TRANSCRIPTIONAL AND TRANSLATIONAL REGULATION BY TNF
AND IFN CONTROLS MULTIPLE CELLULAR FUNCTIONS
By
KUO-SHENG HSU
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Thesis advisor: Hung-Ying Kao, Ph.D.
Department of Biochemistry CASE WESTERN RESERVE UNIVERSITY
May, 2015 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of Kuo-Sheng Hsu candidate for the degree of Doctor of Philosophy *.
Committee Chair Yu-Chung Yang, Ph.D. Committee Member David Samols, Ph.D. Committee Member Ruth Keri, Ph.D. Committee Member Colleen Croniger, Ph.D. Committee Member Hung-Ying Kao, Ph.D.
Date of Defense March 25th, 2015
*We also certify that written approval has been obtained for any proprietary material contained therein
Table of Contents
Table of Contents ...... 1
List of Tables ...... 8
List of Figures ...... 9
Acknowledgements ...... 14
List of Abbreviations ...... 16
Abstract ...... 21
Chapter 1. Introduction ...... 23
I. TNF-induced inflammatory response trough transcriptional regulation ...... 23
TNF and TNF receptors ...... 24
TNF downstream signaling controls inflammation, cell survival and apoptosis
...... 28
Long-term TNF stimulation suppresses global protein synthesis but selectively
induces a subset of mRNA translation via the activation of their 5’UTR IRESs ... 32
TNF controls NFB-mediated transactivation through the canonical IKK-IB
axis ...... 36
1
NFB Feedback loop and the dynamics of transcriptional activation of NFB
...... 38
Other models for selective NFB target gene expression ...... 40
Removal of NFB complex from chromatin ...... 40
Other pathways involved in regulation of NFB activity ...... 42
TNF and inflammation-associated diseases ...... 44
TNF and cancer ...... 44
TNF and diabetes ...... 45
Targeting TNF as a therapeutic approach against inflammation-related
diseases ...... 45
II. SMRT and transcriptional repression ...... 47
The model of nuclear receptor and co-repressor-mediated gene regulation .... 47
The exchange of cofactors controlled by ligand binding ...... 48
NR-mediated trans-repression through ligand-induced NR-sumoylation ...... 51
Depression of co-repressors by multiple signaling mechanisms ...... 53
2
The reciprocal exchange of active and repressive transcription factor complex
on co-regulatory cistromes ...... 55
SMRT/NCOR structure ...... 56
The core components of the SMRT/NCoR repression complexes ...... 57
SMRT/NCoR and nuclear receptor interaction ...... 61
SMRT/NCoR and other transcription factor interaction ...... 62
Regulation of SMRT ...... 65
Transcription and alternative splicing ...... 65
Regulation of SMRT by post-translational modification ...... 66
Mouse studies on SMRT/NCoR ...... 73
SMRT/NCoR knockout mice are embryonic lethal ...... 73
SMRT knockin mice ...... 75
Genome-wide study demonstrates the role of SMRT in the homeostasis of immunity ...... 77
Clinical investigation of SMRT-associated diseases ...... 81
3
III. Promyelocytic Leukemia protein (PML) ...... 87
PML protein structure ...... 87
PML Nuclear bodies ...... 91
PML function ...... 92
Regulation of transcription by PML ...... 92
Regulation of protein translation and post-translational modification by PML
...... 93
Regulation of PML ...... 96
Transcriptional and translational control of PML ...... 96
Sumoylation ...... 98
Phosphorylation ...... 100
PML degradation mediated by ubiquitination and viral components ...... 102
Other modifications ...... 104
Cytoplasmic PML ...... 105
TNF induced-apoptosis through PML ...... 106
4
TNF-mediated anti-angiogenesis via PML ...... 108
TNF-induced inflammation mediated by PML ...... 109
IV. -TrCP1-mediated poly-ubiquitination and protein turnover ...... 117
UPS system controls protein stability ...... 117
-TrCP1 structure and function ...... 123
The regulation of -TrCPs ...... 128
The biological function of -TrCP1 ...... 131
-TrCP1, cell cycle and tumorigenesis ...... 131
-TrCP1 and inflammation response ...... 135
V. IFN-induced activation of Stats by Pml ...... 145
VI. Our research strategy ...... 154
Chapter 2: beta-Transducin repeat-containing protein 1 (beta-TrCP1)-mediated silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) protein degradation promotes tumor necrosis factor alpha (TNFalpha)-induced inflammatory gene expression...... 156
Abstract ...... 156 5
Introduction ...... 157
Materials and Methods ...... 160
Results ...... 168
Conclusion and Discussion ...... 190
Chapter 3: Translational control of PML contributes to TNF-induced apoptosis of
MCF7 breast cancer cells and decreased angiogenesis in HUVECs ...... 210
Abstract ...... 210
Introduction ...... 211
Results ...... 214
Discussion ...... 242
Materials and Methods ...... 246
Chapter 4: The role of PML in IFN-induced activation of Stat1/Stat2/Stat3 ...... 275
Abstract ...... 275
Results ...... 276
Discussion and Future Directions ...... 294
6
Materials and Methods ...... 298
Chapter 5: Discussion and Implication ...... 306
References ...... 318
7
List of Tables
Table 1. Summary of SMRT regulation and the corresponding factors ...... 70
Table 2. Summary of animal models in SMRT functional research and the current
studies of SMRT function by next generation ChIP-seq ...... 83
Table 3. Summary of PML regulation and the corresponding factors ...... 111
Table 4. Summary of β-TrCP substrates, the conserved degron motifs and their
function ...... 138
Table 5. siRNA sequence for -TrCP1 and SMRT ...... 199
Table 6. PCR primer sequences for chapter 2 ...... 200
Table 7. ChIP primer sequences for chapter 2 ...... 201
Table 8. A list of primer sequences and siRNA and shRNA target sequences for
chapter 3 ...... 269
Table 9. A list of bi- and mono-cistronic reporter plasmids for chapter 3 ...... 272
Table 10. A list of antibodies for chapter 3...... 273
Table 11. The experimental materials for chapter 4 ...... 304
8
List of Figures
Figure 1. Summary of physiological and pathological function of TNFα ...... 25
Figure 2. An overview of TNFα downstream signaling and its regulation of NFκB
activation ...... 29
Figure 3. Current models of co-regulator regulation and co-regulator-mediated
transcriptional regulation ...... 49
Figure 4. Schematic representation of SMRT co-repressor and SMRT isoforms ..... 58
Figure 5. The classic model of the switch of NR LBD-co-activator and NR LBD-co-
repressor interaction via agonists and antagonists ...... 63
Figure 6. Schematic representation of the PML gene and its isoforms and
subcellular localizations ...... 89
Figure 7. The process of ubiquitin and ubiquitin-like modification...... 121
Figure 8. Structure of SCF-β-Trcp1-Skp1-Cul1 E3 complex and β-Trcp1-mediated
ubiquitination...... 126
Figure 9. PML has a dual function in regulating Stat1 and Stat3 during IFN
stimulation ...... 153
9
Figure 10. The effects of SMRT knockdown on expression of TNFα-inducible genes
...... 170
Figure 11. The effects of β-TrCP1 on SMRT protein accumulation ...... 174
Figure 12. SMRT and β-TrCP1 associate in mammalian cells ...... 178
Figure 13. β-TrCP1 promotes TNFα-induced SMRT polyubiquitination and
proteolysis ...... 183
Figure 14. The effects of the β-TrCP1-SMRT axis on the expression of TNFα-
inducible genes ...... 188
Figure 15. A model depicting TNFα-induced gene expression through the β-TrCP1-
SMRT axis ...... 197
Figure 16. Knockdown of β-TrCP1 by four siRNAs ...... 202
Figure 17. TNFα treatment in HUVECs does not change SMRT mRNA ...... 204
Figure 18. β-TrCP1 mediated SMRT down-regulation is independent of Cdk2/Pin1
pathway ...... 206
Figure 19. In vitro association of SMRT fusion proteins and β-TrCP1 are post-
translational modification dependent and independent ...... 208
10
Figure 20. TNF induces PML protein accumulation without changing protein
stability ...... 216
Figure 21. TNF increases PML protein accumulation in a p38 kinase-dependent
manner ...... 219
Figure 22. MNK1 is a p38 downstream kinase that mediates TNF-induced PML
protein ...... 222
Figure 23. Identification of PML 5’-UTR (-100->-1) as an IRES activated by the TNF-
MNK1 axis ...... 225
Figure 24. MNK1 mediates TNF-induced inhibition of cell migration and capillary
tube formation in ECs ...... 229
Figure 25. Inhibition of PML, p38 or MNK1 decreases TNF-inducible MCP-1 and
MMP10 mRNA expression ...... 232
Figure 26. TNF-mediated MCP-1 and MMP10 mRNA expression is controlled by
MNK1-PML-HDAC7 axis ...... 236
Figure 27. MNK1 mediates TNF-induced PML protein accumulation and apoptosis
in MCF7 breast cancer cells ...... 240
Figure 28. Inhibition of MAPK activity by kinase-specific inhibitors ...... 257 11
Figure 29. The effect of p38 knockdown on TNF-mediated accumulation of PML
NBs ...... 259
Figure 30. Mapping of minimal PML IRES ...... 261
Figure 31. A diagram of putative products derived from spurious splicing in pRF bi-
cistronic system ...... 263
Figure 32. The effect of knockdown of PML or HDAC7 on the expression of a subset
of chemokines and angiostatic factors ...... 265
Figure 33. A sequence alignment of the mammalian PML 5’-UTR and a putative
RNA secondary structure of human PML IRES...... 267
Figure 34. Prolonged IFN treatment induces Isgylation of Stat1 and Stat2...... 278
Figure 35. Knockdown of PML compromised IFN-induced isgylation of nuclear
Stat1/Stat2 ...... 283
Figure 36. Depletion of PML in endothelial cells reduces IFN-induced Stat1 target
gene expression ...... 286
Figure 37. The effect of Usp18 on IFN-mediated Stat1 isgylation, cell migration
and capillary tube formation ...... 289
12
Figure 38. PML reduces accumulation of nuclear Stat3 and p-Stat3 by promoting its
degradation ...... 292
13
Acknowledgements
First, I would like to thank my advisor, Dr. Hung-Ying Kao. He is an assiduous advisor and a dedicated scientist. He always kept his patience with my problems and taught me how to be a tough and successful scientist. Without his support and mentoring, I can not have my confidence to overcome many unexpected difficulties and continue doing research to have some performances in the scientific field.
I also want to thank my loved parents, Li-Ching and Ching-Chieh. They always provide me what they can offer in my life and hope that I will have a better life and career in the future. Without their support, I can not come here to pursue my dream and complete my Ph.D. degree. My wife, Yi-Jiun, is an amazing mother and the best research assistant in my graduate studies. Thank you for your endless love and time taking care of our small family. My dear daughter, Levina, was wonderful relief when
I confronted different problems. Also, I have many thanks to Drs. Wayne Hsieh and
Cathy Soong for their encouragement and help.
Additionally, I would like to thank my committee for their inspirations and suggestions on my thesis projects. Specially, Dr. David Samols and Dr. Ruth Keri, always provided 14
thoughtful comments on my studies and were the best readers of my works. My thesis chair, Dr. Yu-Chung Yang gave me a lot of useful suggestions on my projects and on my academic career. Dr. Colleen Croniger spent her valuable time joining my thesis defense examination. I also thank Dr. Maria Hatzoglou for her generosity and wise suggestions.
Finally, I want to thank everyone who had ever helped me in the past years. Your kind assistance warmed my soul and gave me positive energy to be a better man and a successful scientist.
This work was partially supported by National Institutes of Health Grants R01
DK078965 and HL093269 (to H.-Y. K.) and R37 DK060596 and R01 DK053307 (to M. H.)
15
List of Abbreviations
AP-1 Activator protein-1
APL Acute promyelocytic leukemia
ARE AU rich element
Bcl-6 B-cell lymphoma 6 protein (Transcription repressor)
Bora Protein aurora borealis (Aurora kinase activator)
CamK Ca2+/calmodulin-dependent kinase
ChIP Chromatin immunoprecipitation
Ck1 Casein kinase 1
Claspin G2/M checkpoint protein
Co-A Co-activator
COMMD1 Copper metabolism domain containing 1
Co-R Co-repressor
CoRNR box Corepressor nuclear receptor box
C-Rel Cellular cognate of v-Rel
CRL Cullin RING ubiquitin ligase
DAD Deacetylase activation domain
Daxx Death domain-associated protein
DISC Death inducing signaling complex
Dnapk DNA-dependent protein kinase (an atypical protein kinase of the
PIKK family)
E2F1 Cell cycle G1/S phase transcription activator
ECS Elongin-B-elogin-C-cullin-2-SOCS1
16
EGFR Epidermal growth factor receptor
Emi1 Early mitotic inhibitor 1
ERbB2 v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
ERK Extracellular signal-regulated kinases
ER Estrogen receptor alpha
Ets leukemia E26 transformation-specific leukemia
FADD Fas-Associated protein with Death Domain
Gli Effectors of Hedgehog (Hh) signaling
Gps2 G protein pathway suppressor 2
HAT Histone acetyltransferase
HDAC Histone deacetylase
HECT E6-associated protein C-terminus
Hipk2 Homeodomain interacting protein kinase 2
HUVEC Human umbilical vein endothelial cell
IFN Interferon
IKK IκB kinase
IRES Internal ribosomal entry site
ITAF IRES trans-acting factor
ITGB1 Integrin beta-1
IB Inhibitor of NFB
JNK c-Jun N-terminal kinases
Kaiso Transcription repressor binding to CpG dinucleotide
Klhl20 Kelch-like family member 20 (E3 ubiquitin ligase)
17
LBD Ligand binding domain
LPS Lipopolysaccharide
LXR Liver X receptor
MAPK Mitogen activated protein kinase
Mcl1 Myeloid cell leukemia 1 (Induced myeloid leukemia cell
differentiation protein)
Mdm2 Mouse double minute 2 homolog (E3 ubiquitin ligase)
MEF Mouse embryonic fibroblast
MEK Mitogen-activated protein kinase kinase
MHC1 Local major histocompatibility class1
MNK Mitogen-activated protein kinase-interacting serine/threonine kinase
MSK1 Mitogen and stress-activated kinase
NCoR Nuclear corepressor
NEMO NFB essential modulator
NFB Nuclear factor kappa-light-chain-enhancer of activated B cells
NIK NFB inducing kinase
NLS Nuclear localization sequence
NR Nuclear receptor
Pdcd4 Programmed cell death protein 4
PDLIM2 PDZ and LIM domain protein 2
Per2 Period circadian protein homolog 2
PIAS Protein inhibitor of activated STATs
Pin1 Peptidyl-prolyl-cis-trans isomerase 1
PKC Protein kinase C 18
Plk1 Polo-like kinase 1
PML Promyelocytic leukemia protein
PML NB PML nuclear body
PPAR peroxisome proliferator-activated receptor gamma
RA Retinoic acid
RBP-JK Recombining binding protein suppressor of hairless
RD Repression domain
REF Rat embryonic fibroblast
RelA v-rel avian reticuloendotheliosis viral oncogene homolog A
RelB v-rel avian reticuloendotheliosis viral oncogene homolog B
Rest RE1-Silencing Transcription factor
RID Receptor interaction domain
RING U-box E3 ligase and the really interesting new gene
RIP Receptor-interacting protein kinases
ROS Reactive oxygen species
SCF Skp, Cullin, F-box containing complex
Senp4 Sentrin-specific proteases (SUMO protease)
SMRT Silencing mediator of retinoic acid and thyroid hormone receptor
Stat Signal transducers and activators of transcription
TAK1 Transforming growth factor beta activated kinase-1
Tap63 Tumor protein p63 (a member of the p53 family of transcription
Factor)
19
TCF T cell factor (Transcription factors downstream of WNT)
Tetherin/bst-2 Bone marrow stromal antigen 2 (viral restriction factors)
TF Transcription factor
TGF- TGF--activated kniase-1
TNFR Tumor necrosis factor receptor
TNF Tumor necrosis factor alpha
TR Thyroid hormone receptor
TRADD TNFR1-associated death domain protein
TRAF TNF receptor-associated factor
TRAIL TNF-related apoptosis-inducing ligand
TRe Transcription repressor
TSA Trichostatin A
Uhrf1 Ubiquitin-like, containing PHD and RING finger domains 1
UPS Ubiquitin-proteasome system
Usp18 Ubiquitin specific peptidase 18
Wee1 Cell cycle G2 checkpoint kinase
-TrCP Beta-Transducin repeat-containing protein
20
Transcriptional and Translational Regulation by TNF and IFN Controls Multiple
Cellular Functions
Abstract By
KUO-SHENG HSU
TNF and IFN are pleiotropic cytokines with cytotoxic and inflammatory activities that participate in anti-bacterial and anti-viral infection, respectively. Recently, we and others have demonstrated that TNF and IFN also function as angiostatic cytokines, blocking endothelial cell migration and capillary tube formation in vitro. After conjugating with their cognate receptors, TNF and IFNtransduce their signals by various cytoplasmic pathways, including kinase cascades, posttranslational modification, translation and caspase-mediated proteolysis. By these means, upstream signaling is transmitted to the nucleus so that TNF and IFN responsive nuclear components and transcription factors can be either modified or regulated, eventually leading to changes in transcription patterns and cell fate. Some evidence has supported that TNF and IFNcontrol transcription through the regulation of specific transcription factors while the underlying mechanisms are still elusive. In this study, I demonstrate that TNF up-regulates the expression of a subset of target genes
21
through up-regulation of the E3 ubiquitin ligase, -TrCP1. TNF-mediated induction of -TrCP1 promotes ubiquitination and degradation of the transcriptional co- repressor SMRT, an NFB transcriptional co-repressor, resulting in derepressed
SMRT/NFB target genes. I have also discovered that TNF treatment in primary endothelial cells (ECs) and MCF7 breast cancer cells leads to the accumulation of the tumor suppressor protein PML, through increased translation. This mechanism involves activation of the TNF downstream p38-MNK1 kinase axis, which activates an internal ribosome entry site (IRES) in the 5’-UTR of PML mRNA. IRES utilization for
PML translation contributes to the ability of TNF to inhibit angiogenesis and to promote breast cancer apoptosis. Finally, I investigated the mechanism by which PML promotes IFN signaling by its ability to regulate the activity of Stat1, 2 and 3. Using human ECs and Pml-/- mice aortic cells, our data suggest that PML is a critical regulator of IFN signaling through both positive and negative feedback regulation. Overall, our study demonstrates that TNF and IFN control cell fate by both transcription- dependent and -independent mechanisms.
22
Chapter 1. Introduction
I. TNF-induced inflammatory response trough transcriptional regulation
Harboring enigmatic tumor necrotic activity, a magic endotoxin-induced serum factor was reported by Coley’s group in 1891 and named as Coley’s toxins (1). In 1984, two cytotoxic components involved in this tumor inhibitor, TNF and TNF, were identified from human lymphoblastoid and promyelomonocytic conditioned medium, respectively (2,3). Based on cDNA sequence homology, a total of 19 TNF family members and 29 corresponding receptors have been identified and their function intensively investigated (4). In the beginning, TNF was viewed as a powerful anti- tumor agent; however, its significance in cancer therapy was later found to be complicated because of its severe toxicity and an unwanted systematic inflammatory response (5-7). In addition to a contradictory function against tumors, TNFand other
TNF superfamily members are viewed as major players in inflammation that activate
NF-B pathway and subsequently promote expression of pro-inflammatory genes, including IL6, IL8 and MCP-1 (8). It is notable that acute inflammation induced by pathogen and tissue injury is critical for tissue repair and host defense. However, chronic inflammation caused by obesity and systematic inflammatory disorder has been linked to many diseases, including cancer, atherosclerosis, rheumatoid arthritis,
23
neurodegeneration and insulin resistance (9,10) (Figure 1). Interestingly, TNF production by immune cells or metabolic cells has been found in chronic inflammation
(9,10). Abundant evidence also demonstrates that blockade of TNF function ameliorates insulin resistance in obese mice and symptoms in patients with rheumatoid arthritis, suggesting the involvement of TNF in inflammation-associated diseases (10,11). In addition to inflammatory response, TNF also controls cell proliferation and apoptosis because of its ability to govern broad downstream mitogen-activated protein kinases (MAPKs) and caspase-mediated apoptotic pathways. Some studies also suggested that TNF is involved in cell migration, morphological changes and differentiation (12)(Figure 1). In my study, I focused on the function of TNF in inflammation, apoptosis and angiogenesis through regulation of transcription regulators and their downstream target genes.
TNF and TNF receptors
TNF and TNF are 25 and 17 kDa peptides that share ~50% homology in their amino acid sequences (2,3,13). Although TNF and TNFhave similar effects on cellular proliferation, apoptosis and inflammation, these two components demonstrate
24
Figure 1. Summary of physiological and pathological function of TNFα
25
Figure 1. Summary of physiological and pathological function of TNF
TNFis an inflammatory cytokine mainly produced by macrophage, endothelial and natural killer cells. TNFhas multiple functions and contributes to several cellular processes, including proliferation, apoptosis, metabolism and autophagy. Due to the secretion of TNF mainly in the immune and hematopoietic systems, the exquisite regulation of TNF in the body is important to control the inflammation and tissue homeostasis. Furthermore, TNFhas positive and negative effects on physiology and pathology. The unbalanced TNFsignaling is a major cause to several diseases as listed.
26
distinct patterns in expression, secretion and the receptor conjugation (14). As circulating cytokines, both TNF and TNF are expressed and secreted by immune cells but TNF is expressed preferentially in macrophages and endothelial cells. In the human hematopoietic system, TNF is initially expressed as a transmembrane protein and is proteolytically cleaved to its mature soluble form; however, TNF is only found as a soluble ligand (4,15). TNF and TNF demonstrate similar affinity to the universally expressed TNFR1 and tissue-specific TNFR2, which is primarily expressed on immune cells, nerve cells and endothelial cells. Instead of different expression patterns, TNFR1 and TNFR2 also demonstrate distinct characteristics for ligand binding and intracellular partner interaction. For example, TNFR1 binds to the soluble form of
TNF but TNFR2 mostly conjugates with membrane-bound TNF. Furthermore,
TNFR1 can be cleaved as a soluble protein to antagonize its ligand TNF(16).
Additionally, membrane-associated TNF has been suggested as a therapeutic agent due to reciprocal TNF-TNFR signaling (17,18). Based on their intracellular domains,
TNFR1 and TNFR2 are categorized into two different groups. TNFR1 belongs to the
death receptor family because it harbors a ~50 amino acid intracellular death domain which governs caspase-dependent apoptosis (19). In contrast to TNFR1, TNFR2 does not contain a death domain, but harbors cytoplasmic P-X-Q-X-T motifs capable of
27
recruiting TNF receptor-associated factor (TRAF), resulting in activated kinase- associated inflammation and increased survival signaling (20).
TNF downstream signaling controls inflammation, cell survival and apoptosis
Conjugation of TNF to TNFR1/2 activates several downstream pathways, including
MAPK cascades, NFB-mediated gene expression, cell survival signaling and caspase- induced apoptosis (4) (Figure 2). Unlike most transmembrane receptors, TNFR does not have intrinsic kinase activity and transduces signals through its cytoplasmic domains via associated proteins (4). Using biochemical and genetic approaches, multiple TNFR interacting proteins have been identified and named TRAFs. Through
TNFR1-associated death domain protein (TRADD), TRAF2 is recruited to
TNFactivated TNFR1 and transduces inflammatory and cell survival signaling through NFB (21). In the classical TNF activation pathway, NFB essential modulator (NEMO)-mediated IB phosphorylation and proteolysis results in the release of cytoplasmic NFB from IB and subsequent translocation to the nucleus, where NFB binds cognate sequences and activates a subset of inflammatory and anti- apoptotic genes. Additionally, TRAF2 activates JNK kinase through the recruitment of
JNK upstream kinases, MEKK1 and MKK7. This pathway eventually leads to activation 28
Figure 2. An overview of TNFα downstream signaling and its regulation of NFκB activation
29
Figure 2. An overview of TNF downstream signaling and its regulation of NFB activation
Soluble form of TNF secreted by immune or endothelial cells can stimulate surrounding cells that express TNFR1 trimeric receptors. The first cellular sensor of
TNF signaling is TNFR1 associated death domain protein (TRADD) which mediates (1)
TRAF-MAPK cascade-mediated activation of AP-1 transcription factors, (2) MNK-eIF4E- mediated translation, (3) NIK-IKK-mediated NFB transcriptional activation, and (4)
IKK-mediated derepression of transcription corepressors. These axes ultimately result in cell survival or inflammatory gene expression. Additionally, TNF signaling also promotes Fas-Associated protein with death domain (FADD)-caspase-mediated apoptotic pathway, depending on the cellular context and the duration of stimuli.
Several positive and negative feedback loops are marked in green and red lines, respectively.
30
of JNK and transcription factor, activator protein-1 (AP-1)-mediated cell survival
(22,23). Through a distinct mechanism, the TRAF2 downstream kinase, TGF-- activated kniase-1 (TAK-1), can also activate AP-1 through integrating RIP, MK3 and p38 signaling cascades (24,25). In contrast to TRAF2-mediated pro-inflammatory and survival pathway, Fas-associated protein with death domain (FADD) induces caspase-
3-mediated apoptosis through the up-regulation of mitochondrial reactive oxygen species (ROS) and the conventional FADD-caspase apoptotic cascade (26). As discussed above, TNF stimulation activates both cell survival and apoptotic pathways. It is still unclear how the diverse pathways downstream of TNF determine the final cell fate. A proposed model suggests that in the early phase TNF-activated
NFB induces several anti-apoptotic genes and thereby attenuates TNF-mediated cell apoptosis in the late phases of TNF stimulation (27). Indeed, blockade of NFB- mediated cell survival gene expression has been shown to cause cells to be susceptible to apoptosis after TNF treatment (27). In addition, the accumulation of ROS and sustained activation of JNK by TNF stimulation leads to a switch from a pro-survival condition to an apoptotic state (26). TNF-induced cell apoptosis does not commonly occur in most primary mammalian cells unless normal cellular conditions are changed, including inhibition of protein synthesis and alternation of cell cycle or metabolism
31
(28). Unlike most primary cells, transformed cells are more susceptible to TNF- induced cell apoptosis due to genetic and metabolic aberration (28,29). Given that
TNFR2 harbors a cytoplasmic TRAF binding motif but not a death domain, activation of TNFR2 pathway induces AP-1- and NFB-mediated pro-inflammatory and survival signaling via TRAF2-dependent kinase modules. As to the isoform TNF, although it can bind to TNFR1 and TNFR2, the detailed downstream pathways are not clearly established and TNF-mediated pro-inflammatory signaling has been shown to be not as significant as TNF(30).
Long-term TNF stimulation suppresses global protein synthesis but selectively induces a subset of mRNA translation via the activation of their 5’UTR IRESs
TNF senses downstream signaling through a positive feedback loop that involves
MNK kinases. These kinases, including MNK1 and MNK2, are two mammalian serine/ threonine kinases that phosphorylate the mRNA cap-binding protein, eIF4E and may facilitate eIF4E-mediated translation although the detailed mechanism is still unclear and controversial (31,32). Several reports have demonstrated that the activation of
MNK1 is controlled by either p38 or ERK kinase, depending on the stimulus (33-35).
Upon TNF exposure, the ERK and p38 kinase-activated MNK1 is capable of 32
phosphorylating the AU rich element (ARE) binding protein, hnRNPA1 and facilitate the release of hnRNPA1 from the 3’UTR of TNF mRNA (35). Consequently, the reduction of hnRNPA1 occupancy on TNF mRNA attenuates hnRNPA1-mediated blockade of the entry of translational machinery and thereby elevates TNF protein synthesis (35) (Figure 1). During long-term TNF stimulation, several components of translation machinery, such as eIF4GI and eIF4B, are cleaved and inactivated by activated caspases (36). In addition, an increase in PKR-mediated eIF2 phosphorylation and a reduction in the phosphorylation of eIF4E inhibitor, 4E-BP1, are also observed in TNF-induced apoptotic cells. As a result of these molecular mechanisms, TNF treated cells exhibit inhibition of global protein synthesis when cells undergo apoptosis (29,37). Accordingly, the abundance of most proteins are down-regulated during apoptosis while translation of a small subset of mRNAs is either maintained or elevated under this translation unfavorable condition (38). It is reasonable to speculate that most of selectively expressed proteins are apoptosis- associated components and that the translation control of those proteins is key to trigger cell death (39). One mechanism to selectively translate mRNAs is to utilize an internal ribosomal entry sites (IRES). IRES is a specific RNA element that can recruit translation machinery in the middle of mRNA and initiate protein synthesis in an
33
mRNA 5’ cap-dependent manner. Most of IRESs are found in 5’UTR of mRNAs but some are located in the coding region (39). Although the detailed mechanism of IRES activation is largely unclear, several kinases, such as p38 and MNK1, and IRES- associated factors (ITAFs), are known to play critical roles in IRES-mediated translation
(36,40). Of the kinases, p38 has been shown to activate c-MYC IRES activity and contribute to TNF-related apoptosis-inducing ligand (TRAIL)-mediated translation of c-
MYC mRNA during apoptosis. In addition, the p38-MNK1 kinase cascade also enhances rapamycin-induced c-MYC mRNA translation via activation of its IRES activity (41).
Similarly, the activity of the CYCLIND mRNA 5’UTR IRES is positively controlled by p38 and ERK in response to rapamycin treatment but attenuated by the p38 and ERK negative regulator AKT (42). ITAFs are a group of RNA binding proteins that are usually involved in RNA splicing or transport but have the ability to modify and stabilize IRES structures to assist in the access of ribosomes and other translational factors. Several
ITAFs have been identified that facilitate apoptotic factor expression via their association with IRESs. For example, apoptotic protease activating factor 1 (Apaf-1), which is required for caspase activation, is almost undetectable under resting conditions. In response to stresses, the APAF-1 IRES is activated through an association with PTB, Unr or DAP5 and this is a major mechanism to facilitate ribosomal entry and
34
increase the efficiency of APAF-1 mRNA translation (36). In addition to the direct recruitment of ribosomes, several reports also suggest that the formation of an IRES and ITAF complex in the nucleus, named nuclear experience, is a prerequisite to activate an IRES and that the translocation of the IRES-ITAF complex from nucleus to cytoplasm is one of key steps to regulate IRES activity (43,44). Intriguingly, altering specific kinase activity can result in the change of IRES activity, suggesting that the function of ITAFs can be regulated by specific kinases. Indeed, phosphorylation of hnRNPA1 serine 199 by AKT blocks hnRNPA1 function in the activation of c-MYC and
CYCLIN D1 IRES without changing IRES-hnRNPA1 association (42). In contrast, another
ITAF, PDCD4, has been shown to bind XIAP and BCL-XL IRES and inhibit their translation. Phosphorylation of PDCD4 by S6K2 kinase triggers PDCD4 degradation and
in turn reduces PDCD4-mediated inhibition of XIAP and BCL-XL mRNA translation (43).
Another well-established example is the regulation of p53 mRNA translation via its second IRES located in the first 120 nucleotides of the coding region. Upon DNA damage, the activated DNA damage response kinase, ATM, phosphorylates HDMX and promotes its binding to the second IRES of p53 mRNA, thus remodeling IRES structure and promoting access of the HDMX-associated HDM2 protein (45). Through this mechanism, p53 IRES-bound HDMX and HDM2 synergistically increase p53 protein
35
synthesis, which may contribute to p53 tumor suppressor function (46). Rather than regulated by transacting factors, some IRESs harbor RNA sequences complementary to 18S rRNA, the RNA subunit of 40S ribosome so that they can directly recruit ribosomes for translation initiation (47). Through the mechanisms discussed above,
IRES can selectively regulate translation of a subset of mRNAs and switch cell fate between survival and apoptosis. Nevertheless, the mechanism by which TNF regulates IRES-mediated translation that contributes to apoptosis remains largely unknown and requires further investigation.
TNF controls NFB-mediated transactivation through the canonical IKK-IB axis
NFB are well-studied TNF responsive transcription factors that controls a large subset of inflammation-associated and pro-survival genes. Shortly after the identification of TNF, Balitmore’s group first identified immunoglobulin enhancer sequence associated transcription factors that were later known as NFB (48).
Thereafter, Michael Karin’s group elegantly elucidated that TNF activates NFB through the canonical IKK-IB axis (49) (Figure 2). There are five members of NFB family in mammalian cells, including RelA (p65), RelB, c-Rel, NFB1 (p50) and NFB2
(p52) (50). Based on the similarity of their functional domains, the NFB family can be 36
further categorized to two subfamilies, Rel and NFB (51). The N-terminus of both groups harbor a conserved nuclear localization sequence and a Rel homology domain that binds DNA and IB. However, only the Rel subfamily proteins contain C-terminal transactivation domain, which interact with basal transcription machinery and activate transcription (51). The precursor forms of NFB1 and NFB2 are longer polypeptides with several ankyrin repeats and the mature forms, p50 and p52, are the products after proteolysis of the ankyrin repeats upon stimulation (51). In mammals, the major form of NFB appears as heterodimers, such as p50/p50, p50/p52 and most common p50/p65 (51).
Two general working models were proposed that activate NFB transcriptional activity in response to TNF: canonical and non-canonical pathways. In the absence of an activating signal, dimeric NFB is sequestered in the cytoplasm by its cognate inhibitors, IBs, including IB and (50). Upon TNF stimulation, the activation of downstream IKK kinase complex results in the phosphorylation of IB serine 32 and serine 36 residues, which promotes its recognition by ubiquitin E3 ligase -TrCP and subsequent proteasome-mediated degradation (52-54). Degradation of IB enables nuclear translocation of p50/p65 hetero-dimer to the nucleus and binding to B
37
elements present in target gene promoters or enhancers (50). Recently, a non- canonical pathway, induced by TNF, was discovered. In this pathway, the ligation of
TNF and its cognate receptor activates NFB inducing kinase (NIK) and
IKKphosphorylation. The activated IKK triggers p100 phosphorylation at Ser 866 and Ser 870 and subsequently promotes poly-ubiquitination and proteasome- mediated proteolysis of p100, which leads to the production of p52 (55-58). p52 can form a heterodimer with RelB and bind to DNA elements to trans-activate target genes. Noticeably, albeit the non-canonical pathway primarily generates p52/RelB hetero-dimers to regulate gene expression, in some cell types it can also cause the activation of canonical pathway via a crosstalk mechanism (51).
NFB Feedback loop and the dynamics of transcriptional activation of NFB
The models discussed above oversimplify the downstream signaling of TNF stimulation. In fact, NFB activation can also trigger IB expression so that the NFB activity is turned off through a negative feedback mechanism (59). In addition to IB,
A20 is another NFB negative regulator that is rapidly induced by TNF-mediated
NFB activation (60). A20 harbors seven C2/C2 zinc fingers and functions as a E3 ubiquitin ligase to catayze poly-ubiquitination and degradation of TNFR1-associated 38
receptor-interacting protein (RIP) kinase, through which the downstream IKK activity is blocked and NFB signaling is attenuated (60). Since NFB activation and the negative feedback loop occur sequentially during the TNF stimulation, the two types of NFB responses are dependent on the duration and dose of TNF treatment.
Considering nuclear translocation of NFB as an indicator of its activation, the acute exposure of TNFinduces a rapid NFB activation and the signal is diminished in an hour; However, long-term TNF stimulation results in a biphasic NFB signal due to the interplay between NFB and ensuing negative feedback loop (59,61). The oscillation of NFB activation can last for several hours and induce an array of NFB target gene expression. In IB -/- cells, the oscillation of NFB activation is abolished, resulting in expression of the NFB-inducible gene set. This observation indicated a requirement of IB in the feedback loop of NFB signaling. Biochemical analysis and computational simulation indicated that the model of selective expression of NFB target genes by temporal control of NFB activation includes three phases of sequential transcription activation, depending on the persistence and amplitude of
NFB oscillation (59,61,62).
39
Other models for selective NFB target gene expression
An accumulation of studies have demonstrated that the regulation of NFB-mediated gene expression is controlled by various mechanisms, including degradation of NFB, post-translational modification of NFB, the switch of NFB-associated co-regulators and change of chromatin environment for NFB removal. These pathways have been shown to contribute to selective induction of NFB target genes, depending on environmental cues. Although the detailed mechanism and the signaling crosstalk requires further elucidation, a general picture of these regulatory mechanisms has been proposed and summarized below.
Removal of NFB complex from chromatin
The re-synthesis of IB induced by NFB activation is commonly considered as a feedback mechanism that blocks nuclear translocation of NFB. However, this model can not completely explain how to clear the chromatin-bound NFB in the late phase of transactivation. Several possible mechanisms have been proposed for this process, such as ubiquitin-mediated proteolysis, nuclear body sequestration of NFB, blockade of NFB-DNA binding and nuclear export of NFB-IB complexes. In the first context,
40
another NFB induced protein, suppressor of cytokine signaling-1 (SOCS1) has been identified as an ubiquitin E3 subunit which brings the p65 complex to elongin-B-elogin-
C-cullin-2-SOCS1 (ECS) for p65 poly-ubiquitination and sebsequent proteolysis (63,64).
In addition to ECS, PDZ and LIM domain protein 2 (PDLIM2) also serves as an ubiquitin ligase to promote p65 degradation (65); additionally, overexpression of PDLIM2 increases p65 sequestration in PML nuclear bodies and thereby silences NFB target gene expression (65). In the context of ECS-mediated p65 degradation, two other components, copper metabolism domain containing 1 (COMMD1) and peptidyl- prolyl-cis-trans isomerase 1 (Pin1) have been suggested as a positive regulator and a negative inhibitor in this process, respectively (66,67). Phosphorylation of p65 by IKK also promotes its poly-ubiquitination and degradation while the detailed mechanism and upstream signaling is still unknown. NFB is also Sumo conjugated. Sumoylation of NFB by the sumo ligase, PIAS, inhibits its DNA binding activity, thus reduces NFB- mediated transactivation (68). Interestingly, the re-synthesized IB can bind nuclear
NFB and replenish cytoplasmic NFB through nucleus-cytoplasm shuttling. The interaction of NFB and IB in the nucleus facilitates the removal of DNA bound NFB and is negatively regulated by NFB acetylation by p300/CBP acetyltransferase or
41
positively by HDAC3-mediated deacetylation (51). This model is based on IB translocation into the nucleus.
Other pathways involved in regulation of NFB activity
Precise regulation of gene expression relies on local chromatin remodeling mediated by chromatin bound transcription factors that recruit co-regulators and chromatin modifiers that include acetyltransferases, deacetylases, methytransferases and histone specific kinases (69). NFB has been shown to interact with co-activators and co-repressors and an exchange of co-regulators is proposed as an important mechanism for selective gene expression (50,51,69). Under resting conditions, some
NFB target genes are negatively controlled by the repressive p50/p50 hetero-dimer, which directly interacts with HDAC1/2 or recruits HDAC3 through the co-repressor
SMRT (70). Upon TNF stimulation or other inflammatory signals, activated nuclear
IKK phosphorylates SMRT and disrupts this SMRT-HDAC3 interaction, facilitating the replacement of SMRT complex by the acetylatransferases CBP/P300 and enhancing the chromatin access to basal transcription machinery (70-73). We have previously reported that, during TNF stimulation, the nuclear scaffold protein PML, is highly up- regulated with a concomitant increase of PML nuclear bodies (NBs). The increase in 42
PML NB number relieves HDAC7-mediated repression of target genes by sequestering
HDAC7 (74,75). Additionally, stress kinases, such as mitogen and stress-activated kinase (MSK1) and IKK, enhance NFB and proximal histone phosphorylation, resulting in an increase of CBP/P300 occupancy at the surrounding regions, thereby trans-activating gene expression (73,76-78). Notably, not only the switch of co- regulators, in some cases, the replacement of an entire repressive complex by an activating complex has been observed to initiate a subset of NFB target gene expression. For example, in macrophage, without stimulation, most inflammatory genes are repressed by the BCL-6 guided SMRT/NCOR repressive complex and turned on through replacement of the BCL-6 complex with a NFB-associated HAT complex upon LPS stimulation (79,80).
In addition to the mechanisms described above, several new regulators including BCL-
3, IBNS and Akirin, have recently been identified that play a role in TNF/NFB- mediated gene regulation (50). In this study, we focus on how TNF induces inflammatory gene expression by removal of co-repressors, including SMRT and
HDAC7. Since NFB is the major transcription factor that controls the TNF-mediated inflammatory response, we will emphasize this pathway in the next sections.
43
TNF and inflammation-associated diseases
In heart failure patients, chronic inflammation and a higher TNF concentration are found in their circulatory system. TNF production is viewed as a key contributor to heart failure and stroke (81). Chronic inflammation also plays a pivotal role in exacerbating cardiovascular diseases and inflammation-associated diseases (82).
Since TNF and its downstream NFB signaling are critical for triggering an inflammatory response, several reports have been suggested targeting TNF as a possible approach for the treatment of inflammation-associated diseases.
TNF and cancer
Aberrant inflammation has been linked to tumorigenesis. In addition to inflammation,
TNF and NFB also play a role in angiogenesis, cell proliferation, apoptosis and metastasis (83-85). Elevated levels of TNF or TNFR have been found in several tumors, including ovarian, breast and colon cancer (86-88). Furthermore, sustained
TNF and NFB activation have been proposed as key pathways that increase tumor resistance to adjuvant chemotherapy due to their ability to promote cancer cell survival (89).
44
TNF and diabetes
In both mouse models or in humans, obesity also results in TNF expression. This is particularly true in adipocytes which are a major secretory tissue producing massive
TNF and causing an inflammatory response (90). Other findings also clearly demonstrated a positive correlation between obese adipose tissue-secreted TNF and insulin resistance (90,91). In this study, TNF was found to trigger dephosphorylation of insulin receptor substrate-1 and thus lower insulin sensitivity (91).
Targeting TNF as a therapeutic approach against inflammation-related diseases
Since TNF and TNF receptor-mediated signaling pathways play a role in apoptosis, cell survival and inflammation, antibodies that block the conjugation of TNF to its receptors have been largely approved by FDA as therapeutic agents in autoimmune diseases or some types of cancers in the past decade. For example, lnfliximab,
Adalimumab and Golimumab, are humanized TNF-specific antibodies used clinically in rheumatoid arthritis, psoriatic arthritis and Crohn’s disease (9). In addition to blocking
TNF signaling, some drugs against NFB activation through inhibition of IKK and NFB nuclear translocation have been tested to treat cancers and autoimmune diseases and
45
some of them have also been approved by FDA (92). It seems to be promising area to develop compounds that target TNF downstream pathways for clinical therapy. This is especially true because blockade of TNF and NFB can have severe side effects affecting immune homeostasis or induction of cancer metastasis depending on the cell type (84,93). On the other hand, ablation of the IKK-mediated NFB pathway in several mouse models has demonstrated development of chronicle inflammation in skin, intestine and liver and that these mice are susceptible to bacterial infection and sensitive to TNF-mediated apoptosis due to loss of NFB-mediated survival signaling
(93). Based on these studies, targeting TNF or NFB pathways may be effective in some diseases but the side effects and dosage must be taken into consideration during the treatment. To improve the medical application of TNF-associated reagents, understanding the details of TNF signaling is important for development of advanced therapy.
46
II. SMRT and transcriptional repression
The model of nuclear receptor and co-repressor-mediated gene regulation
The precision and timing of transcriptional regulation by extracellular signaling is a key process for multi-cellular organisms to initiate biological responses and maintain tissue homeostasis. To achieve this goal, the interplay among various transcription factors, transcriptional co-activators, co-repressors and their associated chromatin modifying enzymes generates different combinations of DNA and histone modifications, thus regulating access of local chromatin structure to the transcriptional machinery (94). During chromatin remodeling, many histone modifications have been identified, including acetylation, deamination of arginine, methylation, phosphorylation, ADP-ribosylation, sumoylation and ubiquitination (95).
In this study, we focus on the regulation of histone acetylation by HDACs through co- repressors and investigate how extrinsic signaling controls these events. Histone acetylation has been viewed as a gene activation mark that neutralizes the positive charges on histone N-terminal tails and recruits other activating factors, resulting in a loosened form of euchromatin to facilitate the access to proteins including the basal transcription machinery. Several histone acetyItransferases, such as CBP/P300, PCAF and SRC, have been identified to contribute to this process (96). Conversely, the co-
47
repressors, such as SMRT and NCoR, function as platform proteins that recruit HDACs and other histone modifiers to generate a compact chromatin structure, thus blocking access to the basal transcription machinery (97). This mechanism suppresses inflammatory responses in resting cells and contributes to the temporal-spatial regulation of cell differentiation during development (97). The function of co- repressors was intensively studied recently by novel technologies, which allow genome-wide investigation and the establishment of conditional knockout or knockin mice. Here, some recent findings and a current refined model on co-repressor- mediated gene regulation will be reviewed (Figure 3).
The exchange of cofactors controlled by ligand binding
NCoR and SMRT were identified through yeast two-hybrid screens as binding partners of RAR and TR, respectively (98-101). RAR and TR were two members of NR superfamily, which function as ligand-dependent transcription factors that directly bind to cognate DNA binding sequences and regulate gene expression either positively or negatively through the recruitment of co-activators or co-repressors, respectively
(102). So far, 48 nuclear receptors have been identified in humans and 49 have been characterized in mice (103). Categorized by the ligands, NRs can be divided as steroid 48
Figure 3. Current models of co-regulator regulation and co-regulator-mediated transcriptional regulation
49
Figure 3. Current models of co-regulator regulation and co-regulator-mediated transcriptional regulation
Panel A demonstrates a mechanism in which agonist and antagonist bound NR can change its conformation for co-repressor/co-activator recruitment, leading to target gene repression/activation. The upper right panel B shows that ligand bound NR results in NR sumoylation which in turn recruits co-repressor for NR-mediated transrepression. A recent ChIP experiment provides evidence that elucidates inflammatory signaling of gene activation. Upon LPS stimulation, a transcriptional repressor and co-repressor establish a trans-repression network that is replaced by transcription factor and co-activator-associated complex for corresponding gene expression (Panel C). Upon stimuli, activation of several kinases and protein modification enzymes causes post-translational modifications of transcription factor bound co-repressors, leading to co-repressor degradation or dissociation for target gene derepression (Panel D). (Co-R: co-repressor; Co-A: co-activator; NR: nuclear receptor; TF: transcription factor; TR: transcription repressor)
50
bound, non-steroid bound and ligand undefined NRs. The nuclear receptors share similar structural features with a conserved DNA-binding domain and a ligand-binding domain (LBD) (104,105). Through LBD domain, NRs can dimerize with themselves or with other NRs as hetero-dimers. Importantly, upon ligand binding, the concomitant conformational change of the LBD domain forms a binding pocket for co-activator or co-repressor, thus triggers the switch of target gene expression (Figure 3). A well- known example underlying this co-regulator exchange mechanism can be exemplified by ER-mediated estrogen receptor gene regulation. Upon estradiol binding, the allosteric effect of ligand binding alters ER-LBD conformation, which favors co- activator residence. Conversely, when bound by the antagonist, tamoxifen, the ER-
LBD no longer binds coactivator and instead gains a high affinity for co-repressors that repress target genes (106-108). The overall exchange of co-regulator is transient and reversible and the detailed mechanism for structural change will be discussed in the next section (Figure 5).
NR-mediated trans-repression through ligand-induced NR-sumoylation
In addition to direct DNA binding, several NRs including GR, LXR and PPARhave been found to associate with co-repressor complexes. They can perform a trans-repression 51
function to suppress gene expression as exemplified during the TLR4-activated innate immune response (109). The interesting finding comes from transcriptome and cistrome analyses. A subset of TLR4-activated genes is suppressed by NR cognate ligands following LPS stimulation but examination of these gene promoters did not show consensus binding sites for the corresponding NRs. This indicates that an alternative mechanism in NR DNA binding occurs to suppress expression of these genes (109). A later study proposed a model by which PPAR suppresses a subset of
TLR4-responsive genes by stabilizing the association of the NCoR-repressive complex with inflammation responsive transcription factors, AP-1 and NFB. Ligand-bound
PPARpromotes protein inhibitor of activated Stat1 (PIAS1)-dependent sumoylation of PPAR-LBD and thereby enhances the interaction between PPARand NCoR-
HDAC3 repressive complexes (110). The assembly of PPARand NCoR-HDAC3 further prevents dissociation of NCoR-HDAC3 from NCoR-HDAC3 target promoters and thereby represses AP-1 and NFB transactivation (110). In addition to PPARthe sumoylation-dependent trans-repression mechanism is also found in LXR-NCoR- and
LXR-SMRT-mediated target gene repression (111,112). Notably, although both
PPARand LXR are involved in NCoR-mediated trans-repression through sumoylation, the patterns of their target genes are not completely overlapping and the types of
52
sumoylation in these two pathways are distinct (112). Unlike PPARLXR is conjugated with SUMO2/3 through HDAC4-dependent sumoylation rather than using PIAS1 as a sumoylation ligase found in SUMO1-conjugated PPAR (112).
Depression of co-repressors by multiple signaling mechanisms
Association of the transcription repressive SMRT/NCoR complex with NRs and other transcription factors establishes a gatekeeper network to repress genes that are poised to be activated upon appropriate stimuli (102,103,113). To initiate gene expression, the first step is to remove corepressors from the associated transcription factors, thus facilitating co-activator recruitment. Several models have been proposed explaining how the clearance of co-repressors from their target gene promoters occurs. Two well-studied mechanisms underlying SMRT derepression are: 1) an E3 ubiquitin ligase- and proteasome-dependent pathway and 2) a kinase-mediated and phosphorylation-dependent cytoplasmic shuttling of SMRT. In TBL1 and TBLR1- mediated NCoR/SMRT derepression for example, TBL1 and TBLR1 are SMRT/NCoR associated E3 ubiquitin ligases that recruit S19 proteasome to trigger the clearance of the SMRT/NCoR co-repressor complex and hence promotes target gene expression
(114). Further studies indicated that TBL1 and TBLR1 have parallel functions in the 53
clearance of co-repressor complex. They control distinct transcriptomes and exhibit distinct responses to different stimuli. In addition to TBL1 and TBLR1, two other E3 ubiquitin ligases, mSiah2 and -TrCP1 also target NCoR and SMRT, respectively, to promote their degradation and derepress NCoR/SMRT target genes (115,116). By a different route, phosphorylation of NCoR and SMRT triggers NCoR and SMRT shuttling from the nucleus to the cytoplasm, thus contributing to the derepression of NCoR and
SMRT nuclear targets. For example, the stimulation of ciliary neurotrophic factor
(CNTF) in mouse neural stem cells leads to NCoR phosphorylation by Akt-1 and thereby promotes tentative relocation of nuclear NCoR to the cytoplasm, consequently leading to derepression of NCoR target gene and concomitant glial differentiation (117). For SMRT, several kinases, including MAPK, CKII, CDK2, IKK and calcium calmodulin-dependent kinases, have been found to cause redistribution of nuclear SMRT to the cytoplasm, thus inducing SMRT target gene expression (78,118-
122). Notably, although NCoR/SMRT share similar structures and are viewed as paralougs, they demonstrate distinct responses to various signals, reflecting their non- redundant functions. This is demonstrated by the embryonic lethality in knockout mouse models (123-125) (Table 2).
54
The reciprocal exchange of active and repressive transcription factor complex on co-regulatory cistromes
Taking advantage of genome-wide transcriptome and ChIP-seq studies, a model of reciprocal exchange of transcriptionally repressive complexes with active complexes in the regions upstream of transcription start sites has been proposed. In the early phase of pre-adipocyte maturation, transcriptional repressor, KAISO, assembles with
SMRT as a transcriptional repression complex, residing at the proximal region of a subset of genes that are poised for the mitotic expansion (126). Upon adipocyte differentiation, the KAISO-SMRT repressive complex is replaced by the SP1 guided transcriptional activation complex, which facilitates the stalled pol II to initiate transcription. Another similar transcriptional complex exchange model has also been proposed based on a study in mouse macrophage that induces a subset of LPS-TLR activated inflammatory genes (126). In this study, BCL6 establishes a repression network that affects one third of TLR4-responsive gene promoters. To dissect NFB and BCL6 binding cistromes in response to LPS, Barish et al. found that both co- regulate a subset of TLR4 response genes (79). Within the BCL6/p65 co-regulatory cistromes, the binding site of BCL6 is very close to the p65 occupied region, spanning about one nucleosomal length (79). Upon LPS stimulation, a BCL6 associated
55
repressive complex shows reduced occupancy at the cistrome with greater association of the p65-p300 complex, implicating a transcriptional complex in-and-out process occurring on these BCL6/p65 cistromes (79). Overall, these results suggest that at least in some transcriptional regulatory regions, the repressive complex functions as a gatekeeper in quiescent conditions but the repression can be quickly switched in response to outside stimuli.
SMRT/NCOR structure
SMRT and NCoR are large proteins about 270 kDa (Figure 4A). They share approximately 40 % similarity in their amino acid sequences and their functional domains are conserved (100,127,128). SMRT/NCoR does not have a rigid conformation with only few regions predicted to have a folded structure (128). This loosened structural feature has been found in several co-regulators and provides these presumed platform proteins with a function as hubs interacting with various partners that dynamically associate as multi-functional complexes (129). SMRT/NCoR contain two SANT-like motifs, named after the similar structures found in SWI3, Ada2,
NCoR1 and TFIIB. In SMRT/NCoR the first SANT-like motif and its N-terminal adjacent region form the deacetylase activation domain (DAD), which interacts with, and 56
activates HDAC3 (130,131). The second SANT motif in SMRT/NCoR is a histone interaction domain (HID), which can directly bind histone tails, especially demethylated ones (132). There are three highly conserved repression domains spanning the SANT-like motifs, referred to as RD1, RD2 and RD3 (133). With them,
SMRT/NCoR is capable of binding enzymatic partners, such as SIRT1 and HDAC4/5,
(134-136). In the C-terminus, both SMRT and NCoR have three nuclear receptor interaction domains (RID), which mainly interact with the LBDs of unliganded nuclear repressors (105,133,137-140). Within the RIDs, SMRT/NCoR harbor parallel motifs called CoRNR boxes, by which SMRT/NCoR compete for NR binding with co-activators in a mutually exclusive manner (139-141) (Figure 4).
The core components of the SMRT/NCoR repression complexes
The intrinsic disordered structure and hub-like characteristics of SMRT/NCoR result in a low affinity, transient associations with their binding partners (142-144). Some core partners have been shown to consistently associate with SMRT/NCoR repressive complexes. There include HDAC3, the G protein pathway suppressor (GPS2), transducing b-like 1 (TBL1), and its homologous TBL-related 1 (TBLR1) (145). In addition to HDAC3, other HDACs, such as Class II HDAC 4/5/7 and Sirt1 associate with 57
Figure 4. Schematic representation of SMRT co-repressor and SMRT isoforms
58
Figure 4. Schematic of SMRT co-repressor and SMRT isoforms
(A) A schematic map of SMRT is presented with functional domains indicated. Under the map, some SMRT associated proteins are listed under their binding domains.
RI~RIV: repression domains; SANT: SANT-like domains; NRID: nuclear receptor interacting domain. (B) A list of SMRT isoforms. The asterisk (*) marked isoforms may not be authentic isoforms under normal physiological condition but characterized in earlier studies.
59
SMRT/NCoR in different cellular contexts (134-136). Using the N-terminal RD1 domain, SMRT/NCoR binds GPS2 and TBL1, both of which also associate together, resulting in a stable three way interaction (145). The partial structure of the complexes indicates that SMRT and GPS form a hetero-dimer through an anti-parallel coiled coil interaction and the hetero-dimer complex further binds to a hydrophobic grove in homo-dimerized TBL1 (128,145). Furthermore, a recent study proposes a possible structural module in which four TBL1 or TBLR1 can associate with GPS2 and
SMRT/NCoR as a 2:2 hetero-tetramer and this tetramer further assembles as a 1-2
MDa complex (146).
The DAD domain in SMRT 412-480 region has been shown essential for HDAC3 interaction and its activation (130). The motif deletion experiments demonstrate that the integrity of DAD is indispensable for HDAC3 recruitment and activation because the loss of 412-428 a.a. before SANT-like motif abolishes these functions (130). Other reports also demonstrate that RD2 and RD3 can associate with HDAC3 but this interaction does not enhance HDAC3 enzymatic activity (130,147). In addition to the protein-protein interaction dependent HDAC3 activation, the phosphorylation of
HDAC3 through CKII elevates HDAC3 activity but the activation of HDAC3 can be 60
negatively regulated by protein serine/threonine phosphatase 4 complex
(PP4c/PP4R1) (147). In HDAC3, both N- and C-terminus can interact with DAD domain and loss of either one results in the SMRT unbound and inactive HDAC3 (130,148).
SMRT/NCoR and nuclear receptor interaction
In general, SMRT/NCoR bind to unliganed nuclear receptors through their C-terminal
RID domains (149). The conserved ligand binding domain (LBD) in nuclear receptor is mainly responsible for co-regulator interaction (150). The LBD domain is composed of three layer anti-parallel helices (150) (Figure 5). In the presence of ligand or agonist, helix12 in the central pocket changes its position to accommodate ligand or agonist
(151)(Figure 5a). This conformational change also stabilizes the overall structure and directs helix 12 to an active position for co-activator recruitment (Figure 5e). In co- activator RIDs, multiple small conserved motifs composed of LXXLL amino acids (X: any amino acid) interact through hydrophobic forces with amphipathic residues on the surfaces of helices 3, 4, 5 and 12 of NR LBD (152)(Figure 5e). Similar to co-activators, co-repressors also contain a similar but longer L/IXXI/VI motif (152,153). This longer motif occupies the central cavity of the NR and repositions helix 12 out of the hydrophobic groove (Figure 5c). In some cases, the CoRNR motifs of co-repressors and 61
twisted nuclear receptor helix 11 form a sheet interface in the central pocket, stabilizing the conformation of the repressive complex (Figure 5b). The crystal structures of NR-co-activator and NR-SMRT complexes have shown that SMRT and the co-activator bind to the same hydrophobic groove in LBD. This results in a mutually exclusive binding (128,141,152,154).
SMRT/NCoR and other transcription factor interaction
In addition to the well-defined SMRT/NCoR-NR interaction, SMRT/NCoR have been shown to bind multiple transcription factors. One example is the POZ/zinc finger transcription repressor, BCL6, which is a key regulator for B-cell development. De- regulation of BCL6 results in pathogenesis of non-Hodgkin lymphomas (155,156). BCL6 has an unstructured region in the middle, connecting its N-terminal POZ domain with
C-terminal 6 zinc fingers (157). Using the POZ domain, BCL6 can directly bind SMRT
(amino acids 1414-1430)/NCoR (amino acids 1351-1616) region and HDAC1 (158). On the other hand, another BCL6 specific co-repressor, BCoR, can compete with
SMRT/NCoR for POZ binding and this binding competition results in a mutually exclusive occupancy (157-159). Because of the high affinity between SMRT 1414-1430 peptide and POZ, a synthetic mimic peptide inhibitor has successfully been used to 62
Figure 5. The classic model of the switch of NR LBD-co-activator and NR LBD-co-repressor interaction via agonists and antagonists
63
Figure 5. The classic model of the switch of NR LBD-co-activator and NR LBD-co- repressor interaction via agonists and antagonists
Without co-regulator binding, the -helices 3, 4, 10 and 11 in apo-nuclear receptor
LBD form a core binding pocket in which -helices 4 and 12 occupy the most space as shown in (a). In state (b), some co-repressors utilize their -strands near coRNR1 to induce a conformational change of -helix 11, forming a -sheet interaction between
-3 and S-1. Through this mechanism, co-repressors can interact with NR as a stable complex. In addition, the coRNR1 domains of co-repressors are usually longer than those of co-activators and thereby the insertion of co-repressor coRNR1 domains into the NR binding pocket results in the disordered structure of NR -helix 12 in (c). (d)
During antagonist binding, the change of NR conformation causes the release of - helix 12 out of the binding pocket and clears the space of binding pocket for co- repressor binding. On the other hand, in (e) when an agonist binds to NR, the agonist in the binding pocket changes -helix 12 position and creates a favorable condition for co-activator binding. Noticeably, in this state the -helix 12 of NR is still in the binding pocket but does not block the entry of co-activator into the binding pocket because the interacting domain of co-activator is usually smaller. (NR: nuclear receptor; CoA: co-activator; CoR: co-repressor) (This figure is adapted from (160))
64
disrupt the BCL6-SMRT interaction and reduce inflammatory responses and large B- cell lymphoma in a mouse model (80,161).
Regulation of SMRT
Transcription and alternative splicing
To date, at least seven alternatively spliced variants of SMRT transcripts have been reported (Figure 4B). Most alternative splicing of SMRT mRNA results in partial loss of the C-terminal RID domain and hence refines affinity and specificity of SMRT in the transcription factor interaction. For example, SMRT and SMRT were the first identified isoforms in which SMRT is shorter than SMRTdue to lack of exon 44b in mRNA 3’ end(98,162). The partial loss of the C-terminal region in SMRT causes its reduced affinity for thyroid hormone receptor while there is no significant difference between SMRT and SMRT in RAR binding (163). In addition to their intrinsic affinity to NRs, the expression patterns of SMRT and SMRT are tissue-specific, implying that
SMRT isoforms satisfy specific requirements in different biological settings (163-165).
After SMRT and SMRTidentification, the longest SMRT comprising 2514 amino acids with three NR domains was reported as SMRT(166)This isoform contains an
65
extra RID domain encoded by exon 37b. SMRTis expressed widely as is SMRT and
SMRTis also conserved in other vertebrates, such as Xenopus laevis and mice
(164,165). Other C-terminal variations of SMRT have also been characterized in different tissues of Xenopus laevis and mice but the detailed functions of those isoforms needs further investigation (165). In contrast to the diverse splicing in the 3’ end of SMRT mRNA, a few SMRT variants lack 5’ exons. One isoform lacking N-terminal
RI, called SMRT, has been identified as a weaker repressive factor than SMRT (167).
Overexpression of this isoform even increases RAR target gene expression and rescues the hormone insensitivity in retinoid-resistant leukemia (100,167). Since some transcription factor interacting domains of SMRT are located before the RID cluster, the partial loss of the SMRT N-terminal region may change the protein binding behavior of SMRT. Thus it may reduce SMRT-mediated repression, leading to altered regulation and functions (168).
Regulation of SMRT by post-translational modification
SMRT is a highly phosphorylated protein that demonstrates different levels of phosphorylation and slow electrophoretic mobility when phosphorylated (118). A major function of SMRT phosphorylation is to facilitate shuttling from nucleus to 66
cytoplasm (125). By this means, the TR and SMRT interaction and the concomitant transcription repression are reduced when kinases MEKK1 or v-erbB are over- expressed (169). SMRT phosphorylation by chromatin associated IKK and consequent SMRT nuclear export have also been reported to contribute to the expression of NFB target genes, such as ciap-2 and IL-8 (78). SMRT serine 2410 was identified as a target residue of IKK and overexpression of non-phospho-mutant,
SMRT S2410A, resulted in apoptosis and low cell survival (78). Furthermore, IKK also phosphorylates chromatin bound NFB p65 and promotes the replacement of SMRT with CBP/P300 acetyltransferases, resulting in the acetylation of p65 at lysine 310 and a full p65 activity (170). In colorectal cancer, the hyper-activated IKK causes
SMRT/NCoR phosphorylation and its accumulation in cytoplasm, thus derepressing
Notch target gene for cancer survival (171). Several Cam kinases (calmodulin- dependent protein kinase) in neurons and T cells also phosphorylate SMRT and trigger
SMRT nuclear export. SMRT-associated class II HDACs are also exported in response to hormone or Notch stimuli (172-174). Similarly, Wnt5a through CamKII, promotes
SMRT Ser1470 phosphorylation and cytoplasmic accumulation resulting in enhanced association of Notch1 with RBP-Jk for RBP-Jk target gene activation (119). In contrast to phosphorylation-mediated dissociation of SMRT and transcription factors, a
67
constitutively activated kinase, CKII, directly phosphorylates SMRT Ser1492 and stabilizes the association of SMRT and TR (122). Furthermore, it has been suggested that protein phosphatase 1 counteracts kinase-mediated SMRT derepression and maintains SMRT nuclear localization for RBP-Jk target gene repression (172). These observations indicate that a balance between SMRT phosphorylation and dephosphorylation must be maintained to appropriately control NR or other transcription factor activity. Recently, SMRT phosphorylation by cyclin dependent kinase, CDK2, was characterized. The CDK2 phosphorylated serine-proline/threonine- proline dipeptides which are targets for Pin1 (121). An increase in Pin1 and CDK2 activity promotes SMRT degradation but knockdown of either reduces ErbB2- mediated SMRT degradation and ErbB2-induced tamoxifen resistance in breast cancer cells (121). Based on the crystal structure, it was hypothesized that SMRT can hono- dimerize, a model validated by biochemical assays. Interestingly, SMRT-associated
MAPK kinase, ERK2, has been found to phosphorylate SMRT in multiple ERK2 consensus phosphorylation sites and this phosphorylation abolishes SMRT self- association, resulting in the disassembly of SMRT/NCoR core complex (146).
In earlier studies, two stable partners in the SMRT/NCoR complex, TBL1/TBLR1, had been found to recruit ubiquitination/proteasome system to the SMRT/NCoR target 68
chromatin and promote SMRT ubiquitination and degradation, thus facilitating the exchange of SMRT/NCoR with co-activators (114,142). This TBLR1-mediated
SMRT/NCoR complex removal from NR target promoters was further enhanced by specific kinases such as CKI and PKC. Although TBLR1-mediated removal of the
SMRT/NCoR complex seemed to promote activation, other reports demonstrated that
TBL1 and TBLR1 were also required for NR-mediated gene repression (175,176). In a later study, recruitment of the SMRT/NCoR repression complex to NR target promoters was shown to be accomplished by a feed-forward model in which NR- associated SMRT/NCoR creates a hypo-acetylated histone environment to facilitate
TBL1 and TBLR1 occupancy (175,176). Since the removal of SMRT/NCoR from repressive NR complexes is transient and recycled, the function of TBL1 and TBLR1 in the core SMRT/NCoR complex can be thought as a modulator that maintains repression under certain threshold but will reverse itself upon extra signaling (114). In this study, we also identify TNF downstream effector, -TrCP1, as a bona fide E3 ubiquitin ligase promoting SMRT poly-ubiquitination and consequent proteolysis.
Finally, one recent report demonstrates that SMRT harbors several sumoylation motifs and K688 of SMRT is a putative sumoylation site (177). However, the function
69
Table 1. Summary of SMRT regulation and the corresponding factors
Type of Regulatory region Involved Function Ref. Regulation Component
Alternative Major in 3’ end exons Tissue specific (101,163, splicing isoforms for 167) different patterns of NR association and NR-mediated repression
Translation 3’UTR miR-16 Translational (178) suppression of SMRT
Phosphorylation S2410/S2028 IKK Cytoplasmic (78,170) Exportation & Degradation
S1470 CamKII/ Cytoplasmic (119,172) Exportation CamKIV
ND MEKK1 Cytoplasmic (118,125) Exportation
ND MEK1 Cytoplasmic (118) Exportation
ND p38 ND (118)
S2502 CKII Stable TR-SMRT (122) complex
S1241/T1445/S1469 CDK2 Degradation (121)
70
S1095/S1239 ERK2 ND / SMRT self- (118,146) association
Ubiquitination ND -TrCP1 Degradation (116)
ND TBL1, TBLR1 Degradation (114,142)
Sumoylation K668 ND ND (177)
71
Table 1. Summary of SMRT regulation and the corresponding factors
The regulation of SMRT in cells has been shown through transcription, alternative splicing, translation and post-translational modifications. The types of regulation are listed in the first column, the modifications of SMRT are summarized in the second column, the involved effectors are shown in the third column and the final column briefly describes the outcome of each SMRT regulation (ND: Not determined).
72
of SMRT sumoylation is not clear. To further understand the regulation of SMRT via known mechanisms, I summarized recent findings in Table 1.
Mouse studies on SMRT/NCoR
SMRT/NCoR knockout mice are embryonic lethal
The best way to understand the physiological role of SMRT/NCoR is to observe phenotypic changes in SMRT/NCoR knockout mice (Table 2). The first Ncor knockout mouse strain was generated by Rosenfeld’s group; the Ncor -/- mice demonstrate embryonic lethality at E15.5 due to the defects in erythopoesis, thymocytes and neural development (124). These detrimental consequences were primarily due to the loss of appropriate repression in NR target genes. Taking advantage of Ncor-/- MEFs, these investigations found that NCoR represses ER transactivation in the presence of
ER antagonist and mediates ligand independent repression on a subset of TR and
RAR target genes (124). As to other transcription factors, such as NRSF, the presence of NCoR maintains a long-term repression. Like Ncor-/- mice, Smrt-/- mice also showed embryonic lethality at E16.5 because of the impaired heart development (123).
Introducing SMRT expression specifically in myocytes, the Smrt -/- mice can be
73
rescued. However, they continue to have defects in forebrain development, which requires the cooperation of SMRT with RAR and CSL (123,179). This phenotype suggests a role for SMRT in the neural stem cell maintenance and in the control of neural differentiation (179). On the other hand, heterogenous Smrt knockout mice demonstrate higher body weight and adipogenesis when fed a high fat diet (180).
Although the detailed mechanisms responsible for the phenotype is not clear, MEFs from both Smrt homozygous and heterozygous knockouts show dramatic up- regulation of several metabolic regulators, including PPAR, C/EBPand adiponectin, suggesting a role of SMRT in metabolic regulation (180). Interestingly, Smrt +/- mice show lower hepatic steatosis and higher insulin sensitivity than wild type mice during high fat diet feeding partially because of an increased insulin response in white adipose tissue (180). The knockout strains demonstrate that SMRT and NCoR have distinct functions in development since either knockout of SMRT or NCoR leads to embryonic lethality without compensation but the remaining co-repressor
(123,124,179). In summary, it is clear that SMRT is involved in several steps in the neural and cardiovascular development.
74
SMRT knockin mice
Because of developmental lethality in Smrt knockout mice, several groups have generated SMRT RID domain mutant knock-in mice, with the goal of disrupting SMRT and NR interactions to understand in vivo function of SMRT on NR-mediated gene repression. By mutating the CoRNR motif in RID1 and RID2, mice (SMRTmRID) bearing homozygous mutant SMRT were normally delivered and express similar amounts of
SMRT and NCoR when compared with wild type mice (181). The initial phenotype did not show morbid morphology but demonstrate defects in metabolism system. For example, SMRTmRID mice exhibit lower respiratory rate, glucose tolerance and energy utilization (181). Interestingly, this strain has reduced body weight but accumulates more fat due to higher adipogenesis and higher adipogenic gene expression in liver
(181). The major mechanisms causing the abnormal metabolism in mice were the deregulation of TR and PPAR-mediated gene repression, rendered by SMRTmRID, resulting in an abnormal adipocyte differentiation. Since SMRTmRID knock-in mice exhibit an abnormal respiratory rate and oxygen utilization, a reasonable assumption is that SMRTmRID results in defects in the development of the respiratory system.
Indeed, the SMRTmRID infant mice in the C57BL/6 background demonstrated a severe acute respiratory distress syndrome (RDS) and die because of dysfunction in the
75
differentiation of type I pneumocytes (182). To demonstrate that SMRTmRID defects are NR-mediated, treatment with an anti-thyroid drug can rescue RDS in SMRTmRID.
This result suggests that transcription regulation in lung development is controlled by
SMRT-TR (182). A further study identified Klf, as a key transcriptional regulator controlled by SMRT-TR and deregulation of Klf is a major cause of RDS in SMRTmRID
(182). Instead of ablation of both RIDI and RIDII, the phenotype of mice that bear a single RID disruption (SMRTmRID1), further emphasizes the role of SMRT in specific NR contexts. TR-SMRT and PPAR-SMRT interactions are due to NR-SMRT interactions through RID2. Thus the SMRTmRID1 strain exhibits an early aging phenotype and metabolic defective syndromes, including hyperlipidemia and insulin resistance (183).
These are typical of PPAR dysfunction. An examination of metabolic gene expression showed that genes related to fatty acids oxidation and oxidative phosphorylation are lower in SMRTmRID1 mice, consistent with a defect in PPAR-mediated repression, a key regulator for oxidative metabolism (183,184). Furthermore, these mice demonstrate mitochondrial dysfunction and hence are susceptible to oxidative stress attack. When fed a high fat diet, SMRTmRID1 mice show increased calorie uptake and exhibit severe metabolic defects. They are obese and accumulate excess fat in adipocytes and liver.
In addition, they show hepatic steatosis, insulin resistance and low grade
76
inflammation (184). The deregulation of leptin and adiponectin in SMRTmRID1 mice underlies a comprehensive dysfunction of metabolic homeostasis upon high fat diet challenge, resulting in lower energy expenditure, lower body temperature and a change in glucose usage (183). Overall, these SMRT knock-in mouse models elucidate the significance of SMRT-NR in the context of metabolism and energy production.
Genome-wide study demonstrates the role of SMRT in the homeostasis of immunity
In several mouse macrophage subtypes, high expression of NCoR and SMRT is implicated in their role in the regulation of inflammatory cytokine responses (113).
The interaction of NCoR and SMRT with key inflammatory regulators, such as NFB and AP-1, strongly suggests the involvement of NCoR and SMRT in the repression of inflammatory genes and in the maintenance of immune homeostasis (113). In an early study, the experiments focused on how NCoR provides an inflammatory checkpoint and counteracts NFB in controlling a subset of inflammatory response genes, such as
TNF and IL1. NCoR presumably functions through PPAR and LXR to establish transrepression in a PPAR and LXR ligand dependent manner (112). In this context, antagonist bound PPAR and LXR recruit distinct sumo modifier complexes for sumo- 77
1 or sumo2/3 conjugation which stabilizes PPAR-NCoR and LXR-NCoR repression complexes on their specific target gene promoters, attenuating target gene activation in response to innate inflammatory stimuli, such as LPS (112). In contrast to NR- mediated transrepression, several inflammatory stimuli have been shown to trigger
NCoR removal from target promoters through a phosphorylation dependent mechanism. For example, treatment of the inflammation active agent, 12-O- tetradecanoylphorbol-13-acetate (TPA), induces AP-1 phosphorylation and decreases
NCoR association on the AP-1 target gene promoters, thus derepressing these genes
(185). On the other hand, activation of TLR4 induces NFB associated IKKɛ to phosphorylate adjacent c-Jun/NCoR complexes, thereby releasing the NCoR repression complex from NFB/AP-1 co-regulated genes (185). In the context of TLR2 signaling, activated TLR2 activates CaMKIIγ which quickly phosphorylates NCoR- associated TBLR1 at Ser199. This in turn facilitates the recruitment of a ubiquitin ligase complex to the NCoR repression complex releasing it from AP-1 target promoters
(185). Taking advantage of SMRT or NCoR knockout macrophage, a genome-wide
ChIP-sequencing study elucidated the subtle differences between SMRT and NCoR in the repression of a subset of inflammatory genes (113). In that study, a broad set of inflammatory genes are basally repressed by SMRT and NCoR and can be roughly
78
categorized as NCoR dependent, SMRT dependent or SMRT/NCoR co-regulated genes.
For example, the NCoR repression complex associates with c-Jun and is brought to AP-
1 sites. On the other hand, SMRT is recruited by the E-26 transforming specific related leukemia (ETL) repressor on SMRT target gene promoters, adjacent to NFB p50 consensus target sites (113). Moreover, some genes, such as Ccl2, containing ETL and
AP-1 binding sites which are co-regulated by SMRT and NCoR through their corresponding transcription factors (113). Lastly, each repression complex responds to distinct set of upstream stimuli. The removal of NCoR is driven by TPA stimuli and the derepression of SMRT occurs upon IFN treatment (113). Since LPS-activated TLR4 can promote both SMRT and NCoR removal from target promoters, a universal response to TLR4 can be observed on NCoR specific, SMRT specific and SMRT/NCoR dependent promoters.
Another genome-wide study proposed a model in which SMRT and NCoR associate with the key inflammatory repressor, BCL6, which binds a broad set of cistromes of inflammatory genes and establishes an integrative repression network in mouse macrophages (79). The BCL6-associated SMRT/NCoR repressive network not only restricts the inflammatory gene activity under a basal level but also limits overactive
79
inflammatory responses after TLR activation (79). Interestingly, many BCL6-associated
SMRT/NCoR repressive complex binding elements are very close to NFB binding sites and demonstrate a mutually exclusive occupancy with NFB. This result indicates that a reciprocal exchange of active and negative transcription factors may occur in inflammatory gene upstream cis-regulatory elements (80). Following this finding, a study conducted with BCL-6 knockout mice strongly supports the conclusion that
BCL6-established SMRT/NCoR repressive network reduces immune responses and attenuates atherosclerosis (80).
Recently, SMRT was found to cooperate with transcription factors, C/EBP and KAISO to control a subset of genes that are required for adipocyte maturation (126). KAISO is a transcription repressor binding to DNA elements with a methyl-CpG-dependent manner. In the proposed model, C/EBP-SMRT complexes bind to the distal upstream region of a target gene and limit the entry of other transcription activators, thus inhibiting C/EBP-mediated pro-adipogenic gene expression in pre-adipocytes (126).
On the other hand, SMRT also associates with KAISO on transcription proximal sites of some active adipocyte genes that are required for the mitotic clonal expansion phase before final adipocyte differentiation. Once the conditions are appropriate for
80
differentiation, the transcriptionally active complexes will substitute C/EBP-SMRT and KAISO-SMRT complexes allowing gene expression. According to these new data, the overall repression and derepression process seems more complicated than what we originally expected. By these advanced genomic and biochemical technologies, we may have a clearer profile about how transcription factors interplay in the future.
Clinical investigation of SMRT-associated diseases
A genome wide ChIP-on-chip and microarray analysis indicted that SMRT may be controlled by Gli, an effector of Hedgehog signaling for cell fate determination (186).
Indeed, this observation was further validated by a genome-wide study that investigated important obesity regulators in drosophila (187). A mouse model demonstrated that hedgehog-activated Gli binds the SMRT promoter to increase
SMRT expression and SMRT-mediated anti-adipogenesis (188). Similarly, in human adipose tissue, the SMRT and SMRT-associated co-repressor, GPS2 expression levels are lower in obese patients than in lean normal people. These obese patients also showed an increase of expression of obesity-associated inflammatory markers such as
IL-6 and MCP-1 in adipose tissue (90). Using human adipocytes as a model, Venteclef’s group found that PPAR and TWIST are the upstream factors that sense nutrient or 81
physiological changes and activation of either one of them by treatment with a
PPARagonist or surgical weight control, respectively, enhances SMRT/GPS2 expression and simultaneously reduces the inflammatory response (90). Combing the genome wide studies, moue models and clinical investigations, we start to establish a concept that the accurate regulation of co-repressors, especially SMRT, is critical for restoring inflammatory status to a basal level and also preventing abnormal metabolism.
82
Table 2. Summary of animal models in SMRT functional research and the current studies of SMRT function by next generation ChIP-seq
Genetic Defective Significant Finding Relative Ref. Mouse Phenotype transcription Model factor
Homozygous Embryonic 1. Abnormal neural stem RAR, Foxp1 (123,179) KO lethality cell differentiation and
defects in heart
development
mRID Metabolic 1. Acceleration of adipocyte TR, PPAR, (181) syndrome & lung differentiation and reduced RAR, RXR
and bone sensitivity to insulin
development 2. Defects in type I
pneumocyte differentiation
through lung specific
transcription factor Klf2
3. Disruption of
homeostasis in bone
marrow microenvironment
through thrombopoietin
activation
mRID1 Aging & Metabolic 1. Aging and reduced TR, PPARs, NRs (183,184) mitochondrial function;
susceptible to oxidative
damage
2.Under high fat diet,
increase in obesity,
83
inflammation, hepatic
steatosis but decrease in
energy expenditure and
insulin sensitivity
Heterozygous Metabolic Under high fat diet, Unknown (180) KO increase in caloric intake,
obesity and adiposity
ChIP condition Function Detailed Finding Relative Ref. transcription
factor
SMRT-/- Immunity SMRT and NCOR establish a LXR, Ets (79,113) macrophage transcriptional repression repressor,
network for a subset of co- NFB(p50) (ChIP: regulatory inflammation p65BCL6/ genes but also show p300/Pu.1/H3 distinct regulatory patterns K4me1/ p300 in their specific targets. (79))
(ChIP:
p65p50/
SMRT/NCoR/C
-Jun/TEL/LXR
(113))
3T3L1 pre- Adipocyte SMRT functions as a trans- C/EBP, (126) adipocyte differentiation repression gate keeper KAISO
during adipocyte (ChIP: SMRT differentiation NCoR/ KAISO/
H3K9me2)
84
BCL6-/- Immunity SMRT is involved in BCL6- NFB, BCL-6 (80) mediated inflammatory Macrophage gene repression,
(ChIP: SMRT antagonizing NFB-
NCoR/ BCL6) mediated inflammatory
response
Translational Function Detailed Finding Relative Ref. Model transcription
factor
Human Immunity and SMRT and GPS2 NFB, AP-1, (90) primary adipocyte cooperatively establishes C/EBP
adipocyte differentiation transcriptional repression
network for adipose tissue
inflammation
85
Table 2. Summary of animal models in SMRT functional research and the current studies of SMRT function by next generation ChIP-seq
Using conditional knock-out, knock-in moue models and systematic ChIP sequencing analysis, the function of SMRT under physiological conditions can be examined even though the SMRT knockout moue is an embryonic lethal. So far, those studies demonstrate that SMRT is a critical factor in the regulation of metabolism, development and the homeostasis of immunity. In this table, updated information of current studies is summarized, including the experimental types, phenotypes of the mouse models, a brief summary of the results and the relevant transcription factors in each study (Adapted from (189)).
86
III. Promyelocytic Leukemia protein (PML)
PML was first identified as a part of a PML-RAR chimeric protein in Acute
Promyelocytic Leukemia (APL). The (15;17) chromosomal translocation in APL patients generates oncogenic PML-RAR or RAR-PML fusion proteins that not only inhibit
RAR‘s original transcriptional activity but also interferes with normal PML function
(190-192). Later, abundant evidences showed that wild type PML is a tumor suppressor, controlling apoptosis, cell cycle, senescence and DNA damage response
(193). Furthermore, PML nuclear bodies (NBs) are highly up-regulated upon viral infection and inflammatory stimuli, suggesting their role in those responses (194-197).
Most importantly, our previous studies demonstrated that PML NBs increase in human endothelial cells in response to TNF and that the dynamics of PML NBs contributes to the regulation of a subset of genes related to inflammation and angiogenesis (74,75,198). In this thesis, we focus on how TNF regulates PML and how this mechanism derepresses HDAC7 target genes.
PML protein structure
PML belongs to RING protein family named after a specific zinc finger RING domain in the proteins (199,200). Similar to PML, some members of RING family, such as BRCA1,
87
have been shown to be tumor suppressors responsible for genome stability and DNA repair (201,202). Following with RING domain, two B-box zinc fingers and a helical coiled coil motif all located in the N terminus of PML forms a common RBCC domain which is conserved in all PML isoforms (203) (Figure 6). The RBCC domain has been shown to mediate protein-protein interaction and PML NB assembly (199,200,204).
The nascent transcript of PML contains 9 exons and can be spliced into 11 isoforms with variable C termini. Since the nuclear localization sequence (NLS) in exon 6 is located in the alternatively spliced C-terminal region, PML isoform VII, lacks the NLS, and is a cytoplasmic protein (203). Furthermore, in exon 7, a small region containing
VVVI amino acids is named a sumo interaction motif (SIM) due to its ability for sumo binding (205). Another of the noticeable nuclear PML isoforms is PML IV which is capable of binding p53 and RB through its C terminus. Therefore, PML isoform IV can promote p53 and RB relocation to PML NB and hence regulate p53 and RB-mediated transactivation (206-209). In addition, the C-terminus of PML IV is required for Class I
HDAC association and subsequent regulation of HDAC target gene (210).
88
Figure 6. Schematic representation of the PML gene and its isoforms and subcellular localizations
89
Figure 6. Schematic of PML gene and its isoforms and their localizations
(A) Exon/Intron structure of PML gene. (B) After mRNA splicing, various PML transcripts can be translated into at least 11 isoforms and this figure summarizes several important and most-studied isoforms. In this Figure, the localization, the molecular weight and the length of 5’/3’ UTR of each PML isoform are shown in the right columns. (SIM: SUMO interacting motif)
90
PML Nuclear bodies
Immunostaining of cellular PML with specific antibodies, demonstrates distinctive subnuclear micro-speckles named by different nomenclatures as PML nuclear bodies
(PML NBs), Kremer bodies, nuclear domain 10 or oncogenic domains. In mammalian cells, 1-30 discrete PML NBs of about 0.2-1 m can be observed in each nucleus
(211,212). PML is an indispensable scaffold protein to assemble PML NBs with other associated components. PML NBs are disrupted in Pml-/- knockout cells and in PML-
RAR-containing APL cells (205). Furthermore, the defects in PML NB formation under these conditions can be rescued by overexpression of PML or by RA treatment, either one of which partially restores PML function, further indicating the essential role of
PML in PML NB formation (205). So far more than 170 proteins have been found to associate with PML directly or indirectly in PML NBs. The composition of PML NBs has been shown to be dynamic and heterogeneous due to the shuttling of PML-associated components and the composition of PML NBs dictated by specific PML isoforms (213).
Given that PML-associated components harbor diverse functions, the regulation of
PML NBs was thought as key to control various biological processes, including apoptosis, inflammation, angiogenesis and transcription (198,203,214).
91
PML function
Regulation of transcription by PML
PML has Ying-Yang effects on the regulation of transcription. PML NBs have been shown to localize in euchromatic regions and control local Major Histocompatibility
Calss I (MHC1) and p53 transcription by remodeling adjacent chromatin structure
(215,216). Additionally, most PML proteins co-localize with the histone acetyltransferase, CBP, and RNA Pol ll active transcriptional machinery found in foci during G1 phase or after INF treatment. This implies a role of PML in gene activation
(217,218). In our previous studies, we found that induction of PML NBs by TNF can sequester nuclear HDAC7 and derepress HDAC7-mediated gene repression in HUVECs
(74,75). In contrast to gene activation, PML also causes the reconstitution of heterochromatin and represses gene expression by recruiting Class I HDACs and heterchromatin protein 1 (HP1) (219,220). Furthermore, under conditions of cellular senescence, the induction of PML redistributes RB-E2F complexes into heterochromatic regions and blocks E2F activation, thus facilitating senescent processes.
92
Regulation of protein translation and post-translational modification by
PML
Since PML associates with many protein modifiers, the dynamics of PML NBs have been shown to be important for protein phosphorylation, sumoylation, ubiquitination and acetylation (221). The main purpose of these processes in physiology is to maintain tissue homeostasis and determine various cell fates, such as senescence, apoptosis or cell survival. HIPK2, p53 and CBP are recruited in PML NBs and their association with PML facilitates HIPK2-mediated p53 phosphorylation and ensuing p53 acetylation by CBP. This results in p53-mediated apoptosis (222,223). In contrast to promotion of kinase-mediated protein phosphorylation, PML also enhances dephosphorylation of a subset of proteins. For example, PML knockout in mice neural progenitor cells results in mis-localization of protein phosphatases 1A (PP1A), 2A
(PP2A) and RB and hence enhances RB phosphorylation (224). This mechanism contributes to an increase in neural cell proliferation but a reduction in differentiation, eventually impairing neo-cortex development in PML-/- mice (224). Loss of PML also blocks PP2A-mediated nuclear AKT dephosphorylation, enhances AKT activity and exacerbates AKT-induced tumorigenesis in Pten +/-, Pml -/- mice (225).
93
Several ubiquitinases and deubiquitinases have been found in PML NBs. After INF and stimulation, the increase in the number of PML NBs sequesters ubiquitin E3 subunit KLHL20 from substrate DNAPK, thus enhancing DNAPK stabilization and
DNAPK-mediated apoptosis and autophagy (226). Similarly, PML has been shown to attenuate p53 poly-ubiquitination and degradation by sequestering the p53 ubiquitin ligase, MDM2, to PML NBs (227). On the other hand, PML also compromises de- ubiquitinase HAUSP/USP7-mediated PTEN deubiquitination by antagonizing DAXX, a modulator positively controlling HAUSP activity. Since PTEN mono-ubiquitination is a prerequisite for its nuclear retention and tumor suppressor functions (228), Pml knockout or PML dysfunction in APL cells results in PTEN de-ubiquitination and nuclear exclusion, ultimately contributing to tumor aggressiveness (228).
As described above, PML can enhance p53 acetylation which stabilizes p53 and promotes p53-induced apoptosis. Interestingly, the acetylation and deacetylation of p53 seems to switch dynamically in PML NBs and reach to a steady state. In this equilibrium process, SIRT1 has been shown to serve as a deacetylase to balance p53 acetylation. Overexpression of SIRT1 alters the equilibrium toward p53 de-acetylation
94
which represses p53-mediated trans-activation, eventually antagonizing PML mediated cell senescence (229).
In addition to serving in posttranslational modification, PML also participates in the control of some mRNA nuclear export and subsequent translation due to PML association with eIF4E in the nucleus (230,231). In the general model of translation, the translation initiator eIF4E usually binds to the 5’ m7G cap of most mRNAs that are poised to be translated in cytoplasm. However, about 70% of cellular eIF4E is localized in nucleus and this observation intuitively raises a question of whether eIF4E has other functions in nucleus (232). Indeed, through binding to structurally conserved 3’UTR elements in some capped mRNAs, nuclear eIF4E has been shown to facilitate their mRNA export to the cytoplasm for translation (230). The interaction between PML and eIF4E attenuates eIF4E binding to eIF4E sensitive mRNAs and reduces their nuclear export, thereby lowering protein production of this set of mRNAs. Furthermore, other translation factors, such as eIF3 and elongation factor 1, also interact with PML and their functions are regulated by PML. The detailed interplay among PML-associated translation factors and their target mRNAs still needs additional investigation (233).
95
During genotoxic stress, IKK translocates to the nucleus and is recruited to PML NBs.
There, IKK can be sumoylated by PML-associated SUMO E3 ligase, TOPORS and the sumoylated IKK is capable of phosphorylating NFB p65 and contributing to the anti- apoptotic function of NFB (234). Since PML harbors a sumoylation interacting motif, some PML-associated protein-protein interactions are sumoylaiton dependent.
Through this interaction, several sumoylated proteins are recruited to PML NBs for
further modification. For example, As2O3-induced sumoylation of the antioxidant response transcription factor, NRF2, results in NRF2 recruitment in PML NB and degradation through poly-SUMO-specific E3 ubiquitin ligase, RNF4-mediated proteolysis (235). Furthermore, under osmotic stress, CKII-induced DAXX sumoylation enhances its interaction with PML and promotes DAXX-mediated anti-apoptotic gene repression (236).
Regulation of PML
Transcriptional and translational control of PML
Transcriptional up-regulation of PML is a seminal step for cells responding to outside environmental changes. All IFNs have been shown to enhance PML mRNA and protein
96
levels and consequently enlarge PML NB size and number (195). Transcriptional up- regulation of PML by IFNs is mainly mediated by the IFN downstream transcription factors, signal transducers and activators of transcription (Stats) and their cis- elements in the PML promoter, including IFN-stimulated response elements (ISRE; -
GAGAATCGAAACT-) and gamma-activated sites (GAS; -TTTACCGTAAG-) (197). Based on this mechanism, IFNs can simultaneously induce the PML and PML/RAR expression in APL cells, both of which share similar promoter sequences (195). These
IFN responsive DNA elements, the ISRE motif can respond to both type I and type II
IFN stimuli while deletion of the GAS element only attenuates cellular response to type
II IFNs (197). In addition to Stats, the interferon induced regulatory factor 3, IRF3, is found to bind both ISRE and GAS element indicating its function in transcription of the
PML gene and p53 dependent arrest of cell growth (237). Additionally, IFN regulatory factor 8 (IRF-8) bound to the PML promoter ISRE also up-regulates PML transcription in response to IFN(238). Interestingly, p53 can bind the PML coding region and when overexpressed, up-regulates PML transcription (239). Using a similar mechanism, RAS- induced p53 results in the up-regulation of PML and an increase in both p53 and PML contributing to cellular oncogenic senescence (240). In MEFs, overexpressed K-RAS
97
enhances the translation of PML through its downstream mTOR/eIF4E pathway which facilitates PML mRNA translation in PML mRNA 5’ UTR-dependent manner (241).
Sumoylation
SUMO is an ubiquitin-like small protein conjugated to specific lysine residues through the sumo E1, E2, E3 ligation system (Figure 7). Although only one E1 and one E2 enzyme have been identified in mammalian cells, several E3s have been described
(242). In addition, three related SUMO peptides, SUMO1, SUMO2 and SUMO3, have been identified which can control protein stability, protein-protein interaction and location (242). Lysines at position 11 in SUMO2 and SUMO3 allow the assembly of branched a poly-chain peptides. SUMO1, without K11, is only found as a mono-sumo modifier or a terminator at the end of poly-sumoylation chain. Three lysine residues,
K65, K160 and K490, in PML have been identified as sumoylation sites. Through the C- terminal SIM, PML also can interact with sumo and sumoylated proteins, including
PML itself (205,243,244). Given that the sumoylation of PML is important for protein- protein interaction and oligomerization, sumoylation dependent PML NB biogenesis has been proposed (213,245). In this scheme, defects in PML NB formation were observed while knocking out sumo1 or knocking out Ubc9, the only E2 SUMO- 98
conjugating enzyme in cells (246). However, PML mutants or some PML isoforms lack sumoylation sites or SIMs but still form typical NBs (247,248). These observations conflict with the initial presumption that sumoylation is essential for PML NB formation. An issue that requires further investigation. Additionally, conjugation of
SUMO3 at PML K160 appears to contribute to PML nuclear localization and PML NB formation (249). The sumoylation of PML oscillates through the cell cycle in which
SUMO1 conjugation on PML is elevated in interphase but decreases during mitosis
(250).
Several factors have been shown to promote PML sumoylation. Two sumo E3 ligases,
RanBP2 and PIAS1 have been identified which mediate PML sumoylation at K490 and
K65/K160, respectively. Interestingly, their effects on PML NB formation and stability are opposite of one another (251-253). Furthermore, Arsenic trioxide and DNA damage agents also promote PML sumoylatioin (254). In contrast to sumoylation, several pathways or factors are found to desumoylate PML. The sumo-specific protease (SENP) family has been shown to remove sumoylation from target proteins.
Of this family, all of the SENPs, except SENP4, are capable of removing SUMO
99
conjugation from PML and contribute to the dynamic and compositional change of
PML NBs (255-259).
In addition to direct sumoylation/desumoylation, several proteins have been shown to regulate PML sumoylation and sumoylation-mediated PML degradation and PML
NB formation. Following TNF stimulation, the association of HDAC7 and PML is up- regulated and this association enhances PML SUMO2 conjugation, promoting PML NB formation (74,75). In the opposite direction, overexpression of viral protein LANA2 in
MCF7 cells promotes PML conjugation with SUMO2 but causes PML NB disruption
(260).
Phosphorylation
The major function of PML phosphorylation is to control PML degradation and PML
NB formation in response to several stress conditions, such as DNA damage and oncogenic stress (261). When cells are confronted with DNA damage, inducing UV or double stand breaks, PML NBs initially go to a forced fission state because of topological change of chromatin and hence increase the overall number of small NBs,
100
called PML microbodies (262). In the late phase of DNA repair, these PML microbodies are thought to assist the process of DNA repair and their propagation is regulated by
DNA check point kinases, such as Chk2, ATM and ATR. Thus PML appears to be a sensor and mediator in response to DNA damage (262). Furthermore, in response to - irradiation, the DNA damage check-point kinase, chk2, phosphorylates PML at S117 which is associated with apoptosis (263). During chemically induced DNA damage,
PML is phosphorylated by ataxia telangiectasia Rad-3 related kinase (ATR) and transiently moves to the nucleolus during the S-phase cell cycle checkpoint (227).
Upon Adriamycin-induced DNA damage, HIPK2 induces PML serine 8 and 38 phosphorylation, contributing to PML-sumoylation, stabilization and ensuing apoptosis (264). Similarly, several ERK1/2 phosphorylation sites on PML have been identified and ERK2-mediated PML phosphorylation has been shown to increase PML sumoylation in response to As2O3-induced apoptosis (265). In addition, S403 and
S505 of PML are phosphorylated by ERK2 and are essential for Pin1-induced PML degradation (266,267). In response to hypoxia, CDK1/2 phosphorylates PML at S518 and subsequently promotes Pin1-mediated and cullin3-KLHL20-dependent PML poly- ubiquitination and degradation in prostate cancer cells (268). Given that PML protein levels oscillate during the cell cycle, besides CDK1/2, another cell cycle related kinase,
101
Aurora kinase A can also phosphorylate PML at several serine residues, implying that phosphorylation of PML may be involved in cell cycle control (269). Lastly, some cellular stresses, such as DNA damage and osmotic stress, promote CK2-mediated
PML phosphorylation, leading to PML poly-ubiquitination and degradation promoting cell survival (270).
PML degradation mediated by ubiquitination and viral components
Ubiquitin is a small protein modifier conjugated to specific lysine in mono-, multi- and poly-ubiquitination configurations (Figure 7). The major functions of ubiquitination are to trigger substrate degradation, direct protein trafficking and change protein- protein interacting modules. Like sumoylation, ubiquitin conjugation requires a specific E1/E2/E3 recognition and ligation system. Several ubiquitin E3 ligases have been identified that generate PML poly-ubiquitination and so far the ubiquitination on PML is only associated with its degradation. A PML bona fide ubiquitin E3 ligase,
E6AP, can interact with PML directly in vitro and overexpression of E6AP promotes
PML poly-ubiquitination and degradation (271). Knockout of E6AP in lymphoid cells results in the accumulation of PML and thereby enhances cell susceptibility to genotoxic stress-induced cell death (271,272). Similarly, RING-finger ubiquitin E3 102
ligases, SIAH1 and SIAH2, can directly interact with the PML RING domain and overexpression of these two proteins results in PML and PML-RAR degradation in a proteasome-dependent manner (273). In addition, another RING-finger protein,
UHRF1, has also been found to interact with PML and promote PML proteolysis.
Knockdown of UHRF1 in endothelial cells leads to an accumulation of PML and inhibits angiogenesis in a PML-dependent manner (274). Under hypoxic conditions, KLHL20, an E3 subunit of the KLHL20-Cul3-ROC1 ubiquitin ligase complex, is up-regulated by
HIF1. Simultaneously, PML is phosphorylated by CDK1 and CDK2 at S518 and subsequently modified by Pin1 leading to KLHL20 recognition and consequent degradation, thus promoting prostate cancer progression (268). Interestingly, an E3 ubiquitin ligase family in mammalian cells, RNF4, contains a SUMO interacting motif.
In As2O3 treated APL cells, sumo ligase PIAS1 promotes As2O3-mediated PML sumoylation and facilitates the recruitment of RNF4 to PML for further poly- ubiquitination and degradation (275).
Aside from ubiquitination, upon infection, several viral components can also promote
PML degradation and reduce PML-mediated anti-viral defense. For example, Herpes
Simplex virus 1 (HSV-1) utilizes its regulatory protein, ICP0, to promote PML
103
degradation and PML NB breakdown. A similar scenario is also recapitulated during
Cytomegalovirus infection, (276,277). Additionally, the expression of immediate-early protein BZLF1 by Epstein-Barr virus also causes PML desumoylation and PML NB disruption (278). Given that PML NB formation in the cells is important for its anti-viral function, a reduction in PML levels can be viewed as a strategy for efficient viral infection.
Other modifications
PML is also modified by another sumo-like small protein, ISG15, which is induced by the innate immune system. ISG15 is highly expressed when cells are stimulated by type I interferons, lipopolysaccharide or viral infection. Conjugation of ISG15 to target proteins also relies on the isgylation specific E1/E2/E3 relay system (Figure 7).
Isgylation has been reported to be involved in the blockade of enzyme activity, the inhibition of translation, control of protein stability and interference in protein ubiquitination and neddylation (279). RA induced up-regulation of isgylation E1,
UBE1L, has been shown to enhance PML-RAR degradation by isgylating the PML fusion (280,281). Furthermore, down-regulation of the isgylation removal enzyme,
USP18, also results in accumulation of isgylated PML-RAR which leads to a decrease 104
in PML-RAR protein levels, resulting in APL apoptosis (282). In summary, isgylation of PML may contribute to the PML degradation process.
Using the HDAC inhibitor, TSA in HeLa cells, an increase in PML acetylation was observed and two lysine residues in PML 487 and 515 were identified as acetylation target sites by p300 (283). On the other hand, overexpression of the deacetylase, Sirt1, enhances PML sumoylation and stability independent of Sirt1 deacetylase activity
(284). In Chang’s group, they also found that SIRT1 can remove acetylation at PML
K487, a site located in the PML NLS (285). A mutant of PML, K487R, blocks PML nuclear localization and promotes the retention of PML-associated PER2 in the cytoplasm, thus reducing PER2-mediated circadian gene expression (285).
Cytoplasmic PML
Instead of nuclear localization, about 10 % of all PML isoforms can be found in the cytoplasm. PML VII has no NLS and is exclusively found in the cytoplasm (286-288). In addition, some truncated PML proteins caused by pathological mutations are localized primarily in the cytoplasm and have the ability to sequester nuclear PML, thereby
105
decreasing PML NB formation. Interestingly, this mutant cytoplasmic PML shows dominant effects on normal nuclear PML functions and thereby inhibits p53-mediated transcription and cell growth suppression (289). In response to HSV-1 infection, cytoplasmic PML is up-regulated by alternative splicing which presumably is part of the viral strategies to overcome host defenses (290). Additionally, upon TGF stimulation, cytoplasmic PML can recruit Smad2/3 and SARA to transduce TGF signals for cell growth arrest, senescence, and apoptosis. (288). Using elaborate fractionation methods, some PML proteins in MEFs were found in mitochondria-associated membranes (NEMs) which connects mitochondria with the endoplasmic reticulum
(ER). This NEM-associated PML controls calcium flux to the mitochondria by compartmentalizing a large complex that includes PP2A, AKT, and the inositol triphosphate receptor (IP3R) (287). Given that calcium influx into mitochondria is a key step in apoptosis, PML -/- MEF cells exhibit resistance to ER stress-induced apoptosis. Thus PML appears to be a regulator of apoptosis either in nucleus or in cytoplasm (287).
TNF induced-apoptosis through PML
Overexpression of PML has been shown to suppress anchorage-independent 106
/dependent cell growth in APL and HeLa cells, respectively. Additionally, Pml-/- MEF cells demonstrate a lower growth rate than PML+/+ MEFs (291-293). In mouse models, Pml-/- mice are susceptible to chemical carcinogens, such as dimethybenzanthracene and 12-0-tetradecanoylphorbol-13- acetate. Similarly, Pml-/- mice and their splenocytes are refractory to -irradiation-induced lethality and apoptosis, suggesting that PML is a tumor suppressor that can control cell death (294).
Furthermore, PML is also involved in p53 dependent and p53 independent apoptosis in response to -irradiation, IFN, Fas and TNF(295,296). For the later, TNFmediates apoptotic pathways through the death inducing signaling complex (DISC) cascade and subsequent activation of caspase-3. In Pml-/- hematopoietic cells, TNF-induced activation of caspase 3 and associated apoptosis are reduced (295); however, overexpression of PML in Pml-/- rat embryonic fibroblast cells results in apoptosis without activation of caspase 1 and caspase 3 (297). This controversial result needs further experiments to clarify the involvement of PML in caspase-induced apoptosis but the key role of PML in TNF-induced apoptosis is indisputable. Several mechanisms have been proposed to elucidate how PML contributes to TNF- mediated cell death. First, ectopic expression of PML converts TNF-resistant cancer cells to TNF-induced cell death because of the sequestration of NFB in PML NBs.
107
This reduces the level of NFB-mediated cell survival target genes, such as A20 and survivin (296,298). Secondly, a FAS-interacting protein, DAXX, has been shown to interact with PML. TNF-induced PML NB formation may sequester DAXX and reduce
DAXX-mediated anti-apoptotic gene repression or DAXX’s function in DSIC-mediated apoptosis (299). Finally, PML also interacts with and regulates other apoptosis- associated transcription factors and co-regulators, such as p53 and HDACs. By this mechanism, the increase of PML NBs by TNFtreatment may contribute to TNF- mediated apoptosis but this conclusion requires further investigation.
TNF-mediated anti-angiogenesis via PML
Angiogenesis of endothelial cells is involved in several processes, including morphological change, cell migration and adhesion. TNFα has been found to change the dynamics of actin filaments and cell-cell junctions in human endothelial cells. Thus
TNF, as opposed to VEGF, is an anti-angiogenic factor which results in a reduction in vascular permeability and in endothelial migration. The anti-angiogenic potential of
PML has been demonstrated in Pml-/- mice whose neovascularization occurs faster in response to hypoxic conditions (300). In hypoxia, PML suppresses mTOR function by sequestering mTOR in the nucleus thereby inhibiting mTOR-mediated HIF1 protein 108
synthesis and angiogenesis (300). Recently, several studies have demonstrated that
TNF up-regulates PML abundance by recruiting HDAC7 which promotes PML sumoylation and hence stabilizes PML (74,75). Similarly, the induction of PML by TNF also sequesters HDAC7 in PML NB and relieves HDAC7-mediated repression of the vessel destructive factor and matrix proteinase, MMP-10. This suggests the involvement of a PML-HDAC7 axis in TNF-mediated anti-angiogenesis (75).
Additionally, TNF also induces PML transcription directly by Stat1. In endothelial cells, knockdown of Stat1 or PML compromises integrin β1 (ITGB1) suppression by
TNF and thereby improves EC migration and network formation (198). All together, these studies suggest the existence of a TNF-PML axis that plays an important role in the regulation of angiogenic gene expression. In a related study, using microarray technology, multiple putative genes involved in angiogenesis have been reported but their validation is still lacking (301).
TNF-induced inflammation mediated by PML
Several viral components and inflammatory cytokines can either interact with PML or control PML NB formation. PML is abundant in endothelial cells and macrophages, both of which are fundamental players in the inflammatory response (302). 109
Furthermore, the inflammatory cytokines, IFNs and TNF, can up-regulate PML by either transcription or post-translational control. Since PML NBs interact with several transcription factors and control their transactivation availability, knockdown of PML in endothelial cells changes the profile of TNF-induced inflammatory gene expression (301).
110
Table 3. Summary of PML regulation and the corresponding factors
Type of Involved Final effect Extracellular Ref regulation cellular stimuli signaling or factor
Transcription
Stats/ Upregulation of IFNs (195,197,238) PML mRNA IRF3/IRF8
RAS/p53 Upregulation of Oncogenic stress (239,240) PML mRNA
Post- transcription
Alternative Expression of (203,205) splicing different PML isoforms with distinct function
Alternative Increase in herpes simplex (290) splicing cytoplasmic PML virus-1 infection in response to viral infection
Translation
mTOR/ Upregulation of Oncogenic stress (241) PML translation RAS/
eIF4E
Post-translation
Sumoylation
111
K65/K160/K490 RanBP2 Assembly of PML ND (205,243,244,2 /Ubc9 NBs 46,251,252)
K65 and K160 PIAS1 Increase in CKII- As2O3 (253) mediated PML Tumorgenic degradation adaption
ND Oscillation of PML Cell cycle (250) sumoylation status
Sumoylation and As2O3 (254) sumoylation- mediated ubiquitination and degradation
HDAC7 upregulatioin of TNF (74,75) sumoylation
SENP Desumoylation/ Thermal (253,255-259) NBs dynamic stress/Cellular
stress
LANA2 Upregulation of Viral infection (260) SUMO2- conjugated sumoylation
Phosphorylation
ND ATR Nucleolar DNA damage (212,227,262) localization
S517 CKII PML degradation Osmotic stress (270)
Cellular stress
112
S518 CDK1/2 Increase in hypoxia (268) KLHL20-meidated
PML ubiquitinatin and degradation
ND Aurora Hyper- Cell cycle (269) kinase A phosphorylation
S403 and S505 ERK2 Increase in Pin1- EGF, oncogenic (266,267) mediated PML adaptation
degradation
S527 and S530 ERK1/2 Increase in PML As2O3 (265) sumoylation and PML-mediated apoptosis
S117 Chk2 Increase in PML- -irradiation (263) mediated
Apoptosis
S8, S36, and S38 HIPK2 Increase in PML- DNA damage (264) mediated Apoptosis
S403 and T409 BMK1/ Inhibition of PML- Mitogenic stimuli (303) mediated p21 ERK5 suppression for cancer cell proliferation
Ubiquitination
E6AP PML degradation As2O3 (271,272)
SIAH1 and PML degradation ND (273) SIAH2
113
UHRF1 PML degradation ND (274)
KLHL20 PML degradation Hypoxia (268)
RNF-4 Sumoylation- As2O3 (254) mediated PML degradation
ICP0 PML degradation HSV-1 infection (276)
IE1 PML degradation Cytomegalovirus (277) infection
BZLF1 PML- Epstein-Barr virus (278) desumoylation infection and NB breakdown
Isgylation
Ube1L/ PML-RAR Retinoic acid (207,280,281) degradation USP18 acetylation
K487 and K515 p300 Increase in PML ND (283) sumoylation
K487 Sirt1 Deacetylation of ND (284,285) PML for cytoplasmic retention
Translocation change
Smad2/3 and TGF (288) SARA-mediated TGFsignaling
114
Protein level and NB regulation
Pin1 Decrease in H2O2 (267) Pin1-PML
association and Pin1-mediated degradation
Pin1 Increase in Pin1- IGF-1 (304) PML association
and Pin1- mediated degradation
Decrease in PML Androgen (305) NB formation
Increase in PML Ionizing radiation (306) NB formation
Increase in PML Cisplatin (306) NB formation
E4-ORF3 PML NBs Adenovirus (307,308) disruption infection
As2O3 Pml As2O3 (254,309,310) conformational change for sumoylation- mediated degradation
115
Table 3. Summary of PML regulation and the corresponding factors
The regulation of PML in cells has been shown through transcription, alternative splicing, translation and post-translational modifications. The types of regulation are listed in the first column; the factors that target or modify PML are summarized in the second column; the effects of these regulatory factors on PML regulation are shown in the third column and the final column describes which extracellular agent or stress contributes to the PML regulation.
116
IV. -TrCP1-mediated poly-ubiquitination and protein turnover
UPS system controls protein stability
The precise control of protein quantity and quality is one of the most important events in maintaining cellular homeostasis. Through transcription and translation, newly synthesized proteins replenish the demand for cellular requirements. To control of protein quality and protein metabolism, ubiquitin-proteasome system (UPS) is one of main mechanisms in cells to perform this. The major function of proteasome is to facilitate protein degradation and amino acid recycling. Additionally, it also decreases the amount of aberrant protein and redundant protein (311). To be recognized by the proteasome, proteins are first covalently modified by ubiquitin, an 8.5 kDa polypeptide encoded in almost all tissues of mammals (312). The general process for protein-ubiquitin conjugation requires three enzymes: ATP-dependent ubiquitin- activating enzyme (E1), ubiquitin conjugation enzyme (E2), and E3 substrate recognition ubiquitin ligase (313). Before direct conjugation to substrates, the ubiquitin is activated as a ubiquitin-ATP moiety and then transferred to an E1 Cys residue for subsequent ubiquitin relay to E2 and then to the substrate through ub-E3
(314)(Figure 7). Since E2 usually assembles with E3 as an E2-E3 complex, the E2 conjugated ubiquitin intermediates is conveyed to E3 bound substrates via
117
intermolecular transfer (Figure 8). The major function of E3 is to recognize the substrates and bring them to E2-E3 supercomplex, thus facilitating the ubiquitination process. In mammalian cells, 2 E1s and 38 E2s have been identified and about thousands of putative E3 ligases are encoded in the genome (313). The E3 ubiquitin ligase is believed as the major component that selects target proteins that are destined to ubiqutination and degradation. Numerous studies have shown the involvement of E3 ligase in biological events, such as cell proliferation, differentiation, apoptosis and autophagy (315-319). Based on the structural similarity and functional module, the E3 ubiquitin ligase can be categorized into three subfamily: the homolog of E6-associated protein C-terminus (HECT), the U-box E3 ligases and the really interesting new gene (RING)-finger proteins (320). Of them, the ligases in the HECT superfamily are capable of binding to and directly transferring ubiquitin to a substrate while the U-box and RING-finger protein require E2 to construct a functional module for ubiquitin transfer. In this study, we focus on the RING-finger subtype. There are two types of RING ubiquitin ligases in mammalian cells, the cullin RING ubiquitin ligase
(CRL) and CRL-like ubiquitin ligases. The well-studied F-box -Skp1-Cul1-Rbx1 E3 ubiquitin complex belongs to the CRL subtype and generally contain three stable subunits, a c-terminal ring finger protein Rbx1, a middle scaffold Cul1 and an N-
118
terminal adaptor Skp1 (315)(Figure 8c). Through Skp1, variable F-box proteins can be recruited and assembled with the other subunits as a whole SCF (F-box-SKP1-CUL1-
Rbx1) E3 ubiquitin ligase complex. Owing to its ability for substrate recognition, the main function of the F-box protein is to bring the target protein to the SCF complex for ubiquitination. Sixty-nine F-box proteins have been identified in human cells and most of them interact with their substrates through their C-terminal domains
(321,322). The structural identity of the C-terminal domain divides the F-box proteins into three subtypes that individually have WD 40 repeats (FBXWs), leucine rich repeats
(FBXLs) or other subtype domains (FBXOs)(321). On the other hand, CRL-like ubiquitin ligases, such as the anaphase-promoting complex/cyclosome (APC/C), require additional factors for activation and substrate binding and they recognize targets simply based on the sequence of a consensus KEN element. Unlike CRL-like ubiquitin ligases, the SCF protein usually targets substrates that have a phosphorylated degron motif (DSGXXS)(315,323). Although many putative F-box proteins have been described so far, only nine of them have been confirmed as being E3 ubiquitin ligases and their corresponding substrates validated (315). Since most SCF complex substrates are involved in cell cycle, transcription and inflammation, the deregulation
119
of SCF has been suggested as a major cause of tumorigenesis and abnormal inflammatory responses (324).
After one round of ubiquitination, a single ubiquitin is attached to the substrate and its c-terminal glycine forms a covalent isopeptide bond with -amino group of targeted
Lysine residue. Since ubiquitin itself also has 7 lysine residues (K6, K11, K27, K29, K33,
K48 and K63), after successive ubiquitination cycles the ubiquitin chain is extended via these lysine residues and multiple types of poly-ubiquitination have been observed in biological systems. These include mono-, multi-, poly- and branched ubiquitination
(313). Of them, mono-ubiquitination and multi-ubiquitination can affect protein- protein interaction, protein destination and protein function (Figure 7). Poly- ubiquitination through ubiquitin lysine 48 was first characterized and well-studied
(325). The major function of this type of poly-ubiquitination is to trigger recognition of the modified protein by the 26S proteasome for proteolysis. Similar to Lysine 48, ubiquitin linkage to lysine 6, 11, 27, 29 and 63 is also suggested as a proteasome recognition marker for substrate degradation. In addition to the promotion of target protein degradation, lysine 63 poly-ubiquitination also serves as a scaffold to recruit different binding partners and hence controls NFB activation,
120
Figure 7. The process of ubiquitin and ubiquitin-like modification
121
Figure 7. The process of ubiquitin and ubiquitin-like modification
Initially, the small protein modifiers, including ubiquitin, sumo and Isg15, are activated by ATP and conjugated to E1 activating factors. This activated conjugation complex transfers modifiers to E2 conjugating enzyme that subsequently brings the small protein modifiers to E3 ligase. Finally, E3 ligases recognize their substrates and trigger covalent ligation of modifiers to substrate lysine residues. So far, three major ubiquitin-like modifications have been found in mammalian cell system; ubiquitination, sumoylation and isgylation. Some important functions of those modifications are listed.
122
DNA repair, endocytosis and the translation process (326-329). Instead of tagging on
-amino group of substrates, a novel linear form of ubiquitin conjugation to the N- terminus of substrates has also found to modify several proteins, including MyoD and p21 (330,331). N-terminal ubiquitination may function to regulate target protein degradation while the detailed mechanism and exact biological significance of N- terminal ubiquitination are still missing. In this study, we focus on the function of poly- ubiquitination-mediated proteolysis in corepressor regulation and how this mechanism contributes to inflammatory gene expression.
-TrCP1 structure and function
-TrCP1 is a well-characterized F-box protein in the FBW superfamily which functions as a substrate recognition subunit in a SCF E3 ubiquitin ligase complex. The first identification of-TrCP1 was from a Xenopus cDNA library and suggested a function in cell cycle regulation (332). Later studies further validated that -TrCP1 regulates cell cycle progression by promoting ubiquitination-mediated degradation of several key regulators that control cell cycle check points (315). -TrCP1 is a highly conserved protein encoded from Drosophila (Slimb), to Xenopus (-TrCP) and Humans
(333,334). Noticeably, in the genome of higher organisms, the -TrCP1 gene has a 123
duplicate paralog, that is expressed as a similar protein, called -TrCP2. Both share similar biochemical properties and function. The human -TrCP1 is a 605 amino acid polypeptide that contains an N-terminal F-box (139-186 a.a.) and C-terminal seven
WD40 repeats (235-545 a.a.)(335) (Figure 8 A&B). Based on the crystal structure, the
F-BOX of -TrCP1 consists of three -helixes (H1-H3) which constitute an interaction interface with the corresponding -helixes of Skp1. Adjacent to the F-box, helixes 4-7 form a structural linker that connects the F-box to the C-terminal WD40 repeats
(Figure 8A). Interestingly, the C-terminal WD40 repeats contain multiple small loops and -strands, both of which fold together as a torus-like propeller with a narrow channel in the middle (335) (Figure 8B). Interaction between a substrate such as phospho--catenin and the WD40 repeats of -TrCP1 indicates that almost all seven
WD repeats interact with the phospho--catenin degron and that the hydrogen bonding between the degron phosphate and WD40 hydroxyl groups along with the van der Waals bonding are the major forces that stabilize the interaction between -
TrCP1 and its substrate (335). From an analysis of -TrCP1 favored target sequences, a small motif that contains DSGXXS is thought of as the -TrCP1 canonical target fragment. Phosphorylation of the second and last serine is a key marker for -TrCP1 recognition (315) (Figure 8C). The importance of Degron phosphorylation has been
124
demonstrated by biochemical binding assays and crystal structures (52,335).
Furthermore, the space between the degron and a ubiquitin approachable lysine residue is proposed as a critical parameter to affect the efficiency of -TrCP1- mediated ubiquitination.
As paralogs, -TrCP1 and -TrCP2 have about 75% similarity in amino sequence and share redundant functions in the ubiquitination and degradation of most substrates, including Emi1, IB and Mdm2 (52,336-338). Although indistinguishable in most regions, amino acid differences between -TrCP1 and -TrCP2 in the N-terminal 100 amino acids elicits some distinct characteristics. Indeed, several studies have demonstrated that -TrCP1 and -TrCP2 localize differently with the former primarily in nucleus and, the later primarily in cytoplasm. Additionally, they maybe regulated by different mechanisms in some cell lines (339-342). In the following sections, the different functions and regulations of -TrCP1 and -TrCP2 will be discussed. Since these two proteins share most functions, -TrCPs will be used when referring to both
-TrCP1 and -TrCP2 in the next sections.
125
Figure 8. Structure of SCF-β-Trcp1-Skp1-Cul1 E3 complex and β-Trcp1-mediated ubiquitination and proteolysis
126
Figure 8. Structure of SCF--Trcp1-Skp1-Cul1 E3 complex and -Trcp1-mediated ubiquitination and proteolysis
(A) The conformational overview of -Trcp1-Skp1 and Cul1 crystal structures. The purple barrel like structure is the WD 40 repeats of -Trcp1 responsible for substrate interaction (PDB1P22). Following the WD40 repeats are blue helices-assembled in a structure that contains the F-box for skp1 binding. The skp1 structure is shown in green and Cul1 is a large protein colored in yellow (PDB1LDJ). (B) A top view of WD40 repeats of -Trcp1. This functional domain is required for substrate recognition
(PDB1P22). (C) A schematic process of -Trcp1-mediated ubiquitination and proteolysis. Before -Trcp1 targeting, most substrates are phosphorylated on their conserved degron motifs by specific kinases. Those phospho-degron motifs (DSGXXS) are further recognized by -TrCP and assembled as substrate--Trcp1-Skp1-Cul1 supercomplex for ubiquitination. In most cases, the ubiquitinated substrates will enter into proteasome-mediated proteolysis.
127
The regulation of -TrCPs
-TrCPs are rare proteins because their mRNAs are labile and require RNA associated factors for stability (53,340,343). Thus the availability of -TrCPs can be easily manipulated by overexpression, providing pseudo-substrates, dominant negative -
TrCPs or inhibition by RNAi knockdown techniques (53,344,345). On the other hand, elevation of -TrCPs protein in cells sharply enhances -TrCPs occupancy on substrates and promotes substrate ubiquitination and degradation. In an earlier report, the mRNA encoding -TrCP1 was been found to be transiently and rapidly up- regulated in cells upon WNT stimulation or overexpression of the WNT effector, TCF
(346). Interestingly, the up-regulation of -TrCP1 in turn promotes the degradation of the TCF co-activator, -catenin, and NFB inhibitor, IB, resulting in a negative feedback loop in WNT signaling and enhanced NFB activity, respectively (346). Two other studies further elucidated that TCF/-catenin up-regulates an RNA binding protein, coding region determinant-binding protein (CRDBP), which binds to -TrCP1 mRNA protecting the former from mir-183-mediated mRNA degradation (343,347).
The overall enhancement of -TrCP1 by WNT signaling causes activation of NFB and c-myc, contributing to tumorigenesis (347). In contrast to WNT-mediated -TrCP1 up- regulation, elevation of WNT signaling by overexpression of TCF or constitutively
128
active -catenin leads to transcriptional down-regulation of -TrCP2 (341). In some cell types lacking -TrCP1, WNT signaling results in the inhibition of NFB activity due to suppression of -TrCP2-mediated NFB activation. In addition to WNT signaling, several stresses, including TNFH2O2 and UV, can induce the accumulation of -
TrCP1 mRNA via stress-induced kinase, JNK, thereby resulting in the activation of NFB
(339). In contrast, the transcription of -TrCP2 is up-regulated and its mRNA is further stabilized via activated MAPKs upon mitogenic and growth factor stimulation (340).
From these observations, it is reasonable to question whether the major function of
-TrCP2 is to promote cell proliferation. Indeed, the overexpression of -TrCP2 has been found in several breast cancer cell lines (341). Although the mRNA levels of -
TrCP1 and -TrCP2 are regulated by distinct pathways, both are transcriptionally elevated in mouse melanomas, thus leading to hyper-NFB activity for cancer cell survival (348,349).
In addition to regulation through mRNA stability, multiple alternatively spliced isoforms of human -TrCP1 and -TrCP2 have been reported and some of them are expressed in mouse tissue in a tissue specific manner (350). Interestingly, different isoforms of -TrCP1 demonstrate distinct expression patterns in the cytoplasm or the
129
nucleus, implying that they have distinct functions in the stability of nuclear or cytoplasmic substrates (342,351). However, the biological function of each isoform requires further examination. In the nucleus, -TrCP1 tightly associates with nuclear phospho-protein, hnRNP-U, which functions as a pseudo-substrate to stabilize -
TrCP1 and enhances its nuclear retention. The interaction of -TrCP1 and hnRNP-U is not as strong as its cognate substrate, IB. Due to the low affinity between -TrCP1 and hnRNP-U, -TrCP1 is capable of replacing its binding partner to IB for ubiquitination and consequent IB degradation (342). Furthermore, a mutant of -
TrCP1 that is unable to bind to hnRNP-U changes its original location from the nucleus to the cytoplasm. This indicates that hnRNP-U functions in the regulation of -TrCP1 nuclear-cytoplasm shuttling for cytoplasmic substrate recognition.
Although several studies have reported -TrCP regulation by mRNA stabilization, only a few of them demonstrated how protein levels of -TrCPs are controlled in cells. For example, -TrCP2 is known to be regulated by proteasome-mediated proteolysis
(352). Interestingly, in several cancers, deregulation of -TrCPs has been suggested as a pivotal player in promoting cell transformation and cancer cell proliferation (315).
Thus it is likely that enhancement of -TrCPs in cancer cells causes increased NFB
130
activity, resulting in cell survival and chemotherapy resistance (353). Therefore, further studies understanding how -TrCPs protein is regulated will be useful for the development of new therapies for a subtype of cancers in which -TrCPs are aberrantly expressed.
The biological function of -TrCP1
The major function of -TrCPs in cells results from the degradation of its substrates.
Since -TrCPs regulated substrates are involved in cell cycle, apoptosis, inflammation and metabolism, -TrCPs has been suggested as an important regulators in these biological events (Summary in Table 4).
-TrCP1, cell cycle and tumorigenesis
Since several -TrCP substrates function as cell cycle regulators or gate keepers of cell cycle checkpoints, -TrCP has been thought as a key controller of the cell cycle. During the cell cycle, entry of each phase is tightly controlled by a corresponding cell cycle dependent kinase (CDK). Therefore, the accurate regulation of distinct CDK activity is a key to accomplish cell division and ensures proper cell proliferation. In the transition
131
of G1/S phase and G2/M phase, two CDK regulators, CDC25A and EMI1, have been identified as -TrCP substrates and the degradation of those two proteins results in the blockade of CDK1 activity (354,355). In response to DNA damage, Chk1 and Chk2 phosphorylate CDC25A and the hyper-phosphorylated CDC25A promotes -TrCP- mediated CDC25A degradation, causing CDK1/2 inactivation and cell arrest in S phase
(355). Similarly, Claspin accumulation after DNA damage is also essential for Chk1 activation by ATR (356). When cells recover after DNA damage, Plk1-mediated phosphorylation of Claspin and subsequent -TrCP-mediated degradation of Claspin result in lower Chk1 activity and less CDC25 degradation, relieving the surveillance of
DNA damage (357). Additionally, during late G2, phosphorylation of WEE1, a CDK1 inhibition kinase, by Plk1 and CDK1 triggers -TrCP-mediated WEE1 degradation and in turn enhances a WEE1-CDK1 positive feedback loop for CDK1’s rapid activation. This fulfills a requirement for cells to enter M phase (358). Before entering M phase, the pre-activated CDK1 phosphorylates EMI1, an inhibitor of anaphase-promoting complex/cyclosome (APC/C). Phosphorylation promotes -TrCP-mediated EMI1 ubiquitination and degradation, which enhances APC/C activity and facilitates APC/C- mediated cyclin A/B destruction, thus inhibiting CDK1 activity and accelerating cells into mitosis (337). In the same cell cycle transition state, another mitotic entry
132
regulator, Bora protein levels accumulate and activate a Plk1-CDC25-CDK1 positive feedback loop to facilitate cells undergoing mitosis (359). At the end of cell division,
Bora also functions as a mitotic check point regulator and either loss or overexpression of Bora results in a delayed mitotic process because of the defects in spindle assembly
(360). In this state, the proper control of Bora by Plk1--TrCP-mediated ubiquitination and proteolysis is a key step to promote correct mitotic progression (359). Based on those findings, the -TrCPs are pivotal players in controlling the transition between S and M phases. It is therefore predictable that the deregulation of -TrCP will lead to genome instability and abnormal cell proliferation, both of which are main causes for cell transformation.
In addition to targeting cell cycle regulators, -TrCP also causes the degradation of several tumor suppressors, including IB, PDCD4 and REST. In the previous discussion,
IB was an important suppressor of NFB and up-regulation of -TrCP by BRAF in melanoma has been found to enhance IB degradation resulting in NFB activation, thus contributing to cancer cell survival (349). Another tumor suppressor, PDCD4 is phosphorylated by S6K after mitogen stimulation and phsopho-PDCD4 is further degraded via -TrCP-mediated ubiquitination and proteolysis. Since PDCD4 can block
133
translation factor eIF4A function, expression of -TrCP resistant PDCD4 in cells results in slower cell growth. This implies that -TrCP can accelerate cancer cell proliferation via degradation of PDCD4 (328). As a transcriptional repressor, repressor element 1
(RE1)-silencing transcription factor (REST), has been found frequently mutated in colorectal carcinoma and loss of REST increases PI3K signaling in tumorigenesis (361).
Thus overexpression of -TrCP in mammary epithelial cells drives cell transformation owing to the degradation of tumor suppressor, REST (362). Noticeably, the -TrCP-
REST axis is required for normal neural differentiation, implicating the axis in normal cellular events as well as tumorigenesis depending on the context. In addition to these cases, other pro-apoptotic proteins, such as pro-caspase 3, p53 and TAP63 have also been identified as -TrCP target proteins (363-365). Of note, -TrCP1 and -catenin control each other in a negative feedback loop. However, in some tumor cells, defects in the -catenin phosphorylation causes its accumulation which further enhances the
-TrCP1 protein levels and persistently activates NFB, thus contributing to cancer cell survival (346).
Further supporting evidence of -TrCP’s oncogenic property come from observations in mouse models and clinical tumor samples. -TrCP1 Knockout mice exhibit
134
hypoplastic mammary glands but MMTV-driven -TrCP1 overexpression induces high levels breast tumors, indicating a role of -TrCP1 in breast cancer transformation
(366). Up-regulation and mutations of -TrCP have been found in breast, colon, liver, and skin cancer (315). Combing those physiological observations and biological investigation,-TrCP in some tissue is a oncogenic promoter. In others anti-apoptotic and oncogenic proteins, such as Mcl-1, Mdm2 and UHRF1, exhibit lower levels of accumulation because of TrCP-mediated degradation (338,367,368). It is also noteworthy that in some cancer types, targeting-TrCP as a therapeutic strategy may cause -catenin activation and elevate activity of other survival kinases, such as Akt and S6K, resulting a chemotherapeutic resistance (319,369). Therefore, understanding the crosstalk of each individual-TrCP targeting route will be essential for the development of exquisite and advanced cancer therapies.
-TrCP1 and inflammation response
In 1998, the first noted function of -TrCP was to facilitate human immunodeficiency virus type-1 (HIV-1) encoded, Vpu to mediate CD4 receptor ubiquitination and degradation (370). Using this mechanism, hyper-phosphorylated Vpu functions as an adaptor to bridge -TrCP with host virus receptor CD4 and thereby promotes ER 135
bound CD4 degradation before it is presented on cell membrane. The Vpu-mediated
CD4 degradation not only prevents the early stage host apoptosis which can be caused by super-infection but also reduces CD4-mediated interference in the maturation of the viral envelope precursor glycoprotein, thus enhancing viron release and spread
(371). Recently, a similar mechanism has also been found in the reduction of host anti- viral protein, Tetherin/BST-2 by Vpu (372). In addition, -TrCP2 also targets several inflammatory receptors, such as IL10R1 and IFNAR1. This association results in triggering inflammatory receptor ubiquitination, endocytosis and consequent degradation by lysosomes (373,374), thus preventing the persistent activation of these inflammatory responses. Similarly, prolonged stimulation by IL17 in HeLa cells results in the recruitment of -TrCPs to the IL17 downstream effector, Act1, and thus promotes Act1 degradation by a ubiquitination-proteasome dependent mechanism, desensitizing IL17 downstream signaling (375). Most importantly, as mentioned previously, -TrCPs are central players to in the degradation of p-IB and induce subsequent activation of NFB which programs inflammatory gene expression in response of TNF (52,54). TNF also enhances -TrCP1 protein levels and may directly promote the overall inflammatory response through -TrCP1 accumulation (339).
Based on those concepts, direct targeting -TrCP can be viewed as a possible strategy
136
to reduce inflammatory responses and attenuate symptoms in several inflammation- associated diseases.
137
Table 4. Summary of β-TrCP substrates, the conserved degron motifs and their function
substrate function degron kinase Ref
Act1 Inflammation ND ND (375)
signaling
ATF4 Transcription factor DSGICMS ND (351)
AUF1 ARE-mRNA decay SSPRSHE ND (376)
beta-catenin Wnt signaling DSGIHS GSK3 (369)
BIMEL Proapoptotic factor SSGYFS Rsk1/2, (377)
Erk1/2
BMI1 Animal patterning DSGSDKANS (378)
Bora PLK1 activator DSGYNT Plk1 (359,
360)
BTG1 and BTG2 Anti-cell proliferation ND ND (379)
CD4 (HIV VPU) Viral infection ND ND (380)
CDC25A Phosphatase, CDK1 STDSG Chk1 and (355)
activator Chk2
138
CDC25A Phosphatase, CDK1 STDSG Nek11 (381)
activator
CDC25B Phosphatase, CDK1 DDGFVD/DSGFCLDS/ JNK/p38 (382,
activator 383) DAGLCMDSPSP
Claspin DNA replication and DSGQGS Plk1 (384)
damage stress
Cortactin Cytoskeletal dynamic ND ERK (385)
Deptor mTOR signaling GSSGYFS CKI/S6K/RSK (386,
387)
DLG Cell morphology DSGLPS ND (388)
EMI1 CDH1 inhibitor DSGYSS ND (354)
FOXO3a Transcription factor ND IKKβ (389)
GHR Growth hormone ND ND (390)
signaling
H-RAS GTPase ND ND (391)
HSF1 Mitotic progression DSGSAHS PLk1 (392)
HuR mRNA stability EEAMAIAS ND (393)
regulation
139
IFNAR1 Interferon signaling DSGNYS CKI (394)
IFNR Interferon signaling DSGNYS ND (374)
IB Inhibitor of NFB DSGLDS IKK (52,3
52,36
9)
IB Inhibitor of NFB DSGLGS IKK (395,
396)
IB Inhibitor of NFB DGSIES IKK (395)
IL-10R1 Inflammation DSGFGS ND (373)
signaling
IRAK1 NFB activation ND ND (397)
LPCAT1 Phospholipid SDQDS GSK3 (398)
synthesis
MCL1 Pro-apoptotic factor DGSLPS GGSK3 (367)
Mdm2 P53 stability Multiple sites CKIδ (338,
399)
MTSS1 Cytoskeletal dynamic DSGFIS CKIδ (400)
MYC MYC stabilization ESGSPS Plk1 (401)
140
Nrf1 Antioxidant transcri DSGLS ND (402)
ption factor
Nrf2 Antioxidant transcript DSGIS/DSAPGS GSK3 (403)
ion factor p100 NFB signaling DSAYGS NIK/ IKK (404) p105 NFB signaling DSGVETS IKK/ (405) p53 Tumor suppression GSRAHS IKK (364)
transcription factor p63 Epithelial ND ND (365)
differentiation and
apoptosis
PC2 Calcium signaling ND ND (406)
PDCD4 Translational control DSGRGDS S6K1 (328)
PER1 Circadian TSGCSS CKIɛ (407)
transcription factor
PER2 Circadian SSGYGS CKIɛ (408)
transcription factor
PFKFB3 glycolysis DSGLLS ND (409)
141
PHLPP1 dephosphosrylation DSLSV/QSVLLT CKI/GSK3 (410)
Plk4 Cell cycle regulation DSGHAT Plk4 (411)
PRL-R Growth hormone DSGRGS ND (412)
signaling
Pro-caspase 3 Pro-apoptotic factor ND ND (363)
REST Tumor suppression DEGIHS/STDSG ND (413)
Transcriptional
repressor
REST Tumor suppression EGSDDS ND (414)
transcription factor
SMRT Transcription ND ND (116)
repression
Snail Animal patterning DSGKGS GSK3 (415)
SPAR synaptic morphology DSGIDT Plk2 (416)
Stat1 Transcription factor ND Erk (417)
TAZ Transcription DSGSHS/DSGSFS GSK3 (418)
activation
Tetherin Anti-viral component Vpu (372)
142
TWIST Animal patterning DVSSSPVS/DSLSNS IKK (419)
UHRF1 Epigenetic modifier SDTDS CK1δ (368)
VEGFR2 Angiogenesis DSGLS/DSGMYLAS/D CKIδ (420)
SGTT/ DTDTT
WEE1 CDK1 inhibitory DSAFQE/EEGFGS Plk1/CDC2 (358)
kinase
YAP Transcription DSGLS CKIδ/ɛ (421)
activation
143
Table 4. Summary of -TrCP substrates, the conserved degron motifs and their function
The major function of -TrCP is to recognize substrates that usually contain phosphorylated degron motifs. Through -TrCP-mediated poly-ubiquitination, -TrCP substrates are prone to proteasome-mediated proteolysis. So far, about one hundred
-TrCP substrates have been identified and shown to be involved in different biological processes. In this table, the known -TrCP substrates and a brief description of their biological function, is provided along with their degron motifs and the associated kinases that are responsible for degron phosphorylation (This table is adapted from (315)).
144
V. IFN-induced activation of Stats by Pml
Interferons (IFNs) are glycoproteins secreted by many cell types, such as lymphocyte, macrophage, fibroblast and endothelial cells, in response to various pathological stresses, such as viral infection, bacterial infection and tumor burden (422). The major function of IFNs is to restrict virus replication through the activation of intrinsic anti- microbial modules in the infected cells and surrounding tissues and to eradicate pathogens by invoking innate and adaptive immune systems (422). In mammals, IFNs can be classified into two major types due to their distinct receptors (422). The type I
IFNs, including IFN and IFNwhich bind to a complex of IFNAR1 and IFNAR2. IFN the unique type II interferon, binds to the IFNGR complex which consists of 2:2 IFNGR1 and IFNGR2 subunits (423). Unlike IFN expression, which is restricted to immune cells, type I IFNs and their cognate receptors are widely expressed in various tissues and can rapidly respond to the type I IFN stimuli (424). In this study, we focus on the cellular signaling activated by IFN.
Upon IFNconjugation, the IFNAR complex associated tyrosine kinase JAK1/2 is activated and subsequently phosphorylates the IFNAR to recruit Stats (423). By this means, JAK1/2 can further phosphorylate Stats, which results in Stat dimerization and
145
nuclear translocation. This activates a cohort of Stat target genes, collectively called interferon stimulated genes (ISGs) (423). Through this mechanism, IFN stimuli control a set of genes that contributes to anti-viral defense, inflammation, anti-tumor immunity and cell apoptosis. There are seven Stats in mammals and Stat1, Stat2 and
Stat3 are preferentially activated upon Type I IFNs (425). For example, IFN-activated
JAK1 phosphorylates Stat1 at Y701 so that the phosphorylated Stat1 (p-Stat1) can hetero-dimerize with phosphorylated Stat2 (p-Stat2) and translocate into nucleus to assemble with interferon regulatory factor 9 (IRF9) to form a ternary complex, IFN- stimulated gene factor 3 (ISGF3) (422). The ISGF3 is capable of binding to specific IFN- stimulated response DNA elements (ISREs) to activate a set of anti-viral gene transcription (422). In addition, p-Stat1 (p-Y701) and p-Stat3 (p-Y705) can also form homo-dimer complexes respectively, both of which enter the nucleus to compete for
IFN-activated sites (GAS) binding to a subset of pro-inflammatory genes (422).
Noticeably, although Stat1 and Stat3 show similar DNA binding property in vitro and co-regulate a set of genes in vivo, they also activate distinct gene sets, depending on the cell type and cytokine (426). Several studies also suggested that Stat1 and Stat3 exert opposing effects in many physiological conditions (426).
146
Like other cytokine stimuli, the IFN-mediated JAK-Stat signaling has been shown to be biphasic, depending on the dose and the duration of stimulation. With short-term and high dose stimuli, the phosphorylated Stat1/2 and Stat3 translocate into the nucleus and regulate target gene transcription as previously described. Several Stat activated genes, such as SOCS1, SOCS3 and USP18, function as negative regulators to terminate IFN-dependent signaling (422). In contrast to acute stimuli, long-term and low dose treatment of IFNresults in a continuous increase of un-phosphorylated
Stat1 (U-Stat1) which is generated from newly synthesized poly-peptides or dephosphorylated Stat1, which is also found in nucleus and has transcription activities
(427). Comparing the genes activated by U-Stat1 and p-Stat1, the U-Stat1 only induces a small subset of genes that overlap with p-Stat1 target genes, such as OASs and MX1
(428). The central function of U-Stat1 is to sustain type I IFN signaling for anti-viral gene expression, thus protecting the cells from further infection (429). Unlike Stat1 translocation to the nucleus via phosphorylation, Stat3 can constitutively associate with importin and shuttles across the nuclear membrane without phosphorylation
(430). By this means, U-Stat3 might accumulate in the nucleus without extracellular stimuli. It is still unknown whether long-term IFN stimulation results in the accumulation of U-Stat3 but sustained IL6 stimulation in hTERT-HME1 (human
147
mammary epithelia cell line) cells has been shown to elevate U-Stat3 accumulation at late times after stimulation. The increase in U-Stat3 results in a second wave of gene activation, the pattern of which is distinct from the primary transcription, indicating that U-Stat3 mediates a separate transcriptional signature from p-Stat3 (431).
In addition to phosphorylation, Stat1 is also subjected to acetylation, Sumo1 conjugation and isgylation (Isg15 conjugation) (432). Isg15 expression is induced by type I IFNs. Like ubiquitination, protein isgylation is catalyzed by E1, E2 and E3 small protein modifier system (Figure 7). In mammalian cells, Isg15-activating E1 enzyme
(Ube1L), Isg15-conjugating E2 enzyme (UbcH8) and Isg15 E3 ligase (HerC5) are known to facilitate Isg15 conjugation to lysine residues of target proteins (433). Isg15 conjugation is cleaved by the sole Isg15 deconjugating enzyme, Usp18 (318). The exact biological function of protein isgylation is poorly understood. Some studies suggest that protein isgylation may enhance antiviral responses and may participate in protein stability control (434,435). Knockdown of USP18 has been shown to promote
IFN/Stat1 target gene expression and elevate the activity of a reporter containing an
ISRE. These results suggest that isgylation is a positive modification that enhances
Stat1 activity (436).
148
Stat1 is viewed as a positive regulator that promotes IFN-mediated anti-viral, anti- proliferation, anti-angiogenesis and apoptosis (437-439). However, Stat3 is proposed as a negative regulator that antagonizes Stat1 function in several cellular events, including tumorigenesis, angiogenesis and inflammation (440). Since Stat1-/- mice are susceptible to carcinogen-induced tumorigenesis and reduced expression of Stat1 is usually found in cancers, Stat1 is believed to have tumor suppression activity (441).
Indeed, activation of Stat1 results in the up-regulation of pro-apoptotic factors, caspases and the Cdk inhibitor, p27Kip1 and thereby decreases the overall cell growth
(442). Furthermore, oncogenic c-Myc and HER2/Neu gene expression are inhibited by
Stat1 (443). In contrast, Stat3 is highly activated in various cancers, including breast carcinoma, melanoma and neuroblastoma (444). Stat3-mediated activation of several pro-survival genes, such as Survivin and Bcl-2, and inhibition of tumor suppressor p53 expression define STAT3 as an oncogene (445,446). In addition to the direct control of cell growth and survival, Stat1 and Stat3 also control angiogenesis in opposite ways, highlighting their antagonistic property in the regulation of the tumor microenvironment. For example, activation of Stat1 by IFNinhibits HUVEC activity in capillary tube formation assays accompanied by the repression of several
149
angiogenesis-associated genes, such as VEGFR2 and angiopoietin-2 (447). Similarly, during IFNstimulation, several angiostatic factors, including CXCL10 and CXCL11, are up-regulated in a Stat1-dependent manner (448,449). However, overexpression of a constitutive activated Stat3 mutant, Stat3C, in several cancer cell lines, induces the expression of VEGF, a key angiogenic promoter (450). During hypoxia and oncogenic stimulation, the blockade of Stat3 by small molecule inhibitors represses HIF1 and
VEGF expression and attenuates tumor-associated angiogenesis (451). Although the results discussed above were not performed in the same experimental setting, it is generally true that Stat1 and Stat3 regulate biological processes by activating pathways with opposing activity. In addition, Stat3 can physically antagonize Stat1 in the some cellular contexts. Overexpression of Stat3 is capable of sequestering Stat1 and reducing expression for a subset of IFN-Stat1 regulated genes by enhancing the ratio of Stat1/Stat3 in complexes (451). In this case, it is unlikely that Stat3 and Stat1 compete for sole occupancy of a DNA binding elements because the Stat3 DNA binding domain is dispensable for this effect (451).
As mentioned above, the expression of PML is also up-regulated by type I IFN and classified as an ISG (195,197,238). Interestingly, PML interacts with both Stat1 and
150
Stat3 (452,453). Nonetheless, it is still unknown whether PML functions in IFN- mediated Stat1 activation and Stat1 target gene expression. In two recent studies using Pml-/- MEFs, contradictory results in which PML plays disparate role in Stat1 transcription activity during IFN stimulation were reported (453,454). Choi et al. showed that compared to WT MEFs, short-term IFN treatment of Pml-/- MEFs enhances Stat1 transcriptional activity in the regulation of GAS response elements and elevates a subset of Stat1 target gene expression (453). They also proposed that the enhancement of PML-mediated Stat1 sequestration during IFN stimuli causes a decrease in Stat1 transactivation ability (453). However, Baugrini et al. found that overexpression of PML enhances IFN-driven Stat1 phosphorylation and Stat1- mediated target gene expression, including PKR or IRF-9 (454). Furthermore, knockdown or knockout of PML in the HEK293 or MEFs attenuates Stat1-DNA binding when stimulating cells with IFN (454). The contradictory findings of PML in Stat1- mediated transcription regulation in these two studies are still unresolved. However, it is known that PML can physically interact with Stat1 and affect its transactivation activity. Through the B-box and C-terminal domain, PML also associates with Stat3 and overexpression of PML inhibits Stat3 transactivation ability (452). Collectively, these studies indicated that PML regulates Stat1 and Stat3-mediated transcriptional
151
regulation, while the detailed mechanisms remain largely unknown. In this study, we surmise that PML functions as a mediator to control Stat3 and Stat1 transcription activity during IFN stimuli. Based on our data, we conclude that PML promotes isgylation of nuclear Stat1/Stat2 and Stat1/Stat2 target gene expression after a prolonged IFN (16 hr) exposure but negatively regulates nuclear Stat3 activity by enhancing its nuclear proteolysis in response to acute IFN stimulation. Our findings support a model in which PML forms a positive feed forward loop with Stat1 to potentiate IFN activity and reciprocally counteracts Stat3 activity that suppresses
Stat1 activity, thus assuring the ultimate biological effects upon exposure of sustained
IFN stimulation (Figure 9).
152
IFN
Figure 9. PML has a dual function in regulating Stat1 and Stat3 during IFN stimulation
153
VI. Our research strategy
TNF and IFN are two inflammation-associated cytokines that induce a subset of genes promoting multiple cellular functions, including inflammatory response, angiostasis and apoptosis (12,422). To understand how these two cytokines activate target genes, we focus on the regulation of transcription factors and transcriptional corepressors in response to TNF or IFN stimulation. SMRT is a key transcriptional corepressor that mediates repressive activity of associated DNA-binding transcription factors to suppress the expression of a subset of inflammatory genes, including TNF- inducible genes. Removal of SMRT from target gene promoter by signaling activated kinases and post-transcriptional modifiers promotes SMRT target gene expression
(Figure 3 and Table1). Based on these observations, we propose that TNF may promote SMRT post-translational modification through its downstream effectors, thereby promoting dissociation or removal of SMRT from TNF-inducible gene promoters and subsequent induction of a set of inflammatory genes. Our data indicate that TNF downstream effector, -TrCP1, promotes ubiquitination of SMRT and its removal from the promoter of target genes, including IL1, IL6 and IL8. In another study, we investigated the mechanism by which TNF facilitates PML mRNA translation to induce protein expression. Our lab has previously demonstrated that
PML is transcriptionally induced by TNF(198). Interestingly, TNF-induced PML 154
protein accumulation is greater than mRNA accumulation. Based on this observation, we examine the possibility whether PML is also post-transcriptionally controlled by
TNF stimulation. We elucidate that PML mRNA translation is activated by TNF downstream p38-MNK1 kinase axis, which activates an internal ribosome entry site
(IRES) in the 5’-UTR of PML mRNA, thereby facilitating PML protein synthesis.
Accordingly, PML mediates TNF-mediated gene regulation, anti-angiogenesis and apoptosis. Lastly, our preliminary data indicate that loss of Pml converts IFN from an angiostaic factor to a pro-angiogenic factor in Matrigel plug assays. This observation suggests that PML is a key component involved in feedback regulation that promotes
IFN-mediated anti-angiogenesis. To dissect this feedback regulation, we examined the role of PML in the regulation of IFNdownstream transcription factors, Stat1 and
Stat3. Since Stat1 and PML are angiostatic and Stat3 is angiogenic, we hypothesize a model in which PML forms a positive feed forward loop enhancing Stat1 activity to potentiate IFN activity and reciprocally counteracts Stat3 activity, thus assuring the optimal angiostatic effects upon exposure of sustained IFN stimulation
(438,440,447,450).
155
Chapter 2: beta-Transducin repeat-containing protein 1 (beta-
TrCP1)-mediated silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) protein degradation promotes tumor necrosis factor alpha (TNFalpha)-induced inflammatory gene expression.
This chapter has been published in The Journal of Biological Chemistry (116)
Abstract
Cytokine modulation of the endothelium is considered an important contributor to the inflammation response. TNFα is an early response gene during the initiation of inflammation. However, the detailed mechanism by which TNFα induces proinflammatory gene expression is not completely understood. In this report, we demonstrate that silencing mediator of retinoic acid and thyroid hormone receptor
(SMRT) represses the expression of a subset of TNFα target genes in human umbilical vein endothelial cells. Upon TNFα stimulation, we observed an increase in the E3 ubiquitin ligase β-TrCP1 and a decrease in SMRT protein levels. We show that β-TrCP1 interacts with SMRT in a phosphorylation-independent manner and cooperates with the E2 ubiquitin-conjugating enzyme E2D2 to promote ubiquitination-dependent
SMRT degradation. Knockdown of β-TrCP1 increases SMRT protein accumulation,
156
increases SMRT association with its targeted promoters, and decreases SMRT target gene expression. Taken together, our results support a model in which TNFα-induced
β-TrCP1 accumulation promotes SMRT degradation and the subsequent induction of proinflammatory gene expression.
Introduction
Pathogen-mediated acute inflammation is recognized by the innate immune system, which is critical for repair of damaged tissue and defense against infection. By contrast, chronic inflammation in the endothelium is considered a major cause of atherogenesis and cardiovascular diseases (455). Normally, the expression of inflammatory genes in endothelial cells (ECs) is repressed but becomes activated in response to extracellular stimuli, including infection, injury, and cytokine exposure. In the endothelium, cytokine stimulation results in induction of the expression of a subset of proinflammatory genes. Several transcription factors and transcriptional coregulators have been shown to play a key role in cytokine signaling, ensuring an appropriate inflammatory response (97,456).
157
TNFα is an immediate-response cytokine secreted by the endothelium and immune cells when they sense extracellular risk signals, such as injury or infection (457,458).
The release of TNFα from ECs and immune cells in circulation not only induces the expression of adhesion molecules to recruit leukocytes to the injured lesion but also amplifies the inflammatory response via a cytokine-chemokine cascade (455,459).
These cytokines and chemokines further attract leukocytes and promote their differentiation into macrophages to maintain long-term inflammation until clearance of the risk factors is achieved (459).
To maintain homeostasis, most inflammation-associated genes are repressed under an unstimulated condition. The nuclear receptor corepressor (NCoR) and silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) are two potent transcriptional corepressors that repress inflammatory response genes (80,113).
Guided by inflammation-responsive transcription factors, such as AP-1, NF-κB, and
BCL-6, NCoR and SMRT establish a complex repression network to silence a set of inflammatory genes in mouse macrophages (79,113). Disruption of the BCL-6 and
NCoR-SMRT interaction in mouse or human macrophages abolishes NCoR-SMRT- mediated repression and promotes inflammatory events such as atherosclerosis
158
(80,460). These results suggest that SMRT is critical for the regulation of the inflammatory response in the immune system. However, SMRT function and its regulation in the endothelium in response to cytokine activation have not been thoroughly investigated.
Upon TNFα stimulation, an early response is the selective induction of inflammatory genes driven by NF-κB (59,61,62,69,461). Although several mechanisms underlying the activation of NF-κB have been proposed (69), a complete picture includes less well studied nuclear events. One strategy to facilitate NF-κB-mediated transactivation is the removal of repressive complexes from NF-κB target gene promoters. This is achieved by phosphorylation and nuclear export of SMRT, a NF-κB-associated transcription corepressor (78,174). Alternatively, substantial decreases in SMRT levels through transcriptional regulation have been shown to contribute to NF-κB transactivation in human adipocytes (90). In addition to transcriptional regulation, ubiquitination-mediated proteolysis of SMRT has been suggested as a posttranslational pathway to lower SMRT levels and attenuate its repression activity in HEK-293 cells (119). However, a bona fide E3 ubiquitin ligase to trigger this process is still unknown.
159
In this study, we have uncovered a previously unappreciated mechanism in which the
TNFα-inducible E3 ubiquitin ligase β-TrCP1 promotes SMRT protein turnover through polyubiquitination and proteasome-mediated degradation. Furthermore, we demonstrate that β-TrCP1-mediated SMRT degradation facilitates the clearance of
SMRT from TNFα target gene promoters, resulting in elevated inflammatory gene expression in human umbilical endothelial cells (HUVECs).
Materials and Methods
Plasmids and DNA Constructs
The expression plasmids CMX-SMRT, CMX-β-TrCP1, and dominant-negative UBE2D2
(dnUBE2D2) were generated by PCR and subcloned into a cytomegalovirus-based promoter (CMX)-HA and FLAG or Myc vectors. SMRT point mutations (3X) and deletion and truncation expression plasmids were subcloned into CMX-HA vectors or used as described previously (121). FLAG- or Myc-β-TrCP1/2 and HA-Ub were generated by
PCR from a HeLa cDNA library. Site-directed mutagenesis was used to generate point mutations and deletions. The GST-β-TrCP1 and truncated GST-SMRT fusions were
160
generated by PCR and subcloning. All clones were sequenced to confirm their identities.
Cell Lines, Reagents, and Antibodies
HeLa and HEK-293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 50 units of penicillin G/ml, and 50 μg of streptomycin sulfate at 37 °C in 5% CO2. HUVECs were purchased from Lonza and cultured in endothelial cell basal medium (EBM-2, Lonza) with EGM-2 SingleQuot growth supplements (Lonza). Cells of < 6 passages were used in this study. TNFα was purchased from Promega (G5421). siRNAs were purchased from Thermo Scientific, and the siRNA sequences are listed as Table 5. The antibodies used were α-BCL-6
(catalog no. sc-858), α-p65 (catalog no. sc-2212), α-HA (catalog no. sc-805), and α- mouse-IgG conjugated with HRP (catalog no. sc-2005) from Santa Cruz Biotechnology;
α-FLAG (catalog no. F3165), α-β-TrCP1 (catalog no. 37-3400), normal goat IgG (catalog no. 10200), Alexa Fluor 488 goat anti-rabbit (catalog no. A-11008), and Alexa Fluor 594 goat anti-mouse (catalog no. A-11005) from Invitrogen; α-rabbit-IgG conjugated with
HRP (catalog no. 12-348) from Millipore; α-HA conjugated with HRP (catalog no.
12013819001) from Roche; and α-β-TrCP1 (catalog no. 4394) from Cell Signaling 161
Technology. Anti-SMRT antibodies and anti-ubiquitin antibodies were purified as described previously (121,462). The transfection reagent DharmaFECT1 (catalog no.
T-2001) was purchased from Thermo Scientific.
Transient Transfection
Transient transfection of a total of 10 μg of expression plasmids was performed using
Lipofectamine 2000 according to the protocol of the manufacturer (Invitrogen), and cells were harvested 48 h after transfection. For siRNA knockdown, a non-targeting siRNA or two independent siRNAs against β-TrCP1 or SMRT (Thermo Scientific) were transfected into HeLa cells or HUVECs using DF1 transfection reagent (Thermo
Scientific) according to the protocol of the manufacturer. Cells were harvested 72 h after transfection, and total RNAs and cell extracts were prepared.
Total RNA Extraction, RT-PCR, and Real-time PCR
Seventy-two hours after transfection with siRNAs, HeLa cells and HUVECs were harvested, and total RNA was prepared using PrepEase RNA spin kits (USB/Affymetrix) and quantified by A260/A280 spectrometry. The cDNA pool was generated from each
162
RNA sample with Superscript 3 reverse transcriptase (Invitrogen) according to the instructions of the manufacturer. The cDNAs of interest and internal controls were quantified by real-time PCR using an iCycler (Bio-Rad) platform with 2× iQ SYBR Green
Supermix (Bio-Rad) and appropriate primer sets. The PCR program was set for 40 cycles with three steps of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. Melting curves were acquired after PCR to ensure the homogeneity of the PCR products. The relative quantities of the genes of interest were normalized to an internal control (18
S rRNA) and depicted as mean ± S.E. from three independent experiments. The primer sequences are shown in Table 6.
In Vitro Protein-Protein Interaction Assays
GST and GST-SMRT fusion proteins were expressed in the Escherichia coli DH5α strain, and GST-β-TrCP1 was expressed in E. coli BL21 plyss (Promega), purified, and immobilized on glutathione-Sepharose 4B beads. GST pull-down assays were carried out according to our published protocol (121). Briefly, immobilized GST-SMRT and
GST-β-TrCP1 beads were incubated with whole cell extracts expressing FLAG-β-TrCP1 or HA-SMRT, respectively for 1 h at 4 °C. After extensive washes, pull-down fractions were subjected to SDS-PAGE followed by Western blotting with anti-HA or anti-FLAG 163
antibodies. For phosphorylation-dependent binding assays, HA-SMRT-expressing lysates were treated with calf intestinal phosphatase (CIP) (10 units/ml, New England
Biolabs) prior to incubation with immobilized GST fusion proteins for 45 min at 30 °C.
Coimmunoprecipitation
HEK-293T and HUVEC whole cell lysates were resuspended in NTEN buffer (20 mM
Tris-Cl (pH 8.0), 100 mM NaCl, 0.1% Nonidet P-40, 1 mM EDTA, 10% glycerol, and 1 mM dithiothreitol) containing a mixture of protease inhibitors (Roche) followed by sonication. Coimmunoprecipitation was carried out using purified an anti-SMRT antibody (121), and immunoprecipitates were subsequently pulled down by protein A beads. The immune pellets were subjected to SDS-PAGE, followed by immunoblotting with anti-SMRT and anti-β-TrCP1 antibodies (Sigma). For coimmunoprecipitation assays with overexpressed SMRT and β-TrCP1, HeLa cells were cotransfected with plasmids expressing FLAG-β-TrCP1, HA-SMRT, or their combination with
Lipofectamine 2000. Forty-eight hours after transfection, whole cell lysates were prepared with radioimmune precipitation assay buffer (1- PBS, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) with protease inhibitors and immunoprecipitated with anti-FLAG (M2) or anti-HA affinity beads (Sigma) for 4 h at 4 164
°C. The immunoprecipitates were subjected to SDS-PAGE, followed by immunoblotting with anti-FLAG and HRP-conjugated anti-HA antibodies (Sigma).
Immunofluorescent Microscopy
HeLa cells were cultured in 12-well plates and transfected with the indicated plasmids.
Twenty-four hours after transfection, immunostaining was performed as described previously (267) using anti-SMRT or anti-FLAG antibodies and secondary antibodies conjugated with Alexa Fluor 488 or 594 (Invitrogen). Cells were mounted with DAPI
(Vectashield, Vector Laboratories), and images were visualized on a fluorescent microscope (Leica). Images were captured and obtained with a camera.
In Vivo Ubiquitination Assay
HeLa cells were cultured in 10-cm dishes and transfected with 10 μg of total expression plasmids as indicated. Twenty-four hours after transfection, cells were treated with or without 50 μM MG132 (Sigma) 5 h prior to harvest, followed by cell extract preparation with NTEN buffer. Whole cell lysates were immunoprecipitated with the appropriate antibodies. After extensive washing, the affinity beads were
165
mixed with SDS buffer and subjected to SDS-PAGE separation. To detect ubiquitination, immunopellets were subjected to Western blotting with antibodies against anti-HA (Ub) antibodies.
ChIP
ChIP assays were modified from our published protocol (463). Briefly, HUVECs were transfected with control or β-TrCP1 siRNAs for 72 h and treated with 1% formaldehyde for 10 min at room temperature. The cross-linking reaction was stopped by incubating cells with 125 mM glycine for 5 min. Cells were collected by centrifugation at 4 °C and lysed in 500 μl of nuclei lysis buffer (50 mM Tris-Cl (pH 8.1), 10 mM EDTA, 1% SDS) on ice for 10 min. Chromatin was prepared by sonicating DNA fragments to 300∼700 bp, followed by 14,000-rpm centrifugation for 15 min at 4 °C. The collected supernatant was precleared with sheared salmon DNA and protein A beads at 4 °C for 2 h. After centrifugation, precleared chromatin was aliquoted and incubated with the appropriate antibodies overnight at 4 °C. The immune complex was subsequently pulled down by protein A beads and washed twice with dialysis buffer (50 mM Tris-Cl
(pH 8.0), 2 mM EDTA, 2% Sarkosyl) and four times with subsequent immunoprecipitation wash buffer (100 mM Tris-Cl (pH 9.0), 500 mM LiCl, 1% Nonidet 166
P-40, 1% deoxycholic acid). To elute the DNA-protein complex, a freshly made elution buffer (50 mM NaHCO3, 1% SDS) was mixed with the beads for 20 min at room temperature, and the eluate was collected twice by centrifuge. The eluted chromatin was incubated with 300 mM NaCl at 68 °C to reverse the DNA-protein cross-links.
Meanwhile RNA was digested by 1 mg/ml RNase at 68 °C overnight, and protein was subsequently digested with 100 mg/ml proteinase K at 45 °C for 3 h. The DNA was extracted by phenol-chloroform-isoamyl alcohol mix (25:24:1). 10 μg of glycogen
(Roche) was added to each sample, and the DNA was precipitated with 2.5× volume of pure ethanol in −20 °C overnight. The final DNA was pelleted by centrifugation at
14,000 rpm at 4 °C for 20 min, dissolved in 1× 10 mM Tris-Cl (pH 8.0) and 1 mM EDTA, and subjected to PCR analysis. The results were calculated from three independent real-time PCR experiments and presented as mean ± S.E. of the relative fold enrichment as the percentage of the input signal. The primers for real-time PCR are shown in the Table 7.
Statistical Analysis
167
Data are presented as mean ± S.E. of three independent experiments. Two compared groups were analyzed by two-tailed Student's t test. p < 0.05 (*) and p < 0.01 (**) were considered statistically significant.
Results
The Effects of TNFα on SMRT and β-TrCP1 Protein Accumulation
Through microarray gene expression analyses, we have genes identified previously whose expression is up-regulated by TNFα in HUVECs (301). Because SMRT is an essential corepressor for silencing a broad set of inflammatory response genes in macrophages (80,113), we hypothesize that SMRT may also play a role in the TNFα- mediated induction of inflammatory genes in HUVECs. To test this, we transiently knocked down SMRT in HUVECs by two independent siRNAs and determined the expression levels of several TNFα target genes. We found that depletion of SMRT in
HUVECs significantly enhanced the expression of inflammation-associated genes, including IL-1β, IL-6, and IL-8 (Figure 10A), suggesting that these TNFα-inducible genes are repressed by SMRT in the absence of TNFα. To test whether TNFα treatment had effects on SMRT protein accumulation, HUVECs were treated with TNFα and harvested at different time points. We found that SMRT protein levels were
168
significantly down-regulated during 4 h of TNFα treatment (Figure 10B). However,
SMRT mRNA levels were unchanged (Figure 17). Because TNFα treatment decreases
SMRT protein levels but not mRNA, we hypothesize that TNFα regulates SMRT levels through posttranscriptional regulation. Recent reports and our prior observations implied that SMRT can be regulated through ubiquitin-dependent proteolysis
(119,121,464). It has been shown previously that TNFα induces an E3 ubiquitin ligase subunit, β-TrCP1, at both the mRNA and protein levels in HEK-293 cells (339), although the role of β-TrCP1 in ECs is completely unknown. Therefore, we examined the correlation between β-TrCP1 and SMRT protein levels in response to TNFα treatment in HUVECs. In contrast to the decrease in SMRT protein levels, β-TrCP1 protein abundance was up-regulated in 4 h of TNFα treatment (Figure 10B). This observation prompted us to question whether β-TrCP1 affects SMRT protein stability. To test this, we carried out siRNA knockdown experiments to determine the effect of β-TrCP1 knockdown on SMRT protein stability. siRNA-transfected HUVECs were treated with cyclohexamide, and the half-life of endogenous SMRT protein was measured. We found that knockdown of β-TrCP1 prolonged the half-life of endogenous SMRT protein from ∼1 h to 4 h (Figure 10C).
169
Figure 10. The effects of SMRT knockdown on expression of TNFα-inducible genes 170
Figure 10. The effects of SMRT knockdown on expression of TNFα-inducible genes
(A) a non-targeting siRNA (siCtrl) or two siRNAs (siS-1 and siS-2) against different exons of SMRT were transiently transfected into HUVECs. After 72 h, cells were harvested, and the mRNA levels of the indicated TNFα-inducible genes were determined by quantitative real-time PCR. *, p < 0.05; **, p < 0.01. (B) HUVECs were treated with 20 ng/ml TNFα and harvested at the indicated times. Aliquots of cells were used to prepare whole cell lysates. Western blot analyses were performed to detect endogenous SMRT protein accumulation. The SMRT and β-TrCP1 protein levels at each time point were quantified by ImageJ and normalized with β-actin. The relative protein levels were further normalized to that at 0 h of TNFα treatment. Changes in the SMRT and β-TrCP1 protein levels in three individual experiments were averaged and plotted as shown in the right graph. Total RNA isolation and quantitative real-time
PCR were carried out as described under “Experimental Procedures.” (C) two siRNAs against β-TrCP1 (siβ-T1-1 and siβ-T1-2) or a non-targeting siRNA were transiently transfected into HUVECs. After 64 h, an aliquot of cells was harvested to examine knockdown efficiency (top left panel). Other aliquots of cells were treated with 50 μM protein translation inhibitor cyclohexamide (CHX). At the time points indicated, cells were collected, and SMRT and β-TrCP1 protein levels were examined by Western blot
171
analyses (bottom panel), quantified by ImageJ, and normalized with β-actin levels. The relative SMRT protein levels at each time point were further normalized to 0 h cyclohexamide treatment, and the trends of SMRT half-life were averaged from three individual experiments.
172
β-TrCP1-mediated Down-regulation of SMRT Protein
We further addressed whether β-TrCP1-mediated down-regulation of SMRT can be observed in other cell types and found that knockdown of β-TrCP1 by siRNAs up- regulates SMRT protein levels in HeLa cells (Figure 11A) without affecting SMRT mRNA accumulation (Figure 16). To determine whether β-TrCP1 interacts with SMRT, we carried out GST pull-down assays with several SMRT fragments and found that β-TrCP1 binds to two regions of SMRT, with SMRT (1188–1833) binding more robustly than
SMRT (1833–2507) (Fig. 2B). The N terminus fragment, SMRT (1–1194), does not bind
GST β-TrCP1. Therefore, we focused our study on amino acids 1188–1833. β-TrCP1 has been identified previously as a substrate-conferring subunit of the Skp1-Cul1-F- box (SCF) ubiquitin E3 ligase complex (315,370). Through a conserved F box motif, β-
TrCP1 binds to Skp1 and Skp1-associated Cul1, Rbx1, and the E2 ubiquitin-conjugating enzyme to assemble a functional E2-E3 supercomplex for ubiquitin transfer (315,335).
The mutant β-TrCP1 (ΔF), which is missing a 45-amino acid F-box motif, had a dominant-negative effect on the degradation of its substrates, CD4 and β-catenin
(370,465). To determine the effect of the F box on the ability of β-TrCP1 to regulate
SMRT protein abundance, we tested whether an F box deletion mutant, FLAG-β-TrCP1
(ΔF), was capable of affecting SMRT protein levels (Figure 11C, left panel).
173
Figure 11. The effects of β-TrCP1 on SMRT protein accumulation
174
Figure 11. The effects of β-TrCP1 on SMRT protein accumulation
(A) HeLa cells were transiently transfected with two individual siRNAs against β-TrCP1
(siβ-T1-1 and siβ-T1-2). Whole cell extracts were prepared and subjected to immunoblotting with anti-α-tubulin, anti-β-TrCP1, and anti-SMRT antibodies. siC, control siRNA. (B) HeLa whole cell extracts expressing the indicated SMRT fragments were subjected to GST pull-down with GST-β-TrCP1 followed by immunoblotting with anti-HA antibody. a.a., amino acids. (C) HA-SMRT (1188–1833) and GFP were cotransfected with FLAG-β-TrCP1 or FLAG-β-TrCP1 (ΔF box) in HeLa cells. Whole cell extracts were subjected to Western blotting with anti-HA, anti-FLAG, and anti-GFP antibodies. (D) HeLa cells were cotransfected with HA-SMRT (1188–1833) and GFP with increasing amounts of FLAG-β-TrCP1 or FLAG-β-TrCP2 constructs. GFP, HA-SMRT, and FLAG-β-TrCP1/2 were detected with the indicated antibodies. The intensity of anti-HA and anti-GFP was quantified by ImageJ, and the relative abundance of HA-
SMRT was normalized to GFP. (E) HeLa cells were transfected with FLAG, FLAG-β-
TrCP1, FLAG-β-TrCP1 (ΔF box), or FLAG-β-TrCP2 and immunostained with anti-FLAG
(red) and anti-SMRT (green). Arrows mark transfected cells.
175
Coexpression of wild-type FLAG-β-TrCP1 significantly decreased protein abundance of
HA-SMRT (1188–1833). In contrast, FLAG-β-TrCP1 (ΔF) did not have an effect on HA-
SMRT (1188–1833) abundance (Figure 11C, right panel). In humans, β-TrCP1 and β-
TrCP2 are encoded by two genes that are very similar (Figure 11C, left panel)(324,339,340). They share identical amino acid sequences in their C termini but diverge in their N-terminal 100 amino acids. We found that overexpression of β-TrCP1 but not β-TrCP2 down-regulated SMRT protein accumulation in a dose-dependent manner (Figure 11D). We further demonstrated that FLAG-β-TrCP1-transfected HeLa cells exhibited significantly lower levels of endogenous SMRT, whereas FLAG-β-
TrCP1ΔF- or FLAG-β-TrCP2-transfected cells showed similar levels of endogenous
SMRT to those in untransfected cells (Figure 11E). Taken together, these data indicate that β-TrCP1 negatively regulates SMRT protein accumulation.
Previously, we identified a phosphorylation-dependent mechanism underlying Pin1- and Cdk2-mediated down-regulation of SMRT protein levels (121). To determine whether Cdk2 or Pin1 plays a role in β-TrCP1-mediated proteolysis, HeLa cells were cotransfected with FLAG-β-TrCP1 and a CDK2-and Pin1-resistant mutant, SMRT (3X),
176
in which the Cdk2 phosphorylation sites/Pin1 binding sites were mutated.
Interestingly, FLAG-β-TrCP1 was still capable of significantly decreasing SMRT (3X) protein levels (Figure 18). These data indicate that the E3 ubiquitin ligase β-TrCP1 down-regulates SMRT protein accumulation independently of the CDK2-Pin1 pathway.
The Interaction between β-TrCP1 and SMRT
To further dissect the mechanism by which β-TrCP1 down-regulates SMRT, we asked whether β-TrCP1 and SMRT interact in mammalian cells. Figure 12A demonstrates that anti-SMRT antibodies coprecipitated endogenous β-TrCP1 in extracts prepared from HEK-293T cells. Furthermore, immunoprecipitation indicated that HA-SMRT
(1188–1833) and FLAG-β-TrCP1 coprecipitated in HeLa cell extracts (Figure 12B). β-
TrCP1 is known to target phosphorylated substrates (315,355). To test whether β-
TrCP1 binds to SMRT (1188–1833) in a phosphorylation-dependent manner, we first examined whether β-TrCP1 bound-HA-SMRT (1188–1833) is phosphorylated. Whole cell extracts were prepared from HA-SMRT (1188–1833)-transfected cells followed by incubation with immobilized purified GST-β-TrCP1 and subsequent treatment with
CIP. We found that, after CIP treatment, GST-β-TrCP1-bound HA-SMRT exhibited a 177
Figure 12. SMRT and β-TrCP1 associate in mammalian cells
178
Figure 12. SMRT and β-TrCP1 associate in mammalian cells
(A) coimmunoprecipitation (IP) was carried out using HEK-293T cell extracts with anti-
SMRT antibodies, followed by immunoblotting with anti-SMRT and anti-β-TCP1 antibodies. (B) HA-SMRT (1188–1833) and FLAG-β-TrCP1 were transiently transfected into HeLa cells. Cell lysates were prepared and immunoprecipitated with anti-HA or anti-FLAG antibodies. Immunopellets were separated by SDS-PAGE and detected by the indicated antibodies. (C) Left panel, HA-SMRT-overexpressed cell lysates were incubated with GST or GST-β-TrCP1. Arrows mark full-length GST-β-TrCP1. Following pull-down and several washes, the bound HA-SMRT was treated with CIP, resolved by
SDS-PAGE, and analyzed by Western blotting with anti-HA antibody. Right panel, HA-
SMRT (1188–1833)-overexpressed cell extracts were treated with CIP prior to pull- down with GST or GST-β-TrCP1. The bound proteins were detected by Western blotting with anti-HA antibody. (D) Whole cell extracts prepared from HeLa cells expressing FLAG-β-TrCP1 were incubated with immobilized, purified GST or GST-SMRT fusion proteins. Pull-down fractions were subjected to Western blotting with anti-
FLAG antibody. (E) Whole cell extracts prepared from HeLa cells expressing HA-SMRT
(1188–1662) or HA-SMRT (1662–1833) were incubated with immobilized, purified GST or GST-β-TrCP1. Arrows mark full-length GST-β-TrCP1. Following pull-down and
179
several washes, the bound HA-SMRT was separated by SDS-PAGE and Western blotting with anti-HA antibody.
180
slightly increased mobility compared with the untreated sample (Figure 12C), implying that GST-β-TrCP1-bound HA-SMRT was phosphorylated. We further determined whether phosphorylation of SMRT is required for GST-β-TrCP1 binding. Using CIP- treated cell extracts for pull-down assays, we found that CIP-treated HA-SMRT (1188–
1833) was still capable of binding GST-β-TrCP1 (Figure 12C). These data indicate that the interaction between SMRT and β-TrCP1 is independent of SMRT phosphorylation.
Using a reverse GST pull-down assay with GST-SMRT, we were able to confirm that bacterially purified GST-SMRT (1188–1470) interacts with β-TrCP1 in vitro (Figure
12D). However, similar experiments with another fragment, SMRT (1662–1833), indicated that, in this region, some posttranslational modification was necessary for
β-TrCP1 binding. Only mammalian cell expressed HA-SMRT (1662–1833) and not bacterially expressed GST-SMRT (1571–1833) or GST-SMRT (1672–1833) bound to β-
TrCP1 in vitro (Figure 12, D and E). Because SMRT phosphorylation is not essential for general β-TrCP1 binding, we did not pursue this further.
β-TrCP1 Promotes SMRT Ubiquitination and TNFα-induced SMRT Proteolysis
The function of β-TrCP1/2 is to bridge their substrates to the SCF ubiquitin complex for ubiquitination-mediated proteolysis (315,335). Through associations with E1 181
ubiquitin-activating and E2 ubiquitin-conjugating enzymes, the SCF complex promotes ubiquitin transfer from E2 to β-TrCP1/2 substrates (315). To determine whether β-
TrCP1 promotes SMRT ubiquitination, we performed in vivo ubiquitination assays.
HeLa cells were transiently transfected with FLAG-SMRT (1188–1833) and HA- ubiquitin with or without Myc-β-TrCP1 or the dominant-negative mutant, Myc-β-
TrCP1 (ΔF box). After blocking proteasome activity with MG132 for 5 h, whole cell extracts were prepared, followed by immunoprecipitation with anti-FLAG antibody and Western blotting with anti-HA antibody. We found that FLAG-SMRT exhibits a higher level of ubiquitination in cells ectopically expressing exogenous Myc-β-TrCP1 than cells without Myc-β-TrCP1 (Figure 13A, lanes 8 and 9). Conversely, overexpression of the dominant-negative mutant Myc-β-TrCP1 (ΔF box) significantly decreased FLAG-SMRT ubiquitination (lane 10). The ubiquitin-conjugating enzyme
E2D2, one of the β-TrCP1-associated E2 components (355), was further tested for its role in SMRT ubiquitination. We found that β-TrCP1-mediated FLAG-SMRT ubiquitination was significantly reduced when the cells were cotransfected with a dominant-negative form of E2D2 (lanes 8 versus lane 11 and lane 9 versus lane 12). In
Figures 10 and 11, we observed that both TNFα and β-TrCP1 were capable of down- regulating SMRT protein levels and that TNFα induces β-TrCP1 protein accumulation.
182
Figure 13. β-TrCP1 promotes TNFα-induced SMRT polyubiquitination and proteolysis
183
Figure 13. β-TrCP1 promotes TNFα-induced SMRT polyubiquitination and proteolysis
(A) HeLa cells were cotransfected with FLAG-SMRT (1188–1833), HA-ubiquitin, Myc-
β-TrCP1, dominant-negative Myc-β-TrCP1 (ΔF box), or dominant-negative (dn) E2D2 as indicated. After transfection, cells were treated with 50 μM proteasome inhibitor
MG132 for 5 h prior to harvest. The cell lysates were immunoprecipitated with anti-
FLAG antibody, and the immunopellets were subjected to Western blotting using anti-
FLAG and anti-HA antibodies. WCE, whole cell extract. (B) HUVECs were treated with or without TNFα (20 ng/ml) for 2 h. Whole cell lysates were prepared for coimmunoprecipitation (IP) with anti-SMRT antibodies as described under
“Experimental Procedures.” SMRT and β-TrCP1 in the immunopellets were further detected by Western blotting using the indicated antibodies. (C) HUVECs were transiently transfected with a non-targeting siRNA (siCtrl) or two distinct β-TrCP1 siRNAs (siβ-T1-1 and siβ-T1-2) as described in Fig. 10C. After 24 h, cells were trypsinized, plated, and grown for 40 h, followed by TNFα (20 ng/ml) treatment for an additional 4 h. During TNFα treatment, cells were further treated with cycloheximide
(CHX, 50 μM) at the indicated times. Endogenous SMRT and β-TrCP1 protein levels were detected by Western blot analyses. The SMRT protein levels at each time point were quantified by ImageJ and normalized with β-actin. (D) HUVECs were pretreated
184
with or without MG132 for 1 h, followed by TNFα treatment for 4 h. Whole cell lysates were prepared, and endogenous SMRT protein levels were detected by Western blot analyses. (E) HUVECs were pretreated with or without TNFα, followed by MG132 (50
μM) treatment for an additional 4 h. Endogenous SMRT was immunoprecipitated with anti-SMRT antibodies. The immunopellets were subjected to Western blotting with anti-SMRT and anti-Ub antibodies as indicated. (F) HUVECs were transiently transfected with a non-targeting siRNA or β-TrCP1 siRNA as described in Fig. 10C. After
72 h, cells were treated with or without TNFα (20 ng/ml), followed by MG132 (50 μM) treatment for an additional 4 h. Endogenous SMRT was immunoprecipitated, followed by Western blotting with anti-SMRT and anti-Ub antibodies. (G) HUVECs were transiently transfected with a non-targeting siRNA or two individual β-TrCP1 siRNAs as shown in Fig. 10C. After 72 h, cells were treated with TNFα (20 ng/ml) and, at the indicated times, harvested. Cell lysates were prepared for Western blotting with the indicated antibodies. (H) HUVECs were transiently transfected with a non-targeting or a β-TrCP1 siRNA for 48 h. Equal numbers of cells were plated and treated with TNFα for 1 h, followed by immunofluorescence microscopy probed with DAPI, anti-β-TrCP1, and anti-p65 antibodies. d, h, l, and p are merged images.
185
We next asked whether β-TrCP1 plays a role in TNFα-induced SMRT degradation. To test this, we performed immunoprecipitation of endogenous proteins and found that
TNFα promotes the interaction between β-TrCP1 and SMRT in HUVECs after 2 h of treatment (Figure 13B). To further determine the role of β-TrCP1 in TNFα-induced
SMRT degradation, we knocked down β-TrCP1, determined the SMRT protein half-life in the presence of TNFα, and found that knockdown of β-TrCP1 significantly prolonged
TNFα-induced SMRT protein half-life (Figure 13C). Furthermore, TNFα-induced SMRT degradation was rescued by the addition of MG132, a proteasome inhibitor (Figure
13D). Moreover, TNFα treatment increased SMRT ubiquitination (Figure 13E), and this
TNFα-mediated SMRT ubiquitination was blocked in β-TrCP1 knockdown cells (Figure
13F). Together, our results support a model in which β-TrCP1 mediates TNFα-induced ubiquitination- and proteasome-dependent degradation of SMRT.
It has been proposed previously that β-TrCP1 and β-TrCP2 share a redundant function in promoting the TNFα-induced degradation of IκBα and subsequent nuclear translocation of p65 (52,53,344,466). Consistent with these reports, knockdown of β-
TrCP1 alone in HUVECs did not have effects on TNFα-induced IκBα degradation (Figure
13G) nor p65 nuclear localization (H).
186
The Function of the β-TrCP1-SMRT Axis in the Regulation of TNFα Target Genes
Our observations that TNFα treatment in HUVECs increases β-TrCP1 and reduces
SMRT protein levels suggest that the regulation of TNFα-inducible genes, in part, is through the β-TrCP1-SMRT axis. To further test this hypothesis, we knocked down β-
TrCP1 in HUVECs. We observed higher SMRT protein levels and lower expression of
TNFα-inducible genes, such as IL-1β, IL-6, and IL-8. These genes are induced in SMRT knockdown ECs and repressed in β-TrCP1 knockdown cells (Figures 10A and 14A). On the basis of these data, we predict that β-TrCP1 knockdown increases the steady-state levels of SMRT, increases the occupancy of SMRT on the promoters of TNFα target genes, and, consequently, decreases the expression of TNFα target genes. Indeed, using ChIP assays, we demonstrate that knockdown of β-TrCP1 leads to increased binding of SMRT to the IL-1β, IL-6, and IL-8 promoters but that the binding of SMRT- associated transcription factors, NF-κB (p50) and BCL-6 (79,80), was not altered on the
IL-1β and IL-8 promoters (Figure 14B). On the IL-6 promoter, we found that NF-κB
(p50) occupancy increased but that BCL-6 did not bind to this region. Furthermore, the inflammatory gene repression because of β-TrCP1 knockdown was rescued by knocking down SMRT (Figure 14C), indicating that these TNFα target genes are regulated by the β-TrCP1-SMRT axis. In conclusion, our results provide evidence
187
Figure 14. The effects of the β-TrCP1-SMRT axis on the expression of TNFα-inducible genes
188
Figure 14. The effects of the β-TrCP1-SMRT axis on the expression of TNFα-inducible genes
(A) HUVECs were transiently transfected with a non-targeting siRNA (siCtrl) or two independent siRNAs against β-TrCP1 (siβ-T1-1 and siβ-T1-2) for 72 h. Total RNAs were isolated and subjected to quantitative real-time PCR to measure the mRNA levels of the indicated genes as in Fig. 10A. Endogenous SMRT and β-TrCP1 protein levels were detected by Western blot analyses. *, p < 0.05; **, p < 0.01. (B) HUVECs were transiently transfected with a non-targeting siRNA or a β-TrCP1 siRNA for 72 h. Cells were harvested, and aliquots of cells were used to prepare cell extracts for immunoblotting or ChIP assays. ns, not significant. N.D., not detected. (C) HUVECs were transiently transfected with a non-targeting siRNA, siRNAs against β-TrCP1, or both β-TrCP1 and SMRT siRNAs for 72 h. Total RNAs were isolated and subjected to quantitative real-time PCR to quantify the mRNA levels of the indicated genes as in
Fig. 10A. Endogenous SMRT and β-TrCP1 protein levels were detected by Western blot analyses.
189
supporting the hypothesis that TNFα induces expression of a subset of inflammatory response genes, in part, by elevating β-TrCP1 and, subsequently, down-regulating
SMRT protein accumulation (Figure 15).
Conclusion and Discussion
In this study, we show that TNFα up-regulates β-TrCP1 protein levels and down- regulates SMRT protein abundance. The latter is caused by β-TrCP1-mediated posttranslational modification. The loss of SMRT by siRNA knockdown significantly increases expression of TNFα target genes. Conversely, knockdown of β-TrCP1 results in an extended SMRT half-life, increased SMRT protein levels, increased occupancy of
SMRT on its target gene promoters, and decreased TNFα target gene expression. We have also mapped the β-TrCP1 interacting domain in SMRT and demonstrated that this interaction does not require phosphorylation of SMRT. Taken together, our study provides evidence supporting a model in which β-TrCP1-dependent SMRT ubiquitination and proteolysis contributes to TNFα-mediated induction of inflammation-associated genes (Figure 15).
190
TNFα-mediated SMRT Regulation and Acute Inflammation
TNFα is an immediate-response cytokine secreted by macrophages and the endothelium during acute inflammation (458,459). A body of studies have elucidated the role of TNFα in inflammatory responses (4), but how it precisely controls inflammatory gene expression is still not completely understood. Activation of NF-κB by TNFα is a major pathway that controls inflammatory gene expression, although it has been shown to be biphasic and depend on the status of its associated coregulators
(59,61,62,69,461,467). On the basis of our findings, the reduction of SMRT protein levels by TNFα downstream β-TrCP1 E3 ligase may partly account for the activation of
NF-κB activity on the expression of its target genes in HUVECs. Upon TNFα stimulation, an increase in β-TrCP1 protein level was observed, and this increase was accompanied by an enhanced interaction between β-TrCP1 and SMRT (Figures 10B and 13B). These observations suggest that an increase in β-TrCP1 plays a role in TNFα-induced SMRT degradation. Alternatively, but not exclusively, TNFα may enhance β-TrCP1 and SMRT interaction through a mechanism yet to be elucidated, and this enhanced interaction facilitates β-TrCP1-mediated SMRT degradation.
SMRT and Inflammation Regulation
191
In addition to the acute inflammatory response, precise and timely repression of inflammatory genes is equally important to maintain homeostasis in the hematopoietic and immune systems. As a transcriptional corepressor, SMRT integrates diverse signals and cooperates with several transcription factors or repressors, including peroxisome proliferator-activated receptor β/δ, liver X receptor, and BCL-6, to establish a transcriptional repression network (79,80,460,467-469).
Using a ChIP-sequencing approach, Ghisletti et al. (113) identified a large set of inflammatory genes, including IL-1β, IL-6, and IL-8 as NCoR-SMRT-dependent target genes that are induced by LPS, INF-γ, or phorbol ester. Similarly, IL-1β and IL-6 are also transcriptional targets mutually controlled by repressive BCL-6- and active NF-κB- associated transcriptional complexes in macrophages (79). In this reciprocal trans- regulation system in macrophages, recruitment of NCoR and SMRT to targeted promoters is critical to establish BCL-6-mediated gene repression (80). Notably, the repertoire of NCoR-SMRT-repressed inflammatory genes shows tissue specificity, at least in human macrophages and adipocytes. The expression of IL-1β, IL-6, and IL-8 is controlled only by the SMRT-associated transcription network in human adipocytes rather than by NCoR-SMRT complexes in human macrophages (90,113). In this study,
192
we found that these genes are repressed by SMRT in HUVECs, but whether they are also coregulated by NCoR will require further investigation.
In this study, we also found that knockdown of SMRT in the absence of TNFα is sufficient to up-regulate the expression of inflammatory response genes (Figure 10A), indicating a pivotal role of SMRT in silencing inflammation in human ECs. Interestingly, in some chronic morbid conditions, such as obesity and diabetes, lower SMRT levels and concomitant low-grade inflammation have been observed in obese adipose tissue
(90). Furthermore, deregulation of inflammatory repression and release of inflammatory components such as IL-6, IL-8, or TNFα into the circulation have been proposed to exacerbate chronic diseases and cause further complications (470-472).
Following this line, deregulation of SMRT protein levels and low-grade inflammation may also occur in the endothelium under chronic morbid conditions. In the future, it will be worth exploring whether deregulation of SMRT in the endothelium contributes to chronic cardiovascular diseases.
The Role of β-TrCP1 in SMRT Regulation
193
As a corepressor, SMRT is brought to gene promoters by association with transcription factors to silence target genes. Clearance of SMRT occupancy on target gene promoters is thought to attenuate SMRT-mediated repression and activate gene expression (97,467). Several mechanisms have been proposed to facilitate SMRT clearance from binding to chromatin. For example, TBL1- and TBLR1-mediated degradation clears SMRT at a subset of NF-κB, AP-1, and nuclear receptor-targeted promoters (114). In addition, early reports indicate that SMRT dissociates from transcription factors such as NF-κB- or thyroid hormone receptor-targeted promoters through signal-induced phosphorylation of SMRT by IKKα, calcium/calmodulin- dependent protein kinase IV, or MEK-1 (118,170,174). Our study provides a previously unappreciated mechanism in which β-TrCP1-dependent and ubiquitin-mediated proteolysis contributes to the clearance of SMRT from target gene promoters in response to TNFα stimulation. It has been suggested previously that the β-TrCP family proteins promote ubiquitination and subsequent proteasome-mediated degradation of the inhibitors of NF-κB, IκBα, and IκBβ (52,53,369). Our observation that knockdown of β-TrCP1 decreases TNFα target gene expression could theoretically result from its blockade of IκB degradation and subsequent NF-κB p65 nuclear translocation.
However, we found that knockdown of β-TrCP1 did not alter IκBα oscillation patterns
194
nor TNFα-mediated nuclear translocation of p65 in HUVECs (Figure 13, G and H). This observation recapitulates a similar scenario in β-TrCP1−/− mouse embryonic fibroblast cells and β-TrCP knockdown HeLa cells in which only simultaneous knockdown of β-
TrCP1 and β-TrCP2 enhanced IκB accumulation, blocking NF-κB activation (344).
Mammals express two β-TrCP paralogs, β-TrCP1 and β-TrCP2. Both share similar amino acid sequences and some redundant functions (324,339,340,344). In our study, ectopic expression of β-TrCP1 but not β-TrCP2 significantly reduced SMRT protein levels (Figure 11, D and E). Furthermore, knockdown of β-TrCP1 alone is sufficient to cause accumulation of SMRT protein (Figures 11A and 14). Both β-TrCP1 and β-TrCP2 harbor a conserved functional module, the F-box domain, that bridges substrates to the functional E3 ubiquitin SCF complex (315,335). Consistent with this notion, deletion of the F box in β-TCP1 abrogates its ability to down-regulate SMRT protein accumulation. A body of literature indicates that the ability of β-TrCP1 to promote degradation largely relies on its phosphorylation-dependent association with its substrates (315). To our surprise, our data indicate that SMRT is capable of binding β-
TrCP1 independently of this posttranslational modification (Figure 12). This
195
observation provides a rare exception for the interaction between β-TrCP1 and its substrates.
In conclusion, the evidence shown in this study supports a model in which the TNFα downstream ubiquitin E3 ligase β-TrCP1 ubiquitinates the corepressor SMRT, contributing to the derepression of SMRT-targeted proinflammatory genes (Figure
15). On the basis of these findings, we hypothesize that β-TrCP1 could be a potential target for the development of therapeutic agents for the treatment of inflammation- associated diseases.
196
Figure 15. A model depicting TNFα-induced gene expression through the β-TrCP1-SMRT axis
197
Figure 15. A model depicting TNFα-induced gene expression through the β-TrCP1-
SMRT axis
In HUVECs, TNFα increases the protein levels of β-TrCP1, promotes ubiquitination- mediated proteasome degradation of SMRT via β-TrCP1-associated SCF E3 ubiquitin ligase, and, hence, elevates the expression of a subset of SMRT and TNFα target genes.
198
Table 5. siRNA sequence for -TrCP1 and SMRT
SiRNA target Sequence Catalog Number
-TrCP1-1 5’-GACCUUAAAUGGACACAAA-3’ J-003463-07
-TrCP1-2 5’-ACACCGAGCUGCUGUCAAU-3’ J-003463-08
SMRT-1 5’-GAACCUCGAUGAGAUCUUG-3’ J-006145-06
SMRT-2 5’-AAGGGUAUCAUCACCGCUGUG-3’ J-006145-08
Non- 5’-GCUGUUAAUUCUUCAGUCA-3’ D-001810-50 targeting
199
Table 6. PCR primer sequences for chapter 2
Primers Sequence
IL1forward 5’-AGCTACGAATCTCCGACCAC-3’
IL1reverse 5’-CGTTATCCCATGTGTCGAAGAA-3’
IL-6 forward 5’-AGCAGCAAAGAGGCACTGGCA-3’
IL-6 reverse 5’-GCTTCGTCAGCAGGCTGGCAT-3’
IL-8 forward 5’-TTTTGCCAAGGAGTGCTAAAGA-3’
IL-8 reverse 5’-AACCCTCTGCACCCAGTTTTC-3’
SMRT forward 5’-GGTACCCATTTGGAATCACGGGCTGC-3’
SMRT reverse 5’-AAGCTTCCACACACACACAGACACGCAC-3’
18S rRNA forward 5’-CGTCTGCCCTATCAACTTTCG-3’
18S rRNA reverse 5’-CCTTGGATGTGGTAGCCGTT-3’
200
Table 7. ChIP primer sequences for chapter 2
Primers Sequence
IL1forward1 5’-CTGTGTGTCTTCCACTTTGTCCC -3’
IL1reverse1 5’- TGCATTGTTTTCCTGACAATCG-3’
IL6 forward1 5’- CGTCCACATTGCACAATCTTA-3’
IL6 reverse1 5’- CATCTCCAGTCCTATATTTA-3’
IL-8 forward1 5’- GGGCCATCAGTTGCAAATC-3’
IL-8 reverse1 5’-TTCCTTCCGGTGGTTTCTTC -3’
201
Figure 16. Knockdown of β-TrCP1 by four siRNAs
202
Figure 16. Knockdown of -TrCP1 by four siRNAs
Four independent siRNAs targeting different regions in -TrCP1 were transiently transfected into HeLa cells. Whole cell extracts of the control and -TrCP1 siRNA transfected cells were analyzed by Western blotting with anti-SMRT antibody (left panel). Immunoblotting with anti--tubulin antibody was used as an internal loading control. The knockdown efficiency and SMRT mRNA levels detected by qRT-PCR were shown (right panel).
203
Figure 17. TNFα treatment in HUVECs does not change SMRT mRNA
204
Figure 17. TNF treatment in HUVECs does not change SMRT mRNA
HUVECs were treated with TNF (20ng/ml and collected at the indicated time points.
Total mRNA was prepared and SMRT mRNA levels were quantified qRT-PCR.
205
Figure 18. β-TrCP1 mediated SMRT down-regulation is independent of Cdk2/Pin1 pathway
206
Figure 18. -TrCP1 mediated SMRT down-regulation is independent of Cdk2/Pin1 pathway
Wild-type HA-SMRT (1188-1833) or mutant, HA-SMRT (1188-1833, 3X) (121) was co- transfcted with GFP and FLAG--TrCP1 expression plasmids. The expression of HA-
SMRT (1188-1833) was examined by Western blotting with anti-HA antibody.
207
Figure 19. In vitro association of SMRT fusion proteins and β-TrCP1 are post-translational modification dependent and independent
208
Figure 19. In vitro association of SMRT fusion proteins and -TrCP1 are post- translational modification dependent and independent
(A) Whole cell extracts prepared from HeLa cells expressing HA-SMRT (1188-1662 and
1662-1833) were pulled down with bacterially expressed GST or GST-β-TrCP1. The arrows mark full-length GST-β-TrCP1. Following pulldown and several washes, the bound HA-SMRT was separated by SDS-PAGE and Western blotting with anti-HA antibody. (B) Whole cell extracts prepared from HeLa cells expressing Flag--TrCP1 were incubated with bacterially expressed GST or GST-SMRT (1188-1470, 1571-1833 and 1672-1833) immobilized beads. Pulldown fractions were subjected to Western blotting with anti-Flag antibody.
209
Chapter 3: Translational control of PML contributes to TNF- induced apoptosis of MCF7 breast cancer cells and decreased angiogenesis in HUVECs
Abstract
The tumor suppressor protein PML is a key regulator of inflammatory responses and tumorigenesis and functions through the assembly of subnuclear structures known as
PML nuclear bodies (NBs). The inflammation-related cytokine TNF, is known to induce PML protein accumulation and PML NB formation, which mediate TNF- induced cell death in cancer cells and inhibition of migration and capillary tube formation in endothelial cells (ECs). In this study, we uncover a novel mechanism of
PML gene regulation in which the p38 MAPK and its downstream kinase MAP kinase- activated protein kinase 1 (MNK1) mediate TNF-induced PML protein accumulation and PML NB formation. The mechanism includes the presence of an internal ribosome entry site (IRES) found within the well-conserved 100 nucleotides upstream of the PML initiation codon. The activity of the PML IRES is induced by TNF in a manner that involves MNK1 activation. It is proposed that the p38-MNK1-PML network regulates
TNF-induced apoptosis in breast cancer cells and TNF-mediated inhibition of migration and capillary tube formation in ECs.
210
Keywords:
TNF; IRES; Translation; PML; p38; MNK1; angiogenesis; apoptosis
Introduction
The pro-inflammatory cytokine, tumor necrosis factor alpha (TNF), was first characterized by its cytotoxic ability to induce cancer cell apoptosis (1). TNF is known to have a role in the maintenance of tissue homeostasis. Dysregulation of TNF contributes to the pathogenesis of several diseases, such as cancer, cardiovascular, neurological and metabolic disorders (4,93). TNF is primarily produced by activated macrophages in response to microbial infection and inflammation. TNF signaling is critical for repair of injured lesions. However, sustained TNF stimulation may also lead to endothelial cell dysfunction, such as senescence and the inhibition of angiogenesis (75,198,473,474). Moreover, long-term TNF treatment in breast cancer cells inhibits global protein synthesis and selectively activates apoptotic signals to promote cell death (29,36,214,295-297). However, a detailed mechanism that links
TNF-regulated protein synthesis and apoptosis is still elusive.
The conjugation of TNF to its cognate receptors, TNFR1/TNFR2, activates TNFR downstream signaling cascades which include activating NFB, caspases, c-Jun N-
211
terminal kinase (JNK), p38 MAPK and extracellular signal-regulated kinase (ERK), depending on cell-type specific responses (4). Generally, caspases, JNK and p38 are apoptotic mediators involved in cytokine and stress-mediated apoptosis, whereas the function of ERK kinase and NFB is mainly responsible for cell survival in response to mitogenic stimuli (475-477). The mechanisms by which p38 promotes apoptosis are complex and involve its ability to regulate transcription, protein synthesis and turnover through its downstream kinases (478).
The promyelocytic leukemia (PML) protein is a tumor suppressor that functions as a transcription regulator in response to environmental stimuli (299). A significant fraction of PML is enriched in subnuclear structures known as the PML nuclear bodies
(PML NBs). These are nuclear depots for a variety of proteins which move in and out in response to stimuli (213). PML NBs control the storage of nuclear proteins that await recruitment in response to a wide variety of important cellular signals and can serve as sites for post-translational modification of proteins including acetylation and sumoylation (479-481). Thus, PML and PML NBs regulate fundamental cellular processes such as transcription, DNA replication and cell cycle progression (299).
Disruption of PML NBs has serious consequences that ultimately alter cell fate (295).
212
In contrast, overexpression of PML results in cell growth arrest, senescence and apoptosis (293,296,481). Histochemical studies indicated that PML is maintained at low levels in most examined tissues and cancer cells, but is expressed at a higher level in inflammation-associated tissues including macrophages and vascular endothelium, suggesting an important role for PML in tumorigenesis, inflammatory responses and endothelial function (198,301,482). We and others have shown that PML protein is subjected to extensive stability regulation (74,267,268,310). It was previously reported that TNF induced PML protein accumulation and PML NB formation in human umbilical endothelial cells (HUVECs) (198). Our previous report demonstrated the TNF induced PML protein accumulation partly through transcriptional control, suggesting that post-transcriptional regulation also plays a role in this process.
Internal ribosome entry site (IRES)-mediated translation via 5’-UTRs is a mechanism to selectively increase expression of apoptosis-associated proteins when cells are under stress such as oxidative stress and genotoxic stress (47,483), conditions known to down-regulate global translation. For example, c-myc, DAP5, APAF-1, XIAP and p53, have been reported to switch from cap-dependent translation to IRES-mediated translation in response to apoptotic stimulation. (41,483-486) TNF downstream
213
MAPK kinases, such as p38, ERK and MNK1 selectively increase IRES-mediated translation of a subset of mRNAs (42,487). As PML is known to promote cell death in response to apoptotic stimulation, it is likely that TNFinduces PML protein accumulation through a translation-dependent mechanism.
In this study, we dissect the mechanisms underlying transcription-independent regulation of PML in response to TNF stimulation. We demonstrate that MNK1, a p38 downstream kinase, plays a pivotal role in TNF-mediated accumulation of PML by activating an IRES in the 5’UTR of PML mRNA to increase PML protein accumulation.
Through this mechanism, the TNF-MNK1-PML axis regulates the expression of histone deeacetylase 7 (HDAC7) target genes including MCP-1 and MMP10 and controls migration and capillary tube formation in endothelial cells. Furthermore, activation of the PML IRES by MNK1 promotes TNF-induced cell death and contributes to MCF7 apoptosis.
Results
TNF enhances PML protein accumulation via both transcription-dependent and – independent mechanisms
214
We have previously shown that TNF induced a 2-fold increase in PML mRNA, while
PML protein expression is elevated to an even greater extent. Indeed, in HUVECs, PML protein continued to accumulate throughout the time course of exposure (Figure
20A), but the PML mRNA levels plateaued at 4 hr of TNFtreatment (Figure 20B).
Similar observations were noted in HeLa cells (Figures 20C and 20D). These data suggest that TNFinduces PML protein accumulation in both transcription- dependent and -independent manners. To test whether protein stability control is involved in TNF-mediated PML protein accumulation, we examined the PML protein half-life with or without TNFstimulation. Using cycloheximide treatment, which blocks translation, we observed little difference in the PML protein half-life with or without TNFtreatment (Figure 20E). Taken together, these data suggested that
TNF-induced PML protein accumulation is at least partially due to translational control.
215
A B
[Ty [Ty pe pe a a qu qu ote ote fro HUVEC fro Cm D m the the [Ty do do pe cu cu a me me qu nt nt ote or or HeLa fro the the E m su su the m m do ma ma cu ry ry me of of nt an an or int int the ere ere su Figuresti 20. TNF induces PML protein accumulation withoutsti changing protein stability m ng ng ma poi poi ry nt. nt. of Yo Yo an u u int ca ca ere n n 216 sti po po ng siti siti poi on on nt. the the Yo tex tex Figure 20. TNF induces PML protein accumulation without changing protein stability
Accumulation of PML protein (A) and mRNA (B) during TNF stimulation in HUVECs.
HUVECs were treated with TNF(20 ng/ml) and harvested at the indicated times. The whole cell lysates and total RNA were prepared for Western blotting with the indicated antibodies and RT-qPCR. -actin and 18S rRNA were used as a loading and an internal control. (C)-(D) The effect of TNF on PML protein expression in HeLa cells.
The experiments were similar to those in (A) and (B) except HeLa cells were used. (D)
Quantitative measurement of the TNF effect on PML protein and mRNA accumulation (n=3). (E) The effects of TNF on PML protein half-life were measured as described in materials and methods. The relative change of protein half-life in three representative experiments was plotted as shown in the right panel. All the results shown in graphs are mean ± S.D..
217
TNF-induced PML accumulation is p38 kinase-dependent
Several TNFdownstream MAPK kinases, including JNK, ERK and p38, have been reported to mediate protein or mRNA regulation in mammalian cells (488,489). To determine which kinase is involved in TNF-mediated induction of PML protein, we first carried out kinase inhibitor screenings with or without TNFtreatment. We found that the blockade of p38 (SB202190) and ERK2 (U0126) kinases in HUVECs effectively reduced TNF-induced PML accumulation 7- and 2.3-fold, respectively
(Figure 21A). We focused on p38 kinase in the following studies. The efficacy of the kinase inhibitors was confirmed by the disappearance of kinase activation markers in
Western blots (Figure 21B and Figure 28). Using an siRNA approach, we further validated that the induction of PML by TNFis p38-dependent (Figure 21C).
Immunofluorescent microscopy studies also demonstrated that the PML NB formation tightly correlates with the abundance of PML in response to TNF treatment and p38 knockdown (Figure 29). Based on these data, we conclude that p38 is indispensable for TNF-mediated induction of PML protein accumulation.
MNK1 is a p38 downstream kinase responsible for TNF-mediated PML up- regulation
218
A
[Ty pe a qu ote fro m the B do C cu me nt or the su
m Figure 21. ma TNF increases PML protein accumulation in a p38 kinase-dependent manner ry of an int
ere sti ng poi nt. Yo u
ca n po siti 219 on the tex t bo Figure 21. TNF increases PML protein accumulation in a p38 kinase-dependent manner
(A) The effects of MAPK inhibitors on TNF-mediated PML protein accumulation.
HUVECs were pre-treated with kinase inhibitors, SP600125 (10 M), SB202195 (10
M) or U0126 (10 M) prior to 16 hr of TNF (20 ng/ml) treatment. Cells were harvested and whole cell lysates prepared for Western blotting with the indicated antibodies. The relative ratio of PML to -actin is shown in the bottom. (B) Inhibition of p38 kinase activity by SB202190. HUVECs were treated with DMSO or SB202190 (10
M) prior to TNF treatment and harvested at indicated times for Western blotting with the indicated antibodies. -tubulin was included as a loading control. (C) The effect of p38 knockdown on TNF-mediated PML protein accumulation. HUVECs were transiently transfected with a control or 2 independent p38 siRNAs, treated with or without TNFharvested and Western blotted with the indicated antibodies.
220
In Figure 21C and Figure 29, we observed that PML protein in HUVECs accumulated in
PML NBs and decreased in p38 knockdown cells. Furthermore, subcellular fractionation also indicated that most PML protein was detected in the nuclear fraction and was up-regulated by TNF and inhibition of p38 compromised TNF- mediated accumulation of PML protein (Figure 22A). Four kinases, including casein kinase 2 (CK2), MNK1, mitogen and stress activated protein kinase (MSK1) and
MAPKAP kinase 2 (MK2), are p38 downstream kinases that mediate various aspects of p38 activity (270,476). To further determine which kinase plays a key role in TNF regulation of PML, we blocked the p38 downstream kinase activity individually, either by kinase inhibitors or siRNAs. From these inhibition assays, we concluded that inhibition of CK2, MSK1 and MK2, had little or no effect on TNF-mediated PML protein accumulation (Figures 22B-D). In contrast, inhibition of MNK1 kinase (MNKi) activity by CGP57380 (Figure 28C) attenuated TNFeffects on the accumulation of nuclear PML protein (Figure 22E). This is similar to the effect of the p38 inhibitor,
SB202190 (Figures 21A). To further confirm a role of MNK1 kinase in TNF-mediated regulation of PML, we carried out knockdown studies and found that the depletion of
MNK1 reduced TNF effects on PML protein accumulation but not on its mRNA abundance (Figure 22F).
221
A B A B
[Ty [Ty pe pe a a qu qu ote ote Cfro D Cfro D m m [Ty V [Ty Athe the pe pe do do [Ty a a cu cu pe qu qu me me a ote ote nt nt qu fro fro or or ote m m the the fro the the suE suE m do do m[Ty m[Ty the cu cu mape mape do me me rya rya cu nt nt ofqu ofqu me or or anote anote nt the the intfro intfro or su su erem erem the m F m stithe stithe su ma ma ngdo ngdo m ry ry poicu poicu ma of of nt.me nt.me ry an an Yo nt Yont ofF int int uor uor an ere ere cathe cathe int sti sti nsu nsu ere ng ng pom pom Figure 22. MNK1 is a p38 downstream kinase that mediates TNF-induced PML protein sti poi poi sitima sitima ng nt. accumulation nt. onry onry 222 poi Yo Yo theof theof nt. u u texan texan Yo ca ca tint t int u n n boere boere ca po po xsti xsti Figure 22. MNK1 is a p38 downstream kinase that mediates TNF-induced PML protein accumulation
HUVECs were pre-treated with kinase inhibitors or transfected with kinase-specific siRNAs prior to TNF treatment, followed by Western blotting with the indicated antibodies. (A) HUVECs were treated with p38 kinase inhibitor and TNF as indicated.
Nuclear and cytosolic fractions were separated and subjected to Western blotting. C: cytosolic fraction; N: nuclear fraction. (B) The effect of MSK inhibitor on TNF- mediated PML protein accumulation in HUVECs. (C) The effect of CK2 inhibitor on
TNF-mediated PML protein accumulation in HUVECs. (D) The effect of knockdown of
MK2 on TNF-mediated PML protein accumulation in HUVECs. (E) The effect of a MNK inhibitor on TNF-mediated PML protein accumulation in HUVECs. (F) The effect of knockdown of MNK1 on TNF-mediated PML protein abundance and mRNA accumulation in HUVECs. The mRNA levels of PML in each sample were quantified by qRT-PCR (n=3).
223
MNK1 kinase regulates the TNF-induced activity of an IRES located within the PML
5’-UTR
MNK1 kinase has been reported to promote protein translation through the activation of a subset of IRESs, although the detailed mechanism remains unknown (487,490).
We first explored whether human PML 5’-UTR has an IRES using a bi-cistronic luciferase reporter system (Figure 23A). This reporter contains an upstream Renilla luciferase (Rluc) gene, which is translated in a cap-dependent manner, fused with the
Firefly luciferase (Fluc) gene, which can only be translated when the intra-cistronic sequence contains a functional IRES. One needs to be cautious as the putative intra- cistronic IRES may harbor a putative cryptic promoter (491). To test this possibility, we generated expression constructs in which several truncated human PML 5’-UTR fragments were inserted immediately upstream of the Fluc gene in a pGL3-basic reporter plasmid, which does not contain any promoter sequence. We were able to determine that the -100 -> -1 region of the PML 5’-UTR (140 nucleotides) contains no detectable promoter activity when compared to an empty vector in HeLa cells (Figure
30A) and HUVECs (Figure 30B). Importantly, the PML 5’-UTR (-100 -> -1)-pRF exhibited substantially higher level of IRES activity than either positive control, EMCV IRES and the p53 IRES in HeLa cells (Figure 30C) and HUVECs (Figure 23B). Furthermore, we
224
A
[Ty
pe a qu
ote fro Bm C the [Ty [Ty do pe pe cu a a me qu qu nt ote ote or fro fro the m m su Dthe the m do do [Tyma cu cu pery me me a of nt nt quan or or oteint the the froere su su msti m m theEng ma ma dopoi [Tyry ry cunt. peof of meYo aan an ntu quint int orca oteere ere then frosti sti supo mng ng mFiguresiti 23. Identification of PML 5’-UTR (-100->-1) as an IRES activated by the TNF- thepoi poi maMNK1on axis 225 dont. nt. rythe cuYo Yo oftex meu u ant ntca ca intbo orn n erex Figure 23. Identification of PML 5’-UTR (-100->-1) as an IRES activated by the TNF-
MNK1 axis
(A) A schematic representation of bi-cistronic pRF plasmids used in the transient transfection reporter assays. (B) The effects of PML 5’-UTR (-100->-1) on reporter activity. The relative ratio of Firefly luciferase/Renilla luciferase intensity is plotted.
The results are mean ± S.D. in triplicates (n=3). (C) Determination of possible alternative splicing of the transcripts of PML 5’-UTR (-100->-1)-pRF. The cDNAs prepared from pRF or PML 5’-UTR (-100->-1)-pRF transfected HUVECs were subjected to qPCR using primer pairs as indicated in (A). The final PCR products were separated on a 0.8% agarose gel, stained by EtBr and images recorded. (D) The reporter activity of PML 5’-UTR (-100->-1) is not derived from ribosomal read-through. HeLa cells were transiently transfected with engineered pRF and -gal plasmids as indicated. Forty- eight hours post transfection, the Firefly luciferase and Renilla luciferase activity were measured and normalized to the transfection control, -gal. The luciferase activity of
PML 5’-UTR (-100->-1)-pRF was set as 1. The results are mean ± S.D. in triplicates. (E)
TNF enhances PML 5’-UTR (-100->-1) activity in a MNK1-dependent manner. shCtrl and shMNK1 knockdown HeLa cells were transiently transfected with PML 5’-UTR (-
100->-1)-pRF plasmid for 72 hr, treated with TNFat the indicated times and cells
226
were harvested. The relative activity of Firefly luciferase to Renilla luciferase was plotted. The results are mean ± S.D. in triplicates (n=3).
227
demonstrated that the detected Fluc reporter activity in our bi-cistronic experimental system is not derived from spurious splicing or a leaky ribosomal read-through
(Figures 23C-D and Figure 31)(492).
To determine whether the PML IRES responds to TNF the PML 5’-UTR (-100 -> -1)- pRF reporter construct was transfected into HeLa cells with or without TNF treatment. Upon TNF stimulation, PML 5’-UTR (-100 -> -1)-pRF showed 1.8- and 2.3- fold increases in reporter activity at 24 and 48 hr of TNFtreatment, respectively, but the increase in Fluc/Rluc by TNF was attenuated when MNK1 was knocked down.
This result indicated that the PML 5’-UTR (-100 -> -1) is activated through a MNK- dependent mechanism in response to TNFtreatment (Figure 23E).
MNK1 kinase contributes to TNF-induced PML accumulation for its function in the inhibition of HUVEC migration and in vitro network formation
We have previously shown that PML is essential for TNF-mediated inhibition of EC migration and capillary network formation (198,482), both of which are key processes in angiogenesis. In parallel with the ability of TNF to induce PML protein
228
A B
[Ty [Ty pe pe
a a qu qu ote ote
fro Cfro D m m [Ty [T the the dope y do
cua p cu mequ e me ntote a nt
Eorfro q or them u the [Ty suthe ot su pe mdo e m a macu fr ma qu ryme o ry ote E ofnt m of froor th [T an an m intthe e int y F thesu d p ere ere dom o e sti sti cuma c a ng ng mery u q poi poi ntof m u nt. nt. oran e ot Yo Yo theint nt eF u u suere or fr ca ca [T m sti th n o Figuren 24. MNK1 mediates TNF-induced inhibition of cell migration and capillary tube formation in y ma ng e po m ECspo p rypoi su th siti siti e ofnt. m 229 e on on a anYo m d the the q intu ar o tex tex u ereca y c t t ot stin of u bo bo e ng xpo a x Figure 24. MNK1 mediates TNF-induced inhibition of cell migration and capillary tube formation in ECs
(A)(B) and (C) The effect of TNF on HUVEC network formation and cell migration in vitro. HUVECs were subjected to capillary tube formation and wound healing assays during TNF treatment as described in Materials and Methods. Representative images in capillary tube formation assays are shown in (A). All the results are mean ± S.D.
(n=6). (D) Knockdown efficiency of MNK1 or PML in aliquots of (E) and (F). (E) The effect of MNK1 or PML knockdown on TNF-mediated inhibition of EC migration. The left panel shows representative images of wound healing assays and the right panel shows cell migration rates. (F) The effect of MNK1 or PML knockdown on TNF- mediated inhibition of in vitro capillary network formation. Representative images are shown in the left panel and the numbers of branches in each field were counted and quantified as shown in the right panel. (E)-(F), The statistical results are mean ± S.D.
(n=6).
230
accumulation (Figure 20A), TNF inhibits EC migration and capillary tube formation in a time-dependent manner (Figures 24A-C). To dissect whether MNK1 plays a role in these two EC activities, we knocked down MNK1 and PML in HUVECs and compared their effects on TNF-mediated inhibition of angiogenesis. As expected, knockdown of PML in HUVECs largely attenuated TNF-mediated inhibition of HUVEC migration and in vitro capillary network formation (Figures 24D-F). Consistently, knockdown of
MNK1 in HUVECs also compromised TNFinhibitory effects on cell migration and capillary network formation (Figures 24E and 24F). Taken together, these data suggested that the MNK1-PML axis contributes to the TNF-mediated inhibition of angiogenesis.
MMP10 and MCP-1 are TNF-induced genes targeted by p38-MNK1-PML axis
Our finding that MNK1 potentiates TNF-mediated induction of PML protein accumulation raised the possibility that MNK1 plays a role in TNF-PML axis to regulate expression of PML-associated genes, thus contributing to TNF-mediated regulation of EC biology. To test this, we first analyzed the gene expression profiles in
HUVECs and identified a list of chemokine and angiostatic genes that are positively regulated by both TNFand PML (301). In addition to MMP10, expression of PDGFB, 231
A
[T y p e a q u ot e frB o[T my thp ee da oq cu uot meC efr [T nto y orm p thth e ee a sud q mo u mc ot aru e y m Figurefr 25. Inhibition of PML, p38 or MNK1 decreases TNF-inducible MCP-1 and MMP10 mRNA expression ofe o ant m nor th inth 232 e tee d resu o stm c inm u gar Figure 25. Inhibition of PML, p38 or MNK1 decreases TNF-inducible MCP-1 and
MMP10 mRNA expression
(A) The effect of PML knockdown on MCP-1 and MMP10 mRNAs. The PML knockdown efficiency was shown in the left panel. (B) The effect of inhibition of p38 and MNK kinases on TNF-mediated induction of MCP-1 and MMP10 mRNAs. The levels of
MCP-1 and MMP10 mRNAs in each sample was measured and normalized to 18S rRNA. (C) The effect of MNK1 knockdown on TNF-mediated accumulation of MCP-1 and MMP10 mRNAs. The statistical results are mean ± S.D. (n=3).
233
CXCL11, CXCLR4 and MCP-1 was down-regulated in PML knockdown HUVECs (Figure
32A). We focused on 2 genes, MMP10 and MCP-1, for further analyses because the functions of these 2 genes in ECs are well characterized (493-495). Using 2 independent PML shRNAs, we further confirmed that MMP10 and MCP-1 were PML downstream target genes (Figure 25A). Moreover, TNF-mediated up-regulation of
MMP10 and MCP-1 mRNAs was significantly reduced in cells pre-treated with inhibitors of p38 or MNK1 (Figure 25B) and cells in which MNK1 was knocked down
(Figure 25C). Based on these data, we conclude that MMP10 and MCP-1 mRNAs are induced by TNFin a p38-, MNK1- and PML-dependent manner.
The expression of MMP10 and MCP1 is controlled by TNF-MNK1-PML axis via
HDAC7
The induction of PML and PML NBs by stress stimuli can increase the sequestration of several PML-associated transcription regulators, preventing access to chromatin and thus contributing to the alterations in the expression of a subset of PML responsive genes (299). Our previous studies suggested that HDAC7 is a PML associated protein and that up-regulation of PML caused the derepression of HDAC7 target genes (74,75).
234
A MCP-1 [T promoter y p e a q u ot eB fr[T oy mp the ea dq ou cotC ue [T mfr MMP10 y eo promoter p ntm e orth a the q ed u suo ot mc e mu fr arm o ye m ofnt th aor e 235 nth d ine o tesu c rem u stm m inar D
[T y p e a q u ot e fr o m th e d o c u m e nt Figure 26. TNF-mediated MCP-1 and MMP10 mRNA expression is controlled by or
MNK1th-PML-HDAC7 axis e su
m m
ar y of a n 236 in te re st in Figure 26. TNF-mediated MCP-1 and MMP10 mRNA expression is controlled by
MNK1-PML-HDAC7 axis
(A) Left panel, a schematic representation of the MCP-1 promoter showing putative transcription factor binding sites that are conserved in human, chimpanzee and mouse. Right panel, the effect of TNF on the association of HDAC7 with the MCP-1 promoter analyzed by ChIP assays. (B) The effect of PML knockdown on the association of HDAC7 with the MCP-1 promoter. The knockdown efficiency is shown on the left. (C) The effect of PML knockdown on the association of HDAC7 with the
MMP10 promoter. (D) The effect of HDAC7 knockdown on TNF-induced accumulation of MCP-1 and MMP10 mRNAs in MNK1 and PML knockdown cells.
HUVECs were infected with lentiviruses carrying the indicated shRNAs and treated with TNF. The normalized expression of MCP-1 and MMP10 in HUVECs is shown. The shCtrl knockdown cells were set at 1. The knockdown efficiency of gene-specific siRNA is shown.
237
We therefore investigated whether HDAC7 participates in TNF- and PML-mediated induction of MMP10 and MCP-1 mRNAs expression. By analyzing the promoters of
MCP-1 from human, mouse and chimpanzee, we identified putative binding sites for transcription factors MEF-2, GATAs and BCL6 that have been shown to bind class II
HDACs (Figure 26A) (496). Using chromatin immunoprecipitation (ChIP) assays, we observed HDAC7 binding to the MCP-1 promoter at two regions, approximately -1.2 kb and -1.6 kb upstream of MCP-1 transcription start site. However, these associations were disrupted by TNF treatment (Figure 26A). Furthermore, knockdown of PML increased HDAC7 occupancy on both MMP10 and MCP-1 promoters and neutralized
TNF effects on the recruitment of HDAC7 to the MMP10 and MCP-1 promoters. This indicates that PML negatively regulates the recruitment of HDAC7 to the MMP10 and
MCP-1 promoters (Figures 26B and 26C). Lastly, we carried out double knockdown experiments followed by TNF treatment and found that further knockdown of
HDAC7 under a PML or MNK1 knockdown background rescued MCP-1 and MMP10 expression in HUVECS (Figure 26D). In summary, our data demonstrated that TNF- induced MCP-1 and MMP10 expression is regulated by the MNK1-PML-HDAC7 regulatory network.
238
MNK1 contributes to TNF-induced PML protein accumulation in MCF7 breast cancer cells
Because PML is a well-known tumor suppressor, we next examined whether this
TNF-mediated regulation of PML also occurs in cancer cells. We first examined the
TNF-induced PML accumulation in MCF7 breast cancer cells due to the ability of this cancer cell line to respond to TNF treatment (37). Similar to what we observed in
HUVECs, the PML protein level was significantly up-regulated in TNF-treated MCF7 cells, and was attenuated by inhibitors of p38 and MNK1 (Figure 27A). Additionally, knockdown of MNK1 by shMNK1 blocked TNF-mediated induction of PML, without decreasing PML mRNA (Figure 27B). Consistently, PML 5’-UTR (-100 -> -1)-pRF showed a 1.8-fold increase in relative reporter activity after 24 hr of TNF treatment in MCF7 cells. However, the increase in Fluc/Rluc by TNF was attenuated when MNK1 was inactivated. This result indicates that the PML 5’-UTR (-100 -> -1) IRES activity is induced through a MNK1-dependent mechanism in response to TNFtreatment
(Figure 27C). To determine biological significance of TNF-MNK1-PML axis in MCF7 cells, we performed viability assays by trypan blue exclusion. We found that TNF treatment of MCF7 cells results in 50% of the cells undergoing cell death, and knockdown of MNK1 or PML partially alleviated this effect (Figure 27D). Furthermore,
239
A B
[T [T y y p p e e a a q q Cu u D ot ot [T e e D y fr fr [T p o o y e m m p a th th e q e e a u d d q otE F o o u e c[T c ot [T fr uy u e y o mp m fr p m ee e o e th nta nt m a e orq or th q d thu th e u o e ot e d ot c sue su o e u mfr m c fr m Figure 27. MNK1 mediates TNF-induced PML protein accumulation and apoptosis in MCF7 breast mo m u o e cancer cells arm ar m m nt y th y e th or 240 ofe of nt e th ad a or d e n o n th o su inc in e c m teu te su u m Figure 27. MNK1 mediates TNF-induced PML protein accumulation and apoptosis in MCF7 breast cancer cells (A) The effect of inhibition of p38 and MNK1 activity on
TNF-induced PML protein expression in MCF7 cells. MCF7 cells were pre-treated with kinase inhibitors followed by TNF treatment, harvested, whole cell lysates prepared and Western blotted with the indicated antibodies. (B) The effect of knockdown of MNK1 on TNF-induced PML protein and mRNA accumulation. (C)
Inhibition of MNK1 activity reduces TNF-mediated PML IRES activation in MCF7 cells.
MCF7 cells were transiently transfected with PML 5’-UTR (-100->-1)-pRF plasmid for
72 hr, treated with or without MNK1 inhibitor and TNF and the cells were harvested.
The relative activity of Firefly luciferase to Renilla luciferase was plotted as shown. The results are mean ± S.D. in triplicates (n=3). (D)-(E) The effect of knockdown of MNK1 or PML on TNF-mediated cell cytotoxicity in MFC7 cells (D) and the cleavage of PARP1
(E). MCF7 cells were infected with lentiviruses expressing a control, MNK1 or PML shRNA followed by TNF treatment. Aliquots of cells were used to determine cell death rate by trypan blue exclusion assays (D) or cleavage of PARP1 by Western blotting (E). The results are mean ± S.D. (n=6). (F) A model by which TNF induces anti- angiogenesis and apoptosis activity through activating PML mRNA translation that involves PML IRES and the p38-MNK1 axis.
241
knockdown by shMNK1 or shPML mitigated TNF-induced cleavage of PARP1, a PML- associated apoptotic effector (Figure 27E) (479). In summary, these data support a model in which the p38-MNK1-PML axis mediates TNF-induced MCF7 cell death in good correlation with regulation of the activity of an IRES that was described for the first time in this report to be present within 100 nucleotides upstream the PML translational initiation codon.
Discussion
In the present study, we have identified an IRES in human PML 5’-UTR spanning -100
-> -1 nucleotides upstream of the translational initiation codon. Notably, this IRES is activated by the TNF-p38-MNK1 axis, in agreement with induced translation of the
PML mRNA and PML protein thus contributing to TNF-regulated apoptosis and inhibition of EC migration and capillary tube formation (Figure 27F).
Several reports have suggested that MNK1-mediated phosphorylation of eIF4E contributes to protein synthesis and cell growth (497,498). Interestingly, Mnk1-/-
Mnk2-/- mice do not exhibit embryonic lethality and no significant reduction in de novo
242
protein synthesis was observed in Mnk1-/- Mnk2-/- MEFs (499). Furthermore, overexpression of a constitutively active form of MNK1 did not increase global protein synthesis and the reduction of eIF4E phosphorylation did not inhibit the formation of translation initiation complexes (499). These results suggest that MNK1 may not directly participate in global translation. In contrast, several lines of evidence have demonstrated that MNK1 may have a role in cap-independent translational control
(487,500). It was proposed that overexpression of MNK1 reduced global protein synthesis and increased cap-independent translation (499). In this study, we propose that MNK1 is a critical effector that potentiates TNF-mediated PML mRNA translation through the PML IRES (Figures 23, 27 and 30C). Since PML has the ability to sequester eIF4E to PML NBs (230,501), it is tempting to speculate that PML- mediated eIF4E nuclear retention contributes to the MNK1-mediated inhibition of cap-dependent translation.
The mouse Pml 5’-UTR has been shown to mediate oncogenic RAS-induced PML mRNA translation through an mTOR kinase cascade (241), but the detailed mechanism is not clear. The human PML 5’-UTR is about 140 nucleotides long, 40 nucleotides longer than the mouse Pml. Using bi-cistronic reporter assays, we have mapped a bona fide
243
IRES to human PML 5’-UTR (-100 -> -1) region. We used stringent criteria to determine the human functional PML IRES. First, we excluded the possibility that human PML 5’-
UTR (-100 -> -1) region might contain any cryptic promoter activity by employing a promoterless reporter assay. Sequence alignment of PML 5-‘UTR from several mammals revealed that the PML 5’-UTR (-100 -> -1) region is highly conserved with the exception of the mouse PML 5’-UTR, which is loosely conserved (Figure 33A). A free energy and secondary structure prediction revealed that the PML 5’-UTR (-100 ->
-1) region contains 2 structural elements, namely 2 stem-loops connected by an open loop, that may indicate possible structure requirement for ribosome entry (Figure
33B) (40,502). In summary, we conclude that the PML 5’UTR (-100 -> -1) region contains a functional IRES and is likely part of the underlying mechanism that controls the accumulation of PML protein.
Several studies suggested that targeting MNK1 represents a novel strategy to inhibit tumor growth (503-505). Breast cancer cell lines such as SKBr3 or BT474 showed sensitivity to MNK1 inhibitor CGP57380-mediated anti-proliferation (503). However,
MCF7 cells are resistant to CGP57380 treatment. In our study, CGP57380 treatment in MCF7 cells attenuated TNF-induced cell death and PML accumulation and caused
244
a decrease in the PML IRES response to TNF(Figures 23E, 27A and 27C). In addition, knockdown of MNK1 by shRNAs reduced TNF-mediated PARP1 activation and subsequently protected MCF7 cells from TNF-induced cell death (Figures 27D-E).
Taken together, these results suggested that the anti-breast cancer activity by MNK1 inhibitors is cell subtype-dependent. This precaution is also likely to be true when treating leukemia patients with IFN because inhibition of MNK1 activity also compromised IFN-mediated suppression of leukemic progenitor cells (33).
Interestingly, in PML/RAR-positive NB4 cells and in primary leukemic progenitors derived from acute promyelocytic leukemia (APL) patients, arsenic trioxide also activated the p38-MNK1 kinase cascade (34). Based on our study, we suspect that the
CGP57380-mediated increase in cell sensitivity to arsenic trioxide may result from the inactivation of the PML-RARIRES (34). Accordingly, inhibitors of MNK1 could be a promising adjuvant agent against some subtypes of leukemia or cancers in which the
PML gene has dominant-negative, gain-of-function mutations.
Our data also indicate that MNK1 plays a key role in TNF-mediated suppression of angiogenesis and endothelial cell migration (Figure 24). Using ChIP assays and qRT-
PCR, we discovered that MMP10 and MCP-1 are TNF-inducible genes that are
245
regulated by the MNK1-PML-HDAC7 axis in HUVECs (Figures 25, 26 and 32). Notably,
MCP-1 and MMP10 are multi-functional effectors involved in various physiological and pathological processes, including sustained EC activation, endothelium dysfunction and vascular permeability (493-495,506,507). Our study reveals a novel mechanism by which the MNK1-PML-HDAC7 cascade mediates TNF-induced gene expression and provides several possible routes targeting MCP-1 to attenuate the vascular complications in different inflammation-associated diseases.
Acknowledgement
This work was supported, in whole or in part, by R01 DK078965 and HL093269 (to H.
Y. K.) and R37 DK060596 and R01 DK053307 (to M. H.). We also thank Drs. David
Samols and William Merrick for their comments on the manuscript. The authors declare no conflict of interest.
Materials and Methods
Plasmids and DNA constructs - The expression plasmids are listed in Supplementary
Table 9. The PCR fragments of PML 5’-UTR were amplified using HEK293T genomic
246
DNA as a template. For bi-cistronic plasmids, PCR products were digested by restriction enzymes, EcoRI and NcoI, and subcloned into the pRF plasmid to replace the EMCV IRES, a gift from Dr. Mazumder. The p53 IRES and hairpin were generated as previously reported and subcloned into the pRF plasmid (45,508). The shRNA plasmids were purchased from Sigma and their related information is listed in Table
8. All clones were sequenced to confirm their identity.
Cell lines, reagents and antibodies - HEK293T, MCF7 and HeLa cells were purchased from ATCC and cultured in Dulbecco's modified Eagle medium supplemented with
10% fetal bovine serum (FBS), 50 U of penicillin G/ml, and 50 g of streptomycin
sulfate at 37°C in 5% CO2. HUVECs were purchased from Lonza and cultured in endothelial cell basal medium (EBM-2; Lonza, Boston, MA) with EGM-2 SingleQuot growth supplements (Lonza, Madison, WI). Cells that were < 6 passages were used in this study. TNF was purchased from Promega (G5421, Madison, WI). The kinase inhibitors used in this study are: p38 kinase (SB202190) (Sigma, St. Louis, MO), CKII
(TBCA) (Calbiochem, San Diego, CA), MSK (SB747651) (Tocris biosience, Bristol, U.K.);
MNK (CGP57380) (Cayman chemical, Ann Arbor, MI). siRNAs were purchased from
Thermo Scientific and the siRNA target sequences are listed in Table 8. Antibodies
247
used in this study are listed in the Table 10. The transfection reagents DharmaFECT1
(T-2001) and Lipofectamine 2000 (LF2000) were purchased from Thermo Scientific
(Waltham, MA) and Invitrogen (Grand island, NY), respectively.
Cycloheximide treatment - HUVECs were treated with or without TNF (20 ng/ml) followed by 40 M cychloheximide (Sigma, St. Louis, MO) treatment for the indicated times and harvested 16 hr after TNF treatment. Whole cell lysates were subjected to Western blotting with anti-PML and anti--actin antibodies. The intensity was quantified by ImageJ.
Kinase inhibition and TNF treatment - HUVECs and MCF7 cells were transiently transfected with kinase-specific siRNAs for 48 hr or pre-treated with kinase inhibitors for 1 hr prior to TNF treatment. The kinase inhibitor concentration used in this study is 10 M unless specifically noted. For HUVECs, the cells were treated with TNF (20 ng/ml) for 16 hr. MCF7 cells were treated with TNF 60 ng/ml for 48 hr.
248
siRNA knockdown and cellular protein extraction - For siRNA knockdown, a non- targeting siRNA or two independent siRNAs against p38 (Thermo Scientific, Waltham,
MA) were transfected into HUVECs using DF1 transfection reagent (Thermo Scientific,
Waltham, MA) according to manufacture's protocol. Cells were treated with TNF 16 hr and harvested 72 hr after siRNA transfection prior to preparation of total RNA or whole cell extracts. For whole cell extracts, cells were resuspended in RIPA buffer (1x
PBS, 1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS) plus protease inhibitors
(Roche, Nutley, NJ) on ice for 35 min and vortexed every 5 min until completely homogenized. The cell lysates were mixed with an equal volume of 2 X SDS buffer (100 mM Tris-Cl pH 6.8, 4% SDS, 0.2% bromophenol blue, 20% glycerol and 2% beta- mercaptoethanol) and boiled in a hot pot for 10 min. For Western blots, -actin or - tubulin were included as internal loading controls.
Lenti-Virus preparation for shRNA knockdown - shRNAs expressing plasmids were purchased from Sigma and the targeted sequences are listed in the Table 8. To generate infection viral particles expressing shRNAs, we individually co-tranfected the shRNA plasmid into HEK293T cells with packaging vectors pMD2G and ps-PAX-2 by
Lipofectamine 2000 according to the manufacture's protocol (Invitrogen, Grand
249
island, NY). The conditioned medium containing the lentivirus was collected 40 hr after transfection. After removing cell debris by passage through a 0.45 m filter, the medium was diluted with culture medium at a 1:4 ratio for viral infection. Six hours after viral infection, the medium was replaced with fresh medium and cells were allowed to recover overnight followed by puromycin selection for an additional 48 hr.
After puromycin selection, the medium was removed and replaced with fresh medium. Cells were cultured overnight in regular medium prior to further experiments.
Total RNA extraction, RT-PCR and quantitative real-time PCR (qRT-PCR) - Seventy-two hours after transient transfection or infection with siRNAs or shRNAs respectively,
HUVECs, HeLa and MCF7 cells were harvested, total RNA prepared using PrepEase
RNA Spin kits (USB/Affymetrix, Cleveland, OH) and quantified by A260/A280 spectrometry. The cDNA pool was generated using Superscript 3 Reverse
Transcriptase (Life Technologies, Grand island, NY) according to the manufacturer’s instructions. The cDNAs of interest and internal controls were quantified by qPCR using an iCycler (Bio-Rad, Hercules, CA) platform with 2×iQ SYBR Green Supermix (Bio-
Rad, Hercules, CA) and appropriate primer sets. The PCR program was set for 40 cycles with three steps of 95 oC for 30 s, 55 oC for 30 s, and 72 oC for 30 s. Melting curves
250
were obtained after PCR to ensure the homogeneity of the PCR products. The relative abundance of genes of interest was normalized to an internal control (18S rRNA) and depicted as mean±S.D. from three independent experiments.
Immunofluorescence microscopy - HUVECs were cultured in 12-well plates, transfected with a control or 2 independent p38 siRNA and followed by TNF treatment. Immunofluorescence microscopy was performed using anti-PML antibodies and secondary antibodies conjugated with Alexa Fluor 594 (Invitrogen,
Grand island, NY). Cells were mounted with DAPI (Vectashield; Vector Laboratories,
Burlingame, CA) and images were visualized using a fluorescent microscope (Leica,
Germany).
Subcellular fractionation - HUVECs were cultured in 60 mm plates and treated with kinase inhibitors, siRNAs and TNF as indicated. Prior to harvest, HUVECs were washed with 1 x PBS one time and spun down using a desktop centrifuge at 4 °C, 5000 r.p.m. for 5 min. The cell pellets were resuspended in five-time their volume in
cytosolic fractionation buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.5%NP-
251
40 and 5% Glycerol) and kept on ice for 10 min. The nuclei were collected by centrifugation at 4,000 r.p.m. for 6 min and the supernatants (1st cytosolic fraction) were transferred to a new tube. The precipitated pellets were resuspended a second time in cytosolic fractionation buffer and spun down again. The supernatant was collected and combined with the 1st extract as the cytosolic fraction. The final nuclear pellets were resuspended in nuclear fraction buffer (10 mM HEPES pH 7.5, 400 mM
NaCl, 5 mM EDTA, 0.5%NP-40, 1 mM DTT and 5% glycerol) on ice for 15 min and vortexed every 5 min until completely homogenized.
Chromatin immunoprecipitation (ChIP) - ChIP assays were modified from our published protocol.(116) Briefly, HUVECs were treated with 1% formaldehyde for 10 min at room temperature and the crosslinking reaction was stopped by adding glycine to a final concentration of 0.125M and incubated for 5 min. Cells were harvested and chromatin was sheared by sonication to an average length of 300~700 bp. Anti-
HDAC7 antibody was confirmed (Figure 31) and used for immunoprecipitation and the immune complex was subsequently pulled down by protein A beads and washed at least 5 times by ChIP wash buffer. As a control experiment (Mock), no antibody was added. The DNA-protein complex was eluted with a freshly prepared elution
252
buffer (50 mM NaHCO3, 1% SDS) at room temperature for 20 min. The eluted chromatin was incubated with 300 mM NaCl at 68 °C to reverse the crosslinks. The protein was subsequently digested with 10 mg/ml proteinase K at 45 °C for 3 h. The
DNA was extracted using a DNA purification kit (Roche, Nutley, NJ) and subjected to
PCR analysis after RNA digestion. The results were calculated from three independent real-time PCR experiments and presented as the mean ± S.D. of the relative fold enrichment as the percentage of input signal. The primers for real-time PCR are listed in Table 8.
Dual luciferase reporter assay for bi-cistronic reporter and cryptic promoter analysis -
The bi-cistronic reporter plasmids or promoterless constructs were individually transfected into HUVECs, MCF7 or HeLa cells by LF2000 (Invitrogen, Grand island, NY).
Forty-eight hours post transfection, cells were harvested by adding 0.3 ml lysis buffer and mixed gently for 10 min on ice. The activities of Renilla (Renilla reniformis) luciferase (Rluc) and firefly (Photinus pyralis) luciferase (Fluc) were measured using dual luciferase reporter assay (E1910 Promega, Madison, WI) by FB12 luminometer
(Berthold, Germany) according to the manufacturer’s instructions. Briefly, 50 µl of lysate was mixed with 50 µl of Luciferase Assay Reagent II to determine luminescent
253
signal for Fluc. After the luminescence was quantified, the Fluc activity was quenched and Rluc activity was measured by adding 50 µl Stop & Glo Reagent. For Figure 23D, a CMX--galactosidase (-gal) plasmid was co-transfected with modified pRF constructs as a transfection efficiency control and the intensity of -gal was measured as previously described (75).
Capillary tube formation assay - HUVECs were transiently infected with the indicated virus expressing shRNAs. Cells were treated with trypsin and 104 cells were plated on
Matrigel (Millipore, Temecula, CA) in 96 well plates. After seeding on the gel for 2 hr, cells were treated with or without TNF (20 ng/ml) in the culture medium for 12 hr prior to image capture. Six fields per experimental group were randomly picked and the branch points in each field were counted for statistical analysis. A fraction of knockdown cells was collected to examine the knockdown efficacy by Western blotting. All results are shown as mean± S.D..
Wound healing assay - HUVECs were transiently infected with virus expressing shRNAs. The next day, the cells were plated on 6-well dishes. Before they become
254
confluent, the cells were treated with TNF (20 ng/ml) for 4 hr and the wounds were generated by scratching with sterile pipet tips. At 0 and 8 hr after scratching, the images of 6 randomly chosen fields were captured by a camera equipped with microscope and the width of the same wounds was measured by imageJ. The cell migration rate was quantified by measuring the ratio of the wound closure between
0 and 8 hr. The results are shown as mean ± S.D..
Trypan blue exclusion assay - MCF7 cells were transiently infected with lentivirus expressing shRNAs. The next day, cells were plated on 35 mm dishes followed by
TNF treatment. Cells were kept in DMEM containing reduced 2% FBS for 1 hr prior to TNF treatment. Forty-eight hours after TNF (60 ng/ml) treatment, cells were treated with trypsin and resuspended with 0.2% trypan blue in 1X PBS to examine cell viability. An aliquot of cells was loaded onto a hemacytometer and the stained dead cells and the total cells were counted in triplicate experiments. The results are shown as mean ± S.D..
255
Statistical analysis - Data are presented as the mean ± S.D. of three independent experiments. Two compared groups were analyzed by two-tailed student’s t test.
Statistical significance is presented as: n.s., not significance, *p<0.05, ** p<0.01 and
***p<0.001.
256
A
[T y p e a q B u C [T ot [T y e y p fr p e o e a m a q th q u e u Figure 28. Inhibition of MAPK activity by kinase-specific inhibitors ot d ot e o e fr c fr o u o m m m th e th nt e e d or d o th o c e c u su u m m m e m e nt ar nt or y or th of th e a e 257 su n su m in m m te m ar re ar y st y Figure 28. Inhibition of MAPK activity by kinase-specific inhibitors
(A)-(C) HUVECs were pre-treated with DMSO or kinase inhibitor, SP600125 (JNKs),
U0126 (ERKs) or CGP57380 (MNKs) 1 hr prior to TNF stimulation and harvested at the indicated time points. The kinase activation markers including pJNK (JNKs), pERK
(ERKs) and peIF4E (MNKs), were detected by Western blotting.
258
Figure 29. The effect of p38 knockdown on TNF-mediated accumulation of PML NBs
259
Figure 29. The effect of p38 knockdown on TNF-mediated accumulation of PML NBs
The p38 knockdown HUVECs in Figure 21C were re-plated on slides with or without
TNFtreatment and cellular PML was detected by immunostaining.
260
A A [T HeLa y [T p y e p a e q a u q ot u e ot B frB e HUVEC [T [To fr y ym o p pth m e e th a ad e q qo d u uc o ot otu c e em Cu C HeLa fr fre m [T Do ont e y m mor [Tnt p th th yor e e e pth a d dsu e q o om asu u c cm qm ot u uar um e m my otar fr e eof ey o nt nta frof m Figure 30. Mapping of minimal PML IRES or orn oa th th thin 261 mn e e ete thin d su sure ete o m mst dre c m min ost u ar arg cin Figure 30. Mapping of minimal PML IRES
(A) Mapping of cryptic promoter sequence in HeLa cells. Left panel, a schematic representation of truncated PML 5’-UTR constructs in pGL3-basic promoterless system. HeLa cells were transiently transfected with the control pGL3-Bsic plasmid
(promoterless) or a set of PML 5’-UTR deletion constructs as indicated. The reporter activity was determined by Firefly luciferase intensity. (B) Mapping of cryptic promoter in HUVECs. The experiments were conducted as in (A) except HUVECs were used. (C)
PML IRES activity in HeLa cells determined by a bi-cistronic pRF system. HeLa cells were transiently transfected with bi-cistronic expression plasmids as indicated. The
IRES activity was determined by the relative activity of Firefly luciferase (Fluc)/Renilla luciferase (Rluc). The activity of pRF-Basic is set as 1. The statistical results are mean ±
S.D. (n=3).
262
Figure 31. A diagram of putative products derived from spurious splicing in pRF bi-cistronic system
263
Figure 31. A diagram of putative products derived from spurious splicing in pRF bi- cistronic system
The primers used for qPCR of cDNA are marked as arrows. The putative RT-qPCR products derived from spurious splicing are presented with a question mark.
264
A B [T [T y y p p e e a a q q u u ot ot e e fr fr
o o m Figurem 32. The effect of knockdown of PML or HDAC7 on the expression of a subset of chemokines and th angiostaticth factors e e
d d o o c c u u m m e e nt nt or or th th 265 e e su su m m m m ar ar Figure 32. The effect of knockdown of PML or HDAC7 on the expression of a subset of chemokines and anigiostatic factors
(A)-(B) HUVECs were transiently transfected with shCtrl, shPML (A) or shHDAC7 (B), harvested and total RNA prepared for RT-qPCR using gene-specific primers. The statistical results are mean ± S.D. (n=3).
266
A
[T y p e a q Bu ot [T e y fr p o e m a th q e u d ot o e c fr u Figureo 33. A sequence alignment of the mammalian PML 5’-UTR and a putative RNA secondary structure of m humanm PML IRES e th nt e or d th o e c su u m m m e ar 267 nt y or of th a e n su in
Figure 33. (A) A sequence alignment of the PML 5’-UTR from human, chimpanzee, dog, pig and mouse. The conserved and similar regions are highlighted with black and grey boxes, respectively. The relative position to the first AUG is indicated. (B) A putative
RNA secondary structure of human PML (-100->-1) predicted by mFold software.
268
Table 8. A list of primer sequences and siRNA and shRNA target sequences for chapter 3
siRNA Target sequence provider
p38-1 5’-GGAAUUCAAUGAUGUGUAU-3’ J-003512- 20 (Dharmaco n)
p38-2 5’-UCUCCGAGGUCUAAAGUAU-3’ J-003512- 21 (Dharmaco n)
Non- D-001810- targeting 01 (Dharmaco n)
shRNA Target sequence
MNK1-1 5’- TRCN0000 CCGGCCTATGCCAAAGTTCAAGGTGCTCGAGCACCTTGA 195343 ACTTTGGCATAGGTTTTTTG-3’ (Sigma)
MNK1-2 5’- TRCN0000 CCGGCCTATAGAGATGGGCAGTAGCCTCGAGGCTACTGC 314867 CCATCTCTATAGGTTTTTG-3’ (Sigma)
HDAC7 5’- TRCN0000 CCGGCAAGTAGTTGGAACCAGAGAACTCGAGTTCTCTGG 195442 TTCCAACTACTTGTTTTTTG-3’ (Sigma)
269
PML-1 5’- TRCN0000 CCGGGCCAGTGTACGCCTTCTCCATCTCGAGATGGAGAA 003867 GGCGTACACTGGCTTTTT-3’ (Sigma)
PML-2 5’- TRCN0000 CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAC 003868 TGCCGGTACACTTTTT-3’ (Sigma)
Non- 5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGT- SHC202 targeting GCTCTTCATCTTGTTGTTTTT-3’ (Sigma)
Primers sequence for qRT- PCR
MCP-1 FORWARD: 5'-AGCAGCAAGTGTCCCAAAGA-3'
REVERSE: 5'-TTGGGTTTGCTTGTCCAGGT-3'
PML FORWARD: 5’-GCCGACTTCTGGTGCTTTG-3’
REVERSE: 5’-GTTGTTGGTCTTGCGGGTG-3’
CXCR4 FORWARD: 5’-TTCTGCGCCTCACGCCCC-3’
REVERSE: 5’-TGGGACGGACCTGGGAG-3’
CXCL11 FORWARD: 5’-GACGCTGTCTTTGCATAGGC-3’
REVERSE: 5’-GGATTTAGGCATCGTTGTCCTTT-3’
MMP10 FORWARD: 5'-GCATTTTGGCCCTCTCTTC-3'
REVERSE: 5'-CAGGGTATGGATGCCTCTTG-3'
PDGF-BB FORWARD: 5’-CTCGATCCGCTCCTTTGATGA-3’
REVERSE: 5’- CGTTGGTGCGGTCTATGAG-3’
18S rRNA FORWARD: 5’-GTAACCCGTTGAACCCATT-3’
REVERSE: 5’-CCATCCAATCGGTAGTAGCG-3’
270
Primers sequence for ChIP
MCP-1 FORWARD:5’-GGAATGTGGCCTGAAGGTAAG-3’
-1.6kb REVERSE: 5’-CAGACTGACCACAGATGTGAACTA-3’
MCP-1 FORWARD:5’-CTCAGCCCAGCCATTAACAT-3’
-1.2kb REVERSE: 5’-CAGACTGACCACAGATGTGAACTA-3’
Mmp-10 FORWARD:5’- TTGCAGACTTACTGTGTTACTGC-3’
REVERSE: 5’- CTTTCACATGTCTAACGATCCA-3’
Primers sequence for pRF RT-PCR
P1 5’-ATGGCGACATGTTGTGCC-3’
P2 5’-GGTGCCAAGAAGTTTCCTA-3’
P3 5’-GAAGAGAGTTTTCACTGCA-3’
P4 5’-CTACACGGGCGATCTTTCCGCCCTTCTTC-3’
271
Table 9. A list of bi- and mono-cistronic reporter plasmids for chapter 3
Plasmid Vector REF
PML 5’-UTR (-140~-1) PRF
PML 5’-UTR (-120~-1) PRF
PML 5’-UTR (-100~-1) PRF
PML 5’-UTR (-100~-20) PRF
PML 5’-UTR (-140~-40) PRF
p53 IRES PRF
EMCV IRES PRF
pGL3-control
pGL3-basic
PML 5’-UTR (-140~-1) pGL3-basic
PML 5’-UTR (-120~-1) pGL3-basic
PML 5’-UTR (-100~-1) pGL3-basic
PML 5’-UTR (-100~-20) pGL3-basic
PML 5’-UTR (-140~-40) pGL3-basic
p53 IRES pGL3-basic
272
Table 10. A list of antibodies for chapter 3
Target Cat. provider
PML SC-966 Santa Cruz
Lamin B sc-365962 Santa Cruz
JNK Sc-1648 Santa Cruz
ERK Sc-292838 Santa Cruz
Mouse-IgG sc-2005 Santa Cruz conjugated with HRP
Rabbit-IgG Sc-2030 Santa Cruz conjugated with HRP
-actin A5441 Sigma
-tubulin T5168 Sigma
HDAC7 H226 Sigma
FLAG F-3165 Sigma
Alexa Fluor 594 μm A-11005 Invitrogen goat anti mouse
p38 9212 Cell signaling
p-p38 9211 Cell signaling
p-JNK 9251 Cell signaling
p-ERK 9101 Cell signaling
MNK1 4394 Cell signaling
eIF4E 9742 Cell signaling
p-eIF4E 9741 Cell signaling
273
PARP1 9532 Cell signaling
MK2 3042 Cell signaling
PML polyclonal in-house
274
Chapter 4: The role of PML in IFN-induced activation of
Stat1/Stat2/Stat3
Abstract
IFN, a pleiotropic cytokine, is widely produced by infected or injured tissues to initiate protective mechanisms in the host against tumors, viral infections and bacterial infections. One key anti-tumor activity of IFN relies on its angiostatic function. However, the detailed mechanism by which IFN achieves this biological outcome is still unclear. Stat1 and Stat2 are the major transcription factors downstream of IFNActivation of Stat1 by IFN is a key mechanism to block angiogenesis. In the same context, IFN also induces Stat3 nuclear translocation to antagonize Stat1 transcriptional activity, in part, through their physical interaction.
Additionally, Stat3 has been viewed as an angiogenic activator. Since Stat1/2 and Stat3 functions are reciprocally activated during IFN stimulation, a putative mediator is likely to counteract Stat3 activity but strengthen Stat1/2 function to insure IFN- mediated anti-angiogenesis. PML is an IFN responsive gene that is highly expressed in endothelium and, like Stat1, has the potential to suppress angiogenesis. A significant fraction of PML is localized in discrete nuclear structures called PML nuclear bodies (PML NBs), which serve as reservoirs to gather proteins for sequestration or
275
modification. In this study, we found that knockdown of PML increases nuclear Stat3 following acute exposure to IFN without altering the abundance of nuclear or cytoplasmic Stat1. Further investigation indicated that PML is a negative regulator promoting nuclear Stat3 proteolysis. In contrast, knockdown of PML decreases isgylated Stat1 and Stat2 after prolonged IFN exposure. This observation suggests that PML contributes to a positive feed forward loop that enhances transcriptional activity of Stat1 and Stat2. Our results support a model in which PML is a key regulator in IFN-mediated gene regulation and inhibition of angiogenesis by tuning Stat1/2 and
Stat3-mediated transcription.
Results
1. PML promotes IFN-mediated Stat1/Stat2 isgylation
Stat1, Stat2, ISG15 and PML are interferon-stimulated genes (ISGs) that are induced by IFNs (197,422). Stat1 is known to be conjugated with ISG15 (isgylation) after long- term IFN exposure (197). Evidence has also suggested that the PML domain of
PML/RAR, a transfused oncoprotein, is isgylated especially when the isgylation E1 activating enzyme, UBE1L is overexpressed (281). However, whether Stat2 is isgylated remains unknown. To investigate this, HUVECs were transiently transfected with a control or USP18 (isgylation peptidase) siRNAs, treated with IFN, harvested at 276
different time points and analyzed by Western bloting. In the siRNA control ECs, we did not observe any difference in total protein levels of Stat1 or Stat2 for the first hour after IFN exposure but a significant increase in total Stat1 and Stat2 protein levels was observed after 16 hr of IFN treatment. Furthermore, several slower migrating
Stat1 and Stat2 species were detected after a 16 hr of IFNtreatment (Figure 34A-B, lanes 1-4). In USP18 knockdown ECs, we found that these slower migrating Stat1 and
Stat2 species were more abundant (Figure 34A-B, lane 4 vs. 8 and lane 12 vs. 16). To determine whether these slower migrating Stat1 and Stat2 species include isgylated forms of Stat1 and Stat2, we carried out immunoprecipitation with extracts prepared from control, USP18 and ISG15 knockdown HUVECs using a control IgG, anti-Stat1 or anti-Stat2 antibodies. We found that several slower migrating species, including a distinct band migrating at 100 kD, were detected in the anti-Stat1 precipitated complexes, but not in control IgG pulldown complexes (Figure 34C, lanes 4 and 7).
Furthermore, these bands were increased in USP18 knockdown HUVECs (lanes 5 and
8) and decreased in ISG15 knockdown HUVECs (lanes 6 and 9). Immunopreciitation using an anti-ISG15 antibody followed by Western blotting also displayed a distinct
Stat1 species migrating at 100 kD which was absent in IgG precipitated complexes
(Figure 34C, lane 8). Additionally, this Stat1 species was increased in USP18
277
Figure 34. Prolonged IFN treatment induces Isgylation of Stat1 and Stat2
278
Figure 34. Prolonged IFN treatment induces Isgylation of Stat1 and Stat2
(A-B) HUVECs were transiently transfected with two independent USP18 siRNAs for 72 hrs. Cells were trypsinized and equal numbers of cells were seeded in 60 mm plates, treated with or without INF (103U/ml), harvested at the indicated times, lysed and nuclear fractions prepared. The nuclear fractions were subjected to Western blotting with the indicated antibodies. Lamin B was used as a loading control for the nuclear fraction. Arrows indicate putative isgylated Stat1 (A) and Stat2 (B) species and asterisks indicate non-specific bands. (C-D) siRNAs against USP18, ISG15 and a non- targeting siRNA were used to knock down the corresponding genes in HUVECs for 72 hrs. Prior to collection, cells were treated with 103U/ml INFfor 16 hrs. Nuclear fractions were prepared and an aliquot was used for immunoprecipitation with antibodies against Stat1 or Stat2 followed by Western blotting with the indicated antibodies. Arrows mark Isgylated Stat1 and Stat2. Conversely, anti-ISG15 antibodies were used to immunoprecipitate isgylated proteins in the nuclear fraction, isgylated
Stat1/Stat2 in the precipitates was detected with antibodies against Stat1/Stat2.
279
knockdown samples and decreased in ISG15 knockdown samples (lane 9). Collectively, these results are consistent with previous reports indicating that Stat1 is isgylated
(509). Using the same immunoprecipitation approach, our data demonstrated for the first time that like Stat1 Stat2 is also isgylated in response to TNF stimulation (Figure
34D).
2. PML promotes IFN-mediated Stat1/2 isgylation
We have previously shown that IFN potently induces PML mRNA and protein levels and inhibits angiogenesis (198). We also demonstrated that IFN-induced PML mRNA is Stat1-dependent. Our microarray data showed significantly decreased expression in
IFN inducible genes in PML KD HUVECs (301,510). Furthermore, more than 100 genes that are induced more than 2 fold by IFN in HUVECs are down-regulated more than
2 fold in PML KD cells. To validate this, we carried out qRT-PCR and confirmed several
IFN and PML common target genes (Cheng et al., unpublished data). These data suggest that PML is a critical component of IFN signaling and that loss of PML may compromise the ability of IFN to induce its target genes. Stat1 is the major IFN- induced transcription factor that is responsible for activation of numerous target genes. In experiments by Cheon et al., even overexpression of a tyrosine
280
phosphorylation-defective Stat1 mutant (U-Stat1) induced expression of several known interferon target genes, indicating that unphosphorylated Stat1 is transcriptionally active (427). Interestingly, these genes are also PML target genes as shown in our array (Cheng et al., unpublished data). By qRT-PCR, we also demonstrated that these Stat1- and unphosphorylated Stat1-inducible genes are down-regulated in PML KD ECs (Cheng et al., unpublished data). Using aortic ECs isolated from WT and Pml KO mice, we further validated that loss of Pml results in reduced expression of several unphosphorylated Stat1-inducible genes (Cheng et al., unpublished data). These data suggest that the regulation of PML on these Stat1 target genes is conserved between human and mouse. The ENCODE database indicates that in K562, a human acute myelocytic leukemia cell line, at least one Stat1 binding site is present in the promoter of every gene on the list. Because IFN induces Stat1 nuclear translocation, which in turn induces its target gene expression including PML, these observations suggest a positive feedback loop between IFN/Stat1 and PML in ECs
(Figure 9). We previously demonstrated that knockdown of PML significantly blocks the ability of IFN to inhibit EC migration and capillary tube formation, suggesting a critical role for PML in IFN/Stat1-mediated angiostatic activity. Indeed, loss of Pml
281
converts the angiostatic activity of IFN to pro-angiogenic activity in Matrigel plug assays (Cheng, X-W. unpublished data).
To further dissect the mechanisms by which PML potentiates IFN/Stat1-mediated transcription activity, we examined whether PML plays a role in IFN-induced phosphorylation, nuclear translocation, and isgylation of Stat1/Stat2. Using PML siRNAs, we knocked down PML in HUVECs prior to IFN treatment. We then harvested the cells at different time points and performed subcellular fractionation and we determined nuclear and cytoplasmic Stat1/Stat2 levels, Stat1 and the status of phosphorylation of nuclear Stat1/2 isgylation (Figure 35A and 38A). In siRNA control cells, we found little or no change in nuclear Stat1 level for the first 2 hours of IFN treatment, and an accumulation of Stat1 and an induction of IRF9 and ISG15 protein were observed in both nuclear and cytoplasmic fractions after 16 hours of IFN stimulation. However, a sharp increase in phosphorylation of nuclear Stat1 (p-Y701) was observed after 30 minutes of IFN stimulation and this increase significantly declined and disappeared after 2 hours of treatment (Figure 38A). Intriguingly, a significant increase in nuclear Stat2 was observed 30 minutes after IFN stimulation.
This was not the case for cytoplasmic Stat2. In PML knockdown cells, we found that:
1) phosphorylation of nuclear Stat1 (p-Y701) was modestly increased (Figure 38A), 2) 282
A
[Ty pe a qu ote fro m the do cu me nt or the su m ma ry of an int ere sti ng poi nt. Yo u ca n po Figure 35. Knockdown of PML compromised IFN-induced isgylation of nuclear Stat1/Stat2 siti on 283 the tex t bo x Figure 35. Knockdown of PML compromised IFN-induced isgylation of nuclear
Stat1/Stat2
(A) HUVECs were transiently transfected with control siRNA or PML siRNAs for 72 hrs.
Equal numbers of cells were seeded in 60 mm plates, treated with IFN (103U/ml) and collected at the indicated times. Cytosolic and nuclear fractions were prepared and subjected to Western blotting with the indicated antibodies. Lamin B and -tubulin were used as loading controls for nuclear and cytoplasmic fractions, respectively.
Arrows indicate the positions of the isgylated Stat1 or Stat2. (B) Aortic endothelial cells were isolated from WT and Pml-/- mice. Cells were cultured in EGM-2 medium with 5% serum, treated with mouse IFN (103U/ml) and harvested at the indicated times. The nuclear fraction was prepared and subjected to Western blotting with the indicated antibodies. Lamin B was used as a loading control. Arrows indicate the isgylated species.
284
nuclear IRF9 and ISG15 were slightly decreased (Figure 35A) and 3) isgylation of nuclear Stat1/2 was reduced (Figure 35A, compare lane 5 and lane 10). Similar results were observed in the nuclear fractions of Pml-/- mouse aortic ECs. Based on these data, we conclude that PML promotes IFN-induced isgylation of nuclear Stat1/2 (Figure
35B, compare lane 4 and lane 8).
3. PML promotes Stat1 function in the IFN-mediated gene expression and inhibition of angiogenesis
Our results suggest that loss of PML decreased nuclear isgylated Stat1 and Stat2 and nuclear abundance of IRF9, suggesting PML is required for optimal expression of ISGF3 target genes.
To test this suggestion, we determined the mRNA abundance of Stat1/2 target genes and found that the knockdown of PML in HUVECs or knockout of Pml in mice aortic
ECs attenuated the IFNeffects on several Stat1/2 target genes, except MX-1 (428)
(Figure 36). PML is angiostatic. Our observations that knockdown of USP18 increased overall isgylation of Stat1 and Stat2 and that knockdown of PML decreased isgylation
285
A
B
Figure 36. Depletion of PML in endothelial cells reduces IFN-induced Stat1 target gene expression
286
Figure 36. Depletion of PML in ECs reduces IFN-induced Stat1 target gene expression
(A) PML was knocked down by 2 independent siRNAs for 72 hrs and treated with or without IFN103U/ml) for 16 hrs. Cells were collected, total RNAs extracted and cDNAs prepared. The expression of Stat1 target genes was determined by qRT-PCR and normalized to 18S rRNA. (B) Murine aortic ECs isolated from WT and Pml-/- mice were cultured, treated with mouse IFN (103U/ml) for 16 hrs. Total RNAs were extracted and cDNA prepared. The expression of mouse Stat1 target genes was determined by qRT-PCR and normalized to mouse 18S rRNA.
287
of nuclear Stat1 and Stat2 suggest that USP18 is pro-angiogenic. To test this idea, we knocked down USP18, PML or both in HUVECs and examined their effects on IFN- mediated inhibition of EC migration and network formation. Consistent with our expectations, knockdown of USP18 increased Stat1 isgylation and decreased EC migration and capillary network formation, while knockdown of PML did the opposite.
Furthermore, knockdown of PML compromised the USP18 knockdown effects on
Stat1 isgylation and EC migration and capillary tube formation after IFN treatment
(Figure 37). Collectively, our data suggest that PML functions as an IFN downstream effector to promote Stat1/2 isgylation and by this means enhances Stat1/2 transactivation of their gene expression and IFN-mediated angiostatic activity.
4. PML negatively regulates IFN-induced nuclear p-Stat3/Stat3
IFN induces transient induction of phosphorylated Stat3 (p-Y705) and its subsequent nuclear translocation, thereby activating Stat3 target gene expression (425,511). Our observation that loss of Pml converts IFN from an angiostaic factor to a pro- angiogenic factor in Matrigel plug assays suggests that Pml inhibits an activity that is induced by IFN. Because IFN induces nuclear translocation of Stat1 and Stat3 and
288
A
B
Figure 37. The effect of Usp18 on IFN-mediated Stat1 isgylation, cell migration and
capillary tube formation
289
Figure 37. The effect of Usp18 on IFN-mediated Stat1 isgylation, cell migration and capillary tube formation
(A) HUVECs were transiently transfected with PML and USP18 siRNAs for 48 hrs, trypsinized and equal amounts of cells were seeded in 6 well plates. Cells were treated with IFN103U/ml) for 16 hrs and wounds were generated by scratching 8 hr before the endpoint. The left panel shows representative results of wound healing assays and the cell migration rates were analyzed and shown in the right panel. The levels of nuclear Stat1 and Stat1 isgylation were detected by Western blotting using antibodies against Stat1. Lamin B was used as a loading control. The arrow points to isgylated
Stat1. The statistical results are mean ± S.D. (n=6) (*p<0.05, ** p<0.01 and
***p<0.001; unpaired two-tailed t-test). (B) HUVECs were treated with the indicated siRNAs and IFN103U/ml) for 16 hrs for capillary tube formation assays.
Representative images are shown on the left. The numbers of branches in each field were counted and the quantitative results are shown in the right panel. The statistical results are mean ± S.D. (n=6) (*p<0.05, ** p<0.01 and ***p<0.001; unpaired two- tailed t-test).
290
Stat1 and Stat3 mutually antagonize one another, we suspected that PML may negatively regulates Stat3 activity. To address this issue, we examined cytoplasmic/nuclear Stat3 and p-Stat3 in control and PML knockdown HUVECs. In control ECs, nuclear Stat3 was increased after a 30 min IFN treatment but rapidly decreased at 1 hr (Figure 38A). Notably, the increased nuclear Stat3 was sustained up to 16 hr of IFN treatment in PML knockdown ECs. However, cytoplasmic Stat3 showed little or no difference in the control and PML knockdown cells (Figure 35A).
Furthermore, the presence of nuclear p-Stat3 was also extended to 2 hr in PML knockdown ECs as opposed to 1 hr in the control ECs. These observations suggest that
PML promotes turnover of nuclear Stat3 (Figure 38A). To test whether the turnover of nuclear Stat3 is regulated by proteasome-mediated degradation, we determined the effect of MG132, a proteasome inhibitor, on the abundance of nuclear Stat3. We found that MG132 treatment following IFN stimulation increased steady-state levels of nuclear Stat3 (Figure 38B). Furthermore, knockdown of PML compromised the ability of MG132 effect on nuclear Stat3 degradation (Figure 38C). In summary, these data suggest that PML negatively regulates nuclear Stat3 abundance in response to
IFN stimulation.
291
Figure 38. PML reduces accumulation of nuclear Stat3 and p-Stat3 by promoting its degradation
292
Figure 38. PML reduces accumulation of nuclear Stat3 and p-Stat3 by promoting its degradation
(A) Knockdown of PML enhances p-Stat3/Stat3 following 30 minutes of IFN stimulation. PML was knocked down in HUVECs for 72 hrs, treated with INF
(103U/ml) and harvested at the indicated time points. Nuclear fractions were prepared and subjected to Western blotting with the indicated antibodies. Lamin B was used as a loading control. The levels of nuclear p-Stat3/Stat3 were quantified and normalized to Lamin B and the relative changes in nuclear p-Stat3/Stat3 during IFN treatment is plotted. (B) Blockade of proteasome attenuates a reduction of nuclear Stat3 in IFN treated ECs. HUVECs were treated for 0.5 h with IFN (103U/ml) followed by a 0.5 h treatment with vehicle or MG132. Cells were harvested, nuclear fractions prepared and Western blotted with the indicated antibodies. (C) Knockdown of PML attenuates
MG132-mediated increase in abundance of nuclear Stat3. HUVECs were transiently transfected with siControl or siPML siRNAs for 72 hrs, treated with IFN (103U/ml) for
0.5 hr followed by 0.5 hr treatment with vehicle or MG132. Cells were harvested, nuclear fractions prepared and Western blotted with the indicated antibodies. The level of nuclear Stat3 was quantified, normalized to Lamin B and the ratio
[Stat3]/[Lamin B] is shown.
293
Discussion and Future Directions
In this study, we found that IFN stimulates Stat1/2 isgylation in both HUVECs and mouse aortic ECs (Figure 35). This modification was confirmed by immunoprecipitation assays in which knockdown of USP18 or ISG15 in HUVECs increased or decreased Stat1/2 isgylation, respectively. Based on their mobility, slower migrating Stat1 and Stat2 are likely conjugated with one ISG15 (Figure 34). A preliminary result shown in this study also indicates that PML is a positive regulator of
IFN-mediated isgylation of nuclear Stat1/2 since the depletion of PML in HUVECs or mouse aortic ECs results in a reduction of this modification (Figure 34 and 35). Using immunoprecipitation to pull down equal amounts of Stat1/2, the reduced levels of
Stat1/2 isgylation in PML knockdown cells can be further quantified by Western blotting. Several outstanding questions warrant further investigation. Because there is no consensus sequence for protein isgylation, which lysine residue(s) in Stat1 and
Stat2 are isgylated remains an important issue in order to study functional significance of Stat1/2 isgylation. An immediate plan to address this issue will be using mutant
Stat1 and Stat2 and a cell-based reconstituted isgylation assay. Mass spectrometry will be also useful in addressing this issue. Does PML directly or indirectly regulate Stat1 and Stat2 isgylation? We suspect that by using an in vitro reconstituted isgylation assay, we will be able to address this question. Based on the role of PML in other post- 294
translational modifications such as p53 acetylation and phosphorylation, it is possible that PML NBs functions as a scaffold to bring together Stat1/2 and the isgylation machinery, thereby facilitating isgylation (221). To test this possibility, we will use immunofluorescence microscopy to determine whether IFN promotes co- localization of Stat1/2 and the isgylation machinery within PML NBs. If the premise is true, we also anticipate that overexpression of a nuclear localized PML (PML-NLS-
K487R) mutant but not a cytoplasmic mutant (PML-K487R) will elevate Stat1/2 isgylation when we overexpressed isgylation system in cells (75,512). Although some studies have suggested that protein isgylation controls protein stability, the function of Stat1/2 isgylation is still elusive (435). However, it is unlikely that this isgylation regulates Stat1 and Stat2 protein stability, because knocking down ISG15 or
USP18 did not significantly affect the total abundance of Stat1 or Stat2. To further examine this issue, using cycloheximide to block translation, Stat1/2 protein half-life can be determined in siUSP18 or siISG15 knockdown cells. On the other hand, we also expect that isgylation of Stat1/2 by IFN will enhance its transactivation activity.
Therefore, the expression of Stat1/2 target genes is anticipated to be up-regulated in
USP18 knockdown cells but reduced in PML or ISG15 knockdown cells.
295
We also observed that IFN not only stimulated p-Stat3 nuclear translocation but also promoted degradation of Stat3 in a PML- and proteasome-dependent manner (Figure
38). This conclusion is based on our observations that MG132 treatment increased nuclear Stat3 abundance and that knockdown of PML blocked MG132-induced nuclear Stat3 accumulation. (Figure 38B and 38C). A previous report showed that ectopically expressed PML recruits Stat3 and binds Stat3 to block its transactivation and DNA binding ability (452). It is possible that IFN induces Stat3 phosphorylation and nuclear translocation and in turn enhances its association with PML NBs for subsequent degradation. Using immunoprecipitation and immunofluorescence experiments, we will examine whether endogenous PML and Stat3 co-localize in the nucleus after 0.5 hr of IFN treatment and whether it decreases afterward.
Additionally, we will overexpress Stat3-NLS and Stat3-NES mutants in cells with or without PML expression and compare their protein half-lives to determine whether
PML promotes degradation of nuclear Stat3. As PML can promote sumoylation and subsequent degradation of NB components, it is possible that PML reduces Stat3 stability by this means. To test this idea, we will block protein degradation with MG132 and measure the ubiquitination of Stat3 in PML knockdown and control cells in
296
response to IFN stimulation. If our hypothesis is correct, we anticipate that Stat3 ubiquitination will be reduced in PML knockdown cells.
According to our preliminary data and proposed model in ECs, PML is a mediator to temporally change Stat1/Stat3 activity, depending on the duration of IFN treatment
(Figure 9). The overall outcome of this mechanism is to activate IFN-inducible gene expression in a time-dependent manner that ultimately promotes angiostasis. To decode these complex phenomena, we will perform ChIP assays to monitor the dynamic binding of Stat1 and Stat3 to the promoters of a subset of INF-inducible genes following IFN treatment. Initially we will examine STAT1, ISG15, CXCL10 and
CXCL11 as the candidate genes for investigation because their expression is co- regulated by Stat1 and PML and has a direct effect on IFN-mediated angiostatic function (301,433,513,514). Taking CXCL10 as an example, following short-term IFN exposure, Stat1 and Stat3 are expected to bind the GAS element of the CXCL10 promoter. However, we anticipate that the occupancy of Stat3 will gradually be replaced by Stat1 due to the large increase in nuclear Stat1 after prolonged IFN treatment. We also predict that because knockdown of PML enhances accumulation of nuclear Stat3, Stat3 occupancy of the GAS element on the CXCL10 promoter will be
297
sustained in PML knockdown ECs. Knockdown of PML also slightly reduces the accumulation of nuclear Stat1, so we anticipate that Stat1-suppressed Stat3 target genes will be induced, and Stat1-isgylation and transactivation activity will also be reduced in PML knockdown cells during IFN stimulation.
Finally, in our preliminary experiments, we showed a correlation between Stat1- isgylation and IFN-mediated inhibition of angiogenesis, both of which are also controlled by PML (Figure 37). We will extend our molecular studies of PML, Stat1 and
Stat3 to IFN-mediated inhibition of angiogenesis by in vitro and in vivo assays.
Materials and Methods
Isolation of Mouse Aortic Endothelial Cells-Both Pml+/+ (WT) and Pml−/− (KO) mice were maintained in the 129S1/SvImJ background with normal rodent chow and sterile water in the Health Science Animal Facility at Case Western Reserve University. All procedures were approved by Case Western Reserve University IACUC. The genotype of the mice was confirmed by PCR analysis of tail biopsies. The mouse aortas were isolated and periadventitial fat was removed. The sliced aortic rings were embedded
298
into Matrigel (BD Biosciences) in EGM2 medium (Lonza) with 10% FBS (Sigma). After
3 days, the gel embedded aortic rings were collected and treated with trypsin.
Endothelial cells were resuspended in EGM2 medium with 5% FBS and cultured on fibronectin coated culture dishes. The endothelial cells used in the study were from passages 2 to 3.
Cell lines, reagents and antibodies - HUVECs were purchased from Lonza and cultured in endothelial cell basal medium (EBM-2; Lonza) with EGM-2 SingleQuot growth supplements (Lonza). Cells that were < 6 passages were used in this study. MG132 was purchased from Sigma, recombinant human IFN was purchased from R&D system and recombinant mouse IFN was purchased from PBL assay science. siRNAs were purchased from Thermo Scientific and the siRNA target sequences are listed in the Table 11. Antibodies used in this study are listed in the Table 11. The transfection reagent DharmaFECT1 (T-2001) was purchased from Thermo Scientific.
siRNA knockdown and subcellar fractionation - A non-targeting siRNA or independent siRNAs against USP18, PML or ISG15(Thermo Scientific) were transfected into
299
HUVECs using DF1 transfection reagent (Thermo Scientific) according to manufacture's protocol. Cells were harvested at 72 hr after siRNA transfection prior to preparation of total RNA or nuclear and cytoplasmic fractionation. Prior to harvest, cells were treated with MG132 (50 g/ml) or IFN (103U/ml) for varying times. For nuclear and cytoplasmic fractionation, HUVECs were washed with 1 x PBS one time and spun down using a desktop centrifuge at 4 °C, 5000 r.p.m. for 5 min. The cell pellets were resuspended in five-times volume in cytosolic fractionation buffer (10
mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.5%NP-40 and 5% Glycerol) and kept on ice for 10 min. The nuclei were collected by centrifugation at 4,000 r.p.m. for 6 min and the supernatants (1st cytosolic fraction) were transferred to a new tube. The pellets were resuspended in cytosolic fractionation buffer and spun down again. The supernatant was collected and combined with the 1st extract as the cytosolic fraction.
The resulting nuclear pellets were resuspended in nuclear fraction buffer (10 mM
HEPES pH 7.5, 400 mM NaCl, 5 mM EDTA, 0.5%NP-40, 1 mM DTT and 5% glycerol) on ice for 15 min and vortexed every 5 min until completely homogenized. The prepared lysates were mixed with an equal volume of 2 X SDS buffer (100 mM Tris-Cl pH 6.8, 4%
SDS, 0.2% bromophenol blue, 20% glycerol and 2% beta-mercaptoethanol) and boiled for 10 min. For Western blots, antibodies against Lamin B or -tubulin served as
300
internal loading and recovery controls for nuclear and cytoplasmic fractions, respectively.
Total RNA extraction, RT-PCR and quantitative real-time PCR (qRT-PCR) - HUVECs and mice aortic endothelial cells were harvested and total RNA prepared using PrepEase
RNA Spin kits (USB/Affymetrix). Single-strand cDNA pools were generated using tracriptor universal cDNA master (Roche) according to the manufacturer’s instructions. The cDNAs for specific genes were quantified by qPCR using an iCycler
(Bio-Rad) platform with 2×iQ SYBR Green Supermix (Bio-Rad) and appropriate primer sets as listed in Table 11. The PCR program was set for 40 cycles with three steps of 95 oC for 30 s, 55 oC for 30 s, and 72 oC for 30 s. Melting curves were obtained after each cycle to ensure the homogeneity of the PCR products. The relative abundance of target genes was normalized to an internal control (18S rRNA) and depicted as mean±S.D. from three independent experiments.
Examination of IFN-induced Stat1/Stat2 isgylation- The siControl, siUSP18 and siISG15 HUVECs were treated with INF (103 U/ml) for 16 hrs. After collection, the
301
cell pellets were suspended in NETN buffer (0 mM Tris-Cl (pH 8.0), 100 mM NaCl, 0.1%
Nonidet P-40, 1 mM EDTA, 10% glycerol, and 1 mM dithiothreitol) containing a mixture of protease inhibitors (Roche) followed by sonication. The lysates were pre- cleared with protein A beads and immunoprecipitated with anti-Stat1, Stat2 or ISG15 antibodies. The immunoprecipitates were pulled down by protein A beads and subjected to Western blotting with the indicated antibodies.
Capillary tube formation assay - HUVECs were transiently transfected with the indicated siRNAs. Cells were treated with trypsin and 104 cells were plated on
Matrigel (millipore) in 96 well plates. After seeding on the gel for 2 hr, cells were treated with or without INF (103 U/ml) in the culture medium for 12 hr prior to image capture. Six fields per experimental group were randomly picked and the branch points in each field were counted for statistical analysis. All results are shown as mean± S.D..
Wound healing assay - HUVECs were transiently transfected with siRNAs. The next day, the cells were plated on 6-well dishes. The cells were treated with INF (103
302
U/ml) for 4 hr followed by scratching with a sterile pipet tip to generate wounds. At
0 and 12 hr after scratching, images of 6 randomly chosen fields were captured through a microscope equipped with a camera and the width of the same wounds was measured by imageJ. A fraction of treated cells was used for Western blotting.
The cell migration rate was quantified by measuring the distance of the wound closure between 0 and 12 hr. The results are shown as the mean ± S.D..
Statistical analysis - Data are presented as the mean ± S.D. of three independent experiments. Two compared groups were analyzed by two-tailed student’s t test.
Statistical significance is presented as: n.s., not significance, *p<0.05, ** p<0.01 and
***p<0.001.
303
Table 11. The experimental materials for chapter 4
Antibody Target Cat. provider
Stat1 Sc-346 Santa Cruz
Stat3 Sc-482 Santa Cruz
Stat2 Sc-22816 Santa Cruz
mStat2 L-20 Santa Cruz
Lamin B sc-365962 Santa Cruz
Mouse-IgG sc-2005 Santa Cruz conjugated with HRP
Rabbit-IgG Sc-2030 Santa Cruz conjugated with HRP
-actin A5441 Sigma
-tubulin T5168 Sigma
IRF9 Sc-10793 Santa Cruz
p-Stat1 (Y701) 9171 Cell signaling
p-Stat3 (Y705) 9131 Cell signaling
Isg15 polyclonal Gift from Dr. Ernest Bordon Cleveland Clinic foundation
PML polyclonal in-house
SiRNA Target Cat. provider
USP18#1 J-004236-07 Dharmacon
304
USP18#2 J-004236-08 Dharmacon
PML J-006547-05 Dharmacon qPCR Target sequence provider
mOAS2 FORWARD: 5'-CAATAATGTGGGCAAAGATGATGG-3'
REVERSE: 5'-ACTGGGAGCGGTTGGTTTTTAGAG-3'
mIFIT3 FORWARD: 5'-CCTACATAAAGCACCTAGATGGC-3'
REVERSE: 5'-ATGTGATAGTAGATCCAGGCGT -3'
mMX1 FORWARD: 5'-GACCATAGGGGTCTTGACCAA -3'
REVERSE: 5'-AGACTTGCTCTTTCTGAAAAGCC -3'
mPML FORWARD:5'-CTGCGCTGCCCGAGCTGCCAGG-3'
REVERSE: 5'-CAGCGCAGGGTTGCGGTGGTTGG-3'
mSTAT1 FORWARD: 5'-TCACAGTGGTTCGAGCTTCAG-3'
REVERSE: 5'-CGAGACATCATAGGCAGCGTG-3'
OAS2 FORWARD: 5'-AATGCCAGGAGAAGCTGTGT-3'
REVERSE: 5'-AGCCATTGCCAGCATATTTT-3'
IFIT3 FORWARD: 5'-GAACATGCTGACCAAGCAGA-3'
REVERSE: 5'-CAGTTGTGTCCACCCTTCCT-3'
MX1 FORWARD: 5'-GTTTCCGAAGTGGACATCGCA -3'
REVERSE: 5'-CTGCACAGGTTGTTCTCAGC -3'
305
Chapter 5: Discussion and Implication
The major focus in this thesis was to investigate the mechanisms by which the inflammation-associated cytokines, TNF and IFN, regulate transcriptional machinery and downstream signaling in vascular and breast cancer cells to control inflammatory responses and determine cell fates, including angiogenesis and apoptosis.
TNF stimulation regulates the transcriptional co-regulators for TNF inducible gene activation
First, we demonstrated that TNF up-regulates the expression of a subset of NFB target genes, including IL1, IL6 and IL8 by inducing expression of the E3 ubiquitin ligase, -TrCP1. In this pathway, TNF-mediated induction of -TrCP1 promotes ubiquitination and degradation of the transcriptional co-repressor SMRT, an NFB associated co-repressor (Figure 10-13). The biological outcome of SMRT down- regulation by the TNF--TrCP1 axis is to enhance NFB target gene expression
(116)(Figure 14 and 15). Our results support a current model of corepressor function in which the removal of co-repressors from chromatin by post-translational
306
modification contributes to target gene expression (Figure 2 and 15). In a recent report, -TrCP1 also elevate -catenin transcriptional activity due to its ability to recruit the p300 co-activator to -catenin target gene promoters (515). Using immunofluorescence experiments, our data and others’ show that unlike the cytoplasmic localization of endogenous -TrCP2, exogenously expressed -TrCP1 is mainly localized in the nucleus. This suggests a possible role of -TrCP1 for transcriptional regulation (116,342)(Figure 11). Combining these observations, we speculate that -TrCP1 functions as a switch in transcriptional status from repression to activation by marking co-repressors for degradation so they can be replaced by co- activators on the target gene promoters. In contrast, Barish et al. proposed that transcriptional repressive and positive complexes reciprocally exchange on BCL6 and
NFB regulated cistromes in mouse macrophages when cells respond to LPS (Figure
2) (79,80). However, in our study we did not observe the same phenomenon. We measured no significant change in p50 and BCL-6 occupancy on our candidate gene promoters in HUVECs after TNF treatment (116)(Figure 14). It is possible that although both TNF and LPS promote NFB target gene expression, they do so by different mechanisms. One triggers SMRT degradation upon exposure to TNF and another one induced by LPS results in an exchange of co-regulators.
307
In addition to -TrCP1-mediated SMRT degradation, we and others previously reported that SMRT is down-regulated in a kinase dependent manner although the exact mechanism is not known (121)(Table 1). SMRT phosphorylation by IKKMEK and Cam kinases triggers its nuclear export which facilitates its degradation in the cytoplasm (Table 1). But proteasomal degradation of SMRT is not restricted to the cytoplasm. Our data and others’ suggest that -TrCP1 and SMRT can also be degraded in the nucleus. In fact, -TrCP1 and SMRT primarily localize in the nucleus
(116,342)(Figure 11). Accordingly, the poly-ubiquitination of SMRT by -TrCP1 and the subsequent SMRT proteolysis probably occurs in the nucleus. This hypothesis is further supported by the observation that the 20S proteasome and ubiquitin are found in the nucleus. Additionally, other nuclear proteins, such as p53 and MyoD, have been shown undergoing proteasome-mediated proteolysis in the nucleus (516). Our data also suggest that unlike other -TrCP1 substrates, the recognition of SMRT by -
TrCP1 does not require a phosphorylated degron motif on SMRT (116)(Figure 12 and
19). Based on these findings, the up-regulation of -TrCP1 by TNF and the nuclear localization of -TrCP1 are critical for -TrCP1-mediated SMRT regulation. In our previous studies, pin1 is another enzymatic component in cells that can trigger SMRT degradation. Using co-expression experiments, we conclude that pin1 and -TrCP1
308
promote SMRT degradation through parallel mechanisms since a Pin1 resistant SMRT mutant (3X) is still down-regulated by overexpressed -TrCP1 (Figure 18).
After TNFstimulation, we observed that the protein levels of -TrCP1 are enhanced in HUVECs (Figure 10). According to the previous reports, up-regulation of -TrCP1 by
TNFis likely triggered by JNK although this needs further validation (116,339). In addition to JNK-mediated regulation, mir-183 has been shown to target the -TrCP1 mRNA coding region and reduce -TrCP1 mRNA stability (343,347). Interestingly, a recent study demonstrated that TNFtreatment in endometrial stromal cells down- regulated the expression of mir-183 (517). Therefore, the up-regulation of -TrCP1 by
TNF shown in our studies may result from reduced miR-183 levels after
TNFexposure (Figure 10). Given that chronic inflammation and high levels of -
TrCP1 have been shown to correlate with tumorigenesis and cancer aggressiveness
(see chapter 1), it will be interesting to investigate whether miR-183 and JNK play roles as key mediators in the context of inflammation and tumorigenesis.
During tumorigenesis, transformed cells confront several environmental stresses, such as hypoxia or oxidative stress, and acquire unique abilities through genetic and
309
epigenetic alterations to adapt themselves to these unfavorable conditions (518). -
TrCP1 is a stress mediator and is up-regulated in response to oxidative, UV and - catenin-induced oncogenic stress. Therefore, it seemed likely that -TrCP1 participates in the cell transformation process. Indeed, over-expression of -TrCP1 has been shown to result in mammary hyperplasia in mice and the E3 ubiquitin ligase function of -TrCP1 is critical for pancreatic cancer tumorigenesis (315,347,366,519).
Interestingly, de-repression of SMRT has been reported as a prerequisite for anchorage dependent cell survival. Based on those observations, we expect that -
TrCP1-mediated SMRT derepression occurs in cancer cells and plays a role in cancer cell survival (78,170) (Chapter 2). Therefore, it will be interesting to examine this hypothesis in more depth in cancer cell lines and -TrCP1 knockout mice in the future.
If our hypothesis is true, blockade of -TrCP1 will be a promising strategy for cancer therapy.
In addition to SMRT regulation, our data further demonstrate that the increase of PML after TNF treatment reduces HDAC7-mediated repression of MCP-1 and MMP10
(Figure 26). The findings are consistent with a model in which sequestration of HDAC7 by PML NBs provides an alternative route to derepress HDAC7 and in turn re-activate
310
HDAC7 target gene expression in response to TNF. By this mechanism, PML may control a variety of genes particularly if PML associates with other class II HDACs
(74,75). Together, our findings shown here support previous proposals on TNF action in transcriptional derepression but also provide new evidence that modifies the working model specific for TNF-inducible genes via a -TrCP1-SMRT axis (Figure 2).
Removal of co-repressors from target promoters in response to inflammatory stimulation has been suggested to facilitate inflammatory gene expression and de- regulation of co-repressors is correlated with inflammation-associated diseases. In a previous clinical investigation, reduced SMRT levels found in obese patients were associated with diabetes and chronic inflammation (90)(Table 2). Several mouse models also demonstrated that knockout or knockdown of SMRT activates inflammatory gene expression and causes metabolic and inflammatory disorders
(Table 2). In this thesis, we elucidated a mechanism in which both the degradation of
SMRT by -TrCP1 and the derepression of HDAC7 by PML in response to TNF enhances a subset of inflammatory gene expression, including IL1, IL6, IL8 and MCP-
1 (Figure 14, 26 and 32). Based on these findings, we expect that blockade of PML up- regulation or -TrCP1 function will provide an alternative strategy to reduce TNF-
311
induced inflammatory responses and thereby ameliorate the syndrome of TNF- associated inflammatory diseases. This assumption can be examined in mouse models using MNK1 kinase or -TrCP1 inhibitors.
Translational control of PML contributes to TNF-induced apoptosis of
MCF7 breast cancer cells and decreased angiogenesis in HUVECs
In our previous studies, we have found that PML is up-regulated by TNF and IFNin
HUVECs and this contributes to TNF- and IFN- mediated gene regulation and anti- angiogenesis (198,301). As discussed in Chapter I, activation of Stats by IFNhas been reported to transcriptionally up-regulate PML (195,198,238). Our previous report established that TNFalso induces PML transcription by activating Stat1 in
HUVECs(198) In this thesis we further extended these findings and demonstrate another route by which TNF can up-regulate PML protein levels through a translational control mechanism (Chapter 3). This pathway is mediated by p38 and
MNK1. In addition to p38, our data also implicate ERK kinase as a participant in TNF- mediated PML up-regulation although the exact mechanism requires further
312
investigation. This assumption is further supported by a recent study that oncogenic
RAS signaling controls PML translation through ERK kinase (241).
Like NRF2 and myc, the PML mRNA 5’UTR can form a low free energy stem-loop, a characteristic of an IRES (47,487). Using dual luciferase assays, we found that the activation of the PML IRES by the TNF-p38-MNK1 axis is positively correlated with the enhancement of PML protein accumulation and is independent of transcriptional regulation (Figure 20-24). Based on our previous findings, the induction of PML mRNA by IFN is similar to TNF; however, the PML protein levels showed a larger increase after IFNtreatment (198). This observation suggests that IFNmay enhance both
PML mRNA abundance and protein abundance. The latter is through MNK1-mediated translational regulation. A recent report extended our findings on translational regulation to two other ISGs, ISG15 and ISG54. Both were up-regulated in MEFs by type I IFN through an ERK-MNK1 axis (33). Given that PML is known to function in cellular senescence and tumor suppression, the translational up-regulation of PML likely contributes to IFN-MNK-mediated arrest of cell growth as has been reported by Platanias’s group (33).
313
Abundant evidence has suggested that PML is a cellular stress sensor. The protein levels of PML sharply change in response to different stresses (Table 3). Under osmotic stress, p38 activated CKII kinase phosphorylates PML on several sites and promotes
PML ubiquitination and degradation (270). Accordingly, inhibition of p38 by kinase inhibitor, SB202190, showed a reduction in stress-induced PML degradation in HEK-
293 and NIH3T3 cells (270). In the thesis, we did not observe a similar function for p38 although we saw about 2- fold increase of PML protein in HUVECs at higher doses of a CKII inhibitor (Figure 22 and 28). The discordant results in p38-mediated PML regulation may come from the cell types used or different stresses. Similar to osmotic stresses, viral infection and oxidative stresses are also negative stimuli triggering PML degradation (Table 3). As for genotoxic agents such as irradiation or DNA damage, their effects on PML protein regulation has not been clearly determined but a redistribution of PML NBs after genotoxic agent treatment is consistently observed
(Table 3). Conversely, both oncogenic stress and TNF positively regulate PML protein levels and arrest cell growth via mTOR and MNK kinase (241)(chapter 3). Both our results and previous reports indicate that the PML mRNA 5’UTR as a critical control for
PML protein translation responding to several kinase cascades (241)(Figure 21-24). In addition to kinase-mediated IRES activation, it is very likely that some TNF-associated
314
ITAFs participate in the control of PML IRES activity. To identify which ITAF is involved in this process, we will first examine the function of two putative ITAFs, hnRNPA1 and hnRNPK, in PML IRES activation using the bi-cistronic system. These two ITAFs have been shown as TNF downstream mediators (35,520). Alternatively, using PML mRNA
5’UTR as bait, we will perform RNA pull-downs to determine which protein binds to the PML mRNA 5’UTR followed by Mass spectrometry identification. Once we have candidate list, we can further confirm their functions by in vitro binding assays and in vivo reporter experiments.
The nuclear PML protein has been shown to control the activities of several apoptosis- associated transcription factors and co-regulators, such as p53 and DAXX (214,239).
Unlike p53 in the activation of apoptotic genes, DAXX is a transcriptional corepressor that suppresses anti-apoptotic genes, such as cIAP2 and SURVIVIN (214). TNF- induced PML protein accumulation may trigger apoptosis by enhancing p53 transactivation and simultaneously suppressing DAXX-associated anti-apoptotic genes. This mechanism warrants further investigation in the future.
315
Overall, our findings demonstrate that TNF and IFN stimulation induces a subset of genes and subsequently activates multiple cellular responses, including inflammatory responses, angiogenesis and apoptosis through regulation of downstream effectors that include transcriptional corepressor SMRT and the tumor suppressor protein PML.
Additionally, TNF also induces MCP-1 and MMP-10 expression by reliving HDAC7- mediated transcriptional repression through induction of PML and PML NBs. TNF- induced increase in PML NBs is mediated by both transcription-dependent and - independent mechanisms. In a previous report, our lab demonstrated that TNF activates PML transcription via Stat1 (198). In this thesis, we describe another mechanism in which TNF treatment leads to the accumulation of the tumor suppressor protein PML, through activation of IRES in PML 5’UTR. The activation of
PML IRES is p38-MNK1 dependent. Lastly, our data indicate that PML is a critical regulator of IFN signaling through positive feedback regulation of Stat1/2 and negative feedback regulation of Stat3. The PML-mediated Stat1/2/3 regulation involves post-translational modification of Stat1/2/3 proteins. In conclusion, our work demonstrates that TNF and IFN control the activities of downstream transcriptional factors through multifaceted mechanisms that include transcriptional regulation,
316
mRNA translation, ubiquitination-mediated proteolysis and post-translational modifications such as phosphorylation and isgylation.
317
References
1. Carswell, E. A., Old, L. J., Kassel, R. L., Green, S., Fiore, N., and Williamson, B. (1975) An endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci U S A 72, 3666-3670 2. Aggarwal, B. B., Moffat, B., and Harkins, R. N. (1984) Human lymphotoxin. Production by a lymphoblastoid cell line, purification, and initial characterization. J Biol Chem 259, 686-691 3. Aggarwal, B. B., Henzel, W. J., Moffat, B., Kohr, W. J., and Harkins, R. N. (1985) Primary structure of human lymphotoxin derived from 1788 lymphoblastoid cell line. J Biol Chem 260, 2334-2344 4. Aggarwal, B. B., Gupta, S. C., and Kim, J. H. (2012) Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 119, 651-665 5. Balkwill, F. (2006) TNF-alpha in promotion and progression of cancer. Cancer Metastasis Rev 25, 409-416 6. Starnes, H. F., Jr., Warren, R. S., Jeevanandam, M., Gabrilove, J. L., Larchian, W., Oettgen, H. F., and Brennan, M. F. (1988) Tumor necrosis factor and the acute metabolic response to tissue injury in man. J Clin Invest 82, 1321-1325 7. Michie, H. R., Manogue, K. R., Spriggs, D. R., Revhaug, A., O'Dwyer, S., Dinarello, C. A., Cerami, A., Wolff, S. M., and Wilmore, D. W. (1988) Detection of circulating tumor necrosis factor after endotoxin administration. N Engl J Med 318, 1481-1486 8. Sethi, G., Sung, B., and Aggarwal, B. B. (2008) TNF: a master switch for inflammation to cancer. Front Biosci 13, 5094-5107 9. Croft, M., Benedict, C. A., and Ware, C. F. (2013) Clinical targeting of the TNF and TNFR superfamilies. Nat Rev Drug Discov 12, 147-168 10. Hotamisligil, G. S. (2006) Inflammation and metabolic disorders. Nature 444, 860-867 11. Feldmann, M., and Maini, R. N. (2001) Anti-TNF alpha therapy of rheumatoid arthritis: what have we learned? Annu Rev Immunol 19, 163-196 12. Aggarwal, B. B. (2003) Signalling pathways of the TNF superfamily: a double- edged sword. Nat Rev Immunol 3, 745-756 13. Aggarwal, B. B., Kohr, W. J., Hass, P. E., Moffat, B., Spencer, S. A., Henzel, W. J., Bringman, T. S., Nedwin, G. E., Goeddel, D. V., and Harkins, R. N. (1985) Human tumor necrosis factor. Production, purification, and characterization. J Biol Chem 260, 2345-2354
318
14. Kelker, H. C., Oppenheim, J. D., Stone-Wolff, D., Henriksen-DeStefano, D., Aggarwal, B. B., Stevenson, H. C., and Vilcek, J. (1985) Characterization of human tumor necrosis factor produced by peripheral blood monocytes and its separation from lymphotoxin. Int J Cancer 36, 69-73 15. Black, R. A., Rauch, C. T., Kozlosky, C. J., Peschon, J. J., Slack, J. L., Wolfson, M. F., Castner, B. J., Stocking, K. L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K. A., Gerhart, M., Davis, R., Fitzner, J. N., Johnson, R. S., Paxton, R. J., March, C. J., and Cerretti, D. P. (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385, 729-733 16. Watts, A. D., Hunt, N. H., Wanigasekara, Y., Bloomfield, G., Wallach, D., Roufogalis, B. D., and Chaudhri, G. (1999) A casein kinase I motif present in the cytoplasmic domain of members of the tumour necrosis factor ligand family is implicated in 'reverse signalling'. EMBO J 18, 2119-2126 17. Vudattu, N. K., Holler, E., Ewing, P., Schulz, U., Haffner, S., Burger, V., Kirchner, S., Andreesen, R., and Eissner, G. (2005) Reverse signalling of membrane- integrated tumour necrosis factor differentially regulates alloresponses of CD4+ and CD8+ T cells against human microvascular endothelial cells. Immunology 115, 536-543 18. Eissner, G., Kolch, W., and Scheurich, P. (2004) Ligands working as receptors: reverse signaling by members of the TNF superfamily enhance the plasticity of the immune system. Cytokine Growth Factor Rev 15, 353-366 19. Sukits, S. F., Lin, L. L., Hsu, S., Malakian, K., Powers, R., and Xu, G. Y. (2001) Solution structure of the tumor necrosis factor receptor-1 death domain. J Mol Biol 310, 895-906 20. Ansieau, S., Scheffrahn, I., Mosialos, G., Brand, H., Duyster, J., Kaye, K., Harada, J., Dougall, B., Hubinger, G., Kieff, E., Herrmann, F., Leutz, A., and Gruss, H. J. (1996) Tumor necrosis factor receptor-associated factor (TRAF)-1, TRAF-2, and TRAF-3 interact in vivo with the CD30 cytoplasmic domain; TRAF-2 mediates CD30-induced nuclear factor kappa B activation. in Proc Natl Acad Sci U S A 93, 14053-14058 21. Chen, G., and Goeddel, D. V. (2002) TNF-R1 Signaling: A Beautiful Pathway. Science 296, 1634-1635 22. Tournier, C., Dong, C., Turner, T. K., Jones, S. N., Flavell, R. A., and Davis, R. J. (2001) MKK7 is an essential component of the JNK signal transduction pathway activated by proinflammatory cytokines. Genes Dev 15, 1419-1426 23. Natoli, G., Costanzo, A., Moretti, F., Fulco, M., Balsano, C., and Levrero, M. (1997) Tumor Necrosis Factor (TNF) Receptor 1 Signaling Downstream of TNF 319
Receptor-associated Factor 2: NUCLEAR FACTOR κB (NFκB)-INDUCING KINASE REQUIREMENT FOR ACTIVATION OF ACTIVATING PROTEIN 1 AND NFκB BUT NOT OF c-Jun N-TERMINAL KINASE/STRESS-ACTIVATED PROTEIN KINASE. J Biol Chem 272, 26079-26082 24. Yuasa, T., Ohno, S., Kehrl, J. H., and Kyriakis, J. M. (1998) Tumor Necrosis Factor Signaling to Stress-activated Protein Kinase (SAPK)/Jun NH2-terminal Kinase (JNK) and p38: GERMINAL CENTER KINASE COUPLES TRAF2 TO MITOGEN- ACTIVATED PROTEIN KINASE/ERK KINASE KINASE 1 AND SAPK WHILE RECEPTOR INTERACTING PROTEIN ASSOCIATES WITH A MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE UPSTREAM OF MKK6 AND p38. J Biol Chem 273, 22681-22692 25. Devin, A., Cook, A., Lin, Y., Rodriguez, Y., Kelliher, M., and Liu, Z. (2000) The distinct roles of TRAF2 and RIP in IKK activation by TNF-R1: TRAF2 recruits IKK to TNF-R1 while RIP mediates IKK activation. Immunity 12, 419-429 26. Morgan, M. J., and Liu, Z. G. (2010) Reactive oxygen species in TNFalpha- induced signaling and cell death. Mol Cells 30, 1-12 27. Muppidi, J. R., Tschopp, J., and Siegel, R. M. (2004) Life and death decisions: secondary complexes and lipid rafts in TNF receptor family signal transduction. Immunity 21, 461-465 28. Sedger, L. M., and McDermott, M. F. (2014) TNF and TNF-receptors: From mediators of cell death and inflammation to therapeutic giants - past, present and future. Cytokine Growth Factor Rev 25, 453-472 29. Jeffrey, I. W., Bushell, M., Tilleray, V. J., Morley, S., and Clemens, M. J. (2002) Inhibition of protein synthesis in apoptosis: differential requirements by the tumor necrosis factor alpha family and a DNA-damaging agent for caspases and the double-stranded RNA-dependent protein kinase. Cancer Res 62, 2272- 2280 30. Desch, C., Dobrina, A., Aggarwal, B., and Harlan, J. (1990) Tumor necrosis factor-alpha exhibits greater proinflammatory activity than lymphotoxin in vitro. Blood 75, 2030-2034 31. Hou, J., Lam, F., Proud, C., and Wang, S. (2012) Targeting Mnks for cancer therapy. Oncotarget 3, 118-131 32. Ueda, T., Watanabe-Fukunaga, R., Fukuyama, H., Nagata, S., and Fukunaga, R. (2004) Mnk2 and Mnk1 are essential for constitutive and inducible phosphorylation of eukaryotic initiation factor 4E but not for cell growth or development. Mol Cell Biol 24, 6539-6549
320
33. Joshi, S., Kaur, S., Redig, A. J., Goldsborough, K., David, K., Ueda, T., Watanabe- Fukunaga, R., Baker, D. P., Fish, E. N., Fukunaga, R., and Platanias, L. C. (2009) Type I interferon (IFN)-dependent activation of Mnk1 and its role in the generation of growth inhibitory responses. Proc Natl Acad Sci U S A 106, 12097- 12102 34. Dolniak, B., Katsoulidis, E., Carayol, N., Altman, J. K., Redig, A. J., Tallman, M. S., Ueda, T., Watanabe-Fukunaga, R., Fukunaga, R., and Platanias, L. C. (2008) Regulation of arsenic trioxide-induced cellular responses by Mnk1 and Mnk2. J Biol Chem 283, 12034-12042 35. Buxade, M., Parra, J. L., Rousseau, S., Shpiro, N., Marquez, R., Morrice, N., Bain, J., Espel, E., and Proud, C. G. (2005) The Mnks are novel components in the control of TNF alpha biosynthesis and phosphorylate and regulate hnRNP A1. Immunity 23, 177-189 36. Clemens, M. J., Bushell, M., Jeffrey, I. W., Pain, V. M., and Morley, S. J. (2000) Translation initiation factor modifications and the regulation of protein synthesis in apoptotic cells. Cell Death Differ 7, 603-615 37. Burow, M. E., Weldon, C. B., Tang, Y., Navar, G. L., Krajewski, S., Reed, J. C., Hammond, T. G., Clejan, S., and Beckman, B. S. (1998) Differences in susceptibility to tumor necrosis factor alpha-induced apoptosis among MCF-7 breast cancer cell variants. Cancer Res 58, 4940-4946 38. Spriggs, K. A., Bushell, M., Mitchell, S. A., and Willis, A. E. (2005) Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death Differ 12, 585-591 39. Holcik, M., and Sonenberg, N. (2005) Translational control in stress and apoptosis. Nat Rev Mol Cell Biol 6, 318-327 40. Komar, A. A., and Hatzoglou, M. (2011) Cellular IRES-mediated translation: the war of ITAFs in pathophysiological states. Cell Cycle 10, 229-240 41. Stoneley, M., Chappell, S. A., Jopling, C. L., Dickens, M., MacFarlane, M., and Willis, A. E. (2000) c-Myc protein synthesis is initiated from the internal ribosome entry segment during apoptosis. Mol Cell Biol 20, 1162-1169 42. Shi, Y., Sharma, A., Wu, H., Lichtenstein, A., and Gera, J. (2005) Cyclin D1 and c-myc internal ribosome entry site (IRES)-dependent translation is regulated by AKT activity and enhanced by rapamycin through a p38 MAPK- and ERK- dependent pathway. J Biol Chem 280, 10964-10973 43. Holcik, M., Gordon, B. W., and Korneluk, R. G. (2003) The internal ribosome entry site-mediated translation of antiapoptotic protein XIAP is modulated by
321
the heterogeneous nuclear ribonucleoproteins C1 and C2. Mol Cell Biol 23, 280-288 44. Stoneley, M., Subkhankulova, T., Le Quesne, J. P., Coldwell, M. J., Jopling, C. L., Belsham, G. J., and Willis, A. E. (2000) Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Res 28, 687-694 45. Ray, P. S., Grover, R., and Das, S. (2006) Two internal ribosome entry sites mediate the translation of p53 isoforms. EMBO Rep 7, 404-410 46. Malbert-Colas, L., Ponnuswamy, A., Olivares-Illana, V., Tournillon, A. S., Naski, N., and Fahraeus, R. (2014) HDMX folds the nascent p53 mRNA following activation by the ATM kinase. Mol Cell 54, 500-511 47. Li, W., Thakor, N., Xu, E. Y., Huang, Y., Chen, C., Yu, R., Holcik, M., and Kong, A. N. (2010) An internal ribosomal entry site mediates redox-sensitive translation of Nrf2. Nucleic Acids Res 38, 778-788 48. Sen, R., and Baltimore, D. (1986) Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46, 705-716 49. DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E., and Karin, M. (1997) A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388, 548-554 50. Ghosh, S., and Hayden, M. S. (2008) New regulators of NF-kappaB in inflammation. Nat Rev Immunol 8, 837-848 51. Chen, L. F., and Greene, W. C. (2004) Shaping the nuclear action of NF-kappaB. Nat Rev Mol Cell Biol 5, 392-401 52. Yaron, A., Hatzubai, A., Davis, M., Lavon, I., Amit, S., Manning, A. M., Andersen, J. S., Mann, M., Mercurio, F., and Ben-Neriah, Y. (1998) Identification of the receptor component of the IkappaBalpha-ubiquitin ligase. Nature 396, 590- 594 53. Spencer, E., Jiang, J., and Chen, Z. J. (1999) Signal-induced ubiquitination of IκBα by the F-box protein Slimb/β-TrCP. Genes Dev 13, 284-294 54. Karin, M., and Ben-Neriah, Y. (2000) Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev Immunol 18, 621-663 55. Xiao, G., Harhaj, E. W., and Sun, S.-C. (2001) NF-κB-Inducing Kinase Regulates the Processing of NF-κB2 p100. Mol Cell 7, 401-409 56. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krähn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S.-C., and Karin, M. (2001) Activation by IKKα of a Second, Evolutionary Conserved, NF-κB Signaling Pathway. Science 293, 1495-1499
322
57. Xiao, G., Fong, A., and Sun, S.-C. (2004) Induction of p100 Processing by NF-κB- inducing Kinase Involves Docking IκB Kinase α (IKKα) to p100 and IKKα- mediated Phosphorylation. J Biol Chem 279, 30099-30105 58. Liang, C., Zhang, M., and Sun, S. C. (2006) beta-TrCP binding and processing of NF-kappaB2/p100 involve its phosphorylation at serines 866 and 870. Cell Signal 18, 1309-1317 59. Hoffmann, A., Levchenko, A., Scott, M. L., and Baltimore, D. (2002) The IkappaB-NF-kappaB signaling module: temporal control and selective gene activation. Science 298, 1241-1245 60. Heyninck, K., De Valck, D., Berghe, W. V., Van Criekinge, W., Contreras, R., Fiers, W., Haegeman, G., and Beyaert, R. (1999) The Zinc Finger Protein A20 Inhibits TNF-induced NF-κB–dependent Gene Expression by Interfering with an RIP- or TRAF2-mediated Transactivation Signal and Directly Binds to a Novel NF-κB–inhibiting Protein ABIN. J Cell Biol 145, 1471-1482 61. Nelson, D. E., Ihekwaba, A. E. C., Elliott, M., Johnson, J. R., Gibney, C. A., Foreman, B. E., Nelson, G., See, V., Horton, C. A., Spiller, D. G., Edwards, S. W., McDowell, H. P., Unitt, J. F., Sullivan, E., Grimley, R., Benson, N., Broomhead, D., Kell, D. B., and White, M. R. H. (2004) Oscillations in NF-κB Signaling Control the Dynamics of Gene Expression. Science 306, 704-708 62. Sung, M. H., Salvatore, L., De Lorenzi, R., Indrawan, A., Pasparakis, M., Hager, G. L., Bianchi, M. E., and Agresti, A. (2009) Sustained oscillations of NF-kappaB produce distinct genome scanning and gene expression profiles. PLoS One 4, e7163 63. Kinjyo, I., Hanada, T., Inagaki-Ohara, K., Mori, H., Aki, D., Ohishi, M., Yoshida, H., Kubo, M., and Yoshimura, A. (2002) SOCS1/JAB is a negative regulator of LPS-induced macrophage activation. Immunity 17, 583-591 64. Nakagawa, R., Naka, T., Tsutsui, H., Fujimoto, M., Kimura, A., Abe, T., Seki, E., Sato, S., Takeuchi, O., Takeda, K., Akira, S., Yamanishi, K., Kawase, I., Nakanishi, K., and Kishimoto, T. (2002) SOCS-1 participates in negative regulation of LPS responses. Immunity 17, 677-687 65. Tanaka, T., Grusby, M. J., and Kaisho, T. (2007) PDLIM2-mediated termination of transcription factor NF-kappaB activation by intranuclear sequestration and degradation of the p65 subunit. Nat Immunol 8, 584-591 66. Ryo, A., Suizu, F., Yoshida, Y., Perrem, K., Liou, Y.-C., Wulf, G., Rottapel, R., Yamaoka, S., and Lu, K. P. (2003) Regulation of NF-κB Signaling by Pin1- Dependent Prolyl Isomerization and Ubiquitin-Mediated Proteolysis of p65/RelA. Mol Cell 12, 1413-1426 323
67. Maine, G. N., Mao, X., Komarck, C. M., and Burstein, E. (2007) COMMD1 promotes the ubiquitination of NF-kappaB subunits through a cullin-containing ubiquitin ligase. EMBO J 26, 436-447 68. Liu, B., Yang, R., Wong, K. A., Getman, C., Stein, N., Teitell, M. A., Cheng, G., Wu, H., and Shuai, K. (2005) Negative regulation of NF-kappaB signaling by PIAS1. Mol Cell Biol 25, 1113-1123 69. Smale, S. T. (2011) Hierarchies of NF-kappaB target-gene regulation. Nat Immunol 12, 689-694 70. Ashburner, B. P., Westerheide, S. D., and Baldwin, A. S., Jr. (2001) The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol 21, 7065-7077 71. Gao, Z., Chiao, P., Zhang, X., Zhang, X., Lazar, M. A., Seto, E., Young, H. A., and Ye, J. (2005) Coactivators and corepressors of NF-kappaB in IkappaB alpha gene promoter. J Biol Chem 280, 21091-21098 72. Hoberg, J. E., Yeung, F., and Mayo, M. W. (2004) SMRT Derepression by the IκB Kinase α: A Prerequisite to NF-κB Transcription and Survival. Mol Cell 16, 245- 255 73. Hoberg, J. E., Popko, A. E., Ramsey, C. S., and Mayo, M. W. (2006) IκB Kinase α- Mediated Derepression of SMRT Potentiates Acetylation of RelA/p65 by p300. Mol Cell Biol 26, 457-471 74. Gao, C., Ho, C. C., Reineke, E., Lam, M., Cheng, X., Stanya, K. J., Liu, Y., Chakraborty, S., Shih, H. M., and Kao, H. Y. (2008) Histone deacetylase 7 promotes PML sumoylation and is essential for PML nuclear body formation. Mol Cell Biol 28, 5658-5667 75. Gao, C., Cheng, X., Lam, M., Liu, Y., Liu, Q., Chang, K. S., and Kao, H. Y. (2008) Signal-dependent regulation of transcription by histone deacetylase 7 involves recruitment to promyelocytic leukemia protein nuclear bodies. Mol Biol Cell 19, 3020-3027 76. Vermeulen, L., De Wilde, G., Van Damme, P., Vanden Berghe, W., and Haegeman, G. (2003) Transcriptional activation of the NF-kappaB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J 22, 1313- 1324 77. Soloaga, A., Thomson, S., Wiggin, G. R., Rampersaud, N., Dyson, M. H., Hazzalin, C. A., Mahadevan, L. C., and Arthur, J. S. (2003) MSK2 and MSK1 mediate the mitogen- and stress-induced phosphorylation of histone H3 and HMG-14. EMBO J 22, 2788-2797 324
78. Hoberg, J. E., Yeung, F., and Mayo, M. W. (2004) SMRT derepression by the IkappaB kinase alpha: a prerequisite to NF-kappaB transcription and survival. Mol Cell 16, 245-255 79. Barish, G. D., Yu, R. T., Karunasiri, M., Ocampo, C. B., Dixon, J., Benner, C., Dent, A. L., Tangirala, R. K., and Evans, R. M. (2010) Bcl-6 and NF-κB cistromes mediate opposing regulation of the innate immune response. Genes Dev 24, 2760-2765 80. Barish, Grant D., Yu, Ruth T., Karunasiri, Malith S., Becerra, D., Kim, J., Tseng, Tiffany W., Tai, L.-J., LeBlanc, M., Diehl, C., Cerchietti, L., Miller, Yury I., Witztum, Joseph L., Melnick, Ari M., Dent, Alexander L., Tangirala, Rajendra K., and Evans, Ronald M. (2012) The Bcl6-SMRT/NCoR Cistrome Represses Inflammation to Attenuate Atherosclerosis. Cell Metab 15, 554-562 81. Bolger, A. P., and Anker, S. D. (2000) Tumour necrosis factor in chronic heart failure: a peripheral view on pathogenesis, clinical manifestations and therapeutic implications. Drugs 60, 1245-1257 82. Sattar, N., McCarey, D. W., Capell, H., and McInnes, I. B. (2003) Explaining How “High-Grade” Systemic Inflammation Accelerates Vascular Risk in Rheumatoid Arthritis. Circulation 108, 2957-2963 83. Balkwill, F. (2009) Tumour necrosis factor and cancer. Nat Rev Cancer 9, 361- 371 84. Kim, S., Takahashi, H., Lin, W. W., Descargues, P., Grivennikov, S., Kim, Y., Luo, J. L., and Karin, M. (2009) Carcinoma-produced factors activate myeloid cells through TLR2 to stimulate metastasis. Nature 457, 102-106 85. Leibovich, S. J., Polverini, P. J., Shepard, H. M., Wiseman, D. M., Shively, V., and Nuseir, N. (1987) Macrophage-induced angiogenesis is mediated by tumour necrosis factor-alpha. Nature 329, 630-632 86. Szlosarek, P. W., Grimshaw, M. J., Kulbe, H., Wilson, J. L., Wilbanks, G. D., Burke, F., and Balkwill, F. R. (2006) Expression and regulation of tumor necrosis factor alpha in normal and malignant ovarian epithelium. Mol Cancer Ther 5, 382-390 87. Naylor, M. S., Stamp, G. W., Foulkes, W. D., Eccles, D., and Balkwill, F. R. (1993) Tumor necrosis factor and its receptors in human ovarian cancer. Potential role in disease progression. J Clin Invest 91, 2194-2206 88. Zins, K., Abraham, D., Sioud, M., and Aharinejad, S. (2007) Colon cancer cell- derived tumor necrosis factor-alpha mediates the tumor growth-promoting response in macrophages by up-regulating the colony-stimulating factor-1 pathway. Cancer Res 67, 1038-1045 325
89. Weldon, C. B., Burow, M. E., Rolfe, K. W., Clayton, J. L., Jaffe, B. M., and Beckman, B. S. (2001) NF-kappa B-mediated chemoresistance in breast cancer cells. Surgery 130, 143-150 90. Toubal, A., Clement, K., Fan, R., Ancel, P., Pelloux, V., Rouault, C., Veyrie, N., Hartemann, A., Treuter, E., and Venteclef, N. (2013) SMRT-GPS2 corepressor pathway dysregulation coincides with obesity-linked adipocyte inflammation. J Clin Invest 123, 362-379 91. Hotamisligil, G. S., Murray, D. L., Choy, L. N., and Spiegelman, B. M. (1994) Tumor necrosis factor alpha inhibits signaling from the insulin receptor. Proc Natl Acad Sci U S A 91, 4854-4858 92. Baud, V., and Karin, M. (2009) Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls. Nat Rev Drug Discov 8, 33-40 93. Pasparakis, M. (2009) Regulation of tissue homeostasis by NF-kappaB signalling: implications for inflammatory diseases. Nat Rev Immunol 9, 778-788 94. Clapier, C. R., and Cairns, B. R. (2009) The biology of chromatin remodeling complexes. Annu Rev Biochem 78, 273-304 95. Kouzarides, T. (2007) Chromatin Modifications and Their Function. Cell 128, 693-705 96. Xu, J., Wu, R. C., and O'Malley, B. W. (2009) Normal and cancer-related functions of the p160 steroid receptor co-activator (SRC) family. Nat Rev Cancer 9, 615-630 97. Perissi, V., Jepsen, K., Glass, C. K., and Rosenfeld, M. G. (2010) Deconstructing repression: evolving models of co-repressor action. Nat Rev Genet 11, 109-123 98. Chen, J. D., and Evans, R. M. (1995) A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377, 454-457 99. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C. K., and et al. (1995) Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377, 397-404 100. Ordentlich, P., Downes, M., Xie, W., Genin, A., Spinner, N. B., and Evans, R. M. (1999) Unique forms of human and mouse nuclear receptor corepressor SMRT. Proc Natl Acad Sci U S A 96, 2639-2644 101. Park, E. J., Schroen, D. J., Yang, M., Li, H., Li, L., and Chen, J. D. (1999) SMRTe, a silencing mediator for retinoid and thyroid hormone receptors-extended isoform that is more related to the nuclear receptor corepressor. Proc Natl Acad Sci U S A 96, 3519-3524
326
102. Perissi, V., and Rosenfeld, M. G. (2005) Controlling nuclear receptors: the circular logic of cofactor cycles. Nat Rev Mol Cell Biol 6, 542-554 103. Glass, C. K., and Saijo, K. (2010) Nuclear receptor transrepression pathways that regulate inflammation in macrophages and T cells. Nat Rev Immunol 10, 365-376 104. Stewart, M. D., and Wong, J. (2009) Nuclear receptor repression: regulatory mechanisms and physiological implications. Prog Mol Biol Transl Sci 87, 235- 259 105. Cohen, R. N., Putney, A., Wondisford, F. E., and Hollenberg, A. N. (2000) The nuclear corepressors recognize distinct nuclear receptor complexes. Mol Endocrinol 14, 900-914 106. Graham, J. D., Bain, D. L., Richer, J. K., Jackson, T. A., Tung, L., and Horwitz, K. B. (2000) Nuclear receptor conformation, coregulators, and tamoxifen- resistant breast cancer. Steroids 65, 579-584 107. Graham, J. D., Bain, D. L., Richer, J. K., Jackson, T. A., Tung, L., and Horwitz, K. B. (2000) Thoughts on tamoxifen resistant breast cancer. Are coregulators the answer or just a red herring? J Steroid Biochem Mol Biol 74, 255-259 108. Smith, C. L., Nawaz, Z., and O'Malley, B. W. (1997) Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4- hydroxytamoxifen. Mol Endocrinol 11, 657-666 109. Ogawa, S., Lozach, J., Benner, C., Pascual, G., Tangirala, R. K., Westin, S., Hoffmann, A., Subramaniam, S., David, M., Rosenfeld, M. G., and Glass, C. K. (2005) Molecular determinants of crosstalk between nuclear receptors and toll-like receptors. Cell 122, 707-721 110. Pascual, G., Fong, A. L., Ogawa, S., Gamliel, A., Li, A. C., Perissi, V., Rose, D. W., Willson, T. M., Rosenfeld, M. G., and Glass, C. K. (2005) A SUMOylation- dependent pathway mediates transrepression of inflammatory response genes by PPAR-gamma. Nature 437, 759-763 111. Blaschke, F., Takata, Y., Caglayan, E., Collins, A., Tontonoz, P., Hsueh, W. A., and Tangirala, R. K. (2006) A nuclear receptor corepressor-dependent pathway mediates suppression of cytokine-induced C-reactive protein gene expression by liver X receptor. Circ Res 99, e88-99 112. Ghisletti, S., Huang, W., Ogawa, S., Pascual, G., Lin, M. E., Willson, T. M., Rosenfeld, M. G., and Glass, C. K. (2007) Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARgamma. Mol Cell 25, 57-70
327
113. Ghisletti, S., Huang, W., Jepsen, K., Benner, C., Hardiman, G., Rosenfeld, M. G., and Glass, C. K. (2009) Cooperative NCoR/SMRT interactions establish a corepressor-based strategy for integration of inflammatory and anti- inflammatory signaling pathways. Genes Dev 23, 681-693 114. Perissi, V., Scafoglio, C., Zhang, J., Ohgi, K. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (2008) TBL1 and TBLR1 Phosphorylation on Regulated Gene Promoters Overcomes Dual CtBP and NCoR/SMRT Transcriptional Repression Checkpoints. Mol Cell 29, 755-766 115. Zhang, J., Guenther, M. G., Carthew, R. W., and Lazar, M. A. (1998) Proteasomal regulation of nuclear receptor corepressor-mediated repression. Genes Dev 12, 1775-1780 116. Hsu, K. S., and Kao, H. Y. (2013) beta-Transducin repeat-containing protein 1 (beta-TrCP1)-mediated silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) protein degradation promotes tumor necrosis factor alpha (TNFalpha)-induced inflammatory gene expression. J Biol Chem 288, 25375-25386 117. Hermanson, O., Jepsen, K., and Rosenfeld, M. G. (2002) N-CoR controls differentiation of neural stem cells into astrocytes. Nature 419, 934-939 118. Hong, S. H., and Privalsky, M. L. (2000) The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export. Mol Cell Biol 20, 6612-6625 119. Ann, E. J., Kim, H. Y., Seo, M. S., Mo, J. S., Kim, M. Y., Yoon, J. H., Ahn, J. S., and Park, H. S. (2012) Wnt5a controls Notch1 signaling through CaMKII-mediated degradation of the SMRT corepressor protein. J Biol Chem 287, 36814-36829 120. Jang, M. K., Goo, Y. H., Sohn, Y. C., Kim, Y. S., Lee, S.-K., Kang, H., Cheong, J., and Lee, J. W. (2001) Ca2+/Calmodulin-dependent Protein Kinase IV Stimulates Nuclear Factor-κB Transactivation via Phosphorylation of the p65 Subunit. J Biol Chem 276, 20005-20010 121. Stanya, K. J., Liu, Y., Means, A. R., and Kao, H. Y. (2008) Cdk2 and Pin1 negatively regulate the transcriptional corepressor SMRT. J Cell Biol 183, 49-61 122. Zhou, Y., Gross, W., Hong, S. H., and Privalsky, M. L. (2001) The SMRT corepressor is a target of phosphorylation by protein kinase CK2 (casein kinase II). Mol Cell Biochem 220, 1-13 123. Jepsen, K., Gleiberman, A. S., Shi, C., Simon, D. I., and Rosenfeld, M. G. (2008) Cooperative regulation in development by SMRT and FOXP1. Genes Dev 22, 740-745
328
124. Jepsen, K., Hermanson, O., Onami, T. M., Gleiberman, A. S., Lunyak, V., McEvilly, R. J., Kurokawa, R., Kumar, V., Liu, F., Seto, E., Hedrick, S. M., Mandel, G., Glass, C. K., Rose, D. W., and Rosenfeld, M. G. (2000) Combinatorial Roles of the Nuclear Receptor Corepressor in Transcription and Development. Cell 102, 753-763 125. Jonas, B. A., and Privalsky, M. L. (2004) SMRT and N-CoR Corepressors Are Regulated by Distinct Kinase Signaling Pathways. J Biol Chem 279, 54676-54686 126. Raghav, Sunil K., Waszak, Sebastian M., Krier, I., Gubelmann, C., Isakova, A., Mikkelsen, Tarjei S., and Deplancke, B. (2012) Integrative Genomics Identifies the Corepressor SMRT as a Gatekeeper of Adipogenesis through the Transcription Factors C/EBPβ and KAISO. Mol Cell 46, 335-350 127. Privalsky, M. L. (2004) The role of corepressors in transcriptional regulation by nuclear hormone receptors. Annu Rev Physiol 66, 315-360 128. Watson, P. J., Fairall, L., and Schwabe, J. W. (2012) Nuclear hormone receptor co-repressors: structure and function. Mol Cell Endocrinol 348, 440-449 129. Singh, G. P., Ganapathi, M., and Dash, D. (2007) Role of intrinsic disorder in transient interactions of hub proteins. Proteins 66, 761-765 130. Guenther, M. G., Barak, O., and Lazar, M. A. (2001) The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Mol Cell Biol 21, 6091-6101 131. Codina, A., Love, J. D., Li, Y., Lazar, M. A., Neuhaus, D., and Schwabe, J. W. R. (2005) Structural insights into the interaction and activation of histone deacetylase 3 by nuclear receptor corepressors. Proc Natl Acad Sci U S A 102, 6009-6014 132. Yu, J., Li, Y., Ishizuka, T., Guenther, M. G., and Lazar, M. A. (2003) A SANT motif in the SMRT corepressor interprets the histone code and promotes histone deacetylation. EMBO J 22, 3403-3410 133. Li, H., Leo, C., Schroen, D. J., and Chen, J. D. (1997) Characterization of receptor interaction and transcriptional repression by the corepressor SMRT. Mol Endocrinol 11, 2025-2037 134. Fischle, W., Dequiedt, F., Hendzel, M. J., Guenther, M. G., Lazar, M. A., Voelter, W., and Verdin, E. (2002) Enzymatic Activity Associated with Class II HDACs Is Dependent on a Multiprotein Complex Containing HDAC3 and SMRT/N-CoR. Mol Cell 9, 45-57 135. Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado De Oliveira, R., Leid, M., McBurney, M. W., and Guarente, L. (2004) Sirt1 promotes
329
fat mobilization in white adipocytes by repressing PPAR-gamma. Nature 429, 771-776 136. Kao, H. Y., Downes, M., Ordentlich, P., and Evans, R. M. (2000) Isolation of a novel histone deacetylase reveals that class I and class II deacetylases promote SMRT-mediated repression. Genes Dev 14, 55-66 137. Downes, M., Burke, L. J., Bailey, P. J., and Muscat, G. E. O. (1996) Two Receptor Interaction Domains in the Corepressor, N-CoR/RIP13, Are Required for an Efficient Interaction with Rev-erbAα and RVR: Physical Association is Dependent on the E Region of the Orphan Receptors. Nucleic Acids Res 24, 4379-4386 138. Webb, P., Anderson, C. M., Valentine, C., Nguyen, P., Marimuthu, A., West, B. L., Baxter, J. D., and Kushner, P. J. (2000) The nuclear receptor corepressor (N- CoR) contains three isoleucine motifs (I/LXXII) that serve as receptor interaction domains (IDs). Mol Endocrinol 14, 1976-1985 139. Hu, X., and Lazar, M. A. (1999) The CoRNR motif controls the recruitment of corepressors by nuclear hormone receptors. Nature 402, 93-96 140. Nagy, L., Kao, H. Y., Love, J. D., Li, C., Banayo, E., Gooch, J. T., Krishna, V., Chatterjee, K., Evans, R. M., and Schwabe, J. W. (1999) Mechanism of corepressor binding and release from nuclear hormone receptors. Genes Dev 13, 3209-3216 141. Perissi, V., Staszewski, L. M., McInerney, E. M., Kurokawa, R., Krones, A., Rose, D. W., Lambert, M. H., Milburn, M. V., Glass, C. K., and Rosenfeld, M. G. (1999) Molecular determinants of nuclear receptor-corepressor interaction. Genes Dev 13, 3198-3208 142. Guenther, M. G., Lane, W. S., Fischle, W., Verdin, E., Lazar, M. A., and Shiekhattar, R. (2000) A core SMRT corepressor complex containing HDAC3 and TBL1, a WD40-repeat protein linked to deafness. Genes Dev 14, 1048-1057 143. Li, J., Wang, J., Wang, J., Nawaz, Z., Liu, J. M., Qin, J., and Wong, J. (2000) Both corepressor proteins SMRT and N-CoR exist in large protein complexes containing HDAC3. EMBO J 19, 4342-4350 144. Wen, Y. D., Perissi, V., Staszewski, L. M., Yang, W. M., Krones, A., Glass, C. K., Rosenfeld, M. G., and Seto, E. (2000) The histone deacetylase-3 complex contains nuclear receptor corepressors. Proc Natl Acad Sci U S A 97, 7202-7207 145. Oberoi, J., Fairall, L., Watson, P. J., Yang, J. C., Czimmerer, Z., Kampmann, T., Goult, B. T., Greenwood, J. A., Gooch, J. T., Kallenberger, B. C., Nagy, L., Neuhaus, D., and Schwabe, J. W. (2011) Structural basis for the assembly of
330
the SMRT/NCoR core transcriptional repression machinery. Nat Struct Mol Biol 18, 177-184 146. Varlakhanova, N., Hahm, J. B., and Privalsky, M. L. (2011) Regulation of SMRT corepressor dimerization and composition by MAP kinase phosphorylation. Mol Cell Endocrinol 332, 180-188 147. Zhang, X., Ozawa, Y., Lee, H., Wen, Y. D., Tan, T. H., Wadzinski, B. E., and Seto, E. (2005) Histone deacetylase 3 (HDAC3) activity is regulated by interaction with protein serine/threonine phosphatase 4. Genes Dev 19, 827-839 148. Yang, W. M., Tsai, S. C., Wen, Y. D., Fejer, G., and Seto, E. (2002) Functional domains of histone deacetylase-3. J Biol Chem 277, 9447-9454 149. Glass, C. K., and Rosenfeld, M. G. (2000) The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14, 121-141 150. Nolte, R. T., Wisely, G. B., Westin, S., Cobb, J. E., Lambert, M. H., Kurokawa, R., Rosenfeld, M. G., Willson, T. M., Glass, C. K., and Milburn, M. V. (1998) Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-gamma. Nature 395, 137-143 151. Heery, D. M., Kalkhoven, E., Hoare, S., and Parker, M. G. (1997) A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387, 733-736 152. Xu, H. E., Stanley, T. B., Montana, V. G., Lambert, M. H., Shearer, B. G., Cobb, J. E., McKee, D. D., Galardi, C. M., Plunket, K. D., Nolte, R. T., Parks, D. J., Moore, J. T., Kliewer, S. A., Willson, T. M., and Stimmel, J. B. (2002) Structural basis for antagonist-mediated recruitment of nuclear co-repressors by PPARalpha. Nature 415, 813-817 153. Phelan, C. A., Gampe, R. T., Jr., Lambert, M. H., Parks, D. J., Montana, V., Bynum, J., Broderick, T. M., Hu, X., Williams, S. P., Nolte, R. T., and Lazar, M. A. (2010) Structure of Rev-erbalpha bound to N-CoR reveals a unique mechanism of nuclear receptor-co-repressor interaction. Nat Struct Mol Biol 17, 808-814 154. Wang, L., Zuercher, W. J., Consler, T. G., Lambert, M. H., Miller, A. B., Orband- Miller, L. A., McKee, D. D., Willson, T. M., and Nolte, R. T. (2006) X-ray crystal structures of the estrogen-related receptor-gamma ligand binding domain in three functional states reveal the molecular basis of small molecule regulation. J Biol Chem 281, 37773-37781 155. Niu, H., Cattoretti, G., and Dalla-Favera, R. (2003) BCL6 controls the expression of the B7-1/CD80 costimulatory receptor in germinal center B cells. J Exp Med 198, 211-221
331
156. Allman, D., Jain, A., Dent, A., Maile, R. R., Selvaggi, T., Kehry, M. R., and Staudt, L. M. (1996) BCL-6 expression during B-cell activation. Blood 87, 5257-5268 157. Dhordain, P., Lin, R. J., Quief, S., Lantoine, D., Kerckaert, J. P., Evans, R. M., and Albagli, O. (1998) The LAZ3(BCL-6) oncoprotein recruits a SMRT/mSIN3A/histone deacetylase containing complex to mediate transcriptional repression. Nucleic Acids Res 26, 4645-4651 158. Ahmad, K. F., Melnick, A., Lax, S., Bouchard, D., Liu, J., Kiang, C. L., Mayer, S., Takahashi, S., Licht, J. D., and Prive, G. G. (2003) Mechanism of SMRT corepressor recruitment by the BCL6 BTB domain. Mol Cell 12, 1551-1564 159. Huynh, K. D., Fischle, W., Verdin, E., and Bardwell, V. J. (2000) BCoR, a novel corepressor involved in BCL-6 repression. Genes Dev 14, 1810-1823 160. le Maire, A., Teyssier, C., Erb, C., Grimaldi, M., Alvarez, S., de Lera, A. R., Balaguer, P., Gronemeyer, H., Royer, C. A., Germain, P., and Bourguet, W. (2010) A unique secondary-structure switch controls constitutive gene repression by retinoic acid receptor. Nat Struct Mol Biol 17, 801-807 161. Cerchietti, L. C., Yang, S. N., Shaknovich, R., Hatzi, K., Polo, J. M., Chadburn, A., Dowdy, S. F., and Melnick, A. (2009) A peptomimetic inhibitor of BCL6 with potent antilymphoma effects in vitro and in vivo. Blood 113, 3397-3405 162. Sande, S., and Privalsky, M. L. (1996) Identification of TRACs (T3 receptor- associating cofactors), a family of cofactors that associate with, and modulate the activity of, nuclear hormone receptors. Mol Endocrinol 10, 813-825 163. Goodson, M. L., Jonas, B. A., and Privalsky, M. L. (2005) Alternative mRNA Splicing of SMRT Creates Functional Diversity by Generating Corepressor Isoforms with Different Affinities for Different Nuclear Receptors. J Biol Chem 280, 7493-7503 164. Short, S., Malartre, M., and Sharpe, C. (2005) SMRT has tissue-specific isoform profiles that include a form containing one CoRNR box. Biochem Biophys Res Commun 334, 845-852 165. Malartre, M., Short, S., and Sharpe, C. (2004) Alternative splicing generates multiple SMRT transcripts encoding conserved repressor domains linked to variable transcription factor interaction domains. Nucleic Acids Res 32, 4676- 4686 166. Goodson, M. L., Mengeling, B. J., Jonas, B. A., and Privalsky, M. L. (2011) Alternative mRNA splicing of corepressors generates variants that play opposing roles in adipocyte differentiation. J Biol Chem 286, 44988-44999 167. Côté, S., McNamara, S., Brambilla, D., Bianchini, A., Rizzo, G., del Rincón, S. V., Grignani, F., Nervi, C., and Miller, W. H. (2004) Expression of SMRTβ promotes 332
ligand-induced activation of mutated and wild-type retinoid receptors. Blood 104, 4226-4235 168. Goodson, M., Jonas, B. A., and Privalsky, M. A. (2005) Corepressors: custom tailoring and alterations while you wait. Nucl Recept Signal 3, e003 169. Hong, S. H., Wong, C. W., and Privalsky, M. L. (1998) Signaling by tyrosine kinases negatively regulates the interaction between transcription factors and SMRT (silencing mediator of retinoic acid and thyroid hormone receptor) corepressor. Mol Endocrinol 12, 1161-1171 170. Hoberg, J. E., Popko, A. E., Ramsey, C. S., and Mayo, M. W. (2006) IkappaB kinase alpha-mediated derepression of SMRT potentiates acetylation of RelA/p65 by p300. Mol Cell Biol 26, 457-471 171. Fernandez-Majada, V., Aguilera, C., Villanueva, A., Vilardell, F., Robert- Moreno, A., Aytes, A., Real, F. X., Capella, G., Mayo, M. W., Espinosa, L., and Bigas, A. (2007) Nuclear IKK activity leads to dysregulated notch-dependent gene expression in colorectal cancer. Proc Natl Acad Sci U S A 104, 276-281 172. McKenzie, G. J., Stevenson, P., Ward, G., Papadia, S., Bading, H., Chawla, S., Privalsky, M., and Hardingham, G. E. (2005) Nuclear Ca2+ and CaM kinase IV specify hormonal- and Notch-responsiveness. J Neurochem 93, 171-185 173. Soriano, F. X., Chawla, S., Skehel, P., and Hardingham, G. E. (2013) SMRT- mediated co-shuttling enables export of class IIa HDACs independent of their CaM kinase phosphorylation sites. J Neurochem 124, 26-35 174. Jang, M. K., Goo, Y. H., Sohn, Y. C., Kim, Y. S., Lee, S. K., Kang, H., Cheong, J., and Lee, J. W. (2001) Ca2+/calmodulin-dependent protein kinase IV stimulates nuclear factor-kappa B transactivation via phosphorylation of the p65 subunit. J Biol Chem 276, 20005-20010 175. Yoon, H. G., Choi, Y., Cole, P. A., and Wong, J. (2005) Reading and function of a histone code involved in targeting corepressor complexes for repression. Mol Cell Biol 25, 324-335 176. Karagianni, P., and Wong, J. (2007) HDAC3: taking the SMRT-N-CoRrect road to repression. Oncogene 26, 5439-5449 177. Jiang, J., Li, N., Wang, X., Lu, Y., Bi, Y., Wang, W., Li, X., and Ning, G. (2010) Aberrant expression and modification of silencing mediator of retinoic acid and thyroid hormone receptors involved in the pathogenesis of tumoral cortisol resistance. Endocrinology 151, 3697-3705 178. Zhou, R., Li, X., Hu, G., Gong, A. Y., Drescher, K. M., and Chen, X. M. (2012) miR- 16 targets transcriptional corepressor SMRT and modulates NF-kappaB- regulated transactivation of interleukin-8 gene. PLoS One 7, e30772 333
179. Jepsen, K., Solum, D., Zhou, T., McEvilly, R. J., Kim, H. J., Glass, C. K., Hermanson, O., and Rosenfeld, M. G. (2007) SMRT-mediated repression of an H3K27 demethylase in progression from neural stem cell to neuron. Nature 450, 415-419 180. Sutanto, M. M., Ferguson, K. K., Sakuma, H., Ye, H., Brady, M. J., and Cohen, R. N. (2010) The Silencing Mediator of Retinoid and Thyroid Hormone Receptors (SMRT) Regulates Adipose Tissue Accumulation and Adipocyte Insulin Sensitivity in Vivo. J Biol Chem 285, 18485-18495 181. Nofsinger, R. R., Li, P., Hong, S.-H., Jonker, J. W., Barish, G. D., Ying, H., Cheng, S.-y., LeBlanc, M., Xu, W., Pei, L., Kang, Y.-J., Nelson, M., Downes, M., Yu, R. T., Olefsky, J. M., Lee, C.-H., and Evans, R. M. (2008) SMRT repression of nuclear receptors controls the adipogenic set point and metabolic homeostasis. Proc Natl Acad Sci U S A 105, 20021-20026 182. Pei, L., Leblanc, M., Barish, G., Atkins, A., Nofsinger, R., Whyte, J., Gold, D., He, M., Kawamura, K., Li, H. R., Downes, M., Yu, R. T., Powell, H. C., Lingrel, J. B., and Evans, R. M. (2011) Thyroid hormone receptor repression is linked to type I pneumocyte-associated respiratory distress syndrome. Nat Med 17, 1466- 1472 183. Fang, S., Suh, J. M., Atkins, A. R., Hong, S. H., Leblanc, M., Nofsinger, R. R., Yu, R. T., Downes, M., and Evans, R. M. (2011) Corepressor SMRT promotes oxidative phosphorylation in adipose tissue and protects against diet-induced obesity and insulin resistance. Proc Natl Acad Sci U S A 108, 3412-3417 184. Reilly, S. M., Bhargava, P., Liu, S., Gangl, M. R., Gorgun, C., Nofsinger, R. R., Evans, R. M., Qi, L., Hu, F. B., and Lee, C.-H. (2010) Nuclear Receptor Corepressor SMRT Regulates Mitochondrial Oxidative Metabolism and Mediates Aging-Related Metabolic Deterioration. Cell Metab 12, 643-653 185. Huang, W., Ghisletti, S., Perissi, V., Rosenfeld, M. G., and Glass, C. K. (2009) Transcriptional Integration of TLR2 and TLR4 Signaling at the NCoR Derepression Checkpoint. Mol Cell 35, 48-57 186. Vokes, S. A., Ji, H., Wong, W. H., and McMahon, A. P. (2008) A genome-scale analysis of the cis-regulatory circuitry underlying sonic hedgehog-mediated patterning of the mammalian limb. Genes Dev 22, 2651-2663 187. Dietzl, G., Chen, D., Schnorrer, F., Su, K. C., Barinova, Y., Fellner, M., Gasser, B., Kinsey, K., Oppel, S., Scheiblauer, S., Couto, A., Marra, V., Keleman, K., and Dickson, B. J. (2007) A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151-156
334
188. Pospisilik, J. A., Schramek, D., Schnidar, H., Cronin, S. J., Nehme, N. T., Zhang, X., Knauf, C., Cani, P. D., Aumayr, K., Todoric, J., Bayer, M., Haschemi, A., Puviindran, V., Tar, K., Orthofer, M., Neely, G. G., Dietzl, G., Manoukian, A., Funovics, M., Prager, G., Wagner, O., Ferrandon, D., Aberger, F., Hui, C. C., Esterbauer, H., and Penninger, J. M. (2010) Drosophila genome-wide obesity screen reveals hedgehog as a determinant of brown versus white adipose cell fate. Cell 140, 148-160 189. Mottis, A., Mouchiroud, L., and Auwerx, J. (2013) Emerging roles of the corepressors NCoR1 and SMRT in homeostasis. Genes Dev 27, 819-835 190. de The, H., Chomienne, C., Lanotte, M., Degos, L., and Dejean, A. (1990) The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha gene to a novel transcribed locus. Nature 347, 558-561 191. Goddard, A., Borrow, J., Freemont, P., and Solomon, E. (1991) Characterization of a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science 254, 1371-1374 192. Kakizuka, A., Miller Jr, W. H., Umesono, K., Warrell Jr, R. P., Frankel, S. R., Murty, V. V. V. S., Dmitrovsky, E., and Evans, R. M. (1991) Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RARα with a novel putative transcription factor, PML. Cell 66, 663-674 193. Salomoni, P., Ferguson, B. J., Wyllie, A. H., and Rich, T. (2008) New insights into the role of PML in tumour suppression. Cell Res 18, 622-640 194. Everett, R. D. (2001) DNA viruses and viral proteins that interact with PML nuclear bodies. Oncogene 20, 7266-7273 195. Chelbi-Alix, M. K., Pelicano, L., Quignon, F., Koken, M. H., Venturini, L., Stadler, M., Pavlovic, J., Degos, L., and de The, H. (1995) Induction of the PML protein by interferons in normal and APL cells. Leukemia 9, 2027-2033 196. Regad, T., and Chelbi-Alix, M. K. (2001) Role and fate of PML nuclear bodies in response to interferon and viral infections. Oncogene 20, 7274-7286 197. Stadler, M., Chelbi-Alix, M. K., Koken, M. H., Venturini, L., Lee, C., Saib, A., Quignon, F., Pelicano, L., Guillemin, M. C., Schindler, C., and et al. (1995) Transcriptional induction of the PML growth suppressor gene by interferons is mediated through an ISRE and a GAS element. Oncogene 11, 2565-2573 198. Cheng, X., Liu, Y., Chu, H., and Kao, H. Y. (2012) Promyelocytic leukemia protein (PML) regulates endothelial cell network formation and migration in response to tumor necrosis factor alpha (TNFalpha) and interferon alpha (IFNalpha). J Biol Chem 287, 23356-23367
335
199. Borden, K. L., Boddy, M. N., Lally, J., O'Reilly, N. J., Martin, S., Howe, K., Solomon, E., and Freemont, P. S. (1995) The solution structure of the RING finger domain from the acute promyelocytic leukaemia proto-oncoprotein PML. EMBO J 14, 1532-1541 200. Jensen, K., Shiels, C., and Freemont, P. S. (2001) PML protein isoforms and the RBCC/TRIM motif. Oncogene 20, 7223-7233 201. Zhu, Q., Pao, G. M., Huynh, A. M., Suh, H., Tonnu, N., Nederlof, P. M., Gage, F. H., and Verma, I. M. (2011) BRCA1 tumour suppression occurs via heterochromatin-mediated silencing. Nature 477, 179-184 202. Deng, C. X. (2006) BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Res 34, 1416-1426 203. Cheng, X., and Kao, H. Y. (2012) Post-translational modifications of PML: consequences and implications. Front Oncol 2, 210 204. Fagioli, M., Alcalay, M., Tomassoni, L., Ferrucci, P. F., Mencarelli, A., Riganelli, D., Grignani, F., Pozzan, T., Nicoletti, I., Grignani, F., and Pelicci, P. G. (1998) Cooperation between the RING + B1-B2 and coiled-coil domains of PML is necessary for its effects on cell survival. Oncogene 16, 2905-2913 205. Shen, T. H., Lin, H. K., Scaglioni, P. P., Yung, T. M., and Pandolfi, P. P. (2006) The mechanisms of PML-nuclear body formation. Mol Cell 24, 331-339 206. Fogal, V., Gostissa, M., Sandy, P., Zacchi, P., Sternsdorf, T., Jensen, K., Pandolfi, P. P., Will, H., Schneider, C., and Del Sal, G. (2000) Regulation of p53 activity in nuclear bodies by a specific PML isoform. EMBO J 19, 6185-6195 207. Guo, A., Salomoni, P., Luo, J., Shih, A., Zhong, S., Gu, W., and Pandolfi, P. P. (2000) The function of PML in p53-dependent apoptosis. Nat Cell Biol 2, 730- 736 208. Mallette, F. A., Goumard, S., Gaumont-Leclerc, M. F., Moiseeva, O., and Ferbeyre, G. (2004) Human fibroblasts require the Rb family of tumor suppressors, but not p53, for PML-induced senescence. Oncogene 23, 91-99 209. Vernier, M., Bourdeau, V., Gaumont-Leclerc, M. F., Moiseeva, O., Begin, V., Saad, F., Mes-Masson, A. M., and Ferbeyre, G. (2011) Regulation of E2Fs and senescence by PML nuclear bodies. Genes Dev 25, 41-50 210. Wu, W. S., Vallian, S., Seto, E., Yang, W. M., Edmondson, D., Roth, S., and Chang, K. S. (2001) The growth suppressor PML represses transcription by functionally and physically interacting with histone deacetylases. Mol Cell Biol 21, 2259-2268
336
211. Boisvert, F. M., Hendzel, M. J., and Bazett-Jones, D. P. (2000) Promyelocytic leukemia (PML) nuclear bodies are protein structures that do not accumulate RNA. J Cell Biol 148, 283-292 212. Dellaire, G., and Bazett-Jones, D. P. (2004) PML nuclear bodies: dynamic sensors of DNA damage and cellular stress. Bioessays 26, 963-977 213. Lallemand-Breitenbach, V., and de Thé, H. (2010) PML Nuclear Bodies. Cold Spring Harb Perspect Biol 2, a000661 214. Bernardi, R., and Pandolfi, P. P. (2003) Role of PML and the PML-nuclear body in the control of programmed cell death. Oncogene 22, 9048-9057 215. Kumar, P. P., Bischof, O., Purbey, P. K., Notani, D., Urlaub, H., Dejean, A., and Galande, S. (2007) Functional interaction between PML and SATB1 regulates chromatin-loop architecture and transcription of the MHC class I locus. Nat Cell Biol 9, 45-56 216. Sun, Y., Durrin, L. K., and Krontiris, T. G. (2003) Specific interaction of PML bodies with the TP53 locus in Jurkat interphase nuclei. Genomics 82, 250-252 217. von Mikecz, A., Zhang, S., Montminy, M., Tan, E. M., and Hemmerich, P. (2000) CREB-binding protein (CBP)/p300 and RNA polymerase II colocalize in transcriptionally active domains in the nucleus. J Cell Biol 150, 265-273 218. Kiesslich, A., von Mikecz, A., and Hemmerich, P. (2002) Cell cycle-dependent association of PML bodies with sites of active transcription in nuclei of mammalian cells. J Struct Biol 140, 167-179 219. Lechner, M. S., Begg, G. E., Speicher, D. W., and Rauscher, F. J., 3rd. (2000) Molecular determinants for targeting heterochromatin protein 1-mediated gene silencing: direct chromoshadow domain-KAP-1 corepressor interaction is essential. Mol Cell Biol 20, 6449-6465 220. Seeler, J. S., Marchio, A., Sitterlin, D., Transy, C., and Dejean, A. (1998) Interaction of SP100 with HP1 proteins: a link between the promyelocytic leukemia-associated nuclear bodies and the chromatin compartment. Proc Natl Acad Sci U S A 95, 7316-7321 221. Bernardi, R., and Pandolfi, P. P. (2007) Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies. Nat Rev Mol Cell Biol 8, 1006-1016 222. D'Orazi, G., Cecchinelli, B., Bruno, T., Manni, I., Higashimoto, Y., Saito, S., Gostissa, M., Coen, S., Marchetti, A., Del Sal, G., Piaggio, G., Fanciulli, M., Appella, E., and Soddu, S. (2002) Homeodomain-interacting protein kinase-2 phosphorylates p53 at Ser 46 and mediates apoptosis. Nat Cell Biol 4, 11-19
337
223. Hofmann, T. G., Moller, A., Sirma, H., Zentgraf, H., Taya, Y., Droge, W., Will, H., and Schmitz, M. L. (2002) Regulation of p53 activity by its interaction with homeodomain-interacting protein kinase-2. Nat Cell Biol 4, 1-10 224. Regad, T., Bellodi, C., Nicotera, P., and Salomoni, P. (2009) The tumor suppressor Pml regulates cell fate in the developing neocortex. Nat Neurosci 12, 132-140 225. Trotman, L. C., Alimonti, A., Scaglioni, P. P., Koutcher, J. A., Cordon-Cardo, C., and Pandolfi, P. P. (2006) Identification of a tumour suppressor network opposing nuclear Akt function. Nature 441, 523-527 226. Lee, Y. R., Yuan, W. C., Ho, H. C., Chen, C. H., Shih, H. M., and Chen, R. H. (2010) The Cullin 3 substrate adaptor KLHL20 mediates DAPK ubiquitination to control interferon responses. EMBO J 29, 1748-1761 227. Bernardi, R., Scaglioni, P. P., Bergmann, S., Horn, H. F., Vousden, K. H., and Pandolfi, P. P. (2004) PML regulates p53 stability by sequestering Mdm2 to the nucleolus. Nat Cell Biol 6, 665-672 228. Song, M. S., Salmena, L., Carracedo, A., Egia, A., Lo-Coco, F., Teruya-Feldstein, J., and Pandolfi, P. P. (2008) The deubiquitinylation and localization of PTEN are regulated by a HAUSP-PML network. Nature 455, 813-817 229. Langley, E., Pearson, M., Faretta, M., Bauer, U. M., Frye, R. A., Minucci, S., Pelicci, P. G., and Kouzarides, T. (2002) Human SIR2 deacetylates p53 and antagonizes PML/p53-induced cellular senescence. EMBO J 21, 2383-2396 230. Culjkovic, B., Topisirovic, I., Skrabanek, L., Ruiz-Gutierrez, M., and Borden, K. L. (2006) eIF4E is a central node of an RNA regulon that governs cellular proliferation. J Cell Biol 175, 415-426 231. Lai, H. K., and Borden, K. L. (2000) The promyelocytic leukemia (PML) protein suppresses cyclin D1 protein production by altering the nuclear cytoplasmic distribution of cyclin D1 mRNA. Oncogene 19, 1623-1634 232. Iborra, F. J., Jackson, D. A., and Cook, P. R. (2001) Coupled transcription and translation within nuclei of mammalian cells. Science 293, 1139-1142 233. Strudwick, S., and Borden, K. L. (2002) The emerging roles of translation factor eIF4E in the nucleus. Differentiation 70, 10-22 234. Renner, F., Moreno, R., and Schmitz, M. L. (2010) SUMOylation-dependent localization of IKKepsilon in PML nuclear bodies is essential for protection against DNA-damage-triggered cell death. Mol Cell 37, 503-515 235. Malloy, M. T., McIntosh, D. J., Walters, T. S., Flores, A., Goodwin, J. S., and Arinze, I. J. (2013) Trafficking of the transcription factor Nrf2 to promyelocytic
338
leukemia-nuclear bodies: implications for degradation of NRF2 in the nucleus. J Biol Chem 288, 14569-14583 236. Chang, C.-C., Naik, Mandar T., Huang, Y.-S., Jeng, J.-C., Liao, P.-H., Kuo, H.-Y., Ho, C.-C., Hsieh, Y.-L., Lin, C.-H., Huang, N.-J., Naik, Nandita M., Kung, Camy C. H., Lin, S.-Y., Chen, R.-H., Chang, K.-S., Huang, T.-H., and Shih, H.-M. (2011) Structural and Functional Roles of Daxx SIM Phosphorylation in SUMO Paralog- Selective Binding and Apoptosis Modulation. Mol Cell 42, 62-74 237. Kim, T. K., Lee, J. S., Oh, S. Y., Jin, X., Choi, Y. J., Lee, T. H., Lee, E., Choi, Y. K., You, S., Chung, Y. G., Lee, J. B., DePinho, R. A., Chin, L., and Kim, H. (2007) Direct transcriptional activation of promyelocytic leukemia protein by IFN regulatory factor 3 induces the p53-dependent growth inhibition of cancer cells. Cancer Res 67, 11133-11140 238. Dror, N., Rave-Harel, N., Burchert, A., Azriel, A., Tamura, T., Tailor, P., Neubauer, A., Ozato, K., and Levi, B. Z. (2007) Interferon regulatory factor-8 is indispensable for the expression of promyelocytic leukemia and the formation of nuclear bodies in myeloid cells. J Biol Chem 282, 5633-5640 239. de Stanchina, E., Querido, E., Narita, M., Davuluri, R. V., Pandolfi, P. P., Ferbeyre, G., and Lowe, S. W. (2004) PML is a direct p53 target that modulates p53 effector functions. Mol Cell 13, 523-535 240. Ferbeyre, G., de Stanchina, E., Querido, E., Baptiste, N., Prives, C., and Lowe, S. W. (2000) PML is induced by oncogenic ras and promotes premature senescence. Genes Dev 14, 2015-2027 241. Scaglioni, P. P., Rabellino, A., Yung, T. M., Bernardi, R., Choi, S., Konstantinidou, G., Nardella, C., Cheng, K., and Pandolfi, P. P. (2012) Translation-dependent mechanisms lead to PML upregulation and mediate oncogenic K-RAS-induced cellular senescence. EMBO Mol Med 4, 594-602 242. Flotho, A., and Melchior, F. (2013) Sumoylation: a regulatory protein modification in health and disease. Annu Rev Biochem 82, 357-385 243. Kamitani, T., Kito, K., Nguyen, H. P., Wada, H., Fukuda-Kamitani, T., and Yeh, E. T. (1998) Identification of three major sentrinization sites in PML. J Biol Chem 273, 26675-26682 244. Lin, D. Y., Huang, Y. S., Jeng, J. C., Kuo, H. Y., Chang, C. C., Chao, T. T., Ho, C. C., Chen, Y. C., Lin, T. P., Fang, H. I., Hung, C. C., Suen, C. S., Hwang, M. J., Chang, K. S., Maul, G. G., and Shih, H. M. (2006) Role of SUMO-interacting motif in Daxx SUMO modification, subnuclear localization, and repression of sumoylated transcription factors. Mol Cell 24, 341-354
339
245. Matunis, M. J., Zhang, X. D., and Ellis, N. A. (2006) SUMO: the glue that binds. Dev Cell 11, 596-597 246. Nacerddine, K., Lehembre, F., Bhaumik, M., Artus, J., Cohen-Tannoudji, M., Babinet, C., Pandolfi, P. P., and Dejean, A. (2005) The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev Cell 9, 769-779 247. Weidtkamp-Peters, S., Lenser, T., Negorev, D., Gerstner, N., Hofmann, T. G., Schwanitz, G., Hoischen, C., Maul, G., Dittrich, P., and Hemmerich, P. (2008) Dynamics of component exchange at PML nuclear bodies. J Cell Sci 121, 2731- 2743 248. Lallemand-Breitenbach, V., Zhu, J., Puvion, F., Koken, M., Honore, N., Doubeikovsky, A., Duprez, E., Pandolfi, P. P., Puvion, E., Freemont, P., and de The, H. (2001) Role of promyelocytic leukemia (PML) sumolation in nuclear body formation, 11S proteasome recruitment, and As2O3-induced PML or PML/retinoic acid receptor alpha degradation. J Exp Med 193, 1361-1371 249. Fu, C., Ahmed, K., Ding, H., Ding, X., Lan, J., Yang, Z., Miao, Y., Zhu, Y., Shi, Y., Zhu, J., Huang, H., and Yao, X. (2005) Stabilization of PML nuclear localization by conjugation and oligomerization of SUMO-3. Oncogene 24, 5401-5413 250. Everett, R. D., Lomonte, P., Sternsdorf, T., van Driel, R., and Orr, A. (1999) Cell cycle regulation of PML modification and ND10 composition. J Cell Sci 112 ( Pt 24), 4581-4588 251. Tatham, M. H., Kim, S., Jaffray, E., Song, J., Chen, Y., and Hay, R. T. (2005) Unique binding interactions among Ubc9, SUMO and RanBP2 reveal a mechanism for SUMO paralog selection. Nat Struct Mol Biol 12, 67-74 252. Saitoh, N., Uchimura, Y., Tachibana, T., Sugahara, S., Saitoh, H., and Nakao, M. (2006) In situ SUMOylation analysis reveals a modulatory role of RanBP2 in the nuclear rim and PML bodies. Exp Cell Res 312, 1418-1430 253. Rabellino, A., Carter, B., Konstantinidou, G., Wu, S. Y., Rimessi, A., Byers, L. A., Heymach, J. V., Girard, L., Chiang, C. M., Teruya-Feldstein, J., and Scaglioni, P. P. (2012) The SUMO E3-ligase PIAS1 regulates the tumor suppressor PML and its oncogenic counterpart PML-RARA. Cancer Res 72, 2275-2284 254. Weisshaar, S. R., Keusekotten, K., Krause, A., Horst, C., Springer, H. M., Gottsche, K., Dohmen, R. J., and Praefcke, G. J. (2008) Arsenic trioxide stimulates SUMO-2/3 modification leading to RNF4-dependent proteolytic targeting of PML. FEBS Lett 582, 3174-3178
340
255. Gong, L., Millas, S., Maul, G. G., and Yeh, E. T. (2000) Differential regulation of sentrinized proteins by a novel sentrin-specific protease. J Biol Chem 275, 3355-3359 256. Best, J. L., Ganiatsas, S., Agarwal, S., Changou, A., Salomoni, P., Shirihai, O., Meluh, P. B., Pandolfi, P. P., and Zon, L. I. (2002) SUMO-1 protease-1 regulates gene transcription through PML. Mol Cell 10, 843-855 257. Han, Y., Huang, C., Sun, X., Xiang, B., Wang, M., Yeh, E. T., Chen, Y., Li, H., Shi, G., Cang, H., Sun, Y., Wang, J., Wang, W., Gao, F., and Yi, J. (2010) SENP3- mediated de-conjugation of SUMO2/3 from promyelocytic leukemia is correlated with accelerated cell proliferation under mild oxidative stress. J Biol Chem 285, 12906-12915 258. Gong, L., and Yeh, E. T. (2006) Characterization of a family of nucleolar SUMO- specific proteases with preference for SUMO-2 or SUMO-3. J Biol Chem 281, 15869-15877 259. Mukhopadhyay, D., Ayaydin, F., Kolli, N., Tan, S. H., Anan, T., Kametaka, A., Azuma, Y., Wilkinson, K. D., and Dasso, M. (2006) SUSP1 antagonizes formation of highly SUMO2/3-conjugated species. J Cell Biol 174, 939-949 260. Marcos-Villar, L., Lopitz-Otsoa, F., Gallego, P., Munoz-Fontela, C., Gonzalez- Santamaria, J., Campagna, M., Shou-Jiang, G., Rodriguez, M. S., and Rivas, C. (2009) Kaposi's sarcoma-associated herpesvirus protein LANA2 disrupts PML oncogenic domains and inhibits PML-mediated transcriptional repression of the survivin gene. J Virol 83, 8849-8858 261. Schmitz, M. L., and Grishina, I. (2012) Regulation of the tumor suppressor PML by sequential post-translational modifications. Front Oncol 2, 204 262. Dellaire, G., Ching, R. W., Ahmed, K., Jalali, F., Tse, K. C., Bristow, R. G., and Bazett-Jones, D. P. (2006) Promyelocytic leukemia nuclear bodies behave as DNA damage sensors whose response to DNA double-strand breaks is regulated by NBS1 and the kinases ATM, Chk2, and ATR. J Cell Biol 175, 55-66 263. Yang, S., Kuo, C., Bisi, J. E., and Kim, M. K. (2002) PML-dependent apoptosis after DNA damage is regulated by the checkpoint kinase hCds1/Chk2. Nat Cell Biol 4, 865-870 264. Gresko, E., Ritterhoff, S., Sevilla-Perez, J., Roscic, A., Frobius, K., Kotevic, I., Vichalkovski, A., Hess, D., Hemmings, B. A., and Schmitz, M. L. (2009) PML tumor suppressor is regulated by HIPK2-mediated phosphorylation in response to DNA damage. Oncogene 28, 698-708
341
265. Hayakawa, F., and Privalsky, M. L. (2004) Phosphorylation of PML by mitogen- activated protein kinases plays a key role in arsenic trioxide-mediated apoptosis. Cancer Cell 5, 389-401 266. Lim, J. H., Liu, Y., Reineke, E., and Kao, H. Y. (2011) Mitogen-activated protein kinase extracellular signal-regulated kinase 2 phosphorylates and promotes Pin1 protein-dependent promyelocytic leukemia protein turnover. J Biol Chem 286, 44403-44411 267. Reineke, E. L., Lam, M., Liu, Q., Liu, Y., Stanya, K. J., Chang, K. S., Means, A. R., and Kao, H. Y. (2008) Degradation of the tumor suppressor PML by Pin1 contributes to the cancer phenotype of breast cancer MDA-MB-231 cells. Mol Cell Biol 28, 997-1006 268. Yuan, W. C., Lee, Y. R., Huang, S. F., Lin, Y. M., Chen, T. Y., Chung, H. C., Tsai, C. H., Chen, H. Y., Chiang, C. T., Lai, C. K., Lu, L. T., Chen, C. H., Gu, D. L., Pu, Y. S., Jou, Y. S., Lu, K. P., Hsiao, P. W., Shih, H. M., and Chen, R. H. (2011) A Cullin3- KLHL20 Ubiquitin ligase-dependent pathway targets PML to potentiate HIF-1 signaling and prostate cancer progression. Cancer Cell 20, 214-228 269. Dephoure, N., Zhou, C., Villen, J., Beausoleil, S. A., Bakalarski, C. E., Elledge, S. J., and Gygi, S. P. (2008) A quantitative atlas of mitotic phosphorylation. Proc Natl Acad Sci U S A 105, 10762-10767 270. Scaglioni, P. P., Yung, T. M., Cai, L. F., Erdjument-Bromage, H., Kaufman, A. J., Singh, B., Teruya-Feldstein, J., Tempst, P., and Pandolfi, P. P. (2006) A CK2- dependent mechanism for degradation of the PML tumor suppressor. Cell 126, 269-283 271. Louria-Hayon, I., Alsheich-Bartok, O., Levav-Cohen, Y., Silberman, I., Berger, M., Grossman, T., Matentzoglu, K., Jiang, Y. H., Muller, S., Scheffner, M., Haupt, S., and Haupt, Y. (2009) E6AP promotes the degradation of the PML tumor suppressor. Cell Death Differ 16, 1156-1166 272. Wolyniec, K., Shortt, J., de Stanchina, E., Levav-Cohen, Y., Alsheich-Bartok, O., Louria-Hayon, I., Corneille, V., Kumar, B., Woods, S. J., Opat, S., Johnstone, R. W., Scott, C. L., Segal, D., Pandolfi, P. P., Fox, S., Strasser, A., Jiang, Y. H., Lowe, S. W., Haupt, S., and Haupt, Y. (2012) E6AP ubiquitin ligase regulates PML- induced senescence in Myc-driven lymphomagenesis. Blood 120, 822-832 273. Fanelli, M., Fantozzi, A., De Luca, P., Caprodossi, S., Matsuzawa, S., Lazar, M. A., Pelicci, P. G., and Minucci, S. (2004) The coiled-coil domain is the structural determinant for mammalian homologues of Drosophila Sina-mediated degradation of promyelocytic leukemia protein and other tripartite motif proteins by the proteasome. J Biol Chem 279, 5374-5379 342
274. Guan, D., Factor, D., Liu, Y., Wang, Z., and Kao, H. Y. (2013) The epigenetic regulator UHRF1 promotes ubiquitination-mediated degradation of the tumor- suppressor protein promyelocytic leukemia protein. Oncogene 32, 3819-3828 275. Geoffroy, M. C., Jaffray, E. G., Walker, K. J., and Hay, R. T. (2010) Arsenic- induced SUMO-dependent recruitment of RNF4 into PML nuclear bodies. Mol Biol Cell 21, 4227-4239 276. Boutell, C., Cuchet-Lourenco, D., Vanni, E., Orr, A., Glass, M., McFarlane, S., and Everett, R. D. (2011) A viral ubiquitin ligase has substrate preferential SUMO targeted ubiquitin ligase activity that counteracts intrinsic antiviral defence. PLoS Pathog 7, e1002245 277. Kelly, C., Van Driel, R., and Wilkinson, G. W. (1995) Disruption of PML- associated nuclear bodies during human cytomegalovirus infection. J Gen Virol 76 ( Pt 11), 2887-2893 278. Adamson, A. L., and Kenney, S. (2001) Epstein-barr virus immediate-early protein BZLF1 is SUMO-1 modified and disrupts promyelocytic leukemia bodies. J Virol 75, 2388-2399 279. Sgorbissa, A., and Brancolini, C. (2012) IFNs, ISGylation and cancer: Cui prodest? Cytokine Growth Factor Rev 23, 307-314 280. Kitareewan, S., Pitha-Rowe, I., Sekula, D., Lowrey, C. H., Nemeth, M. J., Golub, T. R., Freemantle, S. J., and Dmitrovsky, E. (2002) UBE1L is a retinoid target that triggers PML/RARα degradation and apoptosis in acute promyelocytic leukemia. Proc Natl Acad Sci U S A 99, 3806-3811 281. Shah, S. J., Blumen, S., Pitha-Rowe, I., Kitareewan, S., Freemantle, S. J., Feng, Q., and Dmitrovsky, E. (2008) UBE1L represses PML/RAR{alpha} by targeting the PML domain for ISG15ylation. Mol Cancer Ther 7, 905-914 282. Guo, Y., Dolinko, A. V., Chinyengetere, F., Stanton, B., Bomberger, J. M., Demidenko, E., Zhou, D. C., Gallagher, R., Ma, T., Galimberti, F., Liu, X., Sekula, D., Freemantle, S., and Dmitrovsky, E. (2010) Blockade of the ubiquitin protease UBP43 destabilizes transcription factor PML/RARalpha and inhibits the growth of acute promyelocytic leukemia. Cancer Res 70, 9875-9885 283. Hayakawa, F., Abe, A., Kitabayashi, I., Pandolfi, P. P., and Naoe, T. (2008) Acetylation of PML Is Involved in Histone Deacetylase Inhibitor-mediated Apoptosis. J Biol Chem 283, 24420-24425 284. Campagna, M., Herranz, D., Garcia, M. A., Marcos-Villar, L., Gonzalez- Santamaria, J., Gallego, P., Gutierrez, S., Collado, M., Serrano, M., Esteban, M., and Rivas, C. (2011) SIRT1 stabilizes PML promoting its sumoylation. Cell Death Differ 18, 72-79 343
285. Miki, T., Xu, Z., Chen-Goodspeed, M., Liu, M., Van Oort-Jansen, A., Rea, M. A., Zhao, Z., Lee, C. C., and Chang, K. S. (2012) PML regulates PER2 nuclear localization and circadian function. EMBO J 31, 1427-1439 286. Carracedo, A., Ito, K., and Pandolfi, P. P. (2011) The nuclear bodies inside out: PML conquers the cytoplasm. Curr Opin Cell Biol 23, 360-366 287. Giorgi, C., Ito, K., Lin, H. K., Santangelo, C., Wieckowski, M. R., Lebiedzinska, M., Bononi, A., Bonora, M., Duszynski, J., Bernardi, R., Rizzuto, R., Tacchetti, C., Pinton, P., and Pandolfi, P. P. (2010) PML regulates apoptosis at endoplasmic reticulum by modulating calcium release. Science 330, 1247-1251 288. Lin, H. K., Bergmann, S., and Pandolfi, P. P. (2004) Cytoplasmic PML function in TGF-beta signalling. Nature 431, 205-211 289. Bellodi, C., Kindle, K., Bernassola, F., Cossarizza, A., Dinsdale, D., Melino, G., Heery, D., and Salomoni, P. (2006) A cytoplasmic PML mutant inhibits p53 function. Cell Cycle 5, 2688-2692 290. McNally, B. A., Trgovcich, J., Maul, G. G., Liu, Y., and Zheng, P. (2008) A role for cytoplasmic PML in cellular resistance to viral infection. PLoS One 3, e2277 291. Bischof, O., Kirsh, O., Pearson, M., Itahana, K., Pelicci, P. G., and Dejean, A. (2002) Deconstructing PML-induced premature senescence. EMBO J 21, 3358- 3369 292. Mu, Z. M., Chin, K. V., Liu, J. H., Lozano, G., and Chang, K. S. (1994) PML, a growth suppressor disrupted in acute promyelocytic leukemia. Mol Cell Biol 14, 6858-6867 293. Mu, Z. M., Le, X. F., Vallian, S., Glassman, A. B., and Chang, K. S. (1997) Stable overexpression of PML alters regulation of cell cycle progression in HeLa cells. Carcinogenesis 18, 2063-2069 294. Wang, Z. G., Delva, L., Gaboli, M., Rivi, R., Giorgio, M., Cordon-Cardo, C., Grosveld, F., and Pandolfi, P. P. (1998) Role of PML in cell growth and the retinoic acid pathway. Science 279, 1547-1551 295. Wang, Z. G., Ruggero, D., Ronchetti, S., Zhong, S., Gaboli, M., Rivi, R., and Pandolfi, P. P. (1998) PML is essential for multiple apoptotic pathways. Nat Genet 20, 266-272 296. Wu, W.-S., Xu, Z.-X., Hittelman, W. N., Salomoni, P., Pandolfi, P. P., and Chang, K.-S. (2003) Promyelocytic Leukemia Protein Sensitizes Tumor Necrosis Factor α-Induced Apoptosis by Inhibiting the NF-κB Survival Pathway. J Biol Chem 278, 12294-12304
344
297. Quignon, F., De Bels, F., Koken, M., Feunteun, J., Ameisen, J. C., and de The, H. (1998) PML induces a novel caspase-independent death process. Nat Genet 20, 259-265 298. Wu, W. S., Xu, Z. X., and Chang, K. S. (2002) The promyelocytic leukemia protein represses A20-mediated transcription. J Biol Chem 277, 31734-31739 299. Zhong, S., Salomoni, P., and Pandolfi, P. P. (2000) The transcriptional role of PML and the nuclear body. Nat Cell Biol 2, E85-90 300. Bernardi, R., Guernah, I., Jin, D., Grisendi, S., Alimonti, A., Teruya-Feldstein, J., Cordon-Cardo, C., Simon, M. C., Rafii, S., and Pandolfi, P. P. (2006) PML inhibits HIF-1alpha translation and neoangiogenesis through repression of mTOR. Nature 442, 779-785 301. Cheng, X., and Kao, H. Y. (2012) Microarray analysis revealing common and distinct functions of promyelocytic leukemia protein (PML) and tumor necrosis factor alpha (TNFalpha) signaling in endothelial cells. BMC Genomics 13, 453 302. Flenghi, L., Fagioli, M., Tomassoni, L., Pileri, S., Gambacorta, M., Pacini, R., Grignani, F., Casini, T., Ferrucci, P. F., Martelli, M. F., and et al. (1995) Characterization of a new monoclonal antibody (PG-M3) directed against the aminoterminal portion of the PML gene product: immunocytochemical evidence for high expression of PML proteins on activated macrophages, endothelial cells, and epithelia. Blood 85, 1871-1880 303. Yang, Q., Deng, X., Lu, B., Cameron, M., Fearns, C., Patricelli, M. P., Yates Iii, J. R., Gray, N. S., and Lee, J.-D. (2010) Pharmacological Inhibition of BMK1 Suppresses Tumor Growth through Promyelocytic Leukemia Protein. Cancer Cell 18, 258-267 304. Reineke, E. L., Liu, Y., and Kao, H. Y. (2010) Promyelocytic leukemia protein controls cell migration in response to hydrogen peroxide and insulin-like growth factor-1. J Biol Chem 285, 9485-9492 305. Yang, L., Yeh, S. D., Xie, S., Altuwaijri, S., Ni, J., Hu, Y. C., Chen, Y. T., Bao, B. Y., Su, C. H., and Chang, C. (2004) Androgen suppresses PML protein expression in prostate cancer CWR22R cells. Biochem Biophys Res Commun 314, 69-75 306. Chan, J. Y., Li, L., Fan, Y. H., Mu, Z. M., Zhang, W. W., and Chang, K. S. (1997) Cell-cycle regulation of DNA damage-induced expression of the suppressor gene PML. Biochem Biophys Res Commun 240, 640-646 307. Carvalho, T., Seeler, J. S., Ohman, K., Jordan, P., Pettersson, U., Akusjarvi, G., Carmo-Fonseca, M., and Dejean, A. (1995) Targeting of adenovirus E1A and E4- ORF3 proteins to nuclear matrix-associated PML bodies. J Cell Biol 131, 45-56
345
308. Hoppe, A., Beech, S. J., Dimmock, J., and Leppard, K. N. (2006) Interaction of the adenovirus type 5 E4 Orf3 protein with promyelocytic leukemia protein isoform II is required for ND10 disruption. J Virol 80, 3042-3049 309. Zhang, X. W., Yan, X. J., Zhou, Z. R., Yang, F. F., Wu, Z. Y., Sun, H. B., Liang, W. X., Song, A. X., Lallemand-Breitenbach, V., Jeanne, M., Zhang, Q. Y., Yang, H. Y., Huang, Q. H., Zhou, G. B., Tong, J. H., Zhang, Y., Wu, J. H., Hu, H. Y., de The, H., Chen, S. J., and Chen, Z. (2010) Arsenic trioxide controls the fate of the PML- RARalpha oncoprotein by directly binding PML. Science 328, 240-243 310. Jeanne, M., Lallemand-Breitenbach, V., Ferhi, O., Koken, M., Le Bras, M., Duffort, S., Peres, L., Berthier, C., Soilihi, H., Raught, B., and de The, H. (2010) PML/RARA oxidation and arsenic binding initiate the antileukemia response of As2O3. Cancer Cell 18, 88-98 311. Ravid, T., and Hochstrasser, M. (2008) Diversity of degradation signals in the ubiquitin-proteasome system. Nat Rev Mol Cell Biol 9, 679-690 312. Goldstein, G., Scheid, M., Hammerling, U., Schlesinger, D. H., Niall, H. D., and Boyse, E. A. (1975) Isolation of a polypeptide that has lymphocyte- differentiating properties and is probably represented universally in living cells. Proc Natl Acad Sci U S A 72, 11-15 313. Ye, Y., and Rape, M. (2009) Building ubiquitin chains: E2 enzymes at work. Nat Rev Mol Cell Biol 10, 755-764 314. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) Molecular biology of the cell. Garland 315. Frescas, D., and Pagano, M. (2008) Deregulated proteolysis by the F-box proteins SKP2 and beta-TrCP: tipping the scales of cancer. Nat Rev Cancer 8, 438-449 316. Wu, G., Lyapina, S., Das, I., Li, J., Gurney, M., Pauley, A., Chui, I., Deshaies, R. J., and Kitajewski, J. (2001) SEL-10 is an inhibitor of notch signaling that targets notch for ubiquitin-mediated protein degradation. Mol Cell Biol 21, 7403-7415 317. Onoyama, I., Suzuki, A., Matsumoto, A., Tomita, K., Katagiri, H., Oike, Y., Nakayama, K., and Nakayama, K. I. (2011) Fbxw7 regulates lipid metabolism and cell fate decisions in the mouse liver. J Clin Invest 121, 342-354 318. Gao, D., Inuzuka, H., Tan, M.-Kwang M., Fukushima, H., Locasale, Jason W., Liu, P., Wan, L., Zhai, B., Chin, Y. R., Shaik, S., Lyssiotis, Costas A., Gygi, Steven P., Toker, A., Cantley, Lewis C., Asara, John M., Harper, J. W., and Wei, W. (2011) mTOR Drives Its Own Activation via SCFβTrCP-Dependent Degradation of the mTOR Inhibitor DEPTOR. Mol Cell 44, 290-303
346
319. Zhao, Y., Xiong, X., and Sun, Y. (2011) DEPTOR, an mTOR Inhibitor, Is a Physiological Substrate of SCF βTrCP E3 Ubiquitin Ligase and Regulates Survival and Autophagy. Mol Cell 44, 304-316 320. Rotin, D., and Kumar, S. (2009) Physiological functions of the HECT family of ubiquitin ligases. Nat Rev Mol Cell Biol 10, 398-409 321. Jin, J., Cardozo, T., Lovering, R. C., Elledge, S. J., Pagano, M., and Harper, J. W. (2004) Systematic analysis and nomenclature of mammalian F-box proteins. Genes Dev 18, 2573-2580 322. Winston, J. T., Koepp, D. M., Zhu, C., Elledge, S. J., and Harper, J. W. (1999) A family of mammalian F-box proteins. Curr Biol 9, 1180-1182 323. Pfleger, C. M., and Kirschner, M. W. (2000) The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1. Genes Dev 14, 655-665 324. Fuchs, S. Y., Spiegelman, V. S., and Kumar, K. G. (2004) The many faces of beta- TrCP E3 ubiquitin ligases: reflections in the magic mirror of cancer. Oncogene 23, 2028-2036 325. Bamezai, S., Tate, S., and Breslow, E. (1989) Inhibition of ubiquitin-dependent proteolysis by des-Gly-Gly-ubiquitin: implications for the mechanism of polyubiquitin synthesis. Biochem Biophys Res Commun 162, 89-94 326. Chen, Z. J. (2005) Ubiquitin signalling in the NF-kappaB pathway. Nat Cell Biol 7, 758-765 327. Henry, Anastasia G., Hislop, James N., Grove, J., Thorn, K., Marsh, M., and von Zastrow, M. (2012) Regulation of Endocytic Clathrin Dynamics by Cargo Ubiquitination. Dev Cell 23, 519-532 328. Dorrello, N. V., Peschiaroli, A., Guardavaccaro, D., Colburn, N. H., Sherman, N. E., and Pagano, M. (2006) S6K1- and betaTRCP-mediated degradation of PDCD4 promotes protein translation and cell growth. Science 314, 467-471 329. Brooks, C. L., and Gu, W. (2006) p53 ubiquitination: Mdm2 and beyond. Mol Cell 21, 307-315 330. Breitschopf, K., Bengal, E., Ziv, T., Admon, A., and Ciechanover, A. (1998) A novel site for ubiquitination: the N-terminal residue, and not internal lysines of MyoD, is essential for conjugation and degradation of the protein. EMBO J 17, 5964-5973 331. Bloom, J., Amador, V., Bartolini, F., DeMartino, G., and Pagano, M. (2003) Proteasome-Mediated Degradation of p21 via N-Terminal Ubiquitinylation. Cell 115, 71-82 332. Spevak, W., Keiper, B. D., Stratowa, C., and Castanon, M. J. (1993) Saccharomyces cerevisiae cdc15 mutants arrested at a late stage in anaphase 347
are rescued by Xenopus cDNAs encoding N-ras or a protein with beta- transducin repeats. Mol Cell Biol 13, 4953-4966 333. Jiang, J., and Struhl, G. (1998) Regulation of the Hedgehog and Wingless signalling pathways by the F-box/WD40-repeat protein Slimb. Nature 391, 493- 496 334. Marikawa, Y., and Elinson, R. P. (1998) beta-TrCP is a negative regulator of Wnt/beta-catenin signaling pathway and dorsal axis formation in Xenopus embryos. Mech Dev 77, 75-80 335. Wu, G., Xu, G., Schulman, B. A., Jeffrey, P. D., Harper, J. W., and Pavletich, N. P. (2003) Structure of a beta-TrCP1-Skp1-beta-catenin complex: destruction motif binding and lysine specificity of the SCF(beta-TrCP1) ubiquitin ligase. Mol Cell 11, 1445-1456 336. Suzuki, H., Chiba, T., Suzuki, T., Fujita, T., Ikenoue, T., Omata, M., Furuichi, K., Shikama, H., and Tanaka, K. (2000) Homodimer of two F-box proteins betaTrCP1 or betaTrCP2 binds to IkappaBalpha for signal-dependent ubiquitination. J Biol Chem 275, 2877-2884 337. Margottin-Goguet, F., Hsu, J. Y., Loktev, A., Hsieh, H.-M., Reimann, J. D. R., and Jackson, P. K. (2003) Prophase Destruction of Emi1 by the SCFβTrCP/Slimb Ubiquitin Ligase Activates the Anaphase Promoting Complex to Allow Progression beyond Prometaphase. Dev Cell 4, 813-826 338. Inuzuka, H., Tseng, A., Gao, D., Zhai, B., Zhang, Q., Shaik, S., Wan, L., Ang, X. L., Mock, C., Yin, H., Stommel, J. M., Gygi, S., Lahav, G., Asara, J., Xiao, Z. X., Kaelin, W. G., Jr., Harper, J. W., and Wei, W. (2010) Phosphorylation by casein kinase I promotes the turnover of the Mdm2 oncoprotein via the SCF(beta-TRCP) ubiquitin ligase. Cancer Cell 18, 147-159 339. Spiegelman, V. S., Stavropoulos, P., Latres, E., Pagano, M., Ronai, Z. e., Slaga, T. J., and Fuchs, S. Y. (2001) Induction of β-Transducin Repeat-containing Protein by JNK Signaling and Its Role in the Activation of NF-κB. J Biol Chem 276, 27152-27158 340. Spiegelman, V. S., Tang, W., Chan, A. M., Igarashi, M., Aaronson, S. A., Sassoon, D. A., Katoh, M., Slaga, T. J., and Fuchs, S. Y. (2002) Induction of Homologue of Slimb Ubiquitin Ligase Receptor by Mitogen Signaling. J Biol Chem 277, 36624- 36630 341. Spiegelman, V. S., Tang, W., Katoh, M., Slaga, T. J., and Fuchs, S. Y. (2002) Inhibition of HOS expression and activities by Wnt pathway. Oncogene 21, 856- 860
348
342. Davis, M., Hatzubai, A., Andersen, J. S., Ben-Shushan, E., Fisher, G. Z., Yaron, A., Bauskin, A., Mercurio, F., Mann, M., and Ben-Neriah, Y. (2002) Pseudosubstrate regulation of the SCFβ-TrCP ubiquitin ligase by hnRNP-U. Genes Dev 16, 439-451 343. Elcheva, I., Goswami, S., Noubissi, F. K., and Spiegelman, V. S. (2009) CRD-BP Protects the Coding Region of βTrCP1 mRNA from miR-183-Mediated Degradation. Mol Cell 35, 240-246 344. Guardavaccaro, D., Kudo, Y., Boulaire, J., Barchi, M., Busino, L., Donzelli, M., Margottin-Goguet, F., Jackson, P. K., Yamasaki, L., and Pagano, M. (2003) Control of Meiotic and Mitotic Progression by the F Box Protein β-Trcp1 In Vivo. Dev Cell 4, 799-812 345. Bour, S., Perrin, C., Akari, H., and Strebel, K. (2001) The Human Immunodeficiency Virus Type 1 Vpu Protein Inhibits NF-κB Activation by Interfering with βTrCP-mediated Degradation of IκB. J Biol Chem 276, 15920- 15928 346. Spiegelman, V. S., Slaga, T. J., Pagano, M., Minamoto, T., Ronai, Z. e., and Fuchs, S. Y. (2000) Wnt/β-Catenin Signaling Induces the Expression and Activity of βTrCP Ubiquitin Ligase Receptor. Mol Cell 5, 877-882 347. Noubissi, F. K., Elcheva, I., Bhatia, N., Shakoori, A., Ougolkov, A., Liu, J., Minamoto, T., Ross, J., Fuchs, S. Y., and Spiegelman, V. S. (2006) CRD-BP mediates stabilization of betaTrCP1 and c-myc mRNA in response to beta- catenin signalling. Nature 441, 898-901 348. Bhatia, N., Herter, J. R., Slaga, T. J., Fuchs, S. Y., and Spiegelman, V. S. (2002) Mouse homologue of HOS (mHOS) is overexpressed in skin tumors and implicated in constitutive activation of NF-kappaB. Oncogene 21, 1501-1509 349. Liu, J., Suresh Kumar, K. G., Yu, D., Molton, S. A., McMahon, M., Herlyn, M., Thomas-Tikhonenko, A., and Fuchs, S. Y. (2007) Oncogenic BRAF regulates beta-Trcp expression and NF-kappaB activity in human melanoma cells. Oncogene 26, 1954-1958 350. Seo, E., Kim, H., Kim, R., Yun, S., Kim, M., Han, J.-K., Costantini, F., and Jho, E.- h. (2009) Multiple isoforms of β-TrCP display differential activities in the regulation of Wnt signaling. Cell Signal 21, 43-51 351. Lassot, I., Segeral, E., Berlioz-Torrent, C., Durand, H., Groussin, L., Hai, T., Benarous, R., and Margottin-Goguet, F. (2001) ATF4 degradation relies on a phosphorylation-dependent interaction with the SCF(betaTrCP) ubiquitin ligase. Mol Cell Biol 21, 2192-2202
349
352. Fuchs, S. Y., Chen, A., Xiong, Y., Pan, Z. Q., and Ronai, Z. (1999) HOS, a human homolog of Slimb, forms an SCF complex with Skp1 and Cullin1 and targets the phosphorylation-dependent degradation of IkappaB and beta-catenin. Oncogene 18, 2039-2046 353. Nakanishi, C., and Toi, M. (2005) Nuclear factor-kappaB inhibitors as sensitizers to anticancer drugs. Nat Rev Cancer 5, 297-309 354. Miller, J. J., Summers, M. K., Hansen, D. V., Nachury, M. V., Lehman, N. L., Loktev, A., and Jackson, P. K. (2006) Emi1 stably binds and inhibits the anaphase-promoting complex/cyclosome as a pseudosubstrate inhibitor. Genes Dev 20, 2410-2420 355. Jin, J., Shirogane, T., Xu, L., Nalepa, G., Qin, J., Elledge, S. J., and Harper, J. W. (2003) SCFβ-TRCP links Chk1 signaling to degradation of the Cdc25A protein phosphatase. Genes Dev 17, 3062-3074 356. Lee, J., Kumagai, A., and Dunphy, W. G. (2003) Claspin, a Chk1-Regulatory Protein, Monitors DNA Replication on Chromatin Independently of RPA, ATR, and Rad17. Mol Cell 11, 329-340 357. Peschiaroli, A., Dorrello, N. V., Guardavaccaro, D., Venere, M., Halazonetis, T., Sherman, N. E., and Pagano, M. (2006) SCFbetaTrCP-mediated degradation of Claspin regulates recovery from the DNA replication checkpoint response. Mol Cell 23, 319-329 358. Watanabe, N., Arai, H., Nishihara, Y., Taniguchi, M., Watanabe, N., Hunter, T., and Osada, H. (2004) M-phase kinases induce phospho-dependent ubiquitination of somatic Wee1 by SCFbeta-TrCP. Proc Natl Acad Sci U S A 101, 4419-4424 359. Seki, A., Coppinger, J. A., Jang, C.-Y., Yates, J. R., and Fang, G. (2008) Bora and the Kinase Aurora A Cooperatively Activate the Kinase Plk1 and Control Mitotic Entry. Science 320, 1655-1658 360. Seki, A., Coppinger, J. A., Du, H., Jang, C. Y., Yates, J. R., 3rd, and Fang, G. (2008) Plk1- and beta-TrCP-dependent degradation of Bora controls mitotic progression. J Cell Biol 181, 65-78 361. Westbrook, T. F., Martin, E. S., Schlabach, M. R., Leng, Y., Liang, A. C., Feng, B., Zhao, J. J., Roberts, T. M., Mandel, G., Hannon, G. J., DePinho, R. A., Chin, L., and Elledge, S. J. (2005) A Genetic Screen for Candidate Tumor Suppressors Identifies REST. Cell 121, 837-848 362. Westbrook, T. F., Hu, G., Ang, X. L., Mulligan, P., Pavlova, N. N., Liang, A., Leng, Y., Maehr, R., Shi, Y., Harper, J. W., and Elledge, S. J. (2008) SCFbeta-TRCP
350
controls oncogenic transformation and neural differentiation through REST degradation. Nature 452, 370-374 363. Tan, M., Gallegos, J. R., Gu, Q., Huang, Y., Li, J., Jin, Y., Lu, H., and Sun, Y. (2006) SAG/ROC-SCF beta-TrCP E3 ubiquitin ligase promotes pro-caspase-3 degradation as a mechanism of apoptosis protection. Neoplasia 8, 1042-1054 364. Xia, Y., Padre, R. C., De Mendoza, T. H., Bottero, V., Tergaonkar, V. B., and Verma, I. M. (2009) Phosphorylation of p53 by IκB kinase 2 promotes its degradation by β-TrCP. Proc Natl Acad Sci U S A 106, 2629-2634 365. Gallegos, J. R., Litersky, J., Lee, H., Sun, Y., Nakayama, K., Nakayama, K., and Lu, H. (2008) SCF TrCP1 activates and ubiquitylates TAp63gamma. J Biol Chem 283, 66-75 366. Kudo , Y., Guardavaccaro, D., Santamaria, P. G., Koyama-Nasu, R., Latres, E., Bronson, R., Yamasaki, L., and Pagano, M. (2004) Role of F-Box Protein βTrcp1 in Mammary Gland Development and Tumorigenesis. Mol Cell Biol 24, 8184- 8194 367. Ding, Q., He, X., Hsu, J. M., Xia, W., Chen, C. T., Li, L. Y., Lee, D. F., Liu, J. C., Zhong, Q., Wang, X., and Hung, M. C. (2007) Degradation of Mcl-1 by beta-TrCP mediates glycogen synthase kinase 3-induced tumor suppression and chemosensitization. Mol Cell Biol 27, 4006-4017 368. Chen, H., Ma, H., Inuzuka, H., Diao, J., Lan, F., Shi, Y. G., Wei, W., and Shi, Y. (2013) DNA damage regulates UHRF1 stability via the SCF(beta-TrCP) E3 ligase. Mol Cell Biol 33, 1139-1148 369. Winston, J. T., Strack, P., Beer-Romero, P., Chu, C. Y., Elledge, S. J., and Harper, J. W. (1999) The SCFbeta-TRCP-ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in IkappaBalpha and beta-catenin and stimulates IkappaBalpha ubiquitination in vitro. Genes Dev 13, 270-283 370. Margottin, F., Bour, S. P., Durand, H., Selig, L., Benichou, S., Richard, V., Thomas, D., Strebel, K., and Benarous, R. (1998) A novel human WD protein, h- beta TrCp, that interacts with HIV-1 Vpu connects CD4 to the ER degradation pathway through an F-box motif. Mol Cell 1, 565-574 371. Nomaguchi, M., Fujita, M., and Adachi, A. (2008) Role of HIV-1 Vpu protein for virus spread and pathogenesis. Microbes and Infection 10, 960-967 372. Mangeat, B., Gers-Huber, G., Lehmann, M., Zufferey, M., Luban, J., and Piguet, V. (2009) HIV-1 Vpu neutralizes the antiviral factor Tetherin/BST-2 by binding it and directing its beta-TrCP2-dependent degradation. PLoS Pathog 5, e1000574
351
373. Jiang, H., Lu, Y., Yuan, L., and Liu, J. (2011) Regulation of interleukin-10 receptor ubiquitination and stability by beta-TrCP-containing ubiquitin E3 ligase. PLoS One 6, e27464 374. Kumar, K. G., Tang, W., Ravindranath, A. K., Clark, W. A., Croze, E., and Fuchs, S. Y. (2003) SCF(HOS) ubiquitin ligase mediates the ligand-induced down- regulation of the interferon-alpha receptor. EMBO J 22, 5480-5490 375. Shi, P., Zhu, S., Lin, Y., Liu, Y., Liu, Y., Chen, Z., Shi, Y., and Qian, Y. (2011) Persistent stimulation with interleukin-17 desensitizes cells through SCFbeta- TrCP-mediated degradation of Act1. Sci Signal 4, ra73 376. Li, M.-L., Defren, J., and Brewer, G. (2013) Hsp27 and F-Box Protein β-TrCP Promote Degradation of mRNA Decay Factor AUF1. Mol Cell Biol 33, 2315-2326 377. Dehan, E., Bassermann, F., Guardavaccaro, D., Vasiliver-Shamis, G., Cohen, M., Lowes, K. N., Dustin, M., Huang, D. C., Taunton, J., and Pagano, M. (2009) betaTrCP- and Rsk1/2-mediated degradation of BimEL inhibits apoptosis. Mol Cell 33, 109-116 378. Sahasrabuddhe, A. A., Dimri, M., Bommi, P. V., and Dimri, G. P. (2011) betaTrCP regulates BMI1 protein turnover via ubiquitination and degradation. Cell Cycle 10, 1322-1330 379. Sasajima, H., Nakagawa, K., Kashiwayanagi, M., and Yokosawa, H. (2012) Polyubiquitination of the B-cell translocation gene 1 and 2 proteins is promoted by the SCF ubiquitin ligase complex containing betaTrCP. Biol Pharm Bull 35, 1539-1545 380. Akari, H., Bour, S., Kao, S., Adachi, A., and Strebel, K. (2001) The human immunodeficiency virus type 1 accessory protein Vpu induces apoptosis by suppressing the nuclear factor kappaB-dependent expression of antiapoptotic factors. J Exp Med 194, 1299-1311 381. Melixetian, M., Klein, D. K., Sorensen, C. S., and Helin, K. (2009) NEK11 regulates CDC25A degradation and the IR-induced G2/M checkpoint. Nat Cell Biol 11, 1247-1253 382. Uchida, S., Watanabe, N., Kudo, Y., Yoshioka, K., Matsunaga, T., Ishizaka, Y., Nakagama, H., Poon, R. Y., and Yamashita, K. (2011) SCFbeta(TrCP) mediates stress-activated MAPK-induced Cdc25B degradation. J Cell Sci 124, 2816-2825 383. Uchida, S., Yoshioka, K., Kizu, R., Nakagama, H., Matsunaga, T., Ishizaka, Y., Poon, R. Y., and Yamashita, K. (2009) Stress-activated mitogen-activated protein kinases c-Jun NH2-terminal kinase and p38 target Cdc25B for degradation. Cancer Res 69, 6438-6444
352
384. Mailand, N., Bekker-Jensen, S., Bartek, J., and Lukas, J. (2006) Destruction of Claspin by SCFbetaTrCP restrains Chk1 activation and facilitates recovery from genotoxic stress. Mol Cell 23, 307-318 385. Zhao, J., Wei, J., Mialki, R., Zou, C., Mallampalli, R. K., and Zhao, Y. (2012) Extracellular signal-regulated kinase (ERK) regulates cortactin ubiquitination and degradation in lung epithelial cells. J Biol Chem 287, 19105-19114 386. Duan, S., Skaar, J. R., Kuchay, S., Toschi, A., Kanarek, N., Ben-Neriah, Y., and Pagano, M. (2011) mTOR generates an auto-amplification loop by triggering the betaTrCP- and CK1alpha-dependent degradation of DEPTOR. Mol Cell 44, 317-324 387. Zhao, Y., Xiong, X., and Sun, Y. (2011) DEPTOR, an mTOR inhibitor, is a physiological substrate of SCF(betaTrCP) E3 ubiquitin ligase and regulates survival and autophagy. Mol Cell 44, 304-316 388. Mantovani, F., and Banks, L. (2003) Regulation of the discs large tumor suppressor by a phosphorylation-dependent interaction with the beta-TrCP ubiquitin ligase receptor. J Biol Chem 278, 42477-42486 389. Su, J. L., Cheng, X., Yamaguchi, H., Chang, Y. W., Hou, C. F., Lee, D. F., Ko, H. W., Hua, K. T., Wang, Y. N., Hsiao, M., Chen, P. B., Hsu, J. M., Bast, R. C., Jr., Hortobagyi, G. N., and Hung, M. C. (2011) FOXO3a-Dependent Mechanism of E1A-Induced Chemosensitization. Cancer Res 71, 6878-6887 390. van Kerkhof, P., Putters, J., and Strous, G. J. (2007) The ubiquitin ligase SCF(betaTrCP) regulates the degradation of the growth hormone receptor. J Biol Chem 282, 20475-20483 391. Kim, S. E., Yoon, J. Y., Jeong, W. J., Jeon, S. H., Park, Y., Yoon, J. B., Park, Y. N., Kim, H., and Choi, K. Y. (2009) H-Ras is degraded by Wnt/beta-catenin signaling via beta-TrCP-mediated polyubiquitylation. J Cell Sci 122, 842-848 392. Lee, Y. J., Kim, E. H., Lee, J. S., Jeoung, D., Bae, S., Kwon, S. H., and Lee, Y. S. (2008) HSF1 as a mitotic regulator: phosphorylation of HSF1 by Plk1 is essential for mitotic progression. Cancer Res 68, 7550-7560 393. Chu, P. C., Chuang, H. C., Kulp, S. K., and Chen, C. S. (2012) The mRNA-stabilizing factor HuR protein is targeted by beta-TrCP protein for degradation in response to glycolysis inhibition. J Biol Chem 287, 43639-43650 394. Bhattacharya, S., HuangFu, W. C., Liu, J., Veeranki, S., Baker, D. P., Koumenis, C., Diehl, J. A., and Fuchs, S. Y. (2010) Inducible priming phosphorylation promotes ligand-independent degradation of the IFNAR1 chain of type I interferon receptor. J Biol Chem 285, 2318-2325
353
395. Shirane, M., Hatakeyama, S., Hattori, K., Nakayama, K., and Nakayama, K. (1999) Common pathway for the ubiquitination of IkappaBalpha, IkappaBbeta, and IkappaBepsilon mediated by the F-box protein FWD1. J Biol Chem 274, 28169-28174 396. Wu, C., and Ghosh, S. (1999) beta-TrCP mediates the signal-induced ubiquitination of IkappaBbeta. J Biol Chem 274, 29591-29594 397. Cui, W., Xiao, N., Xiao, H., Zhou, H., Yu, M., Gu, J., and Li, X. (2012) β-TrCP- Mediated IRAK1 Degradation Releases TAK1-TRAF6 from the Membrane to the Cytosol for TAK1-Dependent NF-κB Activation. Mol Cell Biol 32, 3990-4000 398. Zou, C., Butler, P. L., Coon, T. A., Smith, R. M., Hammen, G., Zhao, Y., Chen, B. B., and Mallampalli, R. K. (2011) LPS impairs phospholipid synthesis by triggering beta-transducin repeat-containing protein (beta-TrCP)-mediated polyubiquitination and degradation of the surfactant enzyme acyl- CoA:lysophosphatidylcholine acyltransferase I (LPCAT1). J Biol Chem 286, 2719-2727 399. Wang, Z., Inuzuka, H., Zhong, J., Fukushima, H., Wan, L., Liu, P., and Wei, W. (2012) DNA damage-induced activation of ATM promotes beta-TRCP-mediated Mdm2 ubiquitination and destruction. Oncotarget 3, 1026-1035 400. Zhong, J., Shaik, S., Wan, L., Tron, A. E., Wang, Z., Sun, L., Inuzuka, H., and Wei, W. (2013) SCFbeta-TRCP targets MTSS1 for ubiquitination-mediated destruction to regulate cancer cell proliferation and migration. Oncotarget 4, 2339-2353 401. Popov, N., Schulein, C., Jaenicke, L. A., and Eilers, M. (2010) Ubiquitylation of the amino terminus of Myc by SCF(beta-TrCP) antagonizes SCF(Fbw7)- mediated turnover. Nat Cell Biol 12, 973-981 402. Tsuchiya, Y., Morita, T., Kim, M., Iemura, S.-i., Natsume, T., Yamamoto, M., and Kobayashi, A. (2011) Dual Regulation of the Transcriptional Activity of Nrf1 by β-TrCP- and Hrd1-Dependent Degradation Mechanisms. Mol Cell Biol 31, 4500- 4512 403. Chowdhry, S., Zhang, Y., McMahon, M., Sutherland, C., Cuadrado, A., and Hayes, J. D. (2013) Nrf2 is controlled by two distinct beta-TrCP recognition motifs in its Neh6 domain, one of which can be modulated by GSK-3 activity. Oncogene 32, 3765-3781 404. Qing, G., and Xiao, G. (2005) Essential role of IkappaB kinase alpha in the constitutive processing of NF-kappaB2 p100. J Biol Chem 280, 9765-9768 405. Lang, V., Janzen, J., Fischer, G. Z., Soneji, Y., Beinke, S., Salmeron, A., Allen, H., Hay, R. T., Ben-Neriah, Y., and Ley, S. C. (2003) betaTrCP-mediated proteolysis 354
of NF-kappaB1 p105 requires phosphorylation of p105 serines 927 and 932. Mol Cell Biol 23, 402-413 406. Tian, Y., Kolb, R., Hong, J. H., Carroll, J., Li, D., You, J., Bronson, R., Yaffe, M. B., Zhou, J., and Benjamin, T. (2007) TAZ promotes PC2 degradation through a SCFbeta-Trcp E3 ligase complex. Mol Cell Biol 27, 6383-6395 407. Shirogane, T., Jin, J., Ang, X. L., and Harper, J. W. (2005) SCFbeta-TRCP controls clock-dependent transcription via casein kinase 1-dependent degradation of the mammalian period-1 (Per1) protein. J Biol Chem 280, 26863-26872 408. Eide, E. J., Woolf, M. F., Kang, H., Woolf, P., Hurst, W., Camacho, F., Vielhaber, E. L., Giovanni, A., and Virshup, D. M. (2005) Control of mammalian circadian rhythm by CKIepsilon-regulated proteasome-mediated PER2 degradation. Mol Cell Biol 25, 2795-2807 409. Tudzarova, S., Colombo, S. L., Stoeber, K., Carcamo, S., Williams, G. H., and Moncada, S. (2011) Two ubiquitin ligases, APC/C-Cdh1 and SKP1-CUL1-F (SCF)- beta-TrCP, sequentially regulate glycolysis during the cell cycle. Proc Natl Acad Sci U S A 108, 5278-5283 410. Li, X., Liu, J., and Gao, T. (2009) β-TrCP-Mediated Ubiquitination and Degradation of PHLPP1 Are Negatively Regulated by Akt. Mol Cell Biol 29, 6192- 6205 411. Guderian, G., Westendorf, J., Uldschmid, A., and Nigg, E. A. (2010) Plk4 trans- autophosphorylation regulates centriole number by controlling betaTrCP- mediated degradation. J Cell Sci 123, 2163-2169 412. Li, Y., Kumar, K. G., Tang, W., Spiegelman, V. S., and Fuchs, S. Y. (2004) Negative regulation of prolactin receptor stability and signaling mediated by SCF(beta- TrCP) E3 ubiquitin ligase. Mol Cell Biol 24, 4038-4048 413. Guan, H., and Ricciardi, R. P. (2012) Transformation by E1A oncoprotein involves ubiquitin-mediated proteolysis of the neuronal and tumor repressor REST in the nucleus. J Virol 86, 5594-5602 414. Guardavaccaro, D., Frescas, D., Dorrello, N. V., Peschiaroli, A., Multani, A. S., Cardozo, T., Lasorella, A., Iavarone, A., Chang, S., Hernando, E., and Pagano, M. (2008) Control of chromosome stability by the beta-TrCP-REST-Mad2 axis. Nature 452, 365-369 415. Zhou, B. P., Deng, J., Xia, W., Xu, J., Li, Y. M., Gunduz, M., and Hung, M. C. (2004) Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol 6, 931-940
355
416. Ang, X. L., Seeburg, D. P., Sheng, M., and Harper, J. W. (2008) Regulation of postsynaptic RapGAP SPAR by Polo-like kinase 2 and the SCFbeta-TRCP ubiquitin ligase in hippocampal neurons. J Biol Chem 283, 29424-29432 417. Soond, S. M., Townsend, P. A., Barry, S. P., Knight, R. A., Latchman, D. S., and Stephanou, A. (2008) ERK and the F-box protein betaTRCP target STAT1 for degradation. J Biol Chem 283, 16077-16083 418. Azzolin, L., Zanconato, F., Bresolin, S., Forcato, M., Basso, G., Bicciato, S., Cordenonsi, M., and Piccolo, S. (2012) Role of TAZ as mediator of Wnt signaling. Cell 151, 1443-1456 419. Zhong, J., Ogura, K., Wang, Z., and Inuzuka, H. (2013) Degradation of the transcription factor Twist, an oncoprotein that promotes cancer metastasis. Discov Med 15, 7-15 420. Shaik, S., Nucera, C., Inuzuka, H., Gao, D., Garnaas, M., Frechette, G., Harris, L., Wan, L., Fukushima, H., Husain, A., Nose, V., Fadda, G., Sadow, P. M., Goessling, W., North, T., Lawler, J., and Wei, W. (2012) SCF(beta-TRCP) suppresses angiogenesis and thyroid cancer cell migration by promoting ubiquitination and destruction of VEGF receptor 2. J Exp Med 209, 1289-1307 421. Zhao, B., Li, L., Tumaneng, K., Wang, C. Y., and Guan, K. L. (2010) A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta- TRCP). Genes Dev 24, 72-85 422. Platanias, L. C. (2005) Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol 5, 375-386 423. Sadler, A. J., and Williams, B. R. (2008) Interferon-inducible antiviral effectors. Nat Rev Immunol 8, 559-568 424. de Weerd, N. A., Samarajiwa, S. A., and Hertzog, P. J. (2007) Type I interferon receptors: biochemistry and biological functions. J Biol Chem 282, 20053- 20057 425. Schindler, C., Levy, D. E., and Decker, T. (2007) JAK-STAT signaling: from interferons to cytokines. J Biol Chem 282, 20059-20063 426. Gonzalez-Navajas, J. M., Lee, J., David, M., and Raz, E. (2012) Immunomodulatory functions of type I interferons. Nat Rev Immunol 12, 125- 135 427. Cheon, H., and Stark, G. R. (2009) Unphosphorylated STAT1 prolongs the expression of interferon-induced immune regulatory genes. Proc Natl Acad Sci U S A 106, 9373-9378
356
428. Cheon, H., Yang, J., and Stark, G. R. (2011) The functions of signal transducers and activators of transcriptions 1 and 3 as cytokine-inducible proteins. J Interferon Cytokine Res 31, 33-40 429. Yang, J., and Stark, G. R. (2008) Roles of unphosphorylated STATs in signaling. Cell Res 18, 443-451 430. Liu, L., McBride, K. M., and Reich, N. C. (2005) STAT3 nuclear import is independent of tyrosine phosphorylation and mediated by importin-alpha3. Proc Natl Acad Sci U S A 102, 8150-8155 431. Yang, J., Liao, X., Agarwal, M. K., Barnes, L., Auron, P. E., and Stark, G. R. (2007) Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NFkappaB. Genes Dev 21, 1396-1408 432. Stark, G. R., and Darnell, J. E., Jr. (2012) The JAK-STAT pathway at twenty. Immunity 36, 503-514 433. Bogunovic, D., Boisson-Dupuis, S., and Casanova, J. L. (2013) ISG15: leading a double life as a secreted molecule. Exp Mol Med 45, e18 434. Durfee, L. A., Lyon, N., Seo, K., and Huibregtse, J. M. (2010) The ISG15 conjugation system broadly targets newly synthesized proteins: implications for the antiviral function of ISG15. Mol Cell 38, 722-732 435. Huang, Y. F., Wee, S., Gunaratne, J., Lane, D. P., and Bulavin, D. V. (2014) Isg15 controls p53 stability and functions. Cell Cycle 13, 2200-2210 436. Santin, I., Moore, F., Grieco, F. A., Marchetti, P., Brancolini, C., and Eizirik, D. L. (2012) USP18 is a key regulator of the interferon-driven gene network modulating pancreatic beta cell inflammation and apoptosis. Cell Death Dis 3, e419 437. Stephanou, A., and Latchman, D. S. (2003) STAT-1: a novel regulator of apoptosis. Int J Exp Pathol 84, 239-244 438. Huang, S., Bucana, C. D., Van Arsdall, M., and Fidler, I. J. (2002) Stat1 negatively regulates angiogenesis, tumorigenicity and metastasis of tumor cells. Oncogene 21, 2504-2512 439. Cheon, H., Holvey-Bates, E. G., Schoggins, J. W., Forster, S., Hertzog, P., Imanaka, N., Rice, C. M., Jackson, M. W., Junk, D. J., and Stark, G. R. (2013) IFNbeta-dependent increases in STAT1, STAT2, and IRF9 mediate resistance to viruses and DNA damage. EMBO J 32, 2751-2763 440. Regis, G., Pensa, S., Boselli, D., Novelli, F., and Poli, V. (2008) Ups and downs: the STAT1:STAT3 seesaw of Interferon and gp130 receptor signalling. Semin Cell Dev Biol 19, 351-359
357
441. Lesinski, G. B., Anghelina, M., Zimmerer, J., Bakalakos, T., Badgwell, B., Parihar, R., Hu, Y., Becknell, B., Abood, G., Chaudhury, A. R., Magro, C., Durbin, J., and Carson, W. E., 3rd. (2003) The antitumor effects of IFN-alpha are abrogated in a STAT1-deficient mouse. J Clin Invest 112, 170-180 442. Chin, Y. E., Kitagawa, M., Su, W. C., You, Z. H., Iwamoto, Y., and Fu, X. Y. (1996) Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1. Science 272, 719-722 443. Ramana, C. V., Grammatikakis, N., Chernov, M., Nguyen, H., Goh, K. C., Williams, B. R., and Stark, G. R. (2000) Regulation of c-myc expression by IFN- gamma through Stat1-dependent and -independent pathways. EMBO J 19, 263-272 444. Kortylewski, M., Jove, R., and Yu, H. (2005) Targeting STAT3 affects melanoma on multiple fronts. Cancer Metastasis Rev 24, 315-327 445. Barre, B., Avril, S., and Coqueret, O. (2003) Opposite regulation of myc and p21waf1 transcription by STAT3 proteins. J Biol Chem 278, 2990-2996 446. Niu, G., Wright, K. L., Ma, Y., Wright, G. M., Huang, M., Irby, R., Briggs, J., Karras, J., Cress, W. D., Pardoll, D., Jove, R., Chen, J., and Yu, H. (2005) Role of Stat3 in regulating p53 expression and function. Mol Cell Biol 25, 7432-7440 447. Battle, T. E., Lynch, R. A., and Frank, D. A. (2006) Signal transducer and activator of transcription 1 activation in endothelial cells is a negative regulator of angiogenesis. Cancer Res 66, 3649-3657 448. Li, S., Xia, X., Mellieon, F. M., Liu, J., and Steele, S. (2004) Candidate genes associated with tumor regression mediated by intratumoral IL-12 electroporation gene therapy. Mol Ther 9, 347-354 449. Nielsen, S. R., Hammer, T., Gibson, J., Pepper, M. S., Nisato, R. E., Dissing, S., and Tritsaris, K. (2013) IL-27 inhibits lymphatic endothelial cell proliferation by STAT1-regulated gene expression. Microcirculation 20, 555-564 450. Niu, G., Wright, K. L., Huang, M., Song, L., Haura, E., Turkson, J., Zhang, S., Wang, T., Sinibaldi, D., Coppola, D., Heller, R., Ellis, L. M., Karras, J., Bromberg, J., Pardoll, D., Jove, R., and Yu, H. (2002) Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis. Oncogene 21, 2000-2008 451. Xu, Q., Briggs, J., Park, S., Niu, G., Kortylewski, M., Zhang, S., Gritsko, T., Turkson, J., Kay, H., Semenza, G. L., Cheng, J. Q., Jove, R., and Yu, H. (2005) Targeting Stat3 blocks both HIF-1 and VEGF expression induced by multiple oncogenic growth signaling pathways. Oncogene 24, 5552-5560
358
452. Kawasaki, A., Matsumura, I., Kataoka, Y., Takigawa, E., Nakajima, K., and Kanakura, Y. (2003) Opposing effects of PML and PML/RAR alpha on STAT3 activity. Blood 101, 3668-3673 453. Choi, Y. H., Bernardi, R., Pandolfi, P. P., and Benveniste, E. N. (2006) The promyelocytic leukemia protein functions as a negative regulator of IFN- gamma signaling. Proc Natl Acad Sci U S A 103, 18715-18720 454. El Bougrini, J., Dianoux, L., and Chelbi-Alix, M. K. (2011) PML positively regulates interferon gamma signaling. Biochimie 93, 389-398 455. Mehra, V. C., Ramgolam, V. S., and Bender, J. R. (2005) Cytokines and cardiovascular disease. J Leukoc Biol 78, 805-818 456. Lawrence, T., Willoughby, D. A., and Gilroy, D. W. (2002) Anti-inflammatory lipid mediators and insights into the resolution of inflammation. Nat Rev Immunol 2, 787-795 457. Kleinbongard, P., Heusch, G., and Schulz, R. (2010) TNFalpha in atherosclerosis, myocardial ischemia/reperfusion and heart failure. Pharmacol Ther 127, 295- 314 458. Zeuke, S., Ulmer, A. J., Kusumoto, S., Katus, H. A., and Heine, H. (2002) TLR4- mediated inflammatory activation of human coronary artery endothelial cells by LPS. Cardiovasc Res 56, 126-134 459. Sadik, C. D., and Luster, A. D. (2012) Lipid-cytokine-chemokine cascades orchestrate leukocyte recruitment in inflammation. J Leukoc Biol 91, 207-215 460. Toney, L. M., Cattoretti, G., Graf, J. A., Merghoub, T., Pandolfi, P. P., Dalla- Favera, R., Ye, B. H., and Dent, A. L. (2000) BCL-6 regulates chemokine gene transcription in macrophages. Nat Immunol 1, 214-220 461. Hoffmann, A., Leung, T. H., and Baltimore, D. (2003) Genetic analysis of NF- kappaB/Rel transcription factors defines functional specificities. EMBO J 22, 5530-5539 462. Su, Y. T., Gao, C., Liu, Y., Guo, S., Wang, A., Wang, B., Erdjument-Bromage, H., Miyagi, M., Tempst, P., and Kao, H. Y. (2013) Monoubiquitination of filamin B regulates vascular endothelial growth factor-mediated trafficking of histone deacetylase 7. Mol Cell Biol 33, 1546-1560 463. Cheng, X., and Kao, H. Y. (2009) G protein pathway suppressor 2 (GPS2) is a transcriptional corepressor important for estrogen receptor alpha-mediated transcriptional regulation. J Biol Chem 284, 36395-36404 464. Stanya, K. J., and Kao, H. Y. (2009) New insights into the functions and regulation of the transcriptional corepressors SMRT and N-CoR. Cell Div 4, 7
359
465. Hart, M., Concordet, J. P., Lassot, I., Albert, I., del los Santos, R., Durand, H., Perret, C., Rubinfeld, B., Margottin, F., Benarous, R., and Polakis, P. (1999) The F-box protein beta-TrCP associates with phosphorylated beta-catenin and regulates its activity in the cell. Curr Biol 9, 207-210 466. Rice, N. R., and Ernst, M. K. (1993) In vivo control of NF-kappa B activation by I kappa B alpha. EMBO J 12, 4685-4695 467. Perissi, V., Aggarwal, A., Glass, C. K., Rose, D. W., and Rosenfeld, M. G. (2004) A corepressor/coactivator exchange complex required for transcriptional activation by nuclear receptors and other regulated transcription factors. Cell 116, 511-526 468. Shi, Y., Hon, M., and Evans, R. M. (2002) The peroxisome proliferator-activated receptor delta, an integrator of transcriptional repression and nuclear receptor signaling. Proc Natl Acad Sci U S A 99, 2613-2618 469. Hu, X., Li, S., Wu, J., Xia, C., and Lala, D. S. (2003) Liver X receptors interact with corepressors to regulate gene expression. Mol Endocrinol 17, 1019-1026 470. Fernandez-Real, J. M., and Pickup, J. C. (2012) Innate immunity, insulin resistance and type 2 diabetes. Diabetologia 55, 273-278 471. Greenberg, A. S., and Obin, M. S. (2006) Obesity and the role of adipose tissue in inflammation and metabolism. Am J Clin Nutr 83, 461S-465S 472. Lumeng, C. N., Bodzin, J. L., and Saltiel, A. R. (2007) Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest 117, 175-184 473. Zhang, Y., Herbert, B. S., Rajashekhar, G., Ingram, D. A., Yoder, M. C., Clauss, M., and Rehman, J. (2009) Premature senescence of highly proliferative endothelial progenitor cells is induced by tumor necrosis factor-alpha via the p38 mitogen-activated protein kinase pathway. FASEB J 23, 1358-1365 474. Janzen, C., Sen, S., Cuevas, J., Reddy, S. T., and Chaudhuri, G. (2011) Protein phosphatase 2A promotes endothelial survival via stabilization of translational inhibitor 4E-BP1 following exposure to tumor necrosis factor-alpha. Arterioscler Thromb Vasc Biol 31, 2586-2594 475. Pages, G., Lenormand, P., L'Allemain, G., Chambard, J. C., Meloche, S., and Pouyssegur, J. (1993) Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. Proc Natl Acad Sci U S A 90, 8319-8323 476. Wagner, E. F., and Nebreda, A. R. (2009) Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer 9, 537-549
360
477. Beg, A. A., and Baltimore, D. (1996) An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science 274, 782-784 478. Zarubin, T., and Han, J. (2005) Activation and signaling of the p38 MAP kinase pathway. Cell Res 15, 11-18 479. Lapi, E., Di Agostino, S., Donzelli, S., Gal, H., Domany, E., Rechavi, G., Pandolfi, P. P., Givol, D., Strano, S., Lu, X., and Blandino, G. (2008) PML, YAP, and p73 are components of a proapoptotic autoregulatory feedback loop. Mol Cell 32, 803- 814 480. Van Damme, E., Laukens, K., Dang, T. H., and Van Ostade, X. (2010) A manually curated network of the PML nuclear body interactome reveals an important role for PML-NBs in SUMOylation dynamics. Int J Biol Sci 6, 51-67 481. Pearson, M., Carbone, R., Sebastiani, C., Cioce, M., Fagioli, M., Saito, S., Higashimoto, Y., Appella, E., Minucci, S., Pandolfi, P. P., and Pelicci, P. G. (2000) PML regulates p53 acetylation and premature senescence induced by oncogenic Ras. Nature 406, 207-210 482. Gurrieri, C., Capodieci, P., Bernardi, R., Scaglioni, P. P., Nafa, K., Rush, L. J., Verbel, D. A., Cordon-Cardo, C., and Pandolfi, P. P. (2004) Loss of the tumor suppressor PML in human cancers of multiple histologic origins. J Natl Cancer Inst 96, 269-279 483. Yang, D. Q., Halaby, M. J., and Zhang, Y. (2006) The identification of an internal ribosomal entry site in the 5'-untranslated region of p53 mRNA provides a novel mechanism for the regulation of its translation following DNA damage. Oncogene 25, 4613-4619 484. Coldwell, M. J., Mitchell, S. A., Stoneley, M., MacFarlane, M., and Willis, A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene 19, 899-905 485. Holcik, M., Lefebvre, C., Yeh, C., Chow, T., and Korneluk, R. G. (1999) A new internal-ribosome-entry-site motif potentiates XIAP-mediated cytoprotection. Nat Cell Biol 1, 190-192 486. Henis-Korenblit, S., Strumpf, N. L., Goldstaub, D., and Kimchi, A. (2000) A novel form of DAP5 protein accumulates in apoptotic cells as a result of caspase cleavage and internal ribosome entry site-mediated translation. Mol Cell Biol 20, 496-506 487. Shi, Y., Frost, P., Hoang, B., Yang, Y., Fukunaga, R., Gera, J., and Lichtenstein, A. (2013) MNK kinases facilitate c-myc IRES activity in rapamycin-treated multiple myeloma cells. Oncogene 32, 190-197
361
488. de Nadal, E., Ammerer, G., and Posas, F. (2011) Controlling gene expression in response to stress. Nat Rev Genet 12, 833-845 489. Roux, P. P., and Blenis, J. (2004) ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68, 320-344 490. Brown, M. C., Bryant, J. D., Dobrikova, E. Y., Shveygert, M., Bradrick, S. S., Chandramohan, V., Bigner, D. D., and Gromeier, M. (2014) Induction of viral, m7G-cap-independent translation and oncolysis by MAPK interacting kinase (MNK)-mediated effects on the Ser-Arg rich protein kinase, SRPK. J Virol 88, 13135-13148 491. Thompson, S. R. (2012) So you want to know if your message has an IRES? Wiley Interdiscip Rev RNA 3, 697-705 492. Holcik, M., Graber, T., Lewis, S. M., Lefebvre, C. A., Lacasse, E., and Baird, S. (2005) Spurious splicing within the XIAP 5' UTR occurs in the Rluc/Fluc but not the betagal/CAT bicistronic reporter system. RNA 11, 1605-1609 493. Chang, S., Young, B. D., Li, S., Qi, X., Richardson, J. A., and Olson, E. N. (2006) Histone deacetylase 7 maintains vascular integrity by repressing matrix metalloproteinase 10. Cell 126, 321-334 494. Saunders, W. B., Bayless, K. J., and Davis, G. E. (2005) MMP-1 activation by serine proteases and MMP-10 induces human capillary tubular network collapse and regression in 3D collagen matrices. J Cell Sci 118, 2325-2340 495. Stamatovic, S. M., Keep, R. F., Kunkel, S. L., and Andjelkovic, A. V. (2003) Potential role of MCP-1 in endothelial cell tight junction 'opening': signaling via Rho and Rho kinase. J Cell Sci 116, 4615-4628 496. Martin, M., Kettmann, R., and Dequiedt, F. (2007) Class IIa histone deacetylases: regulating the regulators. Oncogene 26, 5450-5467 497. Waskiewicz, A. J., Johnson, J. C., Penn, B., Mahalingam, M., Kimball, S. R., and Cooper, J. A. (1999) Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnk1 in vivo. Mol Cell Biol 19, 1871-1880 498. Ueda, T., Sasaki, M., Elia, A. J., Chio, II, Hamada, K., Fukunaga, R., and Mak, T. W. (2010) Combined deficiency for MAP kinase-interacting kinase 1 and 2 (Mnk1 and Mnk2) delays tumor development. Proc Natl Acad Sci U S A 107, 13984-13990 499. Knauf, U., Tschopp, C., and Gram, H. (2001) Negative regulation of protein translation by mitogen-activated protein kinase-interacting kinases 1 and 2. Mol Cell Biol 21, 5500-5511 362
500. Brown, M. C., Dobrikov, M. I., and Gromeier, M. (2014) MAPK-interacting kinase regulates mTOR/AKT signaling and controls SRPK-responsive type 1 IRES-mediated translation and viral oncolysis. J Virol 88, 13149-13160 501. Cohen, N., Sharma, M., Kentsis, A., Perez, J. M., Strudwick, S., and Borden, K. L. (2001) PML RING suppresses oncogenic transformation by reducing the affinity of eIF4E for mRNA. EMBO J 20, 4547-4559 502. Baird, S. D., Turcotte, M., Korneluk, R. G., and Holcik, M. (2006) Searching for IRES. RNA 12, 1755-1785 503. Wheater, M. J., Johnson, P. W., and Blaydes, J. P. (2010) The role of MNK proteins and eIF4E phosphorylation in breast cancer cell proliferation and survival. Cancer Biol Ther 10, 728-735 504. Lim, S., Saw, T. Y., Zhang, M., Janes, M. R., Nacro, K., Hill, J., Lim, A. Q., Chang, C. T., Fruman, D. A., Rizzieri, D. A., Tan, S. Y., Fan, H., Chuah, C. T., and Ong, S. T. (2013) Targeting of the MNK-eIF4E axis in blast crisis chronic myeloid leukemia inhibits leukemia stem cell function. Proc Natl Acad Sci U S A 110, E2298-2307 505. Ramalingam, S., Gediya, L., Kwegyir-Afful, A. K., Ramamurthy, V. P., Purushottamachar, P., Mbatia, H., and Njar, V. C. (2014) First MNKs degrading agents block phosphorylation of eIF4E, induce apoptosis, inhibit cell growth, migration and invasion in triple negative and Her2-overexpressing breast cancer cell lines. Oncotarget 5, 530-543 506. Gerszten, R. E., Garcia-Zepeda, E. A., Lim, Y. C., Yoshida, M., Ding, H. A., Gimbrone, M. A., Jr., Luster, A. D., Luscinskas, F. W., and Rosenzweig, A. (1999) MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature 398, 718-723 507. Yang, J., Park, Y., Zhang, H., Gao, X., Wilson, E., Zimmer, W., Abbott, L., and Zhang, C. (2009) Role of MCP-1 in tumor necrosis factor-alpha-induced endothelial dysfunction in type 2 diabetic mice. Am J Physiol Heart Circ Physiol 297, H1208-1216 508. Stoneley, M., Paulin, F. E., Le Quesne, J. P., Chappell, S. A., and Willis, A. E. (1998) C-Myc 5' untranslated region contains an internal ribosome entry segment. Oncogene 16, 423-428 509. Malakhova, O. A., Yan, M., Malakhov, M. P., Yuan, Y., Ritchie, K. J., Kim, K. I., Peterson, L. F., Shuai, K., and Zhang, D. E. (2003) Protein ISGylation modulates the JAK-STAT signaling pathway. Genes Dev 17, 455-460 510. Indraccolo, S., Pfeffer, U., Minuzzo, S., Esposito, G., Roni, V., Mandruzzato, S., Ferrari, N., Anfosso, L., Dell'Eva, R., Noonan, D. M., Chieco-Bianchi, L., Albini, 363
A., and Amadori, A. (2007) Identification of genes selectively regulated by IFNs in endothelial cells. J Immunol 178, 1122-1135 511. Borden, E. C., Sen, G. C., Uze, G., Silverman, R. H., Ransohoff, R. M., Foster, G. R., and Stark, G. R. (2007) Interferons at age 50: past, current and future impact on biomedicine. Nat Rev Drug Discov 6, 975-990 512. Guo, S., Cheng, X., Lim, J. H., Liu, Y., and Kao, H. Y. (2014) Control of antioxidative response by the tumor suppressor protein PML through regulating Nrf2 activity. Mol Biol Cell 25, 2485-2498 513. Yang, C. H., Wei, L., Pfeffer, S. R., Du, Z., Murti, A., Valentine, W. J., Zheng, Y., and Pfeffer, L. M. (2007) Identification of CXCL11 as a STAT3-dependent gene induced by IFN. J Immunol 178, 986-992 514. Ho, H. H., and Ivashkiv, L. B. (2006) Role of STAT3 in type I interferon responses. Negative regulation of STAT1-dependent inflammatory gene activation. J Biol Chem 281, 14111-14118 515. Kimbrel, E. A., and Kung, A. L. (2009) The F-box protein beta-TrCp1/Fbw1a interacts with p300 to enhance beta-catenin transcriptional activity. J Biol Chem 284, 13033-13044 516. von Mikecz, A. (2006) The nuclear ubiquitin-proteasome system. J Cell Sci 119, 1977-1984 517. Shi, X. Y., Gu, L., Chen, J., Guo, X. R., and Shi, Y. L. (2014) Downregulation of miR-183 inhibits apoptosis and enhances the invasive potential of endometrial stromal cells in endometriosis. Int J Mol Med 33, 59-67 518. Shay, J. W., and Roninson, I. B. (2004) Hallmarks of senescence in carcinogenesis and cancer therapy. Oncogene 23, 2919-2933 519. Wan, M., Huang, J., Jhala, N. C., Tytler, E. M., Yang, L., Vickers, S. M., Tang, Y., Lu, C., Wang, N., and Cao, X. (2005) SCF(beta-TrCP1) controls Smad4 protein stability in pancreatic cancer cells. Am J Pathol 166, 1379-1392 520. Liepelt, A., Mossanen, J. C., Denecke, B., Heymann, F., De Santis, R., Tacke, F., Marx, G., Ostareck, D. H., and Ostareck-Lederer, A. (2014) Translation control of TAK1 mRNA by hnRNP K modulates LPS-induced macrophage activation. RNA 20, 899-911
364