DOCSLIB.ORG

Neurofibromin Structure, Functions and Regulation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Neurofibromin Structure, Functions and Regulation cells Review Neurofibromin Structure, Functions and Regulation Mohammed Bergoug, Michel Doudeau, Fabienne Godin, Christine Mosrin, Béatrice Vallée and Hélène Bénédetti * Centre de Biophysique Moléculaire, CNRS, UPR 4301, University of Orléans and INSERM, CEDEX 2, 45071 Orléans, France; [email protected] (M.B.); [email protected] (M.D.); [email protected] (F.G.); [email protected] (C.M.); [email protected] (B.V.) * Correspondence: [email protected]; Tel.: +33-23-825-5584 Received: 1 October 2020; Accepted: 26 October 2020; Published: 27 October 2020 Abstract: Neurofibromin is a large and multifunctional protein encoded by the tumor suppressor gene NF1, mutations of which cause the tumor predisposition syndrome neurofibromatosis type 1 (NF1). Over the last three decades, studies of neurofibromin structure, interacting partners, and functions have shown that it is involved in several cell signaling pathways, including the Ras/MAPK, Akt/mTOR, ROCK/LIMK/cofilin, and cAMP/PKA pathways, and regulates many fundamental cellular processes, such as proliferation and migration, cytoskeletal dynamics, neurite outgrowth, dendritic-spine density, and dopamine levels. The crystallographic structure has been resolved for two of its functional domains, GRD (GAP-related (GTPase-activating protein) domain) and SecPH, and its post-translational modifications studied, showing it to be localized to several cell compartments. These findings have been of particular interest in the identification of many therapeutic targets and in the proposal of various therapeutic strategies to treat the symptoms of NF1. In this review, we provide an overview of the literature on neurofibromin structure, function, interactions, and regulation and highlight the relationships between them. Keywords: neurofibromin; structure; function; localization; interactions; post-translational modifications 1. Introduction Neurofibromatosis type 1 is an autosomal dominant disorder caused by inherited or de novo germline mutations in the NF1 tumor suppressor gene [1,2]. It is the most common tumor-predisposing disease in humans. It affects approximately one in 3000 live births and patients present widely heterogeneous clinical manifestations, even within the same family. Hallmark traits of the disease include pigmentary lesions and various types of peripheral nervous system tumors, cutaneous neurofibromas (cNFs), plexiform neurofibromas (pNFs), and malignant peripheral nerve sheath tumors (MPNSTs). However, some individuals develop other symptoms, such as skeletal abnormalities, brain tumors, learning disabilities, attention deficit, and social and behavioral problems. NF1 has been shown to be an essential gene for embryonic development and mice lacking a functional gene die in utero from cardiovascular defects [3]. To date, more than 3000 different germline mutations within the NF1 gene have been identified and shown to be pathogenic [4,5], but acquired somatic mutations in NF1 are also found in a wide variety of malignant neoplasms unrelated to NF1 [6]. NF1 encodes neurofibromin, a large multifunctional protein that is ubiquitously expressed but of which the highest levels are found in the neuronal cells of adults. Allelic variation, second-hit events in the NF1 gene, germline-specific genetic context, and epigenetic changes, as well as tissue-specific functions of neurofibromin may account for the profound degree of clinical heterogeneity in NF1 [7,8]. Detailed studies of the molecular and cellular properties of neurofibromin are required for a full understanding of the diverse phenotypes associated with the disease and their progression, as well as Cells 2020, 9, 2365; doi:10.3390/cells9112365 www.mdpi.com/journal/cells Cells 2020, 9, 2365 2 of 32 Cells 2020, 9, x 2 of 33 for thea full identification understanding of newof the therapeutic diverse phenotypes targets associated to develop with pharmacological the disease and their therapies progression, against as NF1. This reviewwell as for summarizes the identifi threecation decadesof new therapeutic of research targets on neurofibromin to develop pharmacological by focusing therapies on its structure against and molecularNF1. This aspects review of itssummarizes functions three and decades regulation. of research on neurofibromin by focusing on its structure and molecular aspects of its functions and regulation. 2. The NF1 Gene 2. The NF1 Gene Neurofibromatosis type 1 is caused by mutations within the NF1 gene. Early genetic linkage analysis located theNeurofibromatosisNF1 gene near the type centromere 1 is caused on by the mutations long arm within of chromosome the NF1 gene. 17 Early [9]. Subsequentgenetic linkage studies analysis located the NF1 gene near the centromere on the long arm of chromosome 17 [9]. Subsequent that showed NF1 patients to have translocations t(1;17) and t(17;22) [2] and deletions and point studies that showed NF1 patients to have translocations t(1;17) and t(17;22) [2] and deletions and NF1 NF1 mutationspoint mutations [1,10] led [1,10] to mapping led to mapping of the of the NF1gene gene to theto the 17q11.2 17q11.2 locus. locus. NF1 is isa large a large gene gene that that spansspans 350kb 350 of kb genomic of genomic DNA DNA sequence sequence [ 1[1]].. Its Its transcripttranscript is is 11 11 to to 13 13 kb kb long, long, with with an 8454 an 8454-bp-bp open open readingreading frame frame [11] [11] and and 3.5 3.5 kb kb of of 3’ 3 untranslated’ untranslated regionregion [[12]12].. It It contains contains 60 60 exons exons and and is ubiquitously is ubiquitously expressedexpressed [2] (Figure [2] (Figure1). 1). Figure 1. Schematic representation of the NF1 gene and its mRNA transcript; kb: kilo bases Figure 1. Schematic representation of the NF1 gene and its mRNA transcript; kb: kilo bases Three active genes lie within intron 35 (27b in the previous numbering) of NF1 and are transcribed Three active genes lie within intron 35 (27b in the previous numbering) of NF1 and are fromtranscribed the opposite from strand: the oppositeEVI2A strand:(ecotropic EVI2A ( viralecotropic integration viral integration site) [13 site)], EVI2B [13], EVI2B[14], [14] and, andOMGP (oligodendrocyteOMGP (oligodendrocyte myelin glycoprotein) myelin glycoprotein) [15] (Figure [15]1). (FigureEVI2A 1).and EVI2AEVI2B anared EVI2B the human are the homologues human of thehomologues murine Evi-2A of the murineand Evi-2B Evi-2Agenes, and Evi which-2B genes, encode which proteins encode proteins involved involved in retrovirus-induced in retrovirus- murineinduced myeloid murine leukemogenesis myeloid leukemogenesis [13,14]. OMGP [13,14]encodes. OMGP a glycoproteinencodes a glycoprotein specifically specifically expressed in oligodendrocytesexpressed in oligodendrocytes [16]. None of these [16] genes. None have of these been genes found have to bebeen mutated found into NF1be mutated patients in [NF113–15 ]. Thepatients presence [13–15 of]. multiple tumors in affected patients and the identification of somatic mutations within theTheNF1 presencegene in of sporadic multiple tumors tumors independentlyin affected patients of NF1and the disease identification has led toof NF1somaticbeing mutations designated within the NF1 gene in sporadic tumors independently of NF1 disease has led to NF1 being as a tumor suppressor gene [17]. designated as a tumor suppressor gene [17]. 3. Neurofibromin Protein 3. Neurofibromin Protein The NF1Thegene NF1 encodesgene encodes a large a large protein protein of 2818 of amino2818 amino acids acids called called neurofibromin neurofibromin [11]. [11] Sequence. Sequence analysis has shownanalysis homologyhas shown homology between betweenNF1 and NF1 theand Saccharomycesthe Saccharomyces cerevisiae cerevisiae IRA1 IRA1 andand IRA2IRA2 genes,genes, whichwhich negatively negatively regulate regulate the the RAS-cyclic RAS-cyclic AMP AMP pathway pathway [ 18[18]]..In In addition,addition, a a 360 360 amino amino-acid-acid portion portion of neurofibrominof neurofibromin appears appears to be homologous to be homologous to the catalytic to the catalytic domains domains of IRA gene of IRA products gene products and mammalian and p120GAPmammalian (GTPase-activating p120GAP (GTPase protein),-activating suggesting protein), that suggesting neurofibromin that neur possessesofibromin a Ras-GAP possesses function a Ras- [19]. This wasGAP confirmed function [19] by. This the capacitywas confirmed of this by portion the capacity of the of NF1this portiongene to of complement the NF1 gene theto complement function of the IRA1 theand functionIRA2 genes of the andIRA1 restoreand IRA2 a wildtypegenes and phenotyperestore a wildtype when phenotype expressed when in IRA expressed-mutated in IRA yeast- by mutated yeast by stimulating the intrinsic GTPase activity of the yeast Ras protein or the GTPase stimulating the intrinsic GTPase activity of the yeast Ras protein or the GTPase activity of human Ras activity of human Ras expressed in yeast. These studies established neurofibromin as a GTPase- expressed in yeast. These studies established neurofibromin as a GTPase-activating protein for Ras activating protein for Ras (Ras-GAP). The neurofibromin domain carrying the GAP function was (Ras-GAP).named TheGRD neurofibromin for GAP-related domain domain carrying[18,20–23] the. The GAP development function of was specific named antibodies GRD for against GAP-related the domainNF1 [18 gene,20 –product23]. The allowed development the identification of specific of antibodiesneurofibromin
Load more

Recommended publications
  • Adaptive Stress Signaling in Targeted Cancer Therapy Resistance
    Oncogene (2015) 34, 5599–5606 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Adaptive stress signaling in targeted cancer therapy resistance E Pazarentzos1,2 and TG Bivona1,2 The identification of specific genetic alterations that drive the initiation and progression of cancer and the development of targeted drugs that act against these driver alterations has revolutionized the treatment of many human cancers. Although substantial progress has been achieved with the use of such targeted cancer therapies, resistance remains a major challenge that limits the overall clinical impact. Hence, despite progress, new strategies are needed to enhance response and eliminate resistance to targeted cancer therapies in order to achieve durable or curative responses in patients. To date, efforts to characterize mechanisms of resistance have primarily focused on molecular events that mediate primary or secondary resistance in patients. Less is known about the initial molecular response and adaptation that may occur in tumor cells early upon exposure to a targeted agent. Although understudied, emerging evidence indicates that the early adaptive changes by which tumor cells respond to the stress of a targeted therapy may be crucial for tumo r cell survival during treatment and the development of resistance. Here we review recent data illuminating the molecular architecture underlying adaptive stress signaling in tumor cells. We highlight how leveraging this knowledge could catalyze novel strategies to minimize
    [Show full text]
  • Regulation of the Mammalian Target of Rapamycin Complex 2 (Mtorc2)
    Regulation of the Mammalian Target Of Rapamycin Complex 2 (mTORC2) Inauguraldissertation Zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Klaus-Dieter Molle aus Heilbronn, Deutschland Basel, 2006 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät Auf Antrag von Prof. Michael N. Hall und Prof. Markus Affolter. Basel, den 21.11.2006 Prof. Hans-Peter Hauri Dekan Summary The growth controlling mammalian Target of Rapamycin (mTOR) is a conserved Ser/Thr kinase found in two structurally and functionally distinct complexes, mTORC1 and mTORC2. The tumor suppressor TSC1-TSC2 complex inhibits mTORC1 by acting on the small GTPase Rheb, but the role of TSC1-TSC2 and Rheb in the regulation of mTORC2 is unclear. Here we examined the role of TSC1-TSC2 in the regulation of mTORC2 in human embryonic kidney 293 cells. Induced knockdown of TSC1 and TSC2 (TSC1/2) stimulated mTORC2-dependent actin cytoskeleton organization and Paxillin phosphorylation. Furthermore, TSC1/2 siRNA increased mTORC2-dependent Ser473 phosphorylation of plasma membrane bound, myristoylated Akt/PKB. This suggests that loss of Akt/PKB Ser473 phosphorylation in TSC mutant cells, as reported previously, is due to inhibition of Akt/PKB localization rather than inhibition of mTORC2 activity. Amino acids and overexpression of Rheb failed to stimulate mTORC2 signaling. Thus, TSC1-TSC2 also inhibits mTORC2, but possibly independently of Rheb. Our results suggest that mTORC2 hyperactivation may contribute to the pathophysiology of diseases such as cancer and Tuberous Sclerosis Complex. i Acknowledgement During my PhD studies in the Biozentrum I received a lot of support from many people around me who I mention here to express my gratefulness.
    [Show full text]
  • Lymphocyte/WBC-Based Comprehensive Testing Via Next-Gen Sequencing NF1/SPRED1 and Other Rasopathy Related Conditions on Blood/Saliva
    Last Updated October 2019 Institutional Price TAT Genetic Test CPT Codes Z codes Specimen Requirements (USD$) (working days) Lymphocyte/WBC-based Comprehensive Testing via Next-Gen Sequencing NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for the NF1 gene (NF1-NG) This testing includes an average coverage of >1600x to allow for the identification of (1) 3-6ml whole blood in EDTA (purple topped) tubes mosaicism as low as 3-5% of the alleles. In addition, novel variants identified in the $1,000 81408 25 (2) Oragene 575 saliva kit (provided by the MGL) ZB6A9 NF1 gene will be confirmed via RNA-based analysis at no additional charge. RNA- $1,600 (RUSH) 81479 15 (RUSH) (3) DNA sample (25ul volume at 3ug, O.D. value at based testing will also be provided to non-founder, multigenerational families with 260:280 ≥1.8) “classic” NF1 at no additional charge if next-generation sequencing is found negative. (1) 3-6ml whole blood in EDTA (purple topped) tubes SPRED1-only NGS testing and copy number analysis for SPRED1 (SPD1-NG) $800 81405 25 (2) Oragene 575 saliva kit (provided by the MGL) This testing includes an average coverage of >1600x to allow for the identification of ZB6AC $1,400 (RUSH) 81479 15 (RUSH) (3) DNA sample (25ul volume at 3ug, O.D. value at mosaicism as low as 3-5% of the alleles after comprehensive NF1 analysis. 260:280 ≥1.8) NF1/SPRED1 NGS testing and copy number analysis for NF1 and SPRED1 (NFSP-NG) (1) 3-6ml whole blood in EDTA (purple topped) tubes 81408 This testing includes an average coverage of >1600x to allow for the identification of $1,100 25 (2) Oragene 575 saliva kit (provided by the MGL) 81405 ZB6A8 mosaicism as low as 3-5% of the alleles.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Protein EVI2B Gene Symbol Evi2b Organism Mouse Gene Summary Description Not Available Gene Aliases Evi-2, Evi2 RefSeq Accession No. NC_000077.6, NT_096135.6 UniGene ID Not Available Ensembl Gene ID ENSMUSG00000093938 Entrez Gene ID 216984 Assay Information Unique Assay ID qMmuCEP0062720 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000179322, ENSMUST00000170422 Amplicon Context Sequence ACAGTATAATCATGAGTATAGCTACCAACATAGAAATTATAATAGTACCGATTAAT ATGGCAGCAATTGCATTGTGGTTGTTTTTATGAGCAGTTCCTTTGCCACTTGGTG GTTCTGAAGTGAGTGGTGGTGGTGGTGGTGGTG Amplicon Length (bp) 114 Chromosome Location 11:79516072-79516215 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9997 cDNA Cq 22.69 cDNA Tm (Celsius) 79 gDNA Cq 24.61 Specificity (%) 49.93 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Evi2b, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Bioinformatic
    CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Bioinformatic Comparison of the EVI2A Promoter and Coding Regions A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology By Max Weinstein May 2020 The thesis of Max Weinstein is approved: Professor Rheem D. Medh Date Professor Virginia Oberholzer Vandergon Date Professor Cindy Malone, Chair Date California State University Northridge ii Table of Contents Signature Page ii List of Figures v Abstract vi Introduction 1 Ecotropic Viral Integration Site 2A, a Gene within a Gene 7 Materials and Methods 11 PCR and Cloning of Recombinant Plasmid 11 Transformation and Cell Culture 13 Generation of Deletion Constructs 15 Transfection and Luciferase Assay 16 Identification of Transcription Factor Binding Sites 17 Determination of Region for Analysis 17 Multiple Sequence Alignment (MSA) 17 Model Testing 18 Tree Construction 18 Promoter and CDS Conserved Motif Search 19 Results and Discussion 20 Choice of Species for Analysis 20 Mapping of Potential Transcription Factor Binding Sites 20 Confirmation of Plasmid Generation through Gel Electrophoresis 21 Analysis of Deletion Constructs by Transient Transfection 22 EVI2A Coding DNA Sequence Phylogenetics 23 EVI2A Promoter Phylogenetics 23 EVI2A Conserved Leucine Zipper 25 iii EVI2A Conserved Casein kinase II phosphorylation site 26 EVI2A Conserved Sox-5 Binding Site 26 EVI2A Conserved HLF Binding Site 27 EVI2A Conserved cREL Binding Site 28 EVI2A Conserved CREB Binding Site 28 Summary 29 Appendix: Figures 30 Literature Cited 44 iv List of Figures Figure 1. EVI2A is nested within the gene NF1 30 Figure 2 Putative Transcriptions Start Site 31 Figure 3. Gel Electrophoresis of pGC Blue cloned, Restriction Digested Plasmid 32 Figure 4.
    [Show full text]
  • Mutation Analysis of Son of Sevenless in Juvenile Myelomonocytic Leukemia
    Letters to the Editor 1108 3 Licht JD. Reconstructing a disease: what essential features of the the development of acute promyelocytic leukemia in transgenic retinoic acid receptor fusion oncoproteins generate acute promye- mice. Proc Natl Acad Sci USA 2000; 97: 13306–13311. locytic leukemia? Cancer Cell 2006; 9: 73–74. 10 Sternsdorf T, Phan VT, Maunakea ML, Ocampo CB, Sohal J, 4 Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J et al. Silletto A et al. Forced retinoic acid receptor alpha homodimers A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 prime mice for APL-like leukemia. Cancer Cell 2006; 9: 81–94. genes as a therapeutic target of imatinib in idiopathic hypereosino- 11 Kwok C, Zeisig BB, Dong S, So CW. Forced homo-oligomerization philic syndrome. N Engl J Med 2003; 348: 1201–1214. of RARalpha leads to transformation of primary hematopoietic 5 Kaufmann I, Martin G, Friedlein A, Langen H, Keller W. Human cells. Cancer Cell 2006; 9: 95–108. Fip1 is a subunit of CPSF that binds to U-rich RNA elements and 12 Palaniswamy V, Moraes KC, Wilusz CJ, Wilusz J. Nucleophosmin stimulates poly(A) polymerase. EMBO J 2004; 23: 616–626. is selectively deposited on mRNA during polyadenylation. Nat 6 Sainty D, Liso V, Cantu-Rajnoldi A, Head D, Mozziconacci MJ, Struct Mol Biol 2006; 13: 429–435. Arnoulet C et al. A new morphologic classification system for acute 13 Rego EM, Ruggero D, Tribioli C, Cattoretti G, Kogan S, Redner RL promyelocytic leukemia distinguishes cases with underlying PLZF/ et al.
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • Tuberous Sclerosis Complex: Molecular Pathogenesis and Animal Models
    Neurosurg Focus 20 (1):E4, 2006 Tuberous sclerosis complex: molecular pathogenesis and animal models LEANDRO R. PIEDIMONTE, M.D., IAN K. WAILES, M.D., AND HOWARD L. WEINER, M.D. Division of Pediatric Neurosurgery, Department of Neurosurgery, New York University School of Medicine, New York, New York Mutations in one of two genes, TSC1 and TSC2, result in a similar disease phenotype by disrupting the normal inter- action of their protein products, hamartin and tuberin, which form a functional signaling complex. Disruption of these genes in the brain results in abnormal cellular differentiation, migration, and proliferation, giving rise to the charac- teristic brain lesions of tuberous sclerosis complex (TSC) called cortical tubers. The most devastating complications of TSC affect the central nervous system and include epilepsy, mental retardation, autism, and glial tumors. Relevant animal models, including conventional and conditional knockout mice, are valuable tools for studying the normal func- tions of tuberin and hamartin and the way in which disruption of their expression gives rise to the variety of clinical features that characterize TSC. In the future, these animals will be invaluable preclinical models for the development of highly specific and efficacious treatments for children affected with TSC. KEY WORDS • tuberous sclerosis • pathogenesis • animal model Tuberous sclerosis complex is an autosomal-dominant zures, mental retardation, and autism.1,51 The number and tumor predisposition syndrome that affects approximately location of cortical tubers and the patient’s age at seizure 1 in 7500 individuals worldwide.19 The TSC is character- onset are highly correlated with neurological outcomes.1,30 ized by benign hamartomatous growths in multiple organs, Epilepsy occurs in approximately 80% of affected indi- including the kidney, skin, retina, lung, and brain.
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • Associated Fibroblasts in Non-Small Cell Lung Cancer
    Prognostic gene-expression signature of carcinoma- associated fibroblasts in non-small cell lung cancer Roya Navaba,1, Dan Strumpfa,1, Bizhan Bandarchia,1, Chang-Qi Zhua,1, Melania Pintiliea, Varune Rohan Ramnarinea, Emin Ibrahimova, Nikolina Radulovicha, Lisa Leunga, Malgorzata Barczyka,b, Devang Panchala, Christine Toa, James J. Yuna, Sandy Dera, Frances A. Shepherda,c, Igor Jurisicaa,d,e, and Ming-Sound Tsaoa,e,f,2 aThe Campbell Family Institute for Cancer Research, Ontario Cancer Institute at Princess Margaret Hospital, University Health Network, Toronto, ON, Canada M5G 2M9; bDepartment of Biomedicine, Jonas Lies vei, N-5009 Bergen, Norway; Departments of cMedicine, dComputer Science, and eMedical Biophysics, and fLaboratory of Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada M5A 2N4 Edited* by Tak Wah Mak, The Campbell Family Institute for Breast Cancer Research, Ontario Cancer Institute at Princess Margaret Hospital, University Health Network, Toronto, ON, Canada, and approved March 10, 2011 (received for review September 28, 2010) The tumor microenvironment strongly influences cancer develop- Results ment, progression, and metastasis. The role of carcinoma-associated Cultured CAFs Display Features of Myofibroblasts. By using a study fibroblasts (CAFs) in these processes and their clinical impact has protocol approved by the Institutional Research Ethics Board, not been studied systematically in non-small cell lung carcinoma CAFs and NFs were cultured from 15 surgically resected primary (NSCLC). We established primary cultures of CAFs and matched nor- NSCLCs, and the histologically confirmed normal lung tissue was mal fibroblasts (NFs) from 15 resected NSCLC. We demonstrate that obtained from the same lobe (Table S1A). Both the primary CAFs have greater ability than NFs to enhance the tumorigenicity of cultured CAFs and tumor stromal fibroblasts expressed α-smooth lung cancer cell lines.
    [Show full text]
  • Supplementary Table 2
    Supplementary Table 2. Differentially Expressed Genes following Sham treatment relative to Untreated Controls Fold Change Accession Name Symbol 3 h 12 h NM_013121 CD28 antigen Cd28 12.82 BG665360 FMS-like tyrosine kinase 1 Flt1 9.63 NM_012701 Adrenergic receptor, beta 1 Adrb1 8.24 0.46 U20796 Nuclear receptor subfamily 1, group D, member 2 Nr1d2 7.22 NM_017116 Calpain 2 Capn2 6.41 BE097282 Guanine nucleotide binding protein, alpha 12 Gna12 6.21 NM_053328 Basic helix-loop-helix domain containing, class B2 Bhlhb2 5.79 NM_053831 Guanylate cyclase 2f Gucy2f 5.71 AW251703 Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a 5.57 NM_021691 Twist homolog 2 (Drosophila) Twist2 5.42 NM_133550 Fc receptor, IgE, low affinity II, alpha polypeptide Fcer2a 4.93 NM_031120 Signal sequence receptor, gamma Ssr3 4.84 NM_053544 Secreted frizzled-related protein 4 Sfrp4 4.73 NM_053910 Pleckstrin homology, Sec7 and coiled/coil domains 1 Pscd1 4.69 BE113233 Suppressor of cytokine signaling 2 Socs2 4.68 NM_053949 Potassium voltage-gated channel, subfamily H (eag- Kcnh2 4.60 related), member 2 NM_017305 Glutamate cysteine ligase, modifier subunit Gclm 4.59 NM_017309 Protein phospatase 3, regulatory subunit B, alpha Ppp3r1 4.54 isoform,type 1 NM_012765 5-hydroxytryptamine (serotonin) receptor 2C Htr2c 4.46 NM_017218 V-erb-b2 erythroblastic leukemia viral oncogene homolog Erbb3 4.42 3 (avian) AW918369 Zinc finger protein 191 Zfp191 4.38 NM_031034 Guanine nucleotide binding protein, alpha 12 Gna12 4.38 NM_017020 Interleukin 6 receptor Il6r 4.37 AJ002942
    [Show full text]
  • Review Article J Med Genet: First Published As 10.1136/Jmg.33.1.2 on 1 January 1996
    2 J7 Med Genet 1996;33:2-17 Review article J Med Genet: first published as 10.1136/jmg.33.1.2 on 1 January 1996. Downloaded from Molecular genetics of neurofibromatosis type 1 (NFl) Ming Hong Shen, Peter S Harper, Meena Upadhyaya Abstract several discrete entities.'` At least two dis- Neurofibromatosis type 1 (NF1), also tinctive forms, neurofibromatosis type 1 (NF1) called von Recklinghausen disease or peri- and neurofibromatosis type 2 (NF2), were re- pheral neurofibromatosis, is a common cognised and later confirmed by the cloning of autosomal dominant disorder char- two separate genes, the NF1 gene on chro- acterised by multiple neurofibromas, cafe mosome 1746 and the NF2 gene on chro- au lait spots, and Lisch nodules ofthe iris, mosome 22.78 Other NF related syndromes with a variable clinical expression. The were also reported, such as segmental NF,9 gene responsible for this condition, NF1, Watson syndrome,'0 Noonan syndrome," has been isolated by positional cloning. spinal NF,'2 familial cafe au lait spots It spans over 350kb of genomic DNA in (CLS)," and Schwannomatosis.'4 It remains chromosomal region 17qll.2 and encodes to be determined whether such disorders are an mRNA of 11-13 kb containing at least genetically discrete. 59 exons. NFI is widely expressed in a NFl, also called von Recklinghausen disease variety of human and rat tissues. Four or peripheral neurofibromatosis, is a common alternatively spliced NFI transcripts have autosomal dominant disorder affecting about been identified. Three of these transcript 1 in 3000 to 5000 people. It exhibits full pene- isoforms (each with an extra exon: 9br, trance and a high mutation rate with 30 to 23a, and 48a, respectively) show differ- 50% ofNFl patients representing a new muta- ential expression to some extent in various tion.
    [Show full text]