Identification of Expression Qtls Targeting Candidate Genes For

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ISSN: 2378-3648 Salleh et al. J Genet Genome Res 2018, 5:035 DOI: 10.23937/2378-3648/1410035 Volume 5 | Issue 1 Journal of Open Access Genetics and Genome Research RESEARCH ARTICLE Identification of Expression QTLs Targeting Candidate Genes for Residual Feed Intake in Dairy Cattle Using Systems Genomics Salleh MS1,2, Mazzoni G2, Nielsen MO1, Løvendahl P3 and Kadarmideen HN2,4* 1Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark Check for 2Department of Bio and Health Informatics, Technical University of Denmark, Lyngby, Denmark updates 3Department of Molecular Biology and Genetics-Center for Quantitative Genetics and Genomics, Aarhus University, AU Foulum, Tjele, Denmark 4Department of Applied Mathematics and Computer Science, Technical University of Denmark, Lyngby, Denmark *Corresponding author: Kadarmideen HN, Department of Applied Mathematics and Computer Science, Technical University of Denmark, DK-2800, Kgs. Lyngby, Denmark, E-mail: [email protected] Abstract body weight gain and net merit). The eQTLs and biological pathways identified in this study improve our understanding Background: Residual feed intake (RFI) is the difference of the complex biological and genetic mechanisms that de- between actual and predicted feed intake and an important termine FE traits in dairy cattle. The identified eQTLs/genet- factor determining feed efficiency (FE). Recently, 170 can- ic variants can potentially be used in new genomic selection didate genes were associated with RFI, but no expression methods that include biological/functional information on quantitative trait loci (eQTL) mapping has hitherto been per- SNPs. formed on FE related genes in dairy cows. In this study, an integrative systems genetics approach was applied to map Keywords eQTLs in Holstein and Jersey cows fed two different diets to eQTL, RNA-seq, Genotype, Data integration, Systems improve identification of candidate genes for FE. genomics, Feed efficiency, Residual feed intake Methods: Liver RNA-seq transcriptomics data from nine Abbreviations Holstein and ten Jersey cows that had been fed control (C) or high concentrate (HC) diets were integrated with genomic ANOVA: Analysis of Variance; C: Low Concentrate (Con- data (from 777k BovineHD Illumina BeadChip) by using the trol); DCRC: Danish Cattle Research Centre; DEGs: Dif- Matrix eQTL R package. A total of 170 previously identified ferentially Expressed Genes; EDTA: Ethylenediamine- candidate genes for FE (89 differentially expressed genes tetraacetic Acid; eQTL: Expression Quantitative Trait Loci; (DEGs) between high and low RFI groups and 81 hub FDR: False Discovery Rate; FE: Feed Efficiency; HC: High genes (HG) in a group of co-expressed genes) were used in Concentrate; HG: Hub Genes; Mb: Mega Base; QTL: Quan- the data integration analysis. titative Trait Loci; RFI: Residual Feed Intake; RNA: Ribonu- cleic Acid; RNA-seq: RNA Sequencing; SNPs: Single Nu- Results: From the 241,542 SNPs used in the analysis, cleotide Polymorphisms; WGCNA: Weighted Gene Co-ex- we identified 20 significant (FDR < 0.05) local-eQTLs tar- pression Analysis geting seven candidate genes and 16 significant (FDR < 0.05) local-eQTLs targeting five candidate genes related to RFI for the C and HC diet group analysis, respectively, in a Background breed-specific way. Feed intake and the conversion of absorbed nutri- Conclusions: Interestingly, Holstein and Jersey cows ap- pear to rely on different strategies (lipid and cholesterol ents into milk components are major determinants of metabolism versus immune and inflammatory function) to feed efficiency (FE) in dairy cattle and hence production achieve low RFI. The eQTLs overlapped with QTLs previous- economics. FE is a complex trait that is influenced by ly associated with FE trait (e.g. dry matter intake, longevity, several genetic and environmental factors, which in an Citation: Salleh MS, Mazzoni G, Nielsen MO, Løvendahl P, Kadarmideen HN (2018) Identification of Expression QTLs Targeting Candidate Genes for Residual Feed Intake in Dairy Cattle Using Systems Genomics. J Genet Genome Res 5:035. doi.org/10.23937/2378-3648/1410035 Accepted: July 14, 2018: Published: July 16, 2018 Copyright: © 2018 Salleh MS, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Salleh et al. J Genet Genome Res 2018, 5:035 • Page 1 of 14 • DOI: 10.23937/2378-3648/1410035 ISSN: 2378-3648 interactive way control feed intake, nutrient partition- between the phenotype and the genome. Therefore, ing and metabolic adaptation to lactation in different eQTL analysis can identify interesting genetic variants body tissues as well as milk synthesis and immune func- even with a low sample size [12,13]. The identification tion. In dairy cattle, the use of FE for breeding purposes of genomic regions influencing the expressions of the is quite complicated, since recording of individual feed candidate genes could give a better perspective to use intake is difficult in group fed cows. It is therefore de- the information in animal selection as well as provide a sirable to be able to predict the genetic contributions better explanation about the way genomic regions con- to this trait to be able to select the most feed efficient trol traits of interest. cows for breeding purposes. A few studies have been conducted to identify ge- To date, transcriptomics has given precise and re- nomic regions determining FE traits in beef cattle, chick- liable results that identify candidate genes related to en and other livestock species [14-17]. However, no phenotypes of interest [1]. Although gene expressions eQTL mapping has hitherto been performed on FE relat- associated with FE related genes have been studied ed genes in dairy cows. for a long time, also in cattle [2-4], genetic markers are In this study, we performed an eQTL mapping anal- more easily accessible and not affected by environmen- ysis on candidate genes for the RFI trait. The hypoth- tal factors in contrast to gene expression data. esis of the integrative genomics analysis is that SNPs However, in some cows, the actual feed intake devi- associated with the expression of candidate genes are ate from the predicted by their genetic heritage, even involved or in linkage with genomic regions regulat- when they are exposed to similar environmental condi- ing their expression. Therefore, the objective of this tions. The term residual feed intake (RFI) describes this study was to identify eQTL regions together with their deviation and is calculated as the difference between functional annotations associated with the RFI trait in the actual measured and the predicted feed intake of two breeds of dairy cattle (Danish Holstein and Danish the cow [5]. Among groups of high and low RFI cattle, Jersey) fed two different diets and to present an eQTL we have recently identified several candidate genes mapping of candidate genes for RFI using matrix eQTL that predict the RFI in Danish dairy cattle [6]. analysis, as well as characterize the SNPs by comparing our findings with previously annotated QTLs. The eQTL Therefore, in this present study we focused on ge- identified in this study could be important candidate -ge netic markers for RFI in an attempt to improve the pre- netic markers defining actual FE in dairy cattle, and our diction of genetic merit for FE, which is needed to be study suggests that there are differential traits relating able to use this type of determinants in practice. to RFI in Danish Holsteins as compared to Jerseys. Integration of transcriptomics and genomics data can be used to identify potential causal genetic vari- Materials and Methods ants that affect particular phenotypes. This approach is Experimental animals, RFI characteristics and ex- known as Genetical Genomics or Integrative Genomics perimental design [7]. The identified regions are called expression Quanti- tative Trait Loci (eQTL). In other words, an eQTL is a re- The present study is based on biological samples ob- gion in a particular locus that influences or controls the tained from nine Holstein and ten Jersey cows, housed differences of expressions of causal genes [8-11]. The at the Danish Cattle Research Centre (DCRC), Aarhus expression profile is an intermediate biological space University, Denmark. The animals were part of a larg- 1.5 1 0.5 Low-RFI 0 Holstein Jersey High-RFI -0.5 Residual Feed Intake -1 -1.5 Figure 1: Mean ± SE of Residual Feed Intake (RFI) value for the Holstein and Jersey cows used in the present experiment [6]. Salleh et al. J Genet Genome Res 2018, 5:035 • Page 2 of 14 • DOI: 10.23937/2378-3648/1410035 ISSN: 2378-3648 er experiment, where FE was determined in 200 dairy vine reference genome release 82 using STAR aligner cows distributed on the two breeds [18]. The details [20]. After the alignment, quality control of the mapped about the animal’s background and the overall experi- reads was done using Qualimap version 2.0 [21]. Then mental design of the larger trial can be found in Salleh, the HTSeq-count tool was used to compute the gene et al. and Li, et al. [6,18]. expression counts [22]. The DEGs analyses were done using DESeq2 package [23] and weighted gene co-ex- The experimental cows used in the present study pression analyses using WGCNA package [24]. Hub were selected based on individually recorded RFI of genes were selected from the top significant modules cows from the larger study. A total of four Holstein cows that have significant association with RFI trait and hav- with very high and five with very low RFI, and five Jer- ing more than 80% module membership. The RNA-seq sey cows with very high and five with very low RFI were data for the present study is available in selected, and their deviation from the average recorded RFI is shown in Figure 1.
Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf

    PARSANA-DISSERTATION-2020.Pdf

    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
  • CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data

    CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point
  • Acetyl-Coa Synthetase 3 Promotes Bladder Cancer Cell Growth Under Metabolic Stress Jianhao Zhang1, Hongjian Duan1, Zhipeng Feng1,Xinweihan1 and Chaohui Gu2

    Acetyl-Coa Synthetase 3 Promotes Bladder Cancer Cell Growth Under Metabolic Stress Jianhao Zhang1, Hongjian Duan1, Zhipeng Feng1,Xinweihan1 and Chaohui Gu2

    Zhang et al. Oncogenesis (2020) 9:46 https://doi.org/10.1038/s41389-020-0230-3 Oncogenesis ARTICLE Open Access Acetyl-CoA synthetase 3 promotes bladder cancer cell growth under metabolic stress Jianhao Zhang1, Hongjian Duan1, Zhipeng Feng1,XinweiHan1 and Chaohui Gu2 Abstract Cancer cells adapt to nutrient-deprived tumor microenvironment during progression via regulating the level and function of metabolic enzymes. Acetyl-coenzyme A (AcCoA) is a key metabolic intermediate that is crucial for cancer cell metabolism, especially under metabolic stress. It is of special significance to decipher the role acetyl-CoA synthetase short chain family (ACSS) in cancer cells confronting metabolic stress. Here we analyzed the generation of lipogenic AcCoA in bladder cancer cells under metabolic stress and found that in bladder urothelial carcinoma (BLCA) cells, the proportion of lipogenic AcCoA generated from glucose were largely reduced under metabolic stress. Our results revealed that ACSS3 was responsible for lipogenic AcCoA synthesis in BLCA cells under metabolic stress. Interestingly, we found that ACSS3 was required for acetate utilization and histone acetylation. Moreover, our data illustrated that ACSS3 promoted BLCA cell growth. In addition, through analyzing clinical samples, we found that both mRNA and protein levels of ACSS3 were dramatically upregulated in BLCA samples in comparison with adjacent controls and BLCA patients with lower ACSS3 expression were entitled with longer overall survival. Our data revealed an oncogenic role of ACSS3 via regulating AcCoA generation in BLCA and provided a promising target in metabolic pathway for BLCA treatment. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction acetyl-CoA synthetase short chain family (ACSS), which In cancer cells, considerable number of metabolic ligates acetate and CoA6.
  • Environmental Influences on Endothelial Gene Expression

    Environmental Influences on Endothelial Gene Expression

    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Cytotoxic Effects and Changes in Gene Expression Profile

    Cytotoxic Effects and Changes in Gene Expression Profile

    Toxicology in Vitro 34 (2016) 309–320 Contents lists available at ScienceDirect Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit Fusarium mycotoxin enniatin B: Cytotoxic effects and changes in gene expression profile Martina Jonsson a,⁎,MarikaJestoib, Minna Anthoni a, Annikki Welling a, Iida Loivamaa a, Ville Hallikainen c, Matti Kankainen d, Erik Lysøe e, Pertti Koivisto a, Kimmo Peltonen a,f a Chemistry and Toxicology Research Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, Finland b Product Safety Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, c The Finnish Forest Research Institute, Rovaniemi Unit, P.O. Box 16, FI-96301 Rovaniemi, Finland d Institute for Molecular Medicine Finland (FIMM), University of Helsinki, P.O. Box 20, FI-00014, Finland e Plant Health and Biotechnology, Norwegian Institute of Bioeconomy, Høyskoleveien 7, NO -1430 Ås, Norway f Finnish Safety and Chemicals Agency (Tukes), Opastinsilta 12 B, FI-00521 Helsinki, Finland article info abstract Article history: The mycotoxin enniatin B, a cyclic hexadepsipeptide produced by the plant pathogen Fusarium,isprevalentin Received 3 December 2015 grains and grain-based products in different geographical areas. Although enniatins have not been associated Received in revised form 5 April 2016 with toxic outbreaks, they have caused toxicity in vitro in several cell lines. In this study, the cytotoxic effects Accepted 28 April 2016 of enniatin B were assessed in relation to cellular energy metabolism, cell proliferation, and the induction of ap- Available online 6 May 2016 optosis in Balb 3T3 and HepG2 cells. The mechanism of toxicity was examined by means of whole genome ex- fi Keywords: pression pro ling of exposed rat primary hepatocytes.
  • PEX5 Regulates Autophagy Via the Mtorc1-TFEB Axis During Starvation

    PEX5 Regulates Autophagy Via the Mtorc1-TFEB Axis During Starvation

    Eun et al. Experimental & Molecular Medicine (2018) 50:4 DOI 10.1038/s12276-017-0007-8 Experimental & Molecular Medicine ARTICLE Open Access PEX5 regulates autophagy via the mTORC1-TFEB axis during starvation So Young Eun1,JoonNoLee2,In-KooNam2, Zhi-qiang Liu1,Hong-SeobSo 1, Seong-Kyu Choe1 and RaeKil Park2 Abstract Defects in the PEX5 gene impair the import of peroxisomal matrix proteins, leading to nonfunctional peroxisomes and other associated pathological defects such as Zellweger syndrome. Although PEX5 regulates autophagy process in a stress condition, the mechanisms controlling autophagy by PEX5 under nutrient deprivation are largely unknown. Herein, we show a novel function of PEX5 in the regulation of autophagy via Transcription Factor EB (TFEB). Under serum-starved conditions, when PEX5 is depleted, the mammalian target of rapamycin (mTORC1) inhibitor TSC2 is downregulated, which results in increased phosphorylation of the mTORC1 substrates, including 70S6K, S6K, and 4E- BP-1. mTORC1 activation further suppresses the nuclear localization of TFEB, as indicated by decreased mRNA levels of TFEB, LIPA, and LAMP1. Interestingly, peroxisomal mRNA and protein levels are also reduced by TFEB inactivation, indicating that TFEB might control peroxisome biogenesis at a transcriptional level. Conversely, pharmacological inhibition of mTOR resulting from PEX5 depletion during nutrient starvation activates TFEB by promoting nuclear localization of the protein. In addition, mTORC1 inhibition recovers the damaged-peroxisome biogenesis. These data suggest that PEX5 may be a critical regulator of lysosomal gene expression and autophagy through the mTOR-TFEB- autophagy axis under nutrient deprivation. 1234567890():,; 1234567890():,; Introduction Mitochondrial antiviral-signaling protein (MAVS) func- Peroxisome is an essential cellular organelle for per- tions as an antiviral signaling platform to induce the forming various metabolic activities, including oxidation interferon-independent signaling pathways4.
  • Snps) Distant from Xenobiotic Response Elements Can Modulate Aryl Hydrocarbon Receptor Function: SNP-Dependent CYP1A1 Induction S

    Snps) Distant from Xenobiotic Response Elements Can Modulate Aryl Hydrocarbon Receptor Function: SNP-Dependent CYP1A1 Induction S

    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/07/06/dmd.118.082164.DC1 1521-009X/46/9/1372–1381$35.00 https://doi.org/10.1124/dmd.118.082164 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:1372–1381, September 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Single Nucleotide Polymorphisms (SNPs) Distant from Xenobiotic Response Elements Can Modulate Aryl Hydrocarbon Receptor Function: SNP-Dependent CYP1A1 Induction s Duan Liu, Sisi Qin, Balmiki Ray,1 Krishna R. Kalari, Liewei Wang, and Richard M. Weinshilboum Division of Clinical Pharmacology, Department of Molecular Pharmacology and Experimental Therapeutics (D.L., S.Q., B.R., L.W., R.M.W.) and Division of Biomedical Statistics and Informatics, Department of Health Sciences Research (K.R.K.), Mayo Clinic, Rochester, Minnesota Received April 22, 2018; accepted June 28, 2018 ABSTRACT Downloaded from CYP1A1 expression can be upregulated by the ligand-activated aryl fashion. LCLs with the AA genotype displayed significantly higher hydrocarbon receptor (AHR). Based on prior observations with AHR-XRE binding and CYP1A1 mRNA expression after 3MC estrogen receptors and estrogen response elements, we tested treatment than did those with the GG genotype. Electrophoretic the hypothesis that single-nucleotide polymorphisms (SNPs) map- mobility shift assay (EMSA) showed that oligonucleotides with the ping hundreds of base pairs (bp) from xenobiotic response elements AA genotype displayed higher LCL nuclear extract binding after (XREs) might influence AHR binding and subsequent gene expres- 3MC treatment than did those with the GG genotype, and mass dmd.aspetjournals.org sion.
  • 1 Supporting Information for a Microrna Network Regulates

    1 Supporting Information for a Microrna Network Regulates

    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
  • Enzyme DHRS7

    Enzyme DHRS7

    Toward the identification of a function of the “orphan” enzyme DHRS7 Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Selene Araya, aus Lugano, Tessin Basel, 2018 Originaldokument gespeichert auf dem Dokumentenserver der Universität Basel edoc.unibas.ch Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Alex Odermatt (Fakultätsverantwortlicher) und Prof. Dr. Michael Arand (Korreferent) Basel, den 26.6.2018 ________________________ Dekan Prof. Dr. Martin Spiess I. List of Abbreviations 3α/βAdiol 3α/β-Androstanediol (5α-Androstane-3α/β,17β-diol) 3α/βHSD 3α/β-hydroxysteroid dehydrogenase 17β-HSD 17β-Hydroxysteroid Dehydrogenase 17αOHProg 17α-Hydroxyprogesterone 20α/βOHProg 20α/β-Hydroxyprogesterone 17α,20α/βdiOHProg 20α/βdihydroxyprogesterone ADT Androgen deprivation therapy ANOVA Analysis of variance AR Androgen Receptor AKR Aldo-Keto Reductase ATCC American Type Culture Collection CAM Cell Adhesion Molecule CYP Cytochrome P450 CBR1 Carbonyl reductase 1 CRPC Castration resistant prostate cancer Ct-value Cycle threshold-value DHRS7 (B/C) Dehydrogenase/Reductase Short Chain Dehydrogenase Family Member 7 (B/C) DHEA Dehydroepiandrosterone DHP Dehydroprogesterone DHT 5α-Dihydrotestosterone DMEM Dulbecco's Modified Eagle's Medium DMSO Dimethyl Sulfoxide DTT Dithiothreitol E1 Estrone E2 Estradiol ECM Extracellular Membrane EDTA Ethylenediaminetetraacetic acid EMT Epithelial-mesenchymal transition ER Endoplasmic Reticulum ERα/β Estrogen Receptor α/β FBS Fetal Bovine Serum 3 FDR False discovery rate FGF Fibroblast growth factor HEPES 4-(2-Hydroxyethyl)-1-Piperazineethanesulfonic Acid HMDB Human Metabolome Database HPLC High Performance Liquid Chromatography HSD Hydroxysteroid Dehydrogenase IC50 Half-Maximal Inhibitory Concentration LNCaP Lymph node carcinoma of the prostate mRNA Messenger Ribonucleic Acid n.d.
  • Protein Biomarkers Analysis Within Muscular Dystrophies

    Protein Biomarkers Analysis Within Muscular Dystrophies

    EXAMENSARBETE INOM BIOTEKNIK, AVANCERAD NIVÅ, 30 HP STOCKHOLM, SVERIGE 2017 Protein biomarkers analysis within muscular dystrophies SANDRA MENA KTH SKOLAN FÖR BIOTEKNOLOGI PROTEIN BIOMARKERS ANALYSIS WITHIN MUSCULAR DYSTROPHIES Master thesis Author: Sandra Carolina Mena Pérez Supervisor: Cristina Al-Khalili Szigyarto Stockholm 2017 Master’s program: Medical Biotechnology Kungliga Tekniska Högskolan Content Abstract .........................................................................................................................................................1 Abstrakt .........................................................................................................................................................1 Introduction .................................................................................................................................................1 Materials and Methods ............................................................................................................................ 3 Results and Discussion ............................................................................................................................ 4 Conclusion .................................................................................................................................................. 11 Future Perspectives ................................................................................................................................. 11 Aknowledgments ....................................................................................................................................