise reason why NusA is

164 indispensible in B. subtilis is not known. While our mRNA profiling identified genes that are turned on or overexpressed by NusA depletion, expression of several genes were also completely dependent on NusA (Table 3, Chapter 2). A detailed examination of the genes that are turned off as a result of NusA-depletion might reveal why NusA is essential for viability.

Candidate genes that are repressed in the absence of NusA will be expressed ectopically and it will be tested whether NusA can be knocked out under these conditions.

Taken together, our 3' end-mapping method identified several interesting directions for future research in addition to the discovery of NusA-dependent terminators. Follow up experiments can answer several unexplored questions regarding genetic regulation of B. subtilis and enhance our knowledge about gene regulation in bacteria.

4.7 References

Bechhofer DH, Wang W. (1998) Decay of ermC mRNA in a polynucleotide phosphorylase mutant of Bacillus subtilis. J Bacteriol. 180(22):5968-5977.

Caldelari I, Chao Y, Romby P, Vogel J. (2013) RNA-mediated regulation in pathogenic bacteria. Cold Spring Harb Perspect Med.3(9):a010298.

Conway T, Creecy JP, Maddox SM, Grissom JE, Conkle TL, Shadid TM, Teramoto J, San

Miguel P, Shimada T, Ishihama A, Mori H, Wanner BL.(2014) Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing. MBio. 5(4):e01442-14

165 Craven MG, Henner DJ, Alessi D, Schauer AT, Ost KA, Deutscher MP, Friedman DI. (1992)

Identification of the rph (RNase PH) gene of Bacillus subtilis: evidence for suppression of cold-sensitive mutations in Escherichia coli. J Bacteriol. 174(14):4727-4735.

Gaballa A, Antelmann H, Aguilar C, Khakh SK, Song KB, Smaldone GT, Helmann JD.

(2008) The Bacillus subtilis iron-sparing response is mediated by a Fur-regulated small RNA and three small, basic proteins. Proc Natl Acad Sci U S A. 105(33):11927-11932.

Greenblatt J, Li J, Adhya S, Friedman DI, Baron LS, Redfield B, Kung HF, and Weissbach H.

(1980) L factor that is required for beta-galactosidase synthesis is the nusA gene product involved in transcription termination. Proc Natl Acad Sci U S A. 1980 77(4):1991-1994.

Heidrich N, Chinali A, Gerth U, Brantl S. (2006) The small untranslated RNA SR1 from the

Bacillus subtilis genome is involved in the regulation of arginine catabolism. Mol Microbiol.

62(2):520-536.

Kingsford CL, Ayanbule K, Salzberg SL. (2007) Rapid, accurate, computational discovery of

Rho-independent transcription terminators illuminates their relationship to DNA uptake.

Genome Biol. 8(2):R22.

Luttinger A, Hahn J, Dubnau D. (1996). Polynucleotide phosphorylase is necessary for competence development in Bacillus subtilis. Mol Microbiol. 19(2):343-356.

166 Merino E. and Yanofsky C. (2002). Regulation by Termination-Antitermination: a Genomic

Approach. Bacillus subtilis and its Closest Relatives. ed Sonenshein AL, Hoch JA and Losick

R, pp-323-336 (ASM Press)

Mitra S, Hue K, Bechhofer DH. (1996) In vitro processing activity of Bacillus subtilis polynucleotide phosphorylase. Mol Microbiol. 19(2):329-342.

Oussenko IA, Bechhofer DH. (2000) The yvaJ gene of Bacillus subtilis encodes a 3'-to-5' exoribonuclease and is not essential in a strain lacking polynucleotide phosphorylase. J

Bacteriol. 182(9):2639-2642.

Oussenko IA, Abe T, Ujiie H, Muto A, Bechhofer DH. (2005) Participation of 3'-to-5' exoribonucleases in the turnover of Bacillus subtilis mRNA. J Bacteriol.187(8):2758-2767.

Rochat T, Delumeau O, Figueroa-Bossi N, Noirot P, Bossi L, Dervyn E, Bouloc P. (2015)

Tracking the Elusive Function of Bacillus subtilis Hfq. PLoS One. 10(4):e0124977.

Storz G, Vogel J, Wassarman KM. (2011) Regulation by small RNAs in bacteria: expanding frontiers. Mol Cell.43(6):880-891.

Tjaden B. (2008) TargetRNA: a tool for predicting targets of small RNA action in bacteria.

Nucleic Acids Res.36(Web Server issue):W109-13.

167 Unniraman S, Prakash R, Nagaraja V. (2002) Conserved economics of transcription termination in eubacteria. Nucleic Acids Res. 30(3):675-684.

168

Vitae

Smarajit Mondal

Education Ph.D in Biochemistry and Molecular Biology, Penn State University (2016) M.Sc in Biotechnology, University of Calcutta, India (2004) B.Sc (Hons.) in Microbiology, University of Calcutta, India (2002)

Publication Mondal, S., Yakhnin, A.V., Sebastian, A., Albert, I., Babitzke, P. NusA-dependent transcription termination prevents misregulation of global gene expression. Nature Microbiology 1 (2016)

Presentations Oral presentation at the ASM General Meeting, Boston, MA (2014) Oral presentation at the Rustbelt RNA Meeting, Pittsburgh, PA (2014) Oral presentation at the ABASM (Alleghany Branch of ASM) Meeting, State College, PA (2012) Poster presentation at FASEB Mechanism and Regulation of Prokaryotic Transcription meeting, Saxtons River, VT (2013)

Honors Braucher Award, Dept. of Biochem. and Mol. Biol. (BMB), Penn State University (2009) The R. Adams Ducher Memorial Scholarship, BMB, Penn State University (2013) Pre-doctoral fellowship, Council of Scientific and Industrial Research (CSIR-NET), India (2004) Summer Research Fellowship, Indian Academy of Sciences (IAS) (2003)

Non-Academic Interests Diploma in Fine Arts, Academy of Music and Fine Arts, India (1998)