DOCSLIB.ORG

Associated Fibroblasts in Non-Small Cell Lung Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Associated Fibroblasts in Non-Small Cell Lung Cancer Prognostic gene-expression signature of carcinoma- associated fibroblasts in non-small cell lung cancer Roya Navaba,1, Dan Strumpfa,1, Bizhan Bandarchia,1, Chang-Qi Zhua,1, Melania Pintiliea, Varune Rohan Ramnarinea, Emin Ibrahimova, Nikolina Radulovicha, Lisa Leunga, Malgorzata Barczyka,b, Devang Panchala, Christine Toa, James J. Yuna, Sandy Dera, Frances A. Shepherda,c, Igor Jurisicaa,d,e, and Ming-Sound Tsaoa,e,f,2 aThe Campbell Family Institute for Cancer Research, Ontario Cancer Institute at Princess Margaret Hospital, University Health Network, Toronto, ON, Canada M5G 2M9; bDepartment of Biomedicine, Jonas Lies vei, N-5009 Bergen, Norway; Departments of cMedicine, dComputer Science, and eMedical Biophysics, and fLaboratory of Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada M5A 2N4 Edited* by Tak Wah Mak, The Campbell Family Institute for Breast Cancer Research, Ontario Cancer Institute at Princess Margaret Hospital, University Health Network, Toronto, ON, Canada, and approved March 10, 2011 (received for review September 28, 2010) The tumor microenvironment strongly influences cancer develop- Results ment, progression, and metastasis. The role of carcinoma-associated Cultured CAFs Display Features of Myofibroblasts. By using a study fibroblasts (CAFs) in these processes and their clinical impact has protocol approved by the Institutional Research Ethics Board, not been studied systematically in non-small cell lung carcinoma CAFs and NFs were cultured from 15 surgically resected primary (NSCLC). We established primary cultures of CAFs and matched nor- NSCLCs, and the histologically confirmed normal lung tissue was mal fibroblasts (NFs) from 15 resected NSCLC. We demonstrate that obtained from the same lobe (Table S1A). Both the primary CAFs have greater ability than NFs to enhance the tumorigenicity of cultured CAFs and tumor stromal fibroblasts expressed α-smooth lung cancer cell lines. Microarray gene-expression analysis of the 15 muscle actin (α-SMA) (Fig. 1A), a marker of myofibroblasts (7). matched CAF and NF cell lines identified 46 differentially expressed These primary CAFs and NFs could be maintained in culture for genes, encoding for proteins that are significantly enriched for ex- up to 20 population doublings. Primary fibroblasts preserved their tracellular proteins regulated by the TGF-β signaling pathway. We ability to induce collagen gel contraction (8), which was greater have identified a subset of 11 genes (13 probe sets) that formed with CAFs than NFs (Fig. 1B). These results showed that CAFs a prognostic gene-expression signature, which was validated in can maintain the phenotypic properties of myofibroblasts even in multiple independent NSCLC microarray datasets. Functional anno- the absence of continuing interaction with carcinoma cells. tation using protein–protein interaction analyses of these and pub- To facilitate further the in vitro and in vivo studies using CAFs lished cancer stroma-associated gene-expression changes revealed and NFs, one pair of primary cultured CAFs and NFs was prominent involvement of the focal adhesion and MAPK signaling immortalized with lentivirus expressing human telomerase YFPhTERT pathways. Fourteen (30%) of the 46 genes also were differentially (hTERT). The resulting immortalized CAF 094 and expressed in laser-capture–microdissected corresponding primary NF 094YFPhTERT cell lines showed loss of senescence (Fig. 1C). tumor stroma compared with the matched normal lung. Six of these 14 genes could be induced by TGF-β1 in NF. The results CAFs Enhance Invasion and Tumorigenicity of NSCLC Cells. By using establish the prognostic impact of CAF-associated gene-expression the coculture Matrigel invasion assay, CAFs increased the in- changes in NSCLC patients. vasiveness of both NCI-H460 and A549 NSCLC cells compared with NFs (Fig. 1D and Fig. S1A). This effect was not attributable B integrin α11 | NAViGaTOR | adenocarcinoma | extracellular matrix to an effect on proliferation of the tumor cells (Fig. S1 ). We also observed that the invading tumor cells appeared elongated and fibroblast-like only when they were cocultured with CAFs but not ung cancer is the leading cause of cancer deaths worldwide C (1). Non-small cell lung carcinoma (NSCLC) accounts for with NFs (Fig. S1 ). A similar alteration of tumor cell appear- L ance was observed when they were exposed to conditioned media 85% of all lung cancers. One of the most consistent histological D features of cancer cell invasion is the appearance of desmoplasia: of CAFs but not NFs (Fig. S1 ). By using gelatin zymography, an stromal changes characterized by the activation of stromal active lytic band (68 kDa) of matrix metalloproteinase 2 (MMP-2) fibroblasts into carcinoma-associated fibroblasts (CAFs), in- was observed in CAFs but not in NFs cocultured with tumor cells creased matrix protein disposition, new blood vessel formation, (Fig. 1E), suggesting a role for MMP-2 activation in CAF-induced and immune cell infiltration (2, 3). These changes have been enhancement of tumor cell invasion. reported to promote tumor cell growth, invasion, metastases, and Subcutaneous coimplantation of A549 lung adenocarcinoma resistance to treatment as well as to mediate immune reaction cells with CAF 094 into severe combined immunodeficient against tumor cells (2, 4, 5). Published prognostic gene signatures (SCID) mice significantly enhanced tumor growth compared for NSCLC have included genes encoding for ECM proteins with controls (Fig. 1F). A similar effect was observed with the such as collagens 1A1, 1A2, and 9; glypican 3; intercellular ad- immortalized CAF 094YFPhTERT (Fig. 1F). These findings were hesion molecule 1 (ICAM-1); laminin B1; selectin L; selectin P; validated further with the NCI-H460 cell line (Fig. 1F). and secreted protein acidic and rich in cysteine (SPARC) (3, 5). Furthermore, stromal elements, including PDGF-C, VEGF-A, IL-8, endothelin-1 (EDN1), osteopontin (SPP1), and the che- Author contributions: R.N., D.S., and M.-S.T. designed research; R.N., D.S., B.B., E.I., N.R., mokine CXCL1, recently have been suggested as potential ther- L.L., M.B., D.P., and J.J.Y. performed research; R.N., D.S., C.-Q.Z., M.P., V.R.R., C.T., I.J., and apeutic targets in skin and breast cancers (4, 6). M.-S.T. analyzed data; and R.N., D.S., B.B., C.-Q.Z., M.P., N.R., S.D., F.A.S., I.J., and M.-S.T. To gain greater insight into the gene-expression characteristics in wrote the paper. CAFs and tumor stroma of NSCLC and more direct evidence for The authors declare no conflict of interest. their clinical role, we conducted microarray analyses on paired CAF and normal fibroblasts (NFs) cultured from 15 resected NSCLC *This Direct Submission article had a prearranged editor. specimens and their corresponding laser-capture–microdissected Data deposition: The data reported in this paper have been deposited in the Gene Ex- (LCM) tumor stroma and histologically normal lung parenchyma. pression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE22874). We identified a NSCLC stromal prognostic signature that could be 1R.N., D.S., B.B., and C.-Q.Z. contributed equally to this work. validated in multiple independent published expression datasets of 2To whom correspondence should be addressed. E-mail: [email protected]. primary NSCLCs. The results establish the clinical relevance of This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. stromal gene-expression changes in lung cancer. 1073/pnas.1014506108/-/DCSupplemental. 7160–7165 | PNAS | April 26, 2011 | vol. 108 | no. 17 www.pnas.org/cgi/doi/10.1073/pnas.1014506108 Downloaded by guest on September 29, 2021 A C Normal Tumor Primary hTERT 100 +CAF 094YFPhTERT +NF 094YFPhTERT +NF 094 75 +CAF 094 H&E NF 094 50 25 SMA α Population Doubling (PD) 0 CAF 094 0 25 50 75 100 Time (Days) NF CAF D H460 A549 800 p= 0.0286 400 p= 0.0025 700 600 p= 0.0286 300 p= 0.0286 500 p= 0.0022 Cytokeratin AE1/AE3 400 200 300 P<0.0001 p= 0.0286 200 p= 0.0286 100 --------------------------------------------------- 100 --------------------------------------------------- 0 0 Vimentin CAF549 CAF520 CAF089 CAF094 CAF549 CAF520 CAF089 CAF094 Invasion (% of Control NF) Invasion (% of Control NF) E H460 A549 H460 A549 H460 A549 SMA H460 A549 NF 520 CAF 520 NF 089CAF 089NF 089CAF 089NF 520CAF 520NF 520CAF 520NF 094CAF 094NF 094CAF 094 α 72 kDa pro MMP-2 68 kDa MMP-2 B 100 NF 094 F A549 A549 CAF 094 3 80 3 +CAF 094 YFPhTERT +CAF 094 +NF 094 YFPhTERT 60 +NF 094 Control P<0.00053 P<0.0032 Control 40 P=0.01 20 % of initial gel area Tumor Volume (cm ) Volume Tumor 0 (cm ) Volume Tumor 025811 Time (h) Days Days H460 H460 100 NF 549 3 CAF 549 3 YFPhTERT 80 +CAF 094 +CAF 094 YFPhTERT +NF 094 +NF 094 60 Control P<0.0001 Control P<0.0001 40 P=0.001 P<0.0001 20 P=0.001 Tumor Volume (cm ) Volume Tumor % of initial gel area 0 (cm ) Volume Tumor 025811 Time (h) Days Days Fig. 1. Characterization of CAF and lung NF. (A) Representative H&E-stained sections of normal lung and a lung adenocarcinoma with prominent des- moplasia (DS) and showing strong staining of the tumor stromal fibroblasts (S) but not tumor cells (T) for α-SMA. Both CAF and NF stain positive for vimentin but negative for cytokeratin (AE1–AE3 antibody). (Scale bar: 20 μm.) (B) Time-dependent collagen gel contraction induced by NF and CAF. Each point rep- resents means ± SD of eight replicate samples. (CLeft) In contrast to the parent cell lines, NF 094YFPhTERT and CAF 094YFPhTERT continue to proliferate beyond 10–20 population doublings. (Right) The senescence-associated acidic β-galactosidase enzyme activity (blue staining) was detected in primary fibroblasts that failed to continue doubling but not in hTERT-immortalized cells.
Load more

Recommended publications
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • Methylglyoxal Down-Regulates the Expression of Cell Cycle Associated
    www.nature.com/scientificreports OPEN Methylglyoxal down-regulates the expression of cell cycle associated genes and activates the p53 Received: 8 May 2018 Accepted: 12 December 2018 pathway in human umbilical vein Published: xx xx xxxx endothelial cells Jana D. Braun1, Diego O. Pastene1, Annette Breedijk1, Angelica Rodriguez1, Björn B. Hofmann1, Carsten Sticht2, Elke von Ochsenstein3, Heike Allgayer3, Jacob van den Born4, Stephan Bakker4, Sibylle J. Hauske1, Bernhard K. Krämer1, Benito A. Yard1 & Thomas Albrecht1 Although methylglyoxal (MGO) has emerged as key mediator of diabetic microvascular complications, the infuence of MGO on the vascular transcriptome has not thoroughly been assessed. Since diabetes is associated with low grade infammation causing sustained nuclear factor-kappa B (NF-κB) activation, the current study addressed 1) to what extent MGO changes the transcriptome of human umbilical vein endothelial cells (HUVECs) exposed to an infammatory milieu, 2) what are the dominant pathways by which these changes occur and 3) to what extent is this afected by carnosine, a putative scavenger of MGO. Microarray analysis revealed that exposure of HUVECs to high MGO concentrations signifcantly changes gene expression, characterized by prominent down-regulation of cell cycle associated genes and up-regulation of heme oxygenase-1 (HO-1). KEGG-based pathway analysis identifed six signifcantly enriched pathways of which the p53 pathway was the most afected. No signifcant enrichment of infammatory pathways was found, yet, MGO did inhibit VCAM-1 expression in Western blot analysis. Carnosine signifcantly counteracted MGO-mediated changes in a subset of diferentially expressed genes. Collectively, our results suggest that MGO initiates distinct transcriptional changes in cell cycle/apoptosis genes, which may explain MGO toxicity at high concentrations.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Protein EVI2B Gene Symbol Evi2b Organism Mouse Gene Summary Description Not Available Gene Aliases Evi-2, Evi2 RefSeq Accession No. NC_000077.6, NT_096135.6 UniGene ID Not Available Ensembl Gene ID ENSMUSG00000093938 Entrez Gene ID 216984 Assay Information Unique Assay ID qMmuCEP0062720 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000179322, ENSMUST00000170422 Amplicon Context Sequence ACAGTATAATCATGAGTATAGCTACCAACATAGAAATTATAATAGTACCGATTAAT ATGGCAGCAATTGCATTGTGGTTGTTTTTATGAGCAGTTCCTTTGCCACTTGGTG GTTCTGAAGTGAGTGGTGGTGGTGGTGGTGGTG Amplicon Length (bp) 114 Chromosome Location 11:79516072-79516215 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9997 cDNA Cq 22.69 cDNA Tm (Celsius) 79 gDNA Cq 24.61 Specificity (%) 49.93 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Evi2b, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Bioinformatic
    CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Bioinformatic Comparison of the EVI2A Promoter and Coding Regions A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology By Max Weinstein May 2020 The thesis of Max Weinstein is approved: Professor Rheem D. Medh Date Professor Virginia Oberholzer Vandergon Date Professor Cindy Malone, Chair Date California State University Northridge ii Table of Contents Signature Page ii List of Figures v Abstract vi Introduction 1 Ecotropic Viral Integration Site 2A, a Gene within a Gene 7 Materials and Methods 11 PCR and Cloning of Recombinant Plasmid 11 Transformation and Cell Culture 13 Generation of Deletion Constructs 15 Transfection and Luciferase Assay 16 Identification of Transcription Factor Binding Sites 17 Determination of Region for Analysis 17 Multiple Sequence Alignment (MSA) 17 Model Testing 18 Tree Construction 18 Promoter and CDS Conserved Motif Search 19 Results and Discussion 20 Choice of Species for Analysis 20 Mapping of Potential Transcription Factor Binding Sites 20 Confirmation of Plasmid Generation through Gel Electrophoresis 21 Analysis of Deletion Constructs by Transient Transfection 22 EVI2A Coding DNA Sequence Phylogenetics 23 EVI2A Promoter Phylogenetics 23 EVI2A Conserved Leucine Zipper 25 iii EVI2A Conserved Casein kinase II phosphorylation site 26 EVI2A Conserved Sox-5 Binding Site 26 EVI2A Conserved HLF Binding Site 27 EVI2A Conserved cREL Binding Site 28 EVI2A Conserved CREB Binding Site 28 Summary 29 Appendix: Figures 30 Literature Cited 44 iv List of Figures Figure 1. EVI2A is nested within the gene NF1 30 Figure 2 Putative Transcriptions Start Site 31 Figure 3. Gel Electrophoresis of pGC Blue cloned, Restriction Digested Plasmid 32 Figure 4.
    [Show full text]
  • Identification and Validation of Genes Affecting Aortic Lesions in Mice
    Identification and validation of genes affecting aortic lesions in mice Xia Yang, … , Aldons J. Lusis, Pek Yee Lum J Clin Invest. 2010;120(7):2414-2422. https://doi.org/10.1172/JCI42742. Research Article Cardiology Atherosclerosis represents the most significant risk factor for coronary artery disease (CAD), the leading cause of death in developed countries. To better understand the pathogenesis of atherosclerosis, we applied a likelih​ ood-based model selection method to infer gene-disease causality relationships for the aortic lesion trait in a segregating mouse population demonstrating a spectrum of susceptibility to developing atherosclerotic lesions. We identified 292 genes that tested causal for aortic lesions from liver and adipose tissues of these mice, and we experimentally validated one of these candidate causal genes, complement component 3a receptor 1 (C3ar1), using a knockout mouse model. We also found that genes identified by this method overlapped with genes progressively regulated in the aortic arches of 2 mouse models of atherosclerosis during atherosclerotic lesion development. By comparing our gene set with findings from public human genome-wide association studies (GWAS) of CAD and related traits, we found that 5 genes identified by our study overlapped with published studies in humans in which they were identified as risk factors for multiple atherosclerosis- related pathologies, including myocardial infarction, serum uric acid levels, mean platelet volume, aortic root size, and heart failure. Candidate causal genes were also found to be enriched with CAD risk polymorphisms identified by the Wellcome Trust Case Control Consortium (WTCCC). Our findings therefore validate the ability of causality testing procedures to […] Find the latest version: https://jci.me/42742/pdf Research article Identification and validation of genes affecting aortic lesions in mice Xia Yang,1,2 Larry Peterson,3 Rolf Thieringer,4 Joshua L.
    [Show full text]
  • WNT16 Is a New Marker of Senescence
    Table S1. A. Complete list of 177 genes overexpressed in replicative senescence Value Gene Description UniGene RefSeq 2.440 WNT16 wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, mRNA. Hs.272375 NM_016087 2.355 MMP10 matrix metallopeptidase 10 (stromelysin 2) (MMP10), mRNA. Hs.2258 NM_002425 2.344 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) (MMP3), mRNA. Hs.375129 NM_002422 2.300 HIST1H2AC Histone cluster 1, H2ac Hs.484950 2.134 CLDN1 claudin 1 (CLDN1), mRNA. Hs.439060 NM_021101 2.119 TSPAN13 tetraspanin 13 (TSPAN13), mRNA. Hs.364544 NM_014399 2.112 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 2.070 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 2.026 DCBLD2 discoidin, CUB and LCCL domain containing 2 (DCBLD2), mRNA. Hs.203691 NM_080927 2.007 SERPINB2 serpin peptidase inhibitor, clade B (ovalbumin), member 2 (SERPINB2), mRNA. Hs.594481 NM_002575 2.004 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 1.989 OBFC2A Oligonucleotide/oligosaccharide-binding fold containing 2A Hs.591610 1.962 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 1.947 PLCB4 phospholipase C, beta 4 (PLCB4), transcript variant 2, mRNA. Hs.472101 NM_182797 1.934 PLCB4 phospholipase C, beta 4 (PLCB4), transcript variant 1, mRNA. Hs.472101 NM_000933 1.933 KRTAP1-5 keratin associated protein 1-5 (KRTAP1-5), mRNA. Hs.534499 NM_031957 1.894 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 1.884 CYTL1 cytokine-like 1 (CYTL1), mRNA. Hs.13872 NM_018659 tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D), 1.848 TNFRSF10D Hs.213467 NM_003840 mRNA.
    [Show full text]
  • Review Article J Med Genet: First Published As 10.1136/Jmg.33.1.2 on 1 January 1996
    2 J7 Med Genet 1996;33:2-17 Review article J Med Genet: first published as 10.1136/jmg.33.1.2 on 1 January 1996. Downloaded from Molecular genetics of neurofibromatosis type 1 (NFl) Ming Hong Shen, Peter S Harper, Meena Upadhyaya Abstract several discrete entities.'` At least two dis- Neurofibromatosis type 1 (NF1), also tinctive forms, neurofibromatosis type 1 (NF1) called von Recklinghausen disease or peri- and neurofibromatosis type 2 (NF2), were re- pheral neurofibromatosis, is a common cognised and later confirmed by the cloning of autosomal dominant disorder char- two separate genes, the NF1 gene on chro- acterised by multiple neurofibromas, cafe mosome 1746 and the NF2 gene on chro- au lait spots, and Lisch nodules ofthe iris, mosome 22.78 Other NF related syndromes with a variable clinical expression. The were also reported, such as segmental NF,9 gene responsible for this condition, NF1, Watson syndrome,'0 Noonan syndrome," has been isolated by positional cloning. spinal NF,'2 familial cafe au lait spots It spans over 350kb of genomic DNA in (CLS)," and Schwannomatosis.'4 It remains chromosomal region 17qll.2 and encodes to be determined whether such disorders are an mRNA of 11-13 kb containing at least genetically discrete. 59 exons. NFI is widely expressed in a NFl, also called von Recklinghausen disease variety of human and rat tissues. Four or peripheral neurofibromatosis, is a common alternatively spliced NFI transcripts have autosomal dominant disorder affecting about been identified. Three of these transcript 1 in 3000 to 5000 people. It exhibits full pene- isoforms (each with an extra exon: 9br, trance and a high mutation rate with 30 to 23a, and 48a, respectively) show differ- 50% ofNFl patients representing a new muta- ential expression to some extent in various tion.
    [Show full text]
  • Identification of Expression Qtls Targeting Candidate Genes For
    ISSN: 2378-3648 Salleh et al. J Genet Genome Res 2018, 5:035 DOI: 10.23937/2378-3648/1410035 Volume 5 | Issue 1 Journal of Open Access Genetics and Genome Research RESEARCH ARTICLE Identification of Expression QTLs Targeting Candidate Genes for Residual Feed Intake in Dairy Cattle Using Systems Genomics Salleh MS1,2, Mazzoni G2, Nielsen MO1, Løvendahl P3 and Kadarmideen HN2,4* 1Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark Check for 2Department of Bio and Health Informatics, Technical University of Denmark, Lyngby, Denmark updates 3Department of Molecular Biology and Genetics-Center for Quantitative Genetics and Genomics, Aarhus University, AU Foulum, Tjele, Denmark 4Department of Applied Mathematics and Computer Science, Technical University of Denmark, Lyngby, Denmark *Corresponding author: Kadarmideen HN, Department of Applied Mathematics and Computer Science, Technical University of Denmark, DK-2800, Kgs. Lyngby, Denmark, E-mail: [email protected] Abstract body weight gain and net merit). The eQTLs and biological pathways identified in this study improve our understanding Background: Residual feed intake (RFI) is the difference of the complex biological and genetic mechanisms that de- between actual and predicted feed intake and an important termine FE traits in dairy cattle. The identified eQTLs/genet- factor determining feed efficiency (FE). Recently, 170 can- ic variants can potentially be used in new genomic selection didate genes were associated with RFI, but no expression methods that include biological/functional information on quantitative trait loci (eQTL) mapping has hitherto been per- SNPs. formed on FE related genes in dairy cows. In this study, an integrative systems genetics approach was applied to map Keywords eQTLs in Holstein and Jersey cows fed two different diets to eQTL, RNA-seq, Genotype, Data integration, Systems improve identification of candidate genes for FE.
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Microarray Bioinformatics and Its Applications to Clinical Research
    Microarray Bioinformatics and Its Applications to Clinical Research A dissertation presented to the School of Electrical and Information Engineering of the University of Sydney in fulfillment of the requirements for the degree of Doctor of Philosophy i JLI ··_L - -> ...·. ...,. by Ilene Y. Chen Acknowledgment This thesis owes its existence to the mercy, support and inspiration of many people. In the first place, having suffering from adult-onset asthma, interstitial cystitis and cold agglutinin disease, I would like to express my deepest sense of appreciation and gratitude to Professors Hong Yan and David Levy for harbouring me these last three years and providing me a place at the University of Sydney to pursue a very meaningful course of research. I am also indebted to Dr. Craig Jin, who has been a source of enthusiasm and encouragement on my research over many years. In the second place, for contexts concerning biological and medical aspects covered in this thesis, I am very indebted to Dr. Ling-Hong Tseng, Dr. Shian-Sehn Shie, Dr. Wen-Hung Chung and Professor Chyi-Long Lee at Change Gung Memorial Hospital and University of Chang Gung School of Medicine (Taoyuan, Taiwan) as well as Professor Keith Lloyd at University of Alabama School of Medicine (AL, USA). All of them have contributed substantially to this work. In the third place, I would like to thank Mrs. Inge Rogers and Mr. William Ballinger for their helpful comments and suggestions for the writing of my papers and thesis. In the fourth place, I would like to thank my swim coach, Hirota Homma.
    [Show full text]
  • Differentially Expressed Genes in Aneurysm Tissue Compared With
    On-line Table: Differentially expressed genes in aneurysm tissue compared with those in control tissue Fold False Discovery Direction of Gene Entrez Gene Name Function Change P Value Rate (q Value) Expression AADAC Arylacetamide deacetylase Positive regulation of triglyceride 4.46 1.33E-05 2.60E-04 Up-regulated catabolic process ABCA6 ATP-binding cassette, subfamily A (ABC1), Integral component of membrane 3.79 9.15E-14 8.88E-12 Up-regulated member 6 ABCC3 ATP-binding cassette, subfamily C (CFTR/MRP), ATPase activity, coupled to 6.63 1.21E-10 7.33E-09 Up-regulated member 3 transmembrane movement of substances ABI3 ABI family, member 3 Peptidyl-tyrosine phosphorylation 6.47 2.47E-05 4.56E-04 Up-regulated ACKR1 Atypical chemokine receptor 1 (Duffy blood G-protein–coupled receptor signaling 3.80 7.95E-10 4.18E-08 Up-regulated group) pathway ACKR2 Atypical chemokine receptor 2 G-protein–coupled receptor signaling 0.42 3.29E-04 4.41E-03 Down-regulated pathway ACSM1 Acyl-CoA synthetase medium-chain family Energy derivation by oxidation of 9.87 1.70E-08 6.52E-07 Up-regulated member 1 organic compounds ACTC1 Actin, ␣, cardiac muscle 1 Negative regulation of apoptotic 0.30 7.96E-06 1.65E-04 Down-regulated process ACTG2 Actin, ␥2, smooth muscle, enteric Blood microparticle 0.29 1.61E-16 2.36E-14 Down-regulated ADAM33 ADAM domain 33 Integral component of membrane 0.23 9.74E-09 3.95E-07 Down-regulated ADAM8 ADAM domain 8 Positive regulation of tumor necrosis 4.69 2.93E-04 4.01E-03 Up-regulated factor (ligand) superfamily member 11 production ADAMTS18
    [Show full text]