DOCSLIB.ORG

Mutant Tryptophan Aporepressors with Altered Specificities Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutant Tryptophan Aporepressors with Altered Specificities Of Copyright 0 1991 by the Genetics Society of America Mutant Tryptophan Aporepressors With Altered Specificitiesof Corepressor Recognition Dennis N. Arvidson,' Michael Shapiro' and Philip Youderian' Department of Biological Sciences, University of Southern Calqornia, Los Angeles, Calqornia 90089 Manuscript received November 20, 1990 Accepted for publication January 19, 199 1 ABSTRACT The Escherichia coli trpR gene encodes tryptophan aporepressor, which binds the corepressor ligand, L-tryptophan, to form an active repressor complex. The side chain of residue valine 58 of Trp aporepressor sits at the bottom of the corepressor @-tryptophan) binding pocket. Mutant trpR genes encoding changes of Vals8 to the other 19 naturally occurring amino acids were made. Each of the mutant proteins requires a higher intracellular concentration of tryptophan for activation of DNA binding than wild-type aporepressor. Whereas wild-type aporepressor is activated better by 5- methyltryptophan (5-MT) than by tryptophan, IlesHand other mutant aporepressors prefer tryptophan to 5-MT as corepressor, and Ala5' and GIY'~prefer 5-MT much more strongly than wild-type aporepressor in vivo. These mutant aporepressors are the first examples of DNA-binding proteins with altered specificities ofcofactor recognition. ANY regulatory proteins areallosteric, and bind intermonomer interactions stabilize its extraordinary M small metabolic intermediates that modify their hydrophobic core. The aporepressor dimer denatures activities, allowing the intracellular pattern of gene at a very high temperature (>go") (BAEet al. 1988). expression to respond to physiologicalchange. For Comparisons of the crystal structures of repressor example, the Escherichia coli tryptophan aporepressor (SCHEVITZet al. 1985; LAWSONet al. 1988;OTWI- (TrpR) protein binds DNA poorly. However, when NOWSKI et al. 1988), and aporepressor (ZHANG et al. complexed with L-tryptophan (corepressor), it binds 1987) suggest that activation of the TrpR dimer in- three sites (operators) on theE. coli genome to repress volves repositioning a-helices D and E with respect to transcriptionof the trp (BENNETTand YANOFSKY the rigid hydrophobic core determined by &-helices 1978), aroH (ZURAWSKIet al. 198 l), andtrpR operons A, B, C, and F. Crystal structures of theTrp repressor (GUNSALUSand YANOFSKY1980). Thus, Trp apore- complex show that each of the two symmetric core- pressor mediates the homeostatic control of trypto- pressor binding pockets ina repressor dimeris formed phan biosynthesis. by side chains from both monomers (SCHEVITZet al. Although mutations that alleviate the requirement 1985; LAWSONet al. 1988; OTWINOWSKIet al. 1988). of DNA binding proteins for their allosteric cofactors In these structures, tryptophan participates in hydro- havebeen described (ADHYA and GARGES 1990; philic and hydrophobic interactions with these side MENONand LEE 1990), no mutant repressors oracti- chains (Figure 1). Both the carboxylate and a-ammo- vators with altered specificities of cofactor recognition nium groups of tryptophan areinvolved in hydrogen- have been found to date. In this paper, we describe bonding networks. The carboxylate group forms hy- the first such mutants, Trp aporepressors altered in drogen bonds (H-bonds) with the guanidino group of theirinteractions with L-tryptophanand 5-methyl- Arg*4 from one monomer, and the hydroxyl group of tryptophan (5-MT), a toxic corepressor analog. Thr44' fromits partner monomer('). The ammonium The product of theE. coli trpR gene is a monomer group forms H-bondswith the Ser" hydroxyl and the of 107 amino acids that assembles as a dimer (GUN- main-chain carbonyls of Leu4" and Leu43'. The in- SALUS and YANOFSKY1980; JOACHIMIAK et al. 1983; dole ringmakes multiple hydrophobic interactions ARVIDSON, BRUCEand GUNSALUS 1986).The crystal with side chains that mold the binding pocket. The structure of Trp aporepressor (ZHANG et al. 1987) plane of the indole ring is sandwiched between the shows that each monomer is a bundle of six a-helices, A-F. Four of the six a-helices, A, B, C, and F are parallel, extended aliphatic side chains of ArgR4 and interwoven in thedimer, and multiple, symmetric Arg54, and the C5-C7 edge of the indole ring packs against the branched hydrophobic side chains ofIIe5' I Present address: California Institute of Biological Research, 11099 N. and Val5*. The corepressor, L-tryptophan, must act Torrey Pines Road, La Jolla, California 92037. * Present address: Department of Biochemistry. University of California, like a keystone in the hydrophobic core of aporepres- Berkeley, California 94720. sor. Its hydrophobic indole ring is buried in an "argi- Genetics 128: 29-35 (May, 1991) 30 N. D. Arvidson, M. Shapiro and P. Youderian FIGURE1 .-The structure of the L-tryptophan (corepressor) binding pocket is shown as a stereo pair of diagrams. The y-methyl group of ValsRpoints toward the 5tarbon of bound tryptophan. Reprinted from SCHEVITLet al. (I 98.5) with permission from P. B. SIGLER. nine sandwich" and framed by hydrophobic interac- (5-MT) more tightly than tryptophan as corepressor tions, and its hydrophilic functional groups are on the (MARMORSTEINet al. 1987; D. N. ARVIDSONand R. surface of the repressor complex. P. GUNSALUS,unpublished results). However, by no means do the crystal structures of To investigate the nature of corepressor binding, tryptophan repressor give us a complete understand- we have examined the effects of all possible amino ing of how tryptophan binds as corepressor and elicits acid changes of residue valine 58. Thesemutants allow the allosteric change between aporepressor and re- us to explore the role of this residue in a manner pressor. In part, this is because structural differences independent of the conclusions we may draw from a between aporepressor and repressor are obscured by structure in vitro. Several amino acid changes should lattice interactions in the crystals. For example, the shorten or lengthen the Va15'side chain without com- sum ofRMS (root mean square) differences in the promising its hydrophobiccharacter. Therefore, if coordinates of two different crystal forms of repressor the carbon4 of tryptophan is close to the y-methyls is greater than the sum of differences between the of Val"" in the repressor complex, then a subset of same form of aporepressor and repressor (LAWSONet Val5" changes (including Ile"Rand Ala") should alter al. 1988). the preference of aporepressor for 5-MT and trypto- In addition, the pattern of specific weak bonds that phan. Indeed, we show that manyof these mutant stabilizes tryptophan binding in the crystal structures aporepressors have altered specificities of corepressor recognition. Even more surprisingly, we find that a of repressor must be different than the patternin vivo. wide variety of amino acid changes are tolerated at The crystal structures do not explain two things. First, this residue position, suggesting that the corepressor Thr44appears to make an important bond with the binding pocket is much less rigid than the structures tryptophan carboxylate in vitro, the change Thr4' + represented in the crystals. Ala has only a subtle effect on tryptophan binding in vitro (HE andMATTHEWS 1990). Second, the distance MATERIALS AND METHODS between carbon-5 of the tryptophan indole and they- methyl carbons of Val5' in the repressor crystal struc- Bacteria, phage and plasmids: Bacterial strains are deriv- atives of S. typhimurium LT2 or E. coli K12. Salmonella tures (ca. 3.8A) (SCHEVITZet al. 1985; LAWSONet al. strain MSl363 (leuA-am414 SUPE)(SUSSKIND 1980) was used 1988) is tooshort to accommodate an additional for the permissive growth of challenge phages; MS1868/ methyl group. This is disturbing because the related F'lacP' (BASSet al. 1987) carrying plasmid pPY2000 was Enterobacter aerogenes and Enterobacter cloacae trypto- used for challenge phage assays. The "Trp" challenge phage used to assay DNA-binding in vivo, P22 KnY 0-ref1arc- phan aporepressors are predicted to have isoleucine, amH1605 (BASSet al. 1987) carries a minimal reference-type not valine, at this position (our unpublished results). trp operator, 5' GAACTAGTTAACTAGTTC3', control- Furthermore, aporepressorbinds 5-methyltryptophan ling ant expression. Plasmid pPY2000 is a derivative of Mutant Aporepressors 31 pPY 150 (BENSONet al. 1986) missing the sequences between Ana1 the Sal1 and sites of its pBR322 backbone. Mutant plasmld pPY 2000 derivatives of pPY2000 were made by site-directed muta- frpR genesisusing the degenerate mismatch primer,5' CGTGCCTATTNNSGAAGAGCTG 3' and the "clean-up" 1 primer, 5' CGTGCTTATTSRAGAACAGCTG 3' (TAY- Trp aporepressor LOR,OTT and ECKSTEIN1985). Mutagenized plasmids were + t transformed into E. coli strain X90/F'lacfe1 (AMANN,BRO- 4- L-tryptophan SIUS and PTASHNE 1983) andsequenced by the method of SANGER,NICKLEN and COULSON(1977), using the oligonu- cleotide 5'GTCGACCTGCTTAAGAATGCC 3' includ- 1 I ing codons 23 to 29 of trpR, as primer. Strain CG103 (Alac- 00 repressor Trp pro AtrpR505 ara thi recA56 srl::TnlO)/XCLGI45) (D. N. I ARVIDSONand C. G. ARVIDSON,unpublished results) carries a lambda prophage with a fusion of the trp operator/pro- moter region and start of trpE to lacZ. Quantitation of mutant proteins: E. coli CG103 with each mutant derivative of plasmid pPY2000 was grown in Trp "drop-out" medium (BASSet al. 1987) with 50 pg/ml proline, 100 pg/ml thiamine and 400 pg/ml carbenicillin, to a density of 2 X 1O8/rnl. Proteins were resolved by SDS polyacrylanlide gel electrophoresis (SCHAGGERand
Load more

Recommended publications
  • 16.1 | Regulation of Gene Expression
    436 Chapter 16 | Gene Expression 16.1 | Regulation of Gene Expression By the end of this section, you will be able to do the following: • Discuss why every cell does not express all of its genes all of the time • Describe how prokaryotic gene regulation occurs at the transcriptional level • Discuss how eukaryotic gene regulation occurs at the epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels For a cell to function properly, necessary proteins must be synthesized at the proper time and place. All cells control or regulate the synthesis of proteins from information encoded in their DNA. The process of turning on a gene to produce RNA and protein is called gene expression. Whether in a simple unicellular organism or a complex multi-cellular organism, each cell controls when and how its genes are expressed. For this to occur, there must be internal chemical mechanisms that control when a gene is expressed to make RNA and protein, how much of the protein is made, and when it is time to stop making that protein because it is no longer needed. The regulation of gene expression conserves energy and space. It would require a significant amount of energy for an organism to express every gene at all times, so it is more energy efficient to turn on the genes only when they are required. In addition, only expressing a subset of genes in each cell saves space because DNA must be unwound from its tightly coiled structure to transcribe and translate the DNA. Cells would have to be enormous if every protein were expressed in every cell all the time.
    [Show full text]
  • Formation of Heterodimers Between Wild Type and Mutant Trp Aporepressor Polypeptides of Eschem'chia Coli Thomas J
    PROTEINS: Structure, Function, and Genetics 4:173-181 (1988) Formation of Heterodimers Between Wild Type and Mutant trp Aporepressor Polypeptides of Eschem'chia coli Thomas J. Graddis,' Lisa S. Klig,' Charles Yanofsky,' and Dale L. Oxender' 'Department of Biological Chemistry, University of Michigan, Ann Arbor, Michigan 48109 and 'Department of Biological Sciences, Stanford University, Stanford, California 94305 ABSTRACT Availability of the three-dimen- tophan.1-6 The trp aporepressor is activated by the sional structure of the trp repressor of Escherichia binding of two molecules of its corepressor. Once ac- coli and a large group of repressor mutants has per- tivated, trp repressor binds to the operators of the trp, mitted the identification and analysis of mutants aroH, and trpR operons, regulating transcription ini- with substitutions of the amino acid residues that tiati~n.~,'The aroH and trp operons encode biosyn- form the tryptophan binding pocket. Mutant apore- thetic enzymes, whereas the trpR operon encodes the pressors selected for study were overproduced using trp aporepressor. The trpR gene has been cloned and a multicopy expression plasmid. Equilibrium di- its nucleotide sequence determined.3 The aporepres- alysis with ''C-tryptophan and purified mutant and sor and repressor have been purified and the crystal wild type aporepressors was employed to determine structures of both have been solved at high resolu- tryptophan binding constants. The results obtained ti~n.~-"The trp aporepressor is a dimer of identical indicate that replacement of threonine 44 by methi- 107 residue polypeptides." The existence of the three- onine (TM44) or arginine 84 by histidine (RH84) low- dimensional structures, and the availability of many ers the affinity for tryptophan approximately two- repressor mutants,2i12has facilitated this analysis of and four-fold, respectively.
    [Show full text]
  • Application of Models for Biomolecular Structure and Interactions to Understand and Influence Biological Function
    Application of Models for Biomolecular Structure and Interactions to Understand and Influence Biological Function Zur Erlangung des akademischen Grades eines DOKTORS DER NATURWISSENSCHAFTEN (Dr. rer. nat.) Fakultät für Chemie und Biowissenschaften Karlsruher Institut für Technologie (KIT) - Universitätsbereich genehmigte DISSERTATION von Irene Meliciani aus Rom (Italien) Dekan: Prof. Dr. Martin Bastmeyer Referent: Prof. Dr. Stefan Bräse Korreferent: Apl. Prof. Dr. Wolfgang Wenzel Tag der mündlichen Prüfung: 19.10.2011 a mamma e papà Application of Models for Biomolecular Structure and Interactions to Understand and Influence Biological Function Irene Meliciani Karlsruher Institut für Technologie Institut für Nanotechnologie Intitut für Organische Chemie Zusammenfassung Die Forschung in den Lebenswissenschaften hat in den letzten Jahrzehnten zu einem enormen Wissensgewinns bezüglich der Abläufe zellulärer Prozesse und ihrer Steuerung geführt. Die Steuerung biologischer Prozesse wird vielfach über Kontaktwechselwirkungen der daran beteiligten Biomoleküle bewältigt. Mit dieser Arbeit möchte ich zu einem besseren Verständnis biomolekularer Interaktionen beitragen. Ein Teil dieser Arbeit beschäftigt sich mit der Untersuchung von Proteininteraktionen, wobei als Methoden für die Modellierung von Protein-Protein-Wechselwirkungen (POEM) und für die Protein-Liganden-Wechselwirkung (FLEXSCREEN) eingesetzt wurden. Es wurden die Interaktionen der Chemokinrezeptoren CCR3 und CXCR1 mit für den Entzündungsverlauf wichtigen Steuerungsmolekülen (Chemokinen)
    [Show full text]
  • Teaching Gene Regulation in the High School Classroom, AP Biology, Stefanie H
    Wofford College Digital Commons @ Wofford Arthur Vining Davis High Impact Fellows Projects High Impact Curriculum Fellows 4-30-2014 Teaching Gene Regulation in the High School Classroom, AP Biology, Stefanie H. Baker Wofford College, [email protected] Marie Fox Broome High School Leigh Smith Wofford College Follow this and additional works at: http://digitalcommons.wofford.edu/avdproject Part of the Biology Commons, and the Genetics Commons Recommended Citation Baker, Stefanie H.; Fox, Marie; and Smith, Leigh, "Teaching Gene Regulation in the High School Classroom, AP Biology," (2014). Arthur Vining Davis High Impact Fellows Projects. Paper 22. http://digitalcommons.wofford.edu/avdproject/22 This Article is brought to you for free and open access by the High Impact Curriculum Fellows at Digital Commons @ Wofford. It has been accepted for inclusion in Arthur Vining Davis High Impact Fellows Projects by an authorized administrator of Digital Commons @ Wofford. For more information, please contact [email protected]. High Impact Fellows Project Overview Project Title, Course Name, Grade Level Teaching Gene Regulation in the High School Classroom, AP Biology, Grades 9-12 Team Members Student: Leigh Smith High School Teacher: Marie Fox School: Broome High School Wofford Faculty: Dr. Stefanie Baker Department: Biology Brief Description of Project This project sought to enhance high school students’ understanding of gene regulation as taught in an Advanced Placement Biology course. We accomplished this by designing and implementing a lab module that included a pre-lab assessment, a hands-on classroom experiment, and a post-lab assessment in the form of a lab poster. Students developed lab skills while simultaneously learning about course content.
    [Show full text]
  • Development of Novel Transgenic Zebrafish
    DEVELOPMENT OF NOVEL TRANSGENIC ZEBRAFISH MODELS AND THEIR APPLICATION TO STUDIES ON ENVIRONMENTAL OESTROGENS Submitted by Jon Marc Green to the University of Exeter as a thesis for the degree of Doctor of Philosophy in Biological Sciences, September 2016 This thesis is available for Library use on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. I certify that all material in this thesis which is not my own work has been identified and that no material has previously been submitted and approved for the award of a degree by this or any other University. (Signature) ……………………………………………(Jon Marc Green) 1 Abstract Oestrogenic chemicals have become increasingly associated with health effects in wildlife populations and humans. Transgenic animal models have been developed to understand the mechanisms by which these oestrogenic chemicals alter hormonal signalling pathways and how these alterations can lead to chronic health effects. The use of highly informative transgenic animal models will also result in better use and potential reduction of intact animals used in animal testing in line with the principles of the 3Rs. In this thesis work, two novel oestrogen responsive transgenic zebrafish models have been generated to investigate the effects of oestrogenic chemicals, identify their tissue targets and better understand the temporal dynamics of these responses. Both models express the pigment-free ‘Casper’ (a mutant line lacking skin pigment) phenotype, which facilitate identification of responding target tissues in the whole fish in all fish life stages (embryos to adults). The oestrogen response element green fluorescent (ERE-GFP)-Casper model was generated by crossing an established ERE-GFP line with the skin pigment free Casper line.
    [Show full text]
  • Binds Multiple Sites Within the Aroh and Trp Operators
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Escherichia cod tryptophan repressor binds multiple sites within the aroH and trp operators Andrew A. Kumamoto, ~ William G. Miller, 2 and Robert P. GunsalusL2 1Molecular Biology Institute and the 2Department of Microbiology, University of Califomia, Los Angeles, Califomia 90024 USA DNase I footprinting and methylation protection studies have been used to analyze the binding of Escherichia coli Trp repressor to the trpR, aroH, and trp operators. The methylation protection assay shows that Trp repressor binds in two successive major grooves of the trpR operator, three successive major grooves of the aroH operator, and four successive major grooves of the trp operator. The simplest model that explains the difference in Trp repressor interaction at the three operators is that the aroH and trp operators are composed of multiple, helically stacked binding sites. When viewed in three dimensions, each site is positioned on a different face of the DNA, and together process up the surface of the DNA helix. Analysis of a deletion derivative of the trp operator supports this model. [Key Words" Trp repressor; aroH operator; trp operator; repressor binding] Received February 23, 1987; revised version accepted June 6, 1987. The Trp repressor of Escherichia coli coordinately regu- and by the isolation of constitutive mutations within lates the expression of the trp, aroH, and trpR operons in the trp operator {Bennett and Yanofsky 1978). These op- response to the intracellular levels of L-tryptophan erator constitutive mutations map at positions -16, (Cohen and Jacob 1959; Brown 1968; Rose et al.
    [Show full text]
  • Pathogen Xylella Fastidiosa
    articles The genome sequence of the plant pathogen Xylella fastidiosa The Xylella fastidiosa Consortium of the Organization for Nucleotide Sequencing and Analysis*,Sa˜o Paulo, Brazil * A full list of authors appears at the end of this paper ............................................................................................................................................................................................................................................................................ Xylella fastidiosa is a fastidious, xylem-limited bacterium that causes a range of economically important plant diseases. Here we report the complete genome sequence of X. fastidiosa clone 9a5c, which causes citrus variegated chlorosis—a serious disease of orange trees. The genome comprises a 52.7% GC-rich 2,679,305-base-pair (bp) circular chromosome and two plasmids of 51,158 bp and 1,285 bp. We can assign putative functions to 47% of the 2,904 predicted coding regions. Efficient metabolic functions are predicted, with sugars as the principal energy and carbon source, supporting existence in the nutrient-poor xylem sap. The mechanisms associated with pathogenicity and virulence involve toxins, antibiotics and ion sequestration systems, as well as bacterium–bacterium and bacterium–host interactions mediated by a range of proteins. Orthologues of some of these proteins have only been identified in animal and human pathogens; their presence in X. fastidiosa indicates that the molecular basis for bacterial pathogenicity is both conserved and independent of host. At least 83 genes are bacteriophage-derived and include virulence-associated genes from other bacteria, providing direct evidence of phage-mediated horizontal gene transfer. Citrus variegated chlorosis (CVC), which was first recorded in Brazil meningitidis10 (53.7%). This may reflect the lack of previous in 1987, affects all commercial sweet orange varieties1. Symptoms complete genome sequences from phytopathogenic bacteria.
    [Show full text]
  • The Tryptophan Biosynthetic Pathway Trp Biosynthesis Is a Biologically Expensive, Complicated Process
    E. Coli Trp repressor The tryptophan repressor proteins The trp repressor proteins regulate transcription of several diferent operons located at separate sites on the E. coli chromosome. In addition to the trp operon, this repressor represses transcription of aroH, a single-gene operon that encodes an enzyme required for the synthesis of all aromatic amino acids, and trpR, another single-gene operon encoding the trp repressor itself. Such coordinately regulated operons constitute a regulon. Although all three operons in this regulon are repressed by the trp repressor, the extent of repression varies from about twofold for the aroH operon to seventyfold for the trp operon. This variation results from diferences in the afnity of trp repressor for the specific operator in each of these operons, diferences in the position of the operators relative to the −10 and −35 sequences of each promoter, and diferences in the strengths of the three promoters. Thus the specific nucleotide sequences of the promoters and operators in a regulon allow the same repressor to diferentially regulate transcription of the component operons. The tryptophan biosynthetic pathway Trp biosynthesis is a biologically expensive, complicated process. In fact, the products of four other pathways are essential contributors of carbon or nitrogen during tryptophan formation. Thus, the principal pathway precursor, chorismate, is also the precursor of the other aromatic amino acids, phenylalanine and tyrosine, as well as serving as the precursor of p- aminobenzoic acid and several other metabolites. In addition, glutamine, phosphoribosylpyrophosphate, and L-serine contribute nitrogen and/or carbon during tryptophan formation. FIGURE 1. The genes, enzymes, and reactions of the tryptophan biosynthetic pathway.
    [Show full text]
  • Welcome to Part 3 of Bio 219
    Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext 31454 E-mail – [email protected] Lectures and other resources are available online at http://www.as.wvu.edu/~dray. Go to ‘Courses’ link Chapter 12: The Cell Nucleus and Control of Gene Expression The Cell Nucleus… • Every somatic cell contains the same genetic information regardless of whether it is expressed the same way. • Just as in a building under construction, all workers have access to the complete set of blueprints. • However, the workers constructing the floors only use the information related to their word and the workers installing the wiring only use the information related to their project. • Brain cells only express genes related to brain activity and liver cells only express the genes related to their activity. The Cell Nucleus… • The nucleus of most cells is typically amorphous and consists of: – The chromosomes (in the form of chromatin) – Nucleoli – Nucleoplasm – The nuclear matrix • All surrounded by the nuclear envelope The Cell Nucleus… • The nuclear envelope is complex; consists of several distinct components: 2 cellular membranes arranged parallel to one another & separated by 10 - 50 nm – Separates genetic material in nucleus from cytoplasm - important distinction between prokaryotes & eukaryotes; its appearance is an evolutionary landmark • 1. Serves as barrier; keeps ions, solutes, macromolecules from passing between nucleus & cytoplasm The Cell Nucleus… • The nuclear envelope… – B. Fused at sites forming circular pores that contain complex assemblies of proteins • 1. Average mammalian cell: contains ~3000 nuclear pores • 2.
    [Show full text]
  • Dna Binding Domains in Eukaryotic Transcription Factors
    Dna Binding Domains In Eukaryotic Transcription Factors Tre convulsing her tramplings harmfully, inappeasable and animalic. Which Manny phonate so plumb that Ted rankling her rails? Glairiest and unhinged Sandy never womanise peradventure when Allie overstrides his scourers. Dna with the dna binding components in eukaryotic transcription in factors binding dna binding strength of related. If they bind both the building blocks cookies must traverse the vicinity of factors binding dna in transcription factors are? What do not give rise to eukaryotic proteins bind to improve computational approaches and domain that favors aggregation during folding is able to improve customer experience. These domains are comparable domain. What two domains are eukaryotic rna polymerase are? Article you have these factors binding dna sequences using clustering by calculating differences for eukaryotic transcription factor binds. Pictorial representation overlaid, eukaryotic transcription are turned off multiple isoforms have discovered that at concentration. We vary from each of their regulation of transcription through this eukaryotic transcription. The label for statistically overrepresented motifs are also cause a transcription. Two proteins are to accept cookies from four separate lines or due to do? Irradiation of sequence similarity between length of three transcription factors to promote and expressed, a first combining chemical process. Myc is basic residues whose side, factors and dna, genetic information possible by chance if you have been associated with structural unit. Gene regulation or decreased gene editing. An important regulatory domain. This dna binding factors. Xt pondr prediction accuracy of transcriptional regulators of binding factors: a plausible model due to detect. Double fortification of eukaryotic transcription machinery and eukaryotic transcription in dna binding domains.
    [Show full text]
  • DNA Microarray Analysis of Gene Expression in Response to Physiological and Genetic Changes That Affect Tryptophan Metabolism in Escherichia Coli
    DNA microarray analysis of gene expression in response to physiological and genetic changes that affect tryptophan metabolism in Escherichia coli Arkady B. Khodursky*, Brian J. Peter†, Nicholas R. Cozzarelli†, David Botstein‡, Patrick O. Brown*§, and Charles Yanofsky¶ʈ Departments of *Biochemistry and ‡Genetics, §Howard Hughes Medical Institute, Stanford University School of Medicine, and ¶Department of Biological Sciences, Stanford University, Stanford, CA 94305; and †Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720 Contributed by Charles Yanofsky, August 29, 2000 We investigated the global changes in mRNA abundance in Esche- uation as well as by repression (1, 2, 9, 11). The aroH operon richia coli elicited by various perturbations of tryptophan metabolism. specifies one of three nearly identical enzymes (the other two are To do so we printed DNA microarrays containing 95% of all annotated specified by aroF and aroG) that catalyze the first reaction in the E. coli ORFs. We determined the expression profile that is predomi- common pathway of aromatic amino acid biosynthesis (12). The mtr nantly dictated by the activity of the tryptophan repressor. Only three operon encodes a tryptophan-specific permease (13, 14), the trpR operons, trp, mtr, and aroH, exhibited appreciable expression operon encodes the trp aporepressor (15, 16), and the aroL operon changes consistent with this profile. The quantitative changes we encodes one of two enzymes that catalyze the same reaction in the observed in mRNA levels for the five genes of the trp operon were common aromatic pathway (17, 18). The mtr and aroL operons are consistent within a factor of 2, with expectations based on estab- also transcriptionally regulated by TyrR, the general aromatic lished Trp protein levels.
    [Show full text]
  • In Vivo and in Vitro Studies of Trpr-DNA Interactions Jie Yang†, Angelo Gunasekera†, Teresa A
    J. Mol. Biol. (1996) 258, 37–52 In vivo and in vitro Studies of TrpR-DNA Interactions Jie Yang†, Angelo Gunasekera†, Teresa A. Lavoie, Lihua Jin Dale E. A. Lewis and Jannette Carey* Chemistry Department The binding of tryptophan repressor (TrpR) to its operators was examined Princeton University quantitatively using in vitro and in vivo methods. DNA sequence Princeton, NJ 08544-1009 requirements for 1:1 and tandem 2:1 (TrpR:DNA) binding in various (609) 258-1631, USA sequence contexts were studied. The results indicate that the optimal half-site sequence for recognition by one helix-turn-helix motif of one TrpR 5' GNACT 3' dimer is 3' CNTGA 5', consistent with contacts observed by X-ray diffraction analysis of cocrystalline 1:1 and 2:1 complexes. Half-sites can be paired to form a palindrome either by direct abutment, forming the nucleation site for a tandem 2:1 complex, or with an 8-base-pair spacer, forming a 1:1 target. Dimethylsulfate (DMS) methylation-protection footprinting in vitro of 1:1 and 2:1 complexes formed sequentially on the two unequal half-site pairs of the trpEDCBA operator from Serratia marcescens indicated an obligate hierarchy of site occupancy, with one half-site pair serving as the nucleation site for tandem binding. DMS footprinting of Escherichia coli operators in vivo showed that, over a wide range of intracellular TrpR concentration, the trpEDCBA operator is occupied by three repressor dimers, aroH is occupied by two dimers, and the 1:1 binding mode is used on the trpR operator. The coexistence of these distinct occupancy states implies that changes in protein concentration affect only the fractional occupancy of each operator rather than the binding mode, which is determined by the number of half-site sequences present in the operator region.
    [Show full text]