DOCSLIB.ORG

Rapid Screening of a Human Genomic Library in Yeast Artificial

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rapid Screening of a Human Genomic Library in Yeast Artificial Proc. Natl. Acad. Sci. USA Vol. 86, pp. 5898-5902, August 1989 Genetics Rapid screening of a human genomic library in yeast artificial chromosomes for single-copy sequences (colony hybridization/X-chromosome linked disorders/doning/shuttle vector) CHRISTOPHER N. TRAVER*, SUE KLAPHOLZ, RICHARD W. HYMANt, AND RONALD W. DAVIS Department of Biochemistry, Stanford University School of Medicine, Stanford, CA 94305 Contributed by Ronald W. Davis, May 8, 1989 ABSTRACT A yeast artificial chromosome (YAC) library the vector includes a drug-resistance marker selectable in in Saccharomyces cerevisiae consisting of30,000 clones with an mammalian cells. This permits shuttling of YAC DNA from average insert size of 0.1 megabase pair of human DNA has yeast to mammalian cells, a key step for studies of genetic been generated from primary fibroblast DNA. A YAC vector complementation and gene expression with cloned genomic was modified to enable the recovery of both ends of a human DNA. DNA insert in plasmids in Escherichia coi and to confer G418 resistance to mammalian cells. A rapid method for yeast colony MATERIALS AND METHODS hybridization was used that exploits the ability of yeast sphero- plasts to regenerate in a thin layer of calcium aginate. This Strains, DNA, and Cell Lines. Saccharomyces cerevisiae method permits direct replica plating and processing of colo- strain AB1380 (MATa, ura3, trpl, ade2-1, can1-100, lys2-1, nies from the primary transformation plate to nitrocellulose hisS) and the vector pYAC4 were kindly provided by David filters. Yeast colony hybridization conditions have been estab- Burke (1). The following cloned probes from the Xq28 region lished to identify, within a YAC library of human genomic were used for hybridization: St14-1 (DXS52) (5), DX13 DNA, artificial chromosomes with homology to human DNA (DXS15) (6), MN12 (DXS33) (7), hs7 (8), and p625.8, located probes of unique single-copy sequence. An artificial chromo- 30 kilobase pairs (kbp) from the 3' end of the human factor some with a 0.1-megabase-pair insert from the human Xq28 VIII gene (J. Gitschier, personal communication; ref. 9). The region has been identified by hybridization to a DNA probe that MN12 probe is a 2.8-kbp EcoRI/Msp I restriction fragment detects a unique sequence near the 3' end of the factor VIII and the p625.8 probe is a 3.15-kbp EcoRI restriction frag- gene. ment; both are free of highly repetitive DNA sequences. The cloned probe pNN415 is a repetitive-DNA-free 3.5-kbp Sal I The ability to clone and manipulate large pieces of DNA is restriction fragment derived from the ampicillin-resistant essential for many aspects of mammalian molecular genetics. (AmpR) end of the hX1 YAC (see Results). Mouse 3T3 and Key applications of this technology include (i) physical primary human fibroblast MRC-5 cells were obtained from the American Type Culture Collection and were grown isolation ofgenes involved in genetic disease from genetically according to their recommendations. linked restriction fragment length polymorphisms, (ii) anal- Media and Storage of Yeast Transformants. All media were ysis of the large transcription units of some mammalian prepared as described (10). For long-term storage of the genes, and (iii) physical mapping of ordered fragments from library, a synthetic complete medium lacking uracil and large genomes. The introduction of the yeast artificial chro- tryptophan (SCUT) replica plate of each primary transfor- mosome (YAC) as a cloning vehicle for large pieces of DNA mation plate was further replica-plated after 1-2 days at 30'C has opened these areas for investigation (1). YACs have been to a nitrocellulose disc (Schleicher & Schuell, BA85) on a used to physically map the relatively small genome of Cae- yeast extract/peptone/dextrose (YPD) plate, which was then norhabditis elegans (2) and to clone centromeric sequences incubated for 12 hr at 30°C. Discs were then placed colony- from Schizosaccharomyces pombe (3). In addition, YACs side up on Whatman 3MM paper saturated with YPD/ 30o with human DNA inserts have been screened for moderately (vol/vol) glycerol. A fresh nitrocellulose disc, saturated as repetitive DNA elements (4). Several obstacles need to be described above, was overlaid onto the first disc, forming a overcome to apply YAC technology to the comprehensive sandwich. The two discs were placed between dry Whatman analysis ofmammalian genomes. In particular, large numbers 3MM paper and pressure was applied briefly with a steel of colonies must be screened to identify any unique single- replica block. Discs were wrapped in foil, placed in plastic copy sequence (1). YACs are usually present at one copy per storage bags, and stored at -70°C until use. Colonies were yeast cell. To find a single-copy human sequence in a YAC recovered by separating the two nitrocellulose discs, placing library with an average insert size of0.1 megabase pair (Mbp) each colony-side up on a YPD plate, and incubating at 30°C requires detection, on average, of 1 colony of 30,000. This 1-2 days, at which point one disc was refrozen as described paper presents a rapid method for screening a human ge- further nomic YAC library for single-copy human sequences, elim- above, and the other was used for experiments. inating the need to pick each colony from within top agar to arrays. Two YACs containing human DNA inserts with RESULTS homology to probes from the Xq28 region have been identi- Modifications to the YAC Vector. A YAC can be con- fied by this technique. A modified YAC cloning vector has structed from a large DNA restriction fragment by ligating been constructed. This vector was designed to facilitate the the the elements to walking within a library by allowing recovery ofboth ends of onto ends of fragment necessary a given insert within plasmids in Escherichia coli. In addition, Abbreviations: YAC, yeast artificial chromosome; FIGE, field- inversion gel electrophoresis. The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tPresent address: Cancer and Developmental Biology, Syntex Re- in accordance with 18 U.S.C. §1734 solely to indicate this fact. search, 3401 Hillview Avenue, Palo Alto, CA 94304. 5898 Downloaded by guest on September 29, 2021 Genetics: Traver et al. Proc. Natl. Acad. Sci. USA 86 (1989) 5899 stabilize a linear yeast chromosome: a centromere, telo- insert of the artificial chromosome, DNA probes from each meres, an origin of replication, and a means of selection (11). vector arm ofthe YAC hybridized to the same-sized 400- and The YAC vector, pYAC4 (1), as originally described, is 450-kbp, respectively, Xho I restriction fragments (data not sufficient for cloning large DNA fragments in S. cerevisiae. shown). Hence, DNA has been shuttled from a single-copy For genetic complementation studies with human genomic YAC in yeast to mammalian cells by spheroplast fusion and DNA, a vector that enables shuttling of these large DNA G418 selection. An unintegrated artificial chromosome in fragments from yeast to mammalian cells is necessary. In mammalian cells was not detected, but the particular artificial addition, a vector that provides a means to isolate each end chromosome used in these experiments may have been ofan insert for bidirectional walking from a given clone would defective for mammalian replication, segregation, or telo- be useful. Both of these goals were accomplished by modi- meric function. The presence of a mammalian drug- fying the pYAC4 vector with the addition of the neomycin- resistance marker on a YAC will allow for testing of various resistance (Neo) gene and the ColEl origin of replication cloned sequences for these functions. from pSV2neo (12) (Fig. 1). The Neo gene can confer Library Construction. DNA for the human genomic library kanamycin resistance to E. coli and G418 resistance to was derived from 46,XY primary human fibroblast MRC-5 mammalian cells. To determine whether transfection of a cells passaged 25 generations before harvest. MRC-5 cells YAC generated from pYACneo into mammalian cells would were chosen because (i) these cells are available to other result in G418 resistance, the following experiment was researchers and (it) they are not known to undergo somatic performed. A 75-kbp YAC containing inserted mouse DNA rearrangements. DNA was prepared as described (1) with the was transferred from yeast into mouse 3T3 cells by sphero- following modifications: after partial EcoRI digestion, DNA plast fusion and subsequent G418 selection (13). From 106 was fractionated by velocity sedimentation to eliminate frag- mouse cells fused, three independent G418-resistant colonies ments <50 kbp. Gradient fractions were collected, assayed were recovered; no resistant colonies were recovered from by field-inversion gel electrophoresis (FIGE) (15), dialyzed, control fusions between 3T3 cells and the yeast host strain and concentrated. This DNA then was ligated to pYACneo AB1380. DNA was prepared in agarose blocks from the three vector DNA prepared as described (1) (Fig. 1). Large DNA resistant clones and analyzed by contour-clamped homoge- ligation products were fractionated from unligated vector neous electric field pulse-field gel electrophoresis (14). By arms by velocity sedimentation and were purified as de- Southern blot hybridization, all three clones appeared to have scribed above. DNA was transformed into S. cerevisiae incorporated the Neo gene into high molecular weight DNA strain AB1380 as described (1), with the following modifica- >2 Mb. High molecular weight DNA from two of the clones tion. Yeast spheroplasts regenerate in a thin layer of calcium also hybridized to a pBR322-derived probe specific for the alginate with colonies appearing on the surface of the plate opposite end of the YAC. After digestion ofDNA from these (16), thus eliminating the need to pick each colony from two clones with Xho I, which does not cut within the 60-kbp within top agar.
Load more

Recommended publications
  • New York Science Journal 2016;9(10) 19 Gene Library Ma Hongbao Brookdale University Hospital A
    New York Science Journal 2016;9(10) http://www.sciencepub.net/newyork Gene Library Ma Hongbao Brookdale University Hospital and Medical Center, Brooklyn, New York 11212, USA [email protected] Abstract: A gene library is a collection of gene clones that represents the genetic material of an organism. There are different types of gene libraries, including cDNA libraries, genomic libraries and randomized mutant libraries. The applications of these libraries depend on the source of the original DNA fragments. Generally in a gene library each DNA fragment is uniquely inserted into a cloning vector and the pool of recombinant DNA molecules is then transferred into a population of bacteria or yeast such that each organism contains on average one construct. As the population of organisms is grown in culture, the DNA molecules contained within them are copied and propagated. [Ma Hongbao. Gene Library. N Y Sci J 2016;9(10):19-23]. ISSN 1554-0200 (print); ISSN 2375-723X (online). http://www.sciencepub.net/newyork. 4. doi:10.7537/marsnys091016.04. Keywords: gene; library; clone; organism; DNA; molecule; copy A gene library is a collection of gene clones that cDNA libraries are useful in reverse genetics, but they represents the genetic material of an organism. In only represent a very small (less than 1%) portion of molecular biology, a library is a collection of DNA the overall genome in a given organism. The fragments stored and propagated in a population of applications of cDNA libraries include: (1) Discovery micro-organisms through the process of molecular of novel genes; (2) Cloning of full-length cDNA cloning.
    [Show full text]
  • Library Construction and Screening
    Library construction and screening • A gene library is a collection of different DNA sequences from an organism, • which has beenAlso called genomic libraries or gene banks. • cloned into a vector for ease of purification, storage and analysis. Uses of gene libraries • To obtain the sequences of genes for analysis, amplification, cloning, and expression. • Once the sequence is known probes, primers, etc. can be synthesized for further diagnostic work using, for example, hybridization reactions, blots and PCR. • Knowledge of a gene sequence also offers the possibility of gene therapy. • Also, gene expression can be used to synthesize a product in particular host cells, e.g. synthesis of human gene products in prokaryotic cells. two types of gene library depending upon the source of the DNA used. 1.genomic library. 2.cDNA library Types of GENE library: • genomic library contains DNA fragments representing the entire genome of an organism. • cDNA library contains only complementary DNA molecules synthesized from mRNA molecules in a cell. Genomic Library : • Made from nuclear DNA of an organism or species. • DNA is cut into clonable size pieces as randomly possible using restriction endonuclease • Genomic libraries contain whole genomic fragments including gene exons and introns, gene promoters, intragenic DNA,origins of replication, etc Construction of Genomic Libraries 1. Isolation of genomic DNA and vector. 2.Cleavage of Genomic DNA and vector by Restriction Endonucleases. 3.Ligation of fragmented DNA with the vector. 4.Transformation of
    [Show full text]
  • Construction of Small-Insert Genomic DNA Libraries Highly Enriched
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 3419-3423, April 1992 Genetics Construction of small-insert genomic DNA libraries highly enriched for microsatellite repeat sequences (marker-selected libraries/CA repeats/sequence-tagged sites/genetic mapping/dog genome) ELAINE A. OSTRANDER*tt, PAM M. JONG*t, JASPER RINE*t, AND GEOFFREY DUYKt§ *Department of Molecular and Cellular Biology, 401 Barker Hall, University of California, Berkeley, CA 94720; tHuman Genome Center, Lawrence Berkeley Laboratory, 1 Cyclotron Road, 74-157, Berkeley, CA 94720; and §Department of Genetics, Howard Hughes Medical Institute, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 Communicated by Philip Leder, January 8, 1992 ABSTRACT We describe an efficient method for the con- Generation of a high-density map of markers for an entire struction of small-insert genomic libraries enriched for highly genome or a single chromosome requires the isolation and polymorphic, simple sequence repeats. With this approach, characterization of hundreds of markers such as microsatel- libraries in which 40-50% of the members contain (CA). lite repeats (10, 11). Two simple yet tedious approaches have repeats are produced, representing an =50-fold enrichment generally been used for this task. One approach is to screen over conventional small-insert genomic DNA libraries. Briefly, a large-insert genomic library with an end-labeled (CA),, or a genomic library with an average insert size of less than 500 (TG),, oligonucleotide (n > 15). Clones that hybridize to the base pairs was constructed in a phagemid vector. Ampliflcation probe are purified and divided into subclones, which are of this library in a dut ung strain ofEscherchia coli allowed the screened by hybridization for a fragment containing the recovery of the library as closed circular single-stranded DNA repeat.
    [Show full text]
  • Cdna Libraries and Expression Libraries
    Solutions for Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. Your vector would certainly need to have a unique restriction enzyme site, a selectable marker such as the ampicillin resistance gene, and a bacterial origin of replication. Other features may be required depending upon how you plan to use this library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? Prior to transformation, the E. coli cells that you will transform will be sensitive to antibiotic. This allows you to select for cells that obtained a plasmid. c) How do you distinguish bacterial cells that carry a vector from those that do not? Cells that obtained a vector will have obtained the selectable marker (one example is the ampicillin resistance gene).
    [Show full text]
  • Genomic Organization of Borna Disease Virus
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 4362-4366, May 1994 Neurobiology Genomic organization of Borna disease virus (central nervous system Infection/behavioral disorders/negative-strand RNA viruses) THOMAS BRIESE*t, ANETTE SCHNEEMANN*, ANN J. LEWIS*, YOO-SUN PARK*, SARA KIM*, HANNS LUDWIGt, AND W. IAN LIPKIN**§¶ Departments of *Neurology, *Anatomy and Neurobiology, and Microbiology and Molecular Genetics, University of California, Irvine, CA 92717; and tInstitute of Virology, Freie Universitit Berlin, Nordufer 20, D 13353 Berlin, Germany Communicated by Hilary Koprowski, January 27, 1994 ABSTRACT Borna disease virus is a neurotropic negative- RNA. The 5'-terminal sequence from each library was used strand RNA virus that infects a wide range ofvertebrate hosts, to design an oligonucleotide primer for construction of the causing disturbances in movement and behavior. We have next library. cloned and sequenced the 8910-nucleotide viral genome by DNA Sequencing and Sequence Analysis. Plasmid DNA was using RNA from Borna disease virus particles. The viral sequenced on both strands by the dideoxynucleotide chain- genome has complementary 3' and 5' termini and contains termination method (13) using a modified bacteriophage T7 antisense information for five open reading frames. Homology DNA polymerase (Sequenase version 2.0; United States to Filoviridae, Paramyxoviridae, and Rhabdoviridae is found Biochemical). Five to 10 independent clones from each in both cistronic and extracistronic regions. Northern analysis library were sequenced with overlap so that each region of indicates that the virus transcribes mono- and polycistronic the genomic RNA was covered by at least 2 clones. Four RNAs and uses terminatlon/polyadenylylation signals remi- libraries were analyzed, yielding =8.9 kb of continuous niscent ofthose observed in other negative-strand RNA viruses.
    [Show full text]
  • Recombinant DNA Resources for the Comparative Genomics of Ancylostoma Ceylanicum
    bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum. Authors: Wadim J. Kapulkin1,5,6#, Adriana Magalska1, Ewa Janecka1, Arkadiusz Ciesielski2,4, Malgorzata Lobocka2, Jerzy M. Behnke3, Halina Wedrychowicz1 # corresponding author 1. Faculty of Veterinary Medicine, Grochowska 272, 03-849 Warsaw, Poland 2. Institute for Biochemistry and Biophysics –PAS, Pawinskiego 5a, 02-106 Warsaw, Poland 3. School of Life Science, University of Nottingham, University Park, NG7 2RD Nottingham, U.K. 4. Department of Chemistry, University of Warsaw, Pasteura 1, 02-093 Warsaw, Poland Present affiliation: 5. Veterinary Consultancy, Conrada 16/65, 01-922 Warsaw, Poland 6. Mobile Veterinary Consultancy, Nottingham, U.K. Phone: (+44)7466449215 e-mail: [email protected] Keywords: Ancylostoma ceylanicum, Recombinant DNA library, SL1 spliced leader, cDNA, Bacterial Artificial Chromosome library, NUMTs 1 bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under
    [Show full text]
  • Construction of Plant Bacterial Artificial Chromosome (Bac) Libraries: an Illustrated Guide
    1 22nd EEDDIITTIIOONN ((22000022)) CONSTRUCTION OF PLANT BACTERIAL ARTIFICIAL CHROMOSOME (BAC) LIBRARIES: AN ILLUSTRATED GUIDE Daniel G. Peterson1, Jeffrey P. Tomkins2, David A. Frisch3, Rod A. Wing2, and Andrew H. Paterson1, 4 1 Center for Applied Genetic Technologies (CAGT), University of Georgia, Athens, GA 30602 2 Clemson University Genomics Institute (CUGI), Clemson University, Clemson, SC 29634 3 Biotechnology Center, University of Wisconsin, Madison, WI 53706 4 Department of Crop and Soil Sciences, and Department of Genetics, University of Georgia, Athens, GA 30602 Corresponding author: Daniel G. Peterson; Plant Genome Mapping Laboratory; University of Georgia; Room 162, Riverbend Research Center; 110 Riverbend Road; Athens, GA 30602, USA Phone: (706) 583-0167, Fax: (706) 583-0160, e-mail: [email protected] 2 PRINCIPAL REVISIONS MADE SINCE ORIGINAL PUBLICATION IN THE JOURNAL OF AGRICULTURAL GENOMICS (JAG), VOLUME 5, 2000: 1) CHAPTER 7 (a) Recent experiments have shown that the Percoll gradient step is not necessary to get nuclear preparations of sufficient quality. Thus this step has been deleted. (b) EGTA and L-lysine have been made standard components of MEB and MPDB solutions. These compounds greatly reduce DNA damage caused by endogenous nucleases. 2) CHAPTERS 7, 9, and 10 - PVP is no longer added to the lysis buffer or wash buffers (WB-A, WB- B, and WB-C). PVP often precipitates out of solution to form a brown gel in which the agarose/nuclei plugs may get stuck. Lysis buffer is now made 6 mM EGTA and 200 mM L-lysine. 3) CHAPTER 13 - We no longer recommend the use of GELase to isolate BAC insert DNA from plugs.
    [Show full text]
  • Construction and Characterization of a Half Million Clone BAC Library of Durum Wheat (Triticum Turgidum Ssp
    Theor Appl Genet (2003) 107:931–939 DOI 10.1007/s00122-003-1331-z A. Cenci · N. Chantret · X. Kong · Y. Gu · O. D. Anderson · T. Fahima · A. Distelfeld · J. Dubcovsky Construction and characterization of a half million clone BAC library of durum wheat (Triticum turgidum ssp. durum) Received: 10 January 2002 / Accepted: 14 March 2003 / Published online: 27 June 2003 Springer-Verlag 2003 Abstract Durum wheat (Triticum turgidum ssp. durum, randomly selected BAC clones was 131 kb, resulting in a 2n =4x = 28, genomes AB) is an economically important coverage of 5.1-fold genome equivalents for each of the cereal used as the raw material to make pasta and two genomes, and a 99.4% probability of recovering any semolina. In this paper we present the construction and gene from each of the two genomes of durum wheat. Six characterization of a bacterial artificial chromosome known copy-number probes were used to validate this (BAC) library of tetraploid durum wheat cv. Langdon. theoretical coverage and gave an estimated coverage of This variety was selected because of the availability of 5.8-fold genome equivalents. Screening of the library substitution lines that facilitate the assignment of BACs to with 11 probes related to grain storage proteins and starch the A and B genome. The selected Langdon line has a 30- biosynthesis showed that the library contains several cM segment of chromosome 6BS from T. turgidum ssp. clones for each of these genes, confirming the value of the dicoccoides carrying a gene for high grain protein library in characterizing the organization of these impor- content, the target of a positional cloning effort in our tant gene families.
    [Show full text]
  • Solutions for Recombinant DNA Unit Exam
    Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G. Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ GGATCC 3’ 3’ CCTAGG 5’ Cleavage by BamHI results in a 5’ overhang as seen here: 5’ G 3’ CCTAG b) BclI cleaves after the first T. Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ TGATCA 3’ 3’ ACTAGT 5’ 5’ T Cleavage by BclI results in a 5’ overhang as seen here: 3’ ACTAG c) You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAG 3’ 5’ GATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAG 5’ 3’ GCATTACACAGGACTAGTGCGAGGTGC 5’ ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAGGATCCGTAATGTGTCCT 3’ 5’ GATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAG 5’ 3’ TGCGAGGTGC 5’ d) You can ligate the smaller restriction fragment produced in (c, i) to the smaller restriction fragment produced in (c, ii). Write out the sequence of the resulting recombinant fragment. 5’ ATTGAGGATCACGCTCCACG 3’ 3’ TAACTCCTAGTGCGAGGTGC 5’ e) Could you cut the fragment from (d) with either BamHI or BclI? Explain.
    [Show full text]
  • DNA Libraries (PART-I)
    NPTEL – Biotechnology – Fundamentals of Biotechnology Lecture 10: DNA Libraries (PART-I) Introduction-Gene sequence are arranged in genome in a randon fashion and selecting or isolating a gene is a big task especially when the genomic sequences are not known. A small portion of genome is transcribed to give mRNA where as a major portion remained untranscribed. Hence, there are two ways to represent a genomic sequence information into the multiple small fragments in the form of a library: (1) Genomic library (2) cDNA library. Preparation of Genomic Library-A genomic library represents complete genome in multiple clones containing small DNA fragments. Depending upon organism and size of genome, this library is either prepared in a bacterial vector (discussed later in future lectures) or in yeast artificial chromosome (YAC). An outline of the construction of genomic library is given in Figure 10.1. it has following steps: 1. Isolation of genomic DNA 2. Generation of suitable size DNA fragments 3. Cloning in suitable vector system (depending on size) 4. Transformation in suitable host . Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology Figure 10.1: Contruction of Genomic library. Joint initiative of IITs and IISc – Funded by MHRD Page 2 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology 1. Isolation of genomic DNA- Isolation of genomic DNA has following steps: 1. Lysis of cells with detergent containing lysis buffer. 2. Incubation of cells with digestion buffer containing protease-K, SDS to release genomic DNA from DNA-protein complex. 3. Isolation of genomic DNA by absolute alchol precipitation.
    [Show full text]
  • Practice Problems for Recombinant DNA, Session 4: Cdna Libraries and Expression Libraries
    Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? c) How do you distinguish bacterial cells that carry a vector from those that do not? d) How do you distinguish bacterial cells that carry a recombinant vector from those that carry the original cloning vector? e) You could screen your library by hybridization with a probe. • What information would you need to do this screen? • What would you use as a probe? You would use a segment of SS DNA or denatured DS DNA complementary to the harE gene. • Would the entire harE gene need to be present in a recombinant vector for your screen to work? Explain.
    [Show full text]
  • Construction of Genomic Library Mcba P7 T
    CONSTRUCTION OF GENOMIC LIBRARY Sources: 1. Biotechnology By B.D. Singh, 2. Gene cloning and DNA analysis By TA Brown, 3. Advance and Applied Biotechnology By Marian Patrie, 4. Molecular Biotechnology By Glick et al and 5. Principle of Gene Manipulation By sandy b Primrose et al. Dr. Diptendu Sarkar [email protected] Introduction • A genomic library is an organism specific collection of DNA, covering the entire genome of an organism. • A genomic library is a set of recombinant clones that contains all of the DNA present in an individual organism. • Genomic libraries can be retained for many years,and propagated so that copies can be sent from one research group to another. • It contains all DNA sequences such as : 1. expressed genes, 2. non-expressed genes, 3. exons and introns, 4. promoter and terminator regions and 5. intervening DNA sequences. 12/10/2019 DS/RKMV/MB 2 Construction of genomic library • Construction of a genomic DNA library involves o isolation, o purification and fragmentation of genomic DNA o followed by cloning of the fragmented DNA using suitable vectors. • The eukaryotic cell nuclei are purified by digestion with protease and organic (phenol- chloroform) extraction. • The derived genomic DNA is too large to incorporate into a vector, and needs to be broken up into desirable fragment sizes. • Fragmentation of DNA can be achieved by physical method and enzymatic method. Preparation of a gene library in a cosmid • The library created contains representative vector. copies of all DNA fragments present within the genome. 12/10/2019 DS/RKMV/MB 3 Mechanisms for cleaving DNA (a) Physical method It involves mechanical shearing of genomic DNA using a narrow-gauge syringe needle or sonication to break up the DNA into suitable size fragments that can be cloned.
    [Show full text]