DOCSLIB.ORG

Physical Mapping of Complex Genomes by Cosmid Multiplex Analysis (Genomic Cloning/Chromosome Li/Genomic Data Base/Human Genome/DNA Fingerprinting) G

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Physical Mapping of Complex Genomes by Cosmid Multiplex Analysis (Genomic Cloning/Chromosome Li/Genomic Data Base/Human Genome/DNA Fingerprinting) G Proc. Nati. Acad. Sci. USA Vol. 86, pp. 5030-5034, July 1989 Genetics Physical mapping of complex genomes by cosmid multiplex analysis (genomic cloning/chromosome li/genomic data base/human genome/DNA fingerprinting) G. A. EVANS* AND K. A. LEWIS Molecular Genetics Laboratory, The Salk Institute for Biological Studies, La Jolla, CA 92037 Communicated by Renato Dulbecco, March 27, 1989 (receivedfor review January 20, 1989) ABSTRACT A rapid and powerful approach for linking In this paper, we describe an alternate strategy for bottom- individual clones ofa cosmid library and the assembly ofa large up mapping that is applicable to the analysis of mammalian physical map is presented, which depends on the simultaneous chromosomes and allows for the simultaneous determination analysis of many cosmid clones for overlapping regions. This ofoverlaps between cosmid clones analyzed in pools. Rather method uses cosmid vectors that contain endogenous bacteri- than depending on fingerprinting procedures for detection of ophage T3 and T7 promoters to allow for the identification of overlapping clones, we constructed cosmid libraries by using overlapping clones through the synthesis of end-specific RNA vectors containing T3 or T7 bacteriophage promoters flank- probes. A genomic library is constructed and organized as an ing the cloned genomic DNA (10, 11) such that overlapping ordered matrix such that each done is assigned an identifying sequences could be detected by hybridization. To test the coordinate. DNA from mixtures ofcosmid clones is pooled such feasibility of this strategy, we analyzed 960 clones isolated that each pool contains only one common member with any from human chromosome 11 for overlapping regions by other pool, RNA probes are prepared from mixtures of cosmid preparing 68 mixed RNA probes, which were used for clones, and groups of clones overlapping with the constituents hybridization to replicas of this filter. This simple procedure ofthe mixtures are determined by hybridization. Pooled probes resulted in the ordering of cosmid clones spanning 11q13- are most simply prepared by grouping clones according to the llqter and the identification ofcontigs containing many ofthe rows and columns of the library matrix. The pairwise com- genes mapping to this chromosome. This method is poten- parison ofdata generated by the hybridization ofmixed probes tially applicable to cloning, ordering clones, and physical can be decoded by using simple algorithms that predict the mapping of other complex genomes as well. order and linkage of all clones in the collection and organize them into predicted contigs. To demonstrate the feasibility of multiplexed analysis of cosmids, a genomic library was pre- MATERIALS AND METHODS pared from a mouse-human somatic cell hybrid that contains Cell Lines. TG 5D1-1 is a Friend cell line derived from a portion of the long arm of human chromosome 11. Prepa- somatic cell hybrid 5D1 [which carries an intact human X ration, arrangement on a matrix, and analysis ofpooled cosmid chromosome and chromosome 11 (12)] and selected with clones from this collection resulted in the detection of 1099 6-thioguanine for the loss of the entire X chromosome and linked pairs of cosmids, which could be assembled into 315 most ofchromosome 11. TG 5D1-1 contains the distal portion contigs. Thus, with a minimal amount of effort, a substantial of chromosome 11 as the only human material in a mouse portion of this genomic region has been linked in multiple genomic background (13), representing about 0.9o of the overlapping contigs. This method may have practical applica- human genome. tions in the large-scale mapping and sequencing of mammalian Cosmid Vectors and Libraries. Genomic libraries were genomes. constructed in cosmid vector sCos-1 (11), which contains duplicated cos sites for high efficiency microcloning, T3 and The analysis of large genomes will require the application of T7 bacteriophage promoters flanking the unique BamHI both "top-down" and "bottom-up" mapping strategies. The cloning site, two Not I sites for the excision of genomic former strategy depends on the separation on pulsed-field inserts, a selectable gene (SV2-neo9 for mammalian gene DNA rare transfer, and a ColEl origin of replication (see Fig. 1). gels of large fragments generated by using restric- Detailed restriction maps of the cosmid insert in this vector tion endonucleases for physical linkage ofDNA markers and may be rapidly determined by an end-labeling mapping the construction oflong-range maps (1-4). The latter strategy procedure using T3- or T7-specific oligonucleotides (11, 14, depends on identifying overlapping sequences in a large 15). The genomic cosmid library used in this study consisted number ofrandomly selected bacteriophage or cosmid clones of 1.5 x 107 independent clones and was constructed by using by unique restriction enzyme "fingerprinting" (4, 5) and their genomic DNA digested to an average size of 100-120 kilo- assembly into overlapping sets of clones referred to as bases, dephosphorylated with calf intestinal phosphatase, contigs (6). A similar strategy is potentially feasible using and packaged with Gigapak Gold (Stratagene) in vitro pack- megabase-size fragments cloned as yeast artificial chromo- aging lysate (11). Only nonamplified libraries were used, and somes (3). In the past few years, bottom-up mapping strat- cosmid clones were archived in 96-well microtiter plates egies have been successfully applied to generate complete or stored at -700C in LB media with 15% (vol/vol) glycerol and partial genomic maps of Saccharomyces cerevisiae (4), Cae- kanamycin sulfate at 25 pug/ml. norhabditis elegans (5, 7), and Escherichia coli (8). Poustka Library Screening. Cosmid libraries were plated on 576- et al. (9) proposed a different strategy for the ordering of cm2 LB agar trays at a density of 10 clones per cm2, replica cosmid or phage clones organized at high density on a matrix filters were prepared, and filters were hybridized with human by using identifying sequences detected with short oligonu- placenta DNA labeled with [32P]dCTP to a specific activity of cleotide probes. 108 cpm/,ug. Under these hybridization conditions, no back- The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed at: Molecular payment. This article must therefore be hereby marked "advertisement" Genetics Laboratory, The Salk Institute, P.O. Box 85800, San in accordance with 18 U.S.C. §1734 solely to indicate this fact. Diego, CA 92138. 5030 Downloaded by guest on October 1, 2021 Genetics: Evans and Lewis Proc. Natl. Acad. Sci. USA 86 (1989) 5031 ground hybridization was detected against cosmids carrying Notl mouse genomic DNA. Cosmids containing human genomic T3 Promoter DNA inserts were picked with toothpicks, rescreened by BamHl hybridization to 32P-labeled human DNA, and transferred to 96-well archive microtiter plates. Replica transfer ofclones in 96-well microtiter plates and transfer from archived plates to screening filters was carried out with an aluminum "hedge- hog" (5) or a simple laboratory robot (Beckman Biomek 1000). For multiplex analysis, archived cosmids were inoc- ColEl ori sCos-1 ulated on the surface of a nitrocellulose- or nylon-based filter in a matrix or grid pattern using a 36 x 36 matrix based on the size and spacing of the 96-well archive plates. The clones were allowed to grow on the surface of the filter at 370C for 12-15 hr, and bacterial DNA was fixed to the filter by using a standard colony lysis procedure (16). RNA Probe Synthesis and Hybridization Reactions. (Knr ) Cosmids were transferred from archives to fresh 96-well plates containing liquid LB media with kanamycin sulfate at FIG. 1. A vector for cosmid multiplex analysis. The vector 25 Ag/ml and incubated at 370C in a humidified atmosphere sCos-1 contains bacteriophage T3 and T7 promoters flanking a for 6-10 hr. Supernatants from individual wells were pooled, unique BamHI cloning site, Not I sites for expedited restriction and DNA was prepared by using a cosmid minilysate pro- mapping and excision ofthe insert DNA, duplicated cos sites for high cedure (14). RNA probes were synthesized as previously efficiency microcloning, a dominant selection for transfection into described using bacteriophage T3 or T7 polymerase (Strata- mammalian cells (SV2neo9), ampicillin (Amp') and kanamycin (KnD) gene), and [32P]UTP and polymerase reactions were termi- resistance genes, and ColEl origin of replication (11). nated by extraction with phenol and chloroform. The RNA probe was prehybridized with a blocking mixture (a mixture 0.5% (10) and provide strategies for the simultaneous analysis of sonicated human placenta DNA and cloned human repet- of pools of clones. itive sequences at a concentration of 1 mg/ml) as described Overlapping contiguous cosmid clones arranged on an (11) and then hybridized to a replica of the matrix filter for organized matrix may be detected by the synthesis of an 12-18 hr under previously described conditions (11). Filters end-specific RNA probe and hybridization of the probe to a were washed in 0.lx SSC (0.015 M NaCl/0.0015 M sodium replica of the matrix filter. In addition, the use of hybridiza- citrate, pH 7.6)/0.1% SDS at 650C and exposed to x-ray film tion to detect overlapping clones allows a multiplex strategy for 2-8 hr. Restriction enzyme analysis of isolated cosmids where the RNA probes are prepared from predetermined were carried out by using labeled oligonucleotides recogniz- pools of cosmid templates. The templates are pooled such ing the T3 or T7 promoter sequences as described (11, 15). that each two pools contain only one cosmid in common; Data Analysis. The grid coordinates of hybridizing cosmid thus, comparison of the results of hybridization of two clones with each pool ofprobes were entered into a computer different probes to a matrix filter will ensure that clones file and analyzed by using computer programs written by detected by both pools represent that hybridizing to the G.A.E.
Load more

Recommended publications
  • New York Science Journal 2016;9(10) 19 Gene Library Ma Hongbao Brookdale University Hospital A
    New York Science Journal 2016;9(10) http://www.sciencepub.net/newyork Gene Library Ma Hongbao Brookdale University Hospital and Medical Center, Brooklyn, New York 11212, USA [email protected] Abstract: A gene library is a collection of gene clones that represents the genetic material of an organism. There are different types of gene libraries, including cDNA libraries, genomic libraries and randomized mutant libraries. The applications of these libraries depend on the source of the original DNA fragments. Generally in a gene library each DNA fragment is uniquely inserted into a cloning vector and the pool of recombinant DNA molecules is then transferred into a population of bacteria or yeast such that each organism contains on average one construct. As the population of organisms is grown in culture, the DNA molecules contained within them are copied and propagated. [Ma Hongbao. Gene Library. N Y Sci J 2016;9(10):19-23]. ISSN 1554-0200 (print); ISSN 2375-723X (online). http://www.sciencepub.net/newyork. 4. doi:10.7537/marsnys091016.04. Keywords: gene; library; clone; organism; DNA; molecule; copy A gene library is a collection of gene clones that cDNA libraries are useful in reverse genetics, but they represents the genetic material of an organism. In only represent a very small (less than 1%) portion of molecular biology, a library is a collection of DNA the overall genome in a given organism. The fragments stored and propagated in a population of applications of cDNA libraries include: (1) Discovery micro-organisms through the process of molecular of novel genes; (2) Cloning of full-length cDNA cloning.
    [Show full text]
  • Library Construction and Screening
    Library construction and screening • A gene library is a collection of different DNA sequences from an organism, • which has beenAlso called genomic libraries or gene banks. • cloned into a vector for ease of purification, storage and analysis. Uses of gene libraries • To obtain the sequences of genes for analysis, amplification, cloning, and expression. • Once the sequence is known probes, primers, etc. can be synthesized for further diagnostic work using, for example, hybridization reactions, blots and PCR. • Knowledge of a gene sequence also offers the possibility of gene therapy. • Also, gene expression can be used to synthesize a product in particular host cells, e.g. synthesis of human gene products in prokaryotic cells. two types of gene library depending upon the source of the DNA used. 1.genomic library. 2.cDNA library Types of GENE library: • genomic library contains DNA fragments representing the entire genome of an organism. • cDNA library contains only complementary DNA molecules synthesized from mRNA molecules in a cell. Genomic Library : • Made from nuclear DNA of an organism or species. • DNA is cut into clonable size pieces as randomly possible using restriction endonuclease • Genomic libraries contain whole genomic fragments including gene exons and introns, gene promoters, intragenic DNA,origins of replication, etc Construction of Genomic Libraries 1. Isolation of genomic DNA and vector. 2.Cleavage of Genomic DNA and vector by Restriction Endonucleases. 3.Ligation of fragmented DNA with the vector. 4.Transformation of
    [Show full text]
  • Construction of Small-Insert Genomic DNA Libraries Highly Enriched
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 3419-3423, April 1992 Genetics Construction of small-insert genomic DNA libraries highly enriched for microsatellite repeat sequences (marker-selected libraries/CA repeats/sequence-tagged sites/genetic mapping/dog genome) ELAINE A. OSTRANDER*tt, PAM M. JONG*t, JASPER RINE*t, AND GEOFFREY DUYKt§ *Department of Molecular and Cellular Biology, 401 Barker Hall, University of California, Berkeley, CA 94720; tHuman Genome Center, Lawrence Berkeley Laboratory, 1 Cyclotron Road, 74-157, Berkeley, CA 94720; and §Department of Genetics, Howard Hughes Medical Institute, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 Communicated by Philip Leder, January 8, 1992 ABSTRACT We describe an efficient method for the con- Generation of a high-density map of markers for an entire struction of small-insert genomic libraries enriched for highly genome or a single chromosome requires the isolation and polymorphic, simple sequence repeats. With this approach, characterization of hundreds of markers such as microsatel- libraries in which 40-50% of the members contain (CA). lite repeats (10, 11). Two simple yet tedious approaches have repeats are produced, representing an =50-fold enrichment generally been used for this task. One approach is to screen over conventional small-insert genomic DNA libraries. Briefly, a large-insert genomic library with an end-labeled (CA),, or a genomic library with an average insert size of less than 500 (TG),, oligonucleotide (n > 15). Clones that hybridize to the base pairs was constructed in a phagemid vector. Ampliflcation probe are purified and divided into subclones, which are of this library in a dut ung strain ofEscherchia coli allowed the screened by hybridization for a fragment containing the recovery of the library as closed circular single-stranded DNA repeat.
    [Show full text]
  • Cdna Libraries and Expression Libraries
    Solutions for Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. Your vector would certainly need to have a unique restriction enzyme site, a selectable marker such as the ampicillin resistance gene, and a bacterial origin of replication. Other features may be required depending upon how you plan to use this library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? Prior to transformation, the E. coli cells that you will transform will be sensitive to antibiotic. This allows you to select for cells that obtained a plasmid. c) How do you distinguish bacterial cells that carry a vector from those that do not? Cells that obtained a vector will have obtained the selectable marker (one example is the ampicillin resistance gene).
    [Show full text]
  • Genomic Organization of Borna Disease Virus
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 4362-4366, May 1994 Neurobiology Genomic organization of Borna disease virus (central nervous system Infection/behavioral disorders/negative-strand RNA viruses) THOMAS BRIESE*t, ANETTE SCHNEEMANN*, ANN J. LEWIS*, YOO-SUN PARK*, SARA KIM*, HANNS LUDWIGt, AND W. IAN LIPKIN**§¶ Departments of *Neurology, *Anatomy and Neurobiology, and Microbiology and Molecular Genetics, University of California, Irvine, CA 92717; and tInstitute of Virology, Freie Universitit Berlin, Nordufer 20, D 13353 Berlin, Germany Communicated by Hilary Koprowski, January 27, 1994 ABSTRACT Borna disease virus is a neurotropic negative- RNA. The 5'-terminal sequence from each library was used strand RNA virus that infects a wide range ofvertebrate hosts, to design an oligonucleotide primer for construction of the causing disturbances in movement and behavior. We have next library. cloned and sequenced the 8910-nucleotide viral genome by DNA Sequencing and Sequence Analysis. Plasmid DNA was using RNA from Borna disease virus particles. The viral sequenced on both strands by the dideoxynucleotide chain- genome has complementary 3' and 5' termini and contains termination method (13) using a modified bacteriophage T7 antisense information for five open reading frames. Homology DNA polymerase (Sequenase version 2.0; United States to Filoviridae, Paramyxoviridae, and Rhabdoviridae is found Biochemical). Five to 10 independent clones from each in both cistronic and extracistronic regions. Northern analysis library were sequenced with overlap so that each region of indicates that the virus transcribes mono- and polycistronic the genomic RNA was covered by at least 2 clones. Four RNAs and uses terminatlon/polyadenylylation signals remi- libraries were analyzed, yielding =8.9 kb of continuous niscent ofthose observed in other negative-strand RNA viruses.
    [Show full text]
  • Recombinant DNA Resources for the Comparative Genomics of Ancylostoma Ceylanicum
    bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum. Authors: Wadim J. Kapulkin1,5,6#, Adriana Magalska1, Ewa Janecka1, Arkadiusz Ciesielski2,4, Malgorzata Lobocka2, Jerzy M. Behnke3, Halina Wedrychowicz1 # corresponding author 1. Faculty of Veterinary Medicine, Grochowska 272, 03-849 Warsaw, Poland 2. Institute for Biochemistry and Biophysics –PAS, Pawinskiego 5a, 02-106 Warsaw, Poland 3. School of Life Science, University of Nottingham, University Park, NG7 2RD Nottingham, U.K. 4. Department of Chemistry, University of Warsaw, Pasteura 1, 02-093 Warsaw, Poland Present affiliation: 5. Veterinary Consultancy, Conrada 16/65, 01-922 Warsaw, Poland 6. Mobile Veterinary Consultancy, Nottingham, U.K. Phone: (+44)7466449215 e-mail: [email protected] Keywords: Ancylostoma ceylanicum, Recombinant DNA library, SL1 spliced leader, cDNA, Bacterial Artificial Chromosome library, NUMTs 1 bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under
    [Show full text]
  • Construction of Plant Bacterial Artificial Chromosome (Bac) Libraries: an Illustrated Guide
    1 22nd EEDDIITTIIOONN ((22000022)) CONSTRUCTION OF PLANT BACTERIAL ARTIFICIAL CHROMOSOME (BAC) LIBRARIES: AN ILLUSTRATED GUIDE Daniel G. Peterson1, Jeffrey P. Tomkins2, David A. Frisch3, Rod A. Wing2, and Andrew H. Paterson1, 4 1 Center for Applied Genetic Technologies (CAGT), University of Georgia, Athens, GA 30602 2 Clemson University Genomics Institute (CUGI), Clemson University, Clemson, SC 29634 3 Biotechnology Center, University of Wisconsin, Madison, WI 53706 4 Department of Crop and Soil Sciences, and Department of Genetics, University of Georgia, Athens, GA 30602 Corresponding author: Daniel G. Peterson; Plant Genome Mapping Laboratory; University of Georgia; Room 162, Riverbend Research Center; 110 Riverbend Road; Athens, GA 30602, USA Phone: (706) 583-0167, Fax: (706) 583-0160, e-mail: [email protected] 2 PRINCIPAL REVISIONS MADE SINCE ORIGINAL PUBLICATION IN THE JOURNAL OF AGRICULTURAL GENOMICS (JAG), VOLUME 5, 2000: 1) CHAPTER 7 (a) Recent experiments have shown that the Percoll gradient step is not necessary to get nuclear preparations of sufficient quality. Thus this step has been deleted. (b) EGTA and L-lysine have been made standard components of MEB and MPDB solutions. These compounds greatly reduce DNA damage caused by endogenous nucleases. 2) CHAPTERS 7, 9, and 10 - PVP is no longer added to the lysis buffer or wash buffers (WB-A, WB- B, and WB-C). PVP often precipitates out of solution to form a brown gel in which the agarose/nuclei plugs may get stuck. Lysis buffer is now made 6 mM EGTA and 200 mM L-lysine. 3) CHAPTER 13 - We no longer recommend the use of GELase to isolate BAC insert DNA from plugs.
    [Show full text]
  • Construction and Characterization of a Half Million Clone BAC Library of Durum Wheat (Triticum Turgidum Ssp
    Theor Appl Genet (2003) 107:931–939 DOI 10.1007/s00122-003-1331-z A. Cenci · N. Chantret · X. Kong · Y. Gu · O. D. Anderson · T. Fahima · A. Distelfeld · J. Dubcovsky Construction and characterization of a half million clone BAC library of durum wheat (Triticum turgidum ssp. durum) Received: 10 January 2002 / Accepted: 14 March 2003 / Published online: 27 June 2003 Springer-Verlag 2003 Abstract Durum wheat (Triticum turgidum ssp. durum, randomly selected BAC clones was 131 kb, resulting in a 2n =4x = 28, genomes AB) is an economically important coverage of 5.1-fold genome equivalents for each of the cereal used as the raw material to make pasta and two genomes, and a 99.4% probability of recovering any semolina. In this paper we present the construction and gene from each of the two genomes of durum wheat. Six characterization of a bacterial artificial chromosome known copy-number probes were used to validate this (BAC) library of tetraploid durum wheat cv. Langdon. theoretical coverage and gave an estimated coverage of This variety was selected because of the availability of 5.8-fold genome equivalents. Screening of the library substitution lines that facilitate the assignment of BACs to with 11 probes related to grain storage proteins and starch the A and B genome. The selected Langdon line has a 30- biosynthesis showed that the library contains several cM segment of chromosome 6BS from T. turgidum ssp. clones for each of these genes, confirming the value of the dicoccoides carrying a gene for high grain protein library in characterizing the organization of these impor- content, the target of a positional cloning effort in our tant gene families.
    [Show full text]
  • Solutions for Recombinant DNA Unit Exam
    Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G. Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ GGATCC 3’ 3’ CCTAGG 5’ Cleavage by BamHI results in a 5’ overhang as seen here: 5’ G 3’ CCTAG b) BclI cleaves after the first T. Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ TGATCA 3’ 3’ ACTAGT 5’ 5’ T Cleavage by BclI results in a 5’ overhang as seen here: 3’ ACTAG c) You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAG 3’ 5’ GATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAG 5’ 3’ GCATTACACAGGACTAGTGCGAGGTGC 5’ ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAGGATCCGTAATGTGTCCT 3’ 5’ GATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAG 5’ 3’ TGCGAGGTGC 5’ d) You can ligate the smaller restriction fragment produced in (c, i) to the smaller restriction fragment produced in (c, ii). Write out the sequence of the resulting recombinant fragment. 5’ ATTGAGGATCACGCTCCACG 3’ 3’ TAACTCCTAGTGCGAGGTGC 5’ e) Could you cut the fragment from (d) with either BamHI or BclI? Explain.
    [Show full text]
  • DNA Libraries (PART-I)
    NPTEL – Biotechnology – Fundamentals of Biotechnology Lecture 10: DNA Libraries (PART-I) Introduction-Gene sequence are arranged in genome in a randon fashion and selecting or isolating a gene is a big task especially when the genomic sequences are not known. A small portion of genome is transcribed to give mRNA where as a major portion remained untranscribed. Hence, there are two ways to represent a genomic sequence information into the multiple small fragments in the form of a library: (1) Genomic library (2) cDNA library. Preparation of Genomic Library-A genomic library represents complete genome in multiple clones containing small DNA fragments. Depending upon organism and size of genome, this library is either prepared in a bacterial vector (discussed later in future lectures) or in yeast artificial chromosome (YAC). An outline of the construction of genomic library is given in Figure 10.1. it has following steps: 1. Isolation of genomic DNA 2. Generation of suitable size DNA fragments 3. Cloning in suitable vector system (depending on size) 4. Transformation in suitable host . Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology Figure 10.1: Contruction of Genomic library. Joint initiative of IITs and IISc – Funded by MHRD Page 2 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology 1. Isolation of genomic DNA- Isolation of genomic DNA has following steps: 1. Lysis of cells with detergent containing lysis buffer. 2. Incubation of cells with digestion buffer containing protease-K, SDS to release genomic DNA from DNA-protein complex. 3. Isolation of genomic DNA by absolute alchol precipitation.
    [Show full text]
  • Practice Problems for Recombinant DNA, Session 4: Cdna Libraries and Expression Libraries
    Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? c) How do you distinguish bacterial cells that carry a vector from those that do not? d) How do you distinguish bacterial cells that carry a recombinant vector from those that carry the original cloning vector? e) You could screen your library by hybridization with a probe. • What information would you need to do this screen? • What would you use as a probe? You would use a segment of SS DNA or denatured DS DNA complementary to the harE gene. • Would the entire harE gene need to be present in a recombinant vector for your screen to work? Explain.
    [Show full text]
  • Construction of Genomic Library Mcba P7 T
    CONSTRUCTION OF GENOMIC LIBRARY Sources: 1. Biotechnology By B.D. Singh, 2. Gene cloning and DNA analysis By TA Brown, 3. Advance and Applied Biotechnology By Marian Patrie, 4. Molecular Biotechnology By Glick et al and 5. Principle of Gene Manipulation By sandy b Primrose et al. Dr. Diptendu Sarkar [email protected] Introduction • A genomic library is an organism specific collection of DNA, covering the entire genome of an organism. • A genomic library is a set of recombinant clones that contains all of the DNA present in an individual organism. • Genomic libraries can be retained for many years,and propagated so that copies can be sent from one research group to another. • It contains all DNA sequences such as : 1. expressed genes, 2. non-expressed genes, 3. exons and introns, 4. promoter and terminator regions and 5. intervening DNA sequences. 12/10/2019 DS/RKMV/MB 2 Construction of genomic library • Construction of a genomic DNA library involves o isolation, o purification and fragmentation of genomic DNA o followed by cloning of the fragmented DNA using suitable vectors. • The eukaryotic cell nuclei are purified by digestion with protease and organic (phenol- chloroform) extraction. • The derived genomic DNA is too large to incorporate into a vector, and needs to be broken up into desirable fragment sizes. • Fragmentation of DNA can be achieved by physical method and enzymatic method. Preparation of a gene library in a cosmid • The library created contains representative vector. copies of all DNA fragments present within the genome. 12/10/2019 DS/RKMV/MB 3 Mechanisms for cleaving DNA (a) Physical method It involves mechanical shearing of genomic DNA using a narrow-gauge syringe needle or sonication to break up the DNA into suitable size fragments that can be cloned.
    [Show full text]