Translation Activates the Paused Transcription Complex and Restores

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Proc. Nadl. Acad. Sci. USA Vol. 82, pp. 4663-4667, July 1985 Biochemistry Translation activates the paused transcription complex and restores transcription of the trp operon leader region (tanscripfton-tnlation coupling/transcrIptIon pausing/attenuation/pause complex half-life) ROBERT LANDICK, JANNETrE CAREY*, AND CHARLES YANOFSKY Department of Biological Sciences, Stanford University, Stanford, CA 94305 Contributed by Charles Yanofsky, April 5, 1985 ABSTRACT It has been proposed that RNA polymerase have been identified in the trp (6-11), ilv (12), and thr (13) pausing in the leader region of the tryptophan (tIp) operon of operon leader regions, at the position corresponding to the 3' Escherichia coli is responsible for the synchronization of end of the first RNA hairpin. If the paused RNA polymerase transcription and translation essential to attenuation control. remained at this site until ribosome movement caused re- In this report we use an in vitro coupled transcription/ sumption of transcription, synchronization of transcription translation system to study the effect of tip leader peptide and translation would be accomplished. synthesis on RNA polymerase pausing in the tip leader region. Previous studies with the trp operon demonstrated that (l) Wild-type and translation-defective tip leader templates of E. the predicted stability of the pause RNA hairpin is directly cofi and Sernitia marcescens were employed, and pause RNA correlated with the strength of the pause signal (10, 11); (it) synthesis and paused complex release (activation) were quan- NusA protein enhances pausing by RNA polymerase (9, 10, tified relative to synthesis of the terminated leader transcript. 14); (iih) low concentrations of GTP but not the other NTPs It was observed that pausing in the tip leader region was (guanylic acid is the next nucleotide to be added) also prolonged when translation of the leader transcript was re- enhance pausing (6, 10, 11); (iv) mutant RNA polymerases duced by mutations in the leader region or by addition of the that increase or decrease transcription termination at the trp translation inhibitor kasugamycin or chloramphenicol. Exper- attenuator have analogous effects on pausing (4, 8); and (v) iments with S-30 extracts from a mutant strain that is ineffi- RNA polymerase pausing at the trp leader pause site can be cient in translating the tryptophan codons in the leader detected in a coupled transcription/translation system (11). transcript indicated that ribosome movement to these codons In this report we use the coupled system to show that the also releases the paused transcription complex. These findings ribosome engaged in synthesizing the leader peptide releases indicate that the paused tip leader transcription complex the paused complex.! resumes transcription when released by ribosome movement over the leader peptide coding region. This release would MATERIALS AND METHODS facilitate the coupling of transcription and translation essential to attenuation control. Nucleoside triphosphates, rifampicin, kasugamycin, chlor- amphenicol, and reagents required for cell-free transcription/ Transcription attenuation regulates expression of many ami- translation reactions were purchased from Sigma. [a- no acid biosynthetic operons of enteric bacteria (for recent 32PJGTP and [35S]methionine were from Amersham. RNA reviews, see refs. 1-4). According to the current model of polymerase and tryptophanyl-tRNA synthetase were gener- attenuation, formation ofalternative secondary structures in ous gifts of R. Fisher and K. Muench, respectively. Plasmid the transcript of the leader region controls transcription DNAs used as templates for S-30 reactions were prepared by termination at a site immediately preceding the structural standard procedures (15, 16). Restriction fragments used for genes of the operon. It is believed that translation of a short in vitro transcription reactions were prepared by Sau3A peptide coding region in the leader transcript governs for- (Escherichia coli templates) or Hpa II (Serratia marcescens mation of these alternative transcript secondary structures. templates) digestion of appropriate plasmids (17, 18, 19) and In the trp operons ofall enteric bacteria examined the leader isolated from polyacrylamide gels. S-30 cell-free extracts peptide coding region contains tandem tryptophan codons were prepared from RNaseI- strains as described (20, 21, 22). (5). Ribosome stalling at either ofthese tryptophan codons is In Vitro Transcription (Noncoupled). Paused complex half- believed to promote formation of a transcript secondary lives were determined in synchronized single-round in vitro structure, the antiterminator, that prevents transcription transcription experiments conducted as described (6, 9, 10). termination in the leader region. However, when a ribosome Paused complex half-lives were calculated by linear regres- translates the entire leader peptide coding region without sion analysis of the logarithm of pause RNA concentrations stalling it promotes formation of a different transcript sec- vs. time. ondary structure, the terminator. This secondary structure Coupled Transcription/Translation Reactions. Cell-free causes transcription termination at the attenuator in the transcription/translation experiments were performed essen- leader region. The attenuation model demands that transla- tially as described (20). To measure RNA synthesis unlabeled tion of the leader peptide coding region of the transcript be GTP was replaced by [a-32P]GTP. To measure protein closely coupled to transcription of the leader region. This synthesis unlabeled methionine was replaced by [35S]methi- coupling could be achieved if the polymerase molecule onine. Plasmid DNAs were added to a final concentration of transcribing the leader region paused until it was approached 40 nM. The translation inhibitors chloramphenicol and by the ribosome engaged in translating the leader peptide coding region of the transcript. Transcription pause sites *Present address: Department ofBiochemistry, Stanford University Medical School, Stanford, CA 94305. tIn this paper we use "release of the paused complex" or "paused The publication costs ofthis article were defrayed in part by page charge complex release" to mean that RNA polymerase has resumed payment. This article must therefore be hereby marked "advertisement" transcription elongation after having paused at the trp leader pause in accordance with 18 U.S.C. §1734 solely to indicate this fact. site. 4663 Downloaded by guest on October 2, 2021 4664 Biochemistry: Landick et aL Proc. Natl. Acad Sci. USA 82 (1985) kasugamycin were added to the cell-free extract prior to 1:2 A A mixing with the other reaction components. This order of A A STOP G=C mixing was necessary to achieve even 50%o inhibition of U -G C=G protein synthesis by kasugamycin. Reactions were initiated AAGUUCACG SER C-G by adding the cell-free extract (20% of final volume) and A U-A A THR C=G shifting the mixture to 370C. After 15 min of incubation to A A-U A C=G allow transcription and translation to reach steady-state A ARG G U G c A activity, [a-32P]GTP was added. In time course experiments, U G G U after a 2-min labeling period rifampicin was added to block U TRP G=C A U-A further transcription initiation. Samples were removed and U TRP G=C added to 0.6 vol of phenol at the times indicated. To measure C METLYSALAILEPHEVALLEULYSGLYG=C GACAAUAAAGCAAUUUUCGUACUGAAAGGUU-AU * () steady-state pause RNA levels, the reactions were stopped A with 0.6 vol of phenol after the 2-min labeling period. After T RPL29 centrifugation, the aqueous layers of samples were added to an equal volume of transcription stop mix (23) and electro- B phoresed on 10% polyacrylamide gels containing 7 M urea. A310--lA'.'I A C The relative pause RNA level was determined by counting A G the Cerenkov radiation of gel slices and calculating the molar C=G percent of pause RNA in the total of pause plus leader RNAs C=f=c- -A221- = A-b 1:2 (relative pause RNA level molar percent of pause RNA in AAGUUC=GUCGGAU LEU the total ofpause plus leader RNAs). The relative pause RNA CUG LEU U C level is an arbitrary steady-state measure of the half-life for C=G ARG C=G release of paused transcription complexes and is dependent SER C=G on the length of the labeling period (2 min for all measure- U C-UC ALA IHR C-U ments). Because of the complex kinetics of transcription in A-U VAL the coupled system, we used the relative pause RNA level AUG calculation to simplify analysis of coupled transcription/ ARG A STOP measure A translation pausing data. One complication of this is TRP GUC that transcription read-through at the attenuator influences METASNTHRTYRILESERLEUHISGLYTRP C-G the amount of leader RNA. By using a template containing a GUCUGCAAAUGAACACAUACAUUUCUCUUCACGGUUGGUGG=C (G) strong transcription terminator downstream from the trp FIG. 1. Sequence and secondary structure of trp leader pause attenuator to yield a read-through product of defined length, RNAs. (A) RNA secondary structure predicted for the E. coli trp we estimated the level of read-through at the E. coli trp pause RNA. RNA polymerase pausing occurs at the position marked attenuator to be -4% under our assay conditions. Except for by the boldface arrow. The G -+ A change that is present in trpL29 certain situations reported below, this level did not vary is indicated. Structure 1:2 is thought to be the primary pause signal between wild-type and trpL29 templates or with (10). The G shown in parentheses is the next
Recommended publications
  • Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for Cellular Control and Differentiation

    Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for Cellular Control and Differentiation

    Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for cellular control and differentiation. • Understanding “expression” is a “hot” area in Biology. General Mechanisms 1. Regulate Gene Expression 2. Regulate Protein Activity Operon Model • Jacob and Monod (1961) - Prokaryotic model of gene control. • Always on the National AP Biology exam! Operon Structure 1. Regulatory Gene 2. Operon Area a. Promoter b. Operator c. Structural Genes Gene Structures Regulatory Gene • Makes Repressor Protein which may bind to the operator. • Repressor protein blocks transcription. Promoter • Attachment sequence on the DNA for RNA polymerase to start transcription. Operator • The "Switch”, binding site for Repressor Protein. • If blocked, will not permit RNA polymerase to pass, preventing transcription. Structural Genes • Make the enzymes for the metabolic pathway. Lac Operon • For digesting Lactose. • Inducible Operon - only works (on) when the substrate (lactose) is present. If no Lactose • Repressor binds to operator. • Operon is "off”, no transcription, no enzymes made If Lactose is absent If Lactose is present • Repressor binds to Lactose instead of operator. • Operon is "on”, transcription occurs, enzymes are made. If Lactose is present Enzymes • Digest Lactose. • When enough Lactose is digested, the Repressor can bind to the operator and switch the Operon "off”. Net Result • The cell only makes the Lactose digestive enzymes when the substrate is present, saving time and energy. Animation • http://www.biostudio.com/d_%20Lac%20Ope ron.htm trp Operon • Makes/synthesizes Tryptophan. • Repressible Operon. – Predict how it is different from the inducible operon… If no Tryptophan • Repressor protein is inactive, Operon "on” Tryptophan made. • “Normal” state for the cell.
  • Mirnas and Lncrnas As Novel Therapeutic Targets to Improve Cancer Immunotherapy

    Mirnas and Lncrnas As Novel Therapeutic Targets to Improve Cancer Immunotherapy

    cancers Review miRNAs and lncRNAs as Novel Therapeutic Targets to Improve Cancer Immunotherapy Maria Teresa Di Martino 1,*,† , Caterina Riillo 1,† , Francesca Scionti 2, Katia Grillone 1 , Nicoletta Polerà 1, Daniele Caracciolo 1, Mariamena Arbitrio 3, Pierosandro Tagliaferri 1 and Pierfrancesco Tassone 1 1 Department of Clinical and Experimental Medicine, Magna Graecia University of Catanzaro, 88100 Catanzaro, Italy; [email protected] (C.R.); [email protected] (K.G.); [email protected] (N.P.); [email protected] (D.C.); [email protected] (P.T.); [email protected] (P.T.) 2 Institute of Research and Biomedical Innovation (IRIB), Italian National Council (CNR), 98164 Messina, Italy; [email protected] 3 Institute of Research and Biomedical Innovation (IRIB), Italian National Council (CNR), 88100 Catanzaro, Italy; [email protected] * Correspondence: [email protected] † These authors contributed equally. Simple Summary: Cancer onset and progression are promoted by high deregulation of the immune system. Recently, major advances in molecular and clinical cancer immunology have been achieved, offering new agents for the treatment of common tumors, often with astonishing benefits in terms of prolonged survival and even cure. Unfortunately, most tumors are still resistant to current immune therapy approaches, and basic knowledge of the resistance mechanisms is eagerly awaited. We Citation: Di Martino, M.T.; Riillo, C.; focused our attention on noncoding RNAs, a class of RNA that regulates many biological processes Scionti, F.; Grillone, K.; Polerà, N.; by targeting selectively crucial molecular pathways and that, recently, had their role in cancer cell Caracciolo, D.; Arbitrio, M.; immune escape and modulation of the tumor microenvironment identified, suggesting their function Tagliaferri, P.; Tassone, P.
  • Transcription Initiation Sites of the Leucine Operons of Salmonella Typhimurium and Escherichia Coli

    Transcription Initiation Sites of the Leucine Operons of Salmonella Typhimurium and Escherichia Coli

    J. Mol. Biol. (1983) 170, 39-59 Transcription Initiation Sites of the Leucine Operons of Salmonella typhimurium and Escherichia coli ROBERT M. GEMMILL~', JUDITH W. JONES, GEORGE W. HAUGHN AND JOSEPH M. CALVO Section of Biochemistry, Molecular and Cell Biology Cornell University, Ithaca, IV. Y. 14853, U.S.A. (Received 13 September 1982, and in revised form 15 June 1983) Evidence for a transcription attenuation site downstream from the leu promoter was obtained by transcription experiments in vitro. Most transcription initiated in vitro from teuP is terminated prematurely, resulting in the synthesis of a 160 nucleotide leader RNA. We define here the point at which transcription is initiated in vitro and in vivo and demonstrate that the site of premature termination is between the promoter and the first structural gene (leuA). Additional nucleotide sequences are presented that extend the known sequence 200 base-pairs upstream and 300 base-pairs downstream from leuP. The location of the promoter-proximal end of cistron leuA was deduced by comparing nucleotide sequence data with the sequence of the ten amino acids at the N-terminus of a-isopropylmalate synthase. To facilitate the isolation of quantities of material for sequencing experiments, the enzyme was isolated from a plasmid-containing strain, CV605, grown under conditions of leucine limitation. Under such conditions, about 20% of the total soluble protein of strain CV605 is a-isopropylmalate synthase and another 20~/o is fl-isopropylmalate dehydrogenase (leuB product). 1. Introduction Leucine biosynthesis in enteric bacteria is catalyzed by three enzymes whose levels are co-ordinately regulated by the intracellular concentration of leucine (Calvo et al., 1969a).
  • RNA-Based Regulation of Genes of Tryptophan Synthesis and Degradation, in Bacteria

    RNA-Based Regulation of Genes of Tryptophan Synthesis and Degradation, in Bacteria

    REVIEW RNA-based regulation of genes of tryptophan synthesis and degradation, in bacteria CHARLES YANOFSKY Department of Biological Sciences, Stanford University Stanford, California 94305, USA ABSTRACT We are now aware that RNA-based regulatory mechanisms are commonly used to control gene expression in many organisms. These mechanisms offer the opportunity to exploit relatively short, unique RNA sequences, in altering transcription, translation, and/or mRNA stability, in response to the presence of a small or large signal molecule. The ability of an RNA segment to fold and form alternative hairpin secondary structures—each dedicated to a different regulatory function—permits selection of specific sequences that can affect transcription and/or translation. In the present paper I will focus on our current understanding of the RNA-based regulatory mechanisms used by Escherichia coli and Bacillus subtilis in controlling expression of the tryptophan biosynthetic operon. The regulatory mechanisms they use for this purpose differ, suggesting that these organisms, or their ancestors, adopted different strategies during their evolution. I will also describe the RNA-based mechanism used by E. coli in regulating expression of its operon responsible for tryptophan degradation, the tryptophanase operon. Keywords: trp operon; trp suboperon; aro supraoperon; tna operon; transcription attenuation; T box regulation; tryptophan as a regulatory signal; tRNATrp as a regulatory signal; peptidyl-tRNA; ribosome mediated regulation INTRODUCTION A second regulatory lesson learned over the years is that information within mRNAs, or other RNAs, as well as small Studies over the past 50+ years have revealed that metabolites and other molecules—in addition to DNA and optimization of gene expression has been a major evolu- proteins—often provides specific regulatory signals, or tionary objective for most species.
  • Chapter 3. the Beginnings of Genomic Biology – Molecular

    Chapter 3. the Beginnings of Genomic Biology – Molecular

    Chapter 3. The Beginnings of Genomic Biology – Molecular Genetics Contents 3. The beginnings of Genomic Biology – molecular genetics 3.1. DNA is the Genetic Material 3.6.5. Translation initiation, elongation, and termnation 3.2. Watson & Crick – The structure of DNA 3.6.6. Protein Sorting in Eukaryotes 3.3. Chromosome structure 3.7. Regulation of Eukaryotic Gene Expression 3.3.1. Prokaryotic chromosome structure 3.7.1. Transcriptional Control 3.3.2. Eukaryotic chromosome structure 3.7.2. Pre-mRNA Processing Control 3.3.3. Heterochromatin & Euchromatin 3.4. DNA Replication 3.7.3. mRNA Transport from the Nucleus 3.4.1. DNA replication is semiconservative 3.7.4. Translational Control 3.4.2. DNA polymerases 3.7.5. Protein Processing Control 3.4.3. Initiation of replication 3.7.6. Degradation of mRNA Control 3.4.4. DNA replication is semidiscontinuous 3.7.7. Protein Degradation Control 3.4.5. DNA replication in Eukaryotes. 3.8. Signaling and Signal Transduction 3.4.6. Replicating ends of chromosomes 3.8.1. Types of Cellular Signals 3.5. Transcription 3.8.2. Signal Recognition – Sensing the Environment 3.5.1. Cellular RNAs are transcribed from DNA 3.8.3. Signal transduction – Responding to the Environment 3.5.2. RNA polymerases catalyze transcription 3.5.3. Transcription in Prokaryotes 3.5.4. Transcription in Prokaryotes - Polycistronic mRNAs are produced from operons 3.5.5. Beyond Operons – Modification of expression in Prokaryotes 3.5.6. Transcriptions in Eukaryotes 3.5.7. Processing primary transcripts into mature mRNA 3.6. Translation 3.6.1.
  • Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the Tna Operon of Escherichia Coli

    Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the Tna Operon of Escherichia Coli

    JOURNAL OF BACTERIOLOGY, Aug. 1995, p. 4451–4456 Vol. 177, No. 15 0021-9193/95/$04.0010 Copyright 1995, American Society for Microbiology Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the tna Operon of Escherichia coli CHARLES YANOFSKY* AND VIRGINIA HORN Department of Biological Sciences, Stanford University, Stanford, California 94305-5020 Received 13 March 1995/Accepted 27 May 1995 The growth-inhibiting drug bicyclomycin, known to be an inhibitor of Rho factor activity in Escherichia coli, was shown to increase basal level expression of the tryptophanase (tna) operon and to allow growth of a tryptophan auxotroph on indole. The drug also relieved polarity in the trp operon and permitted growth of a trp double nonsense mutant on indole. Nine bicyclomycin-resistant mutants were isolated and partially characterized. Recombination data and genetic and biochemical complementation analyses suggest that five have mutations that affect rho, three have mutations that affect rpoB, and one has a mutation that affects a third locus, near rpoB. Individual mutants showed decreased, normal, or increased basal-level expression of the tna operon. All but one of the resistant mutants displayed greatly increased tna operon expression when grown in the presence of bicyclomycin. The tna operon of the wild-type drug-sensitive parent was also shown to be highly expressed during growth with noninhibitory concentrations of bicyclomycin. These findings demonstrate that resistance to this drug may be acquired by mutations at any one of three loci, two of which appear to be rho and rpoB. Zwiefka et al. (24) found that the antibiotic bicyclomycin segment and interacts with the transcribing RNA polymerase (bicozamycin), an inhibitor of the growth of several gram- molecule, causing it to terminate transcription (7, 9).
  • I = Chpt 15. Positive and Negative Transcriptional Control at Lac BMB

    I = Chpt 15. Positive and Negative Transcriptional Control at Lac BMB

    BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac B M B 400 Part Four: Gene Regulation Section I = Chapter 15 POSITIVE AND NEGATIVE CONTROL SHOWN BY THE lac OPERON OF E. COLI A. Definitions and general comments 1. Operons An operon is a cluster of coordinately regulated genes. It includes structural genes (generally encoding enzymes), regulatory genes (encoding, e.g. activators or repressors) and regulatory sites (such as promoters and operators). 2. Negative versus positive control a. The type of control is defined by the response of the operon when no regulatory protein is present. b. In the case of negative control, the genes in the operon are expressed unless they are switched off by a repressor protein. Thus the operon will be turned on constitutively (the genes will be expressed) when the repressor in inactivated. c. In the case of positive control, the genes are expressed only when an active regulator protein, e.g. an activator, is present. Thus the operon will be turned off when the positive regulatory protein is absent or inactivated. Table 4.1.1. Positive vs. negative control BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac 3. Catabolic versus biosynthetic operons a. Catabolic pathways catalyze the breakdown of nutrients (the substrate for the pathway) to generate energy, or more precisely ATP, the energy currency of the cell. In the absence of the substrate, there is no reason for the catabolic enzymes to be present, and the operon encoding them is repressed. In the presence of the substrate, when the enzymes are needed, the operon is induced or de-repressed.
  • Binds Multiple Sites Within the Aroh and Trp Operators

    Binds Multiple Sites Within the Aroh and Trp Operators

    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Escherichia cod tryptophan repressor binds multiple sites within the aroH and trp operators Andrew A. Kumamoto, ~ William G. Miller, 2 and Robert P. GunsalusL2 1Molecular Biology Institute and the 2Department of Microbiology, University of Califomia, Los Angeles, Califomia 90024 USA DNase I footprinting and methylation protection studies have been used to analyze the binding of Escherichia coli Trp repressor to the trpR, aroH, and trp operators. The methylation protection assay shows that Trp repressor binds in two successive major grooves of the trpR operator, three successive major grooves of the aroH operator, and four successive major grooves of the trp operator. The simplest model that explains the difference in Trp repressor interaction at the three operators is that the aroH and trp operators are composed of multiple, helically stacked binding sites. When viewed in three dimensions, each site is positioned on a different face of the DNA, and together process up the surface of the DNA helix. Analysis of a deletion derivative of the trp operator supports this model. [Key Words" Trp repressor; aroH operator; trp operator; repressor binding] Received February 23, 1987; revised version accepted June 6, 1987. The Trp repressor of Escherichia coli coordinately regu- and by the isolation of constitutive mutations within lates the expression of the trp, aroH, and trpR operons in the trp operator {Bennett and Yanofsky 1978). These op- response to the intracellular levels of L-tryptophan erator constitutive mutations map at positions -16, (Cohen and Jacob 1959; Brown 1968; Rose et al.
  • Noncoding RNA E

    Noncoding RNA E

    Noncoding RNA E. Desgranges, S. Marzi, K. Moreau, P. Romby, Isabelle Caldelari To cite this version: E. Desgranges, S. Marzi, K. Moreau, P. Romby, Isabelle Caldelari. Noncoding RNA. Microbiology Spectrum, American Society for Microbiology, 2019, 7 (2), 10.1128/microbiolspec.GPP3-0038-2018. hal-02112074 HAL Id: hal-02112074 https://hal.archives-ouvertes.fr/hal-02112074 Submitted on 27 Oct 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Gram-positive pathogens, 3rd Edition (ASM) Staphylococcus section Chapter 5: non-coding RNA Desgranges, E. 1, Marzi, S. 1, Moreau, K. 2, Romby, P1, and Caldelari I1*. 1Université de Strasbourg, CNRS, Architecture et Réactivité de l’ARN, UPR9002, F-67000 Strasbourg, France 2CIRI, International Center for Infectiology Research, Inserm, U1111, Université Claude Bernard Lyon 1, CNRS, UMR5308, École Normale Supérieure de Lyon, Hospices Civils de Lyon, Univ Lyon, F-69008, Lyon, France *corresponding author General introduction Regulatory RNAs have been identified in many bacteria, and in pathogenic bacteria such as Staphylococcus aureus, where they play major roles in the regulation of virulence or metabolic proteins synthesis, beside transcriptional factors and two component systems (Bischoff and Romby, 2016, Tomasini et al., 2014, Guillet et al., 2013, Caldelari et al., 2011).
  • The Arginine Attenuator Peptide Interferes with the Ribosome Peptidyl Transferase Center

    The Arginine Attenuator Peptide Interferes with the Ribosome Peptidyl Transferase Center

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Texas A&M University The Arginine Attenuator Peptide Interferes with the Ribosome Peptidyl Transferase Center Jiajie Wei, Cheng Wu, and Matthew S. Sachs Department of Biology, Texas A&M University, College Station, Texas, USA The fungal arginine attenuator peptide (AAP) is encoded by a regulatory upstream open reading frame (uORF). The AAP acts as a nascent peptide within the ribosome tunnel to stall translation in response to arginine (Arg). The effect of AAP and Arg on ri- bosome peptidyl transferase center (PTC) function was analyzed in Neurospora crassa and wheat germ translation extracts using Downloaded from the transfer of nascent AAP to puromycin as an assay. In the presence of a high concentration of Arg, the wild-type AAP inhib- ited PTC function, but a mutated AAP that lacked stalling activity did not. While AAP of wild-type length was most efficient at stalling ribosomes, based on primer extension inhibition (toeprint) assays and reporter synthesis assays, a window of inhibitory function spanning four residues was observed at the AAP’s C terminus. The data indicate that inhibition of PTC function by the AAP in response to Arg is the basis for the AAP’s function of stalling ribosomes at the uORF termination codon. Arg could inter- fere with PTC function by inhibiting peptidyltransferase activity and/or by restricting PTC A-site accessibility. The mode of PTC inhibition appears unusual because neither specific amino acids nor a specific nascent peptide chain length was required for AAP to inhibit PTC function.
  • The Tryptophan Biosynthetic Pathway Trp Biosynthesis Is a Biologically Expensive, Complicated Process

    The Tryptophan Biosynthetic Pathway Trp Biosynthesis Is a Biologically Expensive, Complicated Process

    E. Coli Trp repressor The tryptophan repressor proteins The trp repressor proteins regulate transcription of several diferent operons located at separate sites on the E. coli chromosome. In addition to the trp operon, this repressor represses transcription of aroH, a single-gene operon that encodes an enzyme required for the synthesis of all aromatic amino acids, and trpR, another single-gene operon encoding the trp repressor itself. Such coordinately regulated operons constitute a regulon. Although all three operons in this regulon are repressed by the trp repressor, the extent of repression varies from about twofold for the aroH operon to seventyfold for the trp operon. This variation results from diferences in the afnity of trp repressor for the specific operator in each of these operons, diferences in the position of the operators relative to the −10 and −35 sequences of each promoter, and diferences in the strengths of the three promoters. Thus the specific nucleotide sequences of the promoters and operators in a regulon allow the same repressor to diferentially regulate transcription of the component operons. The tryptophan biosynthetic pathway Trp biosynthesis is a biologically expensive, complicated process. In fact, the products of four other pathways are essential contributors of carbon or nitrogen during tryptophan formation. Thus, the principal pathway precursor, chorismate, is also the precursor of the other aromatic amino acids, phenylalanine and tyrosine, as well as serving as the precursor of p- aminobenzoic acid and several other metabolites. In addition, glutamine, phosphoribosylpyrophosphate, and L-serine contribute nitrogen and/or carbon during tryptophan formation. FIGURE 1. The genes, enzymes, and reactions of the tryptophan biosynthetic pathway.
  • Open Smarajit Mondal Dissertation

    Open Smarajit Mondal Dissertation

    The Pennsylvania State University The Graduate School Eberly College of Science REGULATION OF TRANSCRIPTION BY NusA AND NusG IN Bacillus subtilis A Dissertation in Biochemistry, Microbiology, and Molecular Biology by Smarajit Mondal © 2016 Smarajit Mondal Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2016 The dissertation of Smarajit Mondal was reviewed and approved* by the following: Paul Babitzke Professor Biochemistry and Molecular Biology Dissertation Adviser Chair of Committee David S. Gilmour Professor of Biochemistry and Molecular Biology Joseph C. Reese Professor of Biochemistry and Molecular Biology Katsuhiko Murakami Professor of Biochemistry and Molecular Biology Philip C. Bevilacqua Professor Chemistry Scott B. Selleck Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School. ii ABSTRACT Transcription in bacteria is regulated at the level of initiation, elongation and termination. Although the regulation of transcriptional initiation is well studied, the regulation of elongation and termination are not well understood. This thesis focuses on understanding the role of NusA on intrinsic termination and the role of NusG on RNA polymerase pausing using genomic, biochemical and computational analyses. Tight regulation of transcription termination is required to maintain proper levels of gene expression in bacteria, because termination failure abolishes operon boundaries, leading to misregulation of downstream genes. NusA is a negative transcription elongation factor that was known to cause a slight stimulation of termination at intrinsic terminators in vitro, but its impact on termination and global gene expression in vivo was not known. In this thesis, I describe the mapping of intrinsic terminators genome wide in B subtilis and measure the effect of NusA on the efficiency of these terminators in vivo using a novel high resolution 3’ end-mapping technique coupled with mRNA profiling.